>Feature sequence001 <1 565 gene locus_tag LOCUS_00010 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392543.1:ATP-dependent protease subunit HslV 575 1984 gene locus_tag LOCUS_00020 gene hslU 575 1984 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_00020 2171 3235 gene locus_tag LOCUS_00030 gene argF 2171 3235 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_00030 3890 7069 gene locus_tag LOCUS_00040 3890 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7079 7573 gene locus_tag LOCUS_00050 7079 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7813 8262 gene locus_tag LOCUS_00060 7813 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8488 8958 gene locus_tag LOCUS_00070 8488 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9630 10760 gene locus_tag LOCUS_00080 9630 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10810 11019 gene locus_tag LOCUS_00090 10810 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11019 12215 gene locus_tag LOCUS_00100 11019 12215 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_00100 12236 13294 gene locus_tag LOCUS_00110 12236 13294 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_00110 13642 13379 gene locus_tag LOCUS_00120 gene rpsT 13642 13379 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_00120 13747 15354 gene locus_tag LOCUS_00130 gene murJ 13747 15354 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_00130 15351 16076 gene locus_tag LOCUS_00140 15351 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16089 17423 gene locus_tag LOCUS_00150 16089 17423 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_00150 17715 19796 gene locus_tag LOCUS_00160 17715 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19862 21034 gene locus_tag LOCUS_00170 19862 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21039 21431 gene locus_tag LOCUS_00180 21039 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21443 21610 gene locus_tag LOCUS_00190 21443 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21631 22521 gene locus_tag LOCUS_00200 21631 22521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22549 23508 gene locus_tag LOCUS_00210 22549 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23501 23839 gene locus_tag LOCUS_00220 23501 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23887 24843 gene locus_tag LOCUS_00230 23887 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24854 25333 gene locus_tag LOCUS_00240 24854 25333 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_00240 25404 27095 gene locus_tag LOCUS_00250 gene pilB 25404 27095 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_00250 27199 28299 gene locus_tag LOCUS_00260 27199 28299 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_00260 28301 29500 gene locus_tag LOCUS_00270 28301 29500 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00270 29585 31357 gene locus_tag LOCUS_00280 29585 31357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_00280 31541 32518 gene locus_tag LOCUS_00290 31541 32518 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_00290 32661 34814 gene locus_tag LOCUS_00300 32661 34814 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_00300 34942 36240 gene locus_tag LOCUS_00310 gene eno 34942 36240 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_00310 36320 36655 gene locus_tag LOCUS_00320 36320 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36662 37477 gene locus_tag LOCUS_00330 36662 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 37477 38823 gene locus_tag LOCUS_00340 37477 38823 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_00340 38911 40470 gene locus_tag LOCUS_00350 38911 40470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40492 42099 gene locus_tag LOCUS_00360 40492 42099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42145 43242 gene locus_tag LOCUS_00370 42145 43242 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_00370 43271 44020 gene locus_tag LOCUS_00380 43271 44020 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_00380 44693 44043 gene locus_tag LOCUS_00390 44693 44043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45164 44838 gene locus_tag LOCUS_00400 45164 44838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00400 45553 45468 gene locus_tag LOCUS_t00010 45553 45468 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46100 45621 gene locus_tag LOCUS_00410 46100 45621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46922 46140 gene locus_tag LOCUS_00420 gene tpiA 46922 46140 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_00420 48202 47009 gene locus_tag LOCUS_00430 48202 47009 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_00430 49201 48206 gene locus_tag LOCUS_00440 gene gap 49201 48206 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_00440 49946 49224 gene locus_tag LOCUS_00450 49946 49224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50762 49998 gene locus_tag LOCUS_00460 50762 49998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51804 50755 gene locus_tag LOCUS_00470 51804 50755 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_00470 52216 53202 gene locus_tag LOCUS_00480 52216 53202 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_00480 53249 54409 gene locus_tag LOCUS_00490 gene metK 53249 54409 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_00490 54463 55713 gene locus_tag LOCUS_00500 gene ahcY 54463 55713 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_00500 56868 55783 gene locus_tag LOCUS_00510 gene lptG 56868 55783 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919560.1 protein_id gnl|my_center|LOCUS_00510 58283 56865 gene locus_tag LOCUS_00520 58283 56865 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_00520 58500 59459 gene locus_tag LOCUS_00530 58500 59459 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00530 59469 60497 gene locus_tag LOCUS_00540 59469 60497 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_00540 60548 62737 gene locus_tag LOCUS_00550 gene rnr 60548 62737 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_00550 62745 63917 gene locus_tag LOCUS_00560 62745 63917 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_00560 63919 64500 gene locus_tag LOCUS_00570 63919 64500 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_00570 65190 64546 gene locus_tag LOCUS_00580 65190 64546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65353 65279 gene locus_tag LOCUS_t00020 65353 65279 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67052 65427 gene locus_tag LOCUS_00590 67052 65427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67887 67123 gene locus_tag LOCUS_00600 67887 67123 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_00600 68555 67884 gene locus_tag LOCUS_00610 68555 67884 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944016.1 protein_id gnl|my_center|LOCUS_00610 70771 68666 gene locus_tag LOCUS_00620 70771 68666 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_00620 71534 71031 gene locus_tag LOCUS_00630 71534 71031 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_00630 74544 71806 gene locus_tag LOCUS_00640 74544 71806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 75628 74852 gene locus_tag LOCUS_00650 75628 74852 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_00650 76702 75749 gene locus_tag LOCUS_00660 76702 75749 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_00660 77180 76689 gene locus_tag LOCUS_00670 77180 76689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 77274 77636 gene locus_tag LOCUS_00680 77274 77636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78499 77597 gene locus_tag LOCUS_00690 78499 77597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79452 78751 gene locus_tag LOCUS_00700 79452 78751 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_00700 80796 79597 gene locus_tag LOCUS_00710 80796 79597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81473 80883 gene locus_tag LOCUS_00720 gene rpoE 81473 80883 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_00720 82521 81496 gene locus_tag LOCUS_00730 82521 81496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83064 82687 gene locus_tag LOCUS_00740 83064 82687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 84539 83343 gene locus_tag LOCUS_00750 84539 83343 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_00750 85881 85003 gene locus_tag LOCUS_00760 85881 85003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 87578 85881 gene locus_tag LOCUS_00770 87578 85881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 89218 87575 gene locus_tag LOCUS_00780 89218 87575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 90851 89373 gene locus_tag LOCUS_00790 gene zraR 90851 89373 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148492.1 protein_id gnl|my_center|LOCUS_00790 91372 91229 gene locus_tag LOCUS_00800 91372 91229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 91430 91726 gene locus_tag LOCUS_00810 91430 91726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92352 91918 gene locus_tag LOCUS_00820 92352 91918 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_00820 92774 92583 gene locus_tag LOCUS_00830 92774 92583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 92700 93584 gene locus_tag LOCUS_00840 92700 93584 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_00840 93581 94420 gene locus_tag LOCUS_00850 93581 94420 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_00850 94468 95196 gene locus_tag LOCUS_00860 gene rsmI 94468 95196 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131542.1 protein_id gnl|my_center|LOCUS_00860 95254 96192 gene locus_tag LOCUS_00870 95254 96192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 96277 97125 gene locus_tag LOCUS_00880 gene lgt 96277 97125 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_00880 97247 97849 gene locus_tag LOCUS_00890 97247 97849 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257309.1 protein_id gnl|my_center|LOCUS_00890 97846 98769 gene locus_tag LOCUS_00900 97846 98769 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909057.1 protein_id gnl|my_center|LOCUS_00900 98816 99985 gene locus_tag LOCUS_00910 98816 99985 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_00910 100113 100751 gene locus_tag LOCUS_00920 gene tmk 100113 100751 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_00920 100764 102461 gene locus_tag LOCUS_00930 100764 102461 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_00930 102566 105079 gene locus_tag LOCUS_00940 102566 105079 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943866.1 protein_id gnl|my_center|LOCUS_00940 105376 106857 gene locus_tag LOCUS_00950 105376 106857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 106854 108092 gene locus_tag LOCUS_00960 106854 108092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 108114 109172 gene locus_tag LOCUS_00970 108114 109172 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_00970 109169 109939 gene locus_tag LOCUS_00980 109169 109939 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048115.1 protein_id gnl|my_center|LOCUS_00980 109955 111058 gene locus_tag LOCUS_00990 109955 111058 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_00990 111055 112212 gene locus_tag LOCUS_01000 gene wecB 111055 112212 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_01000 112258 113781 gene locus_tag LOCUS_01010 112258 113781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 113812 115035 gene locus_tag LOCUS_01020 113812 115035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 115068 116105 gene locus_tag LOCUS_01030 115068 116105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 116145 118586 gene locus_tag LOCUS_01040 116145 118586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118637 119902 gene locus_tag LOCUS_01050 gene serS 118637 119902 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869753.1 protein_id gnl|my_center|LOCUS_01050 119934 121202 gene locus_tag LOCUS_01060 119934 121202 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_01060 121255 122820 gene locus_tag LOCUS_01070 121255 122820 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_01070 122895 123356 gene locus_tag LOCUS_01080 gene tsaE 122895 123356 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_01080 123367 124068 gene locus_tag LOCUS_01090 123367 124068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 124065 124556 gene locus_tag LOCUS_01100 124065 124556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776312.1 protein_id gnl|my_center|LOCUS_01100 124556 125467 gene locus_tag LOCUS_01110 gene accD 124556 125467 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_01110 125464 126801 gene locus_tag LOCUS_01120 125464 126801 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_01120 126927 127253 gene locus_tag LOCUS_01130 gene trxA 126927 127253 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_01130 127340 127735 gene locus_tag LOCUS_01140 127340 127735 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_01140 127870 128703 gene locus_tag LOCUS_01150 127870 128703 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_01150 128738 129706 gene locus_tag LOCUS_01160 128738 129706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 129823 131787 gene locus_tag LOCUS_01170 gene dsbD 129823 131787 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 protein_id gnl|my_center|LOCUS_01170 131889 134606 gene locus_tag LOCUS_01180 gene polA 131889 134606 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_01180 134654 136396 gene locus_tag LOCUS_01190 134654 136396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136500 137072 gene locus_tag LOCUS_01200 gene coaE 136500 137072 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_01200 137116 138000 gene locus_tag LOCUS_01210 137116 138000 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_01210 138040 138993 gene locus_tag LOCUS_01220 138040 138993 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_01220 139069 140262 gene locus_tag LOCUS_01230 139069 140262 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_01230 140902 143991 gene locus_tag LOCUS_01240 140902 143991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 144053 147031 gene locus_tag LOCUS_01250 144053 147031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 147081 148094 gene locus_tag LOCUS_01260 gene porV 147081 148094 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence002 2651 3532 gene locus_tag LOCUS_01270 2651 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 3650 4636 gene locus_tag LOCUS_01280 3650 4636 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_01280 4699 5577 gene locus_tag LOCUS_01290 4699 5577 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_01290 5913 6137 gene locus_tag LOCUS_01300 5913 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6175 7248 gene locus_tag LOCUS_01310 6175 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 7245 8234 gene locus_tag LOCUS_01320 7245 8234 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_01320 8255 9322 gene locus_tag LOCUS_01330 8255 9322 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_01330 9319 10221 gene locus_tag LOCUS_01340 9319 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10740 12581 gene locus_tag LOCUS_01350 10740 12581 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_01350 12578 13483 gene locus_tag LOCUS_01360 12578 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 13634 14737 gene locus_tag LOCUS_01370 13634 14737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 15063 15377 gene locus_tag LOCUS_01380 15063 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 15440 16372 gene locus_tag LOCUS_01390 gene rsgA 15440 16372 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_01390 16699 16451 gene locus_tag LOCUS_01400 16699 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 16586 16930 gene locus_tag LOCUS_01410 16586 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 16927 17679 gene locus_tag LOCUS_01420 16927 17679 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 protein_id gnl|my_center|LOCUS_01420 17754 18281 gene locus_tag LOCUS_01430 17754 18281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 18292 18753 gene locus_tag LOCUS_01440 18292 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 18753 19493 gene locus_tag LOCUS_01450 18753 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 21277 20123 gene locus_tag LOCUS_01460 21277 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 26049 21469 gene locus_tag LOCUS_01470 26049 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 26774 28435 gene locus_tag LOCUS_01480 26774 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 28494 29201 gene locus_tag LOCUS_01490 28494 29201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 29292 29726 gene locus_tag LOCUS_01500 29292 29726 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_01500 29730 31184 gene locus_tag LOCUS_01510 29730 31184 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942327.1 protein_id gnl|my_center|LOCUS_01510 31358 31552 gene locus_tag LOCUS_01520 31358 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 34335 31495 gene locus_tag LOCUS_01530 34335 31495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 36153 35128 gene locus_tag LOCUS_01540 36153 35128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 36735 38048 gene locus_tag LOCUS_01550 gene purD 36735 38048 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_01550 38099 38563 gene locus_tag LOCUS_01560 gene purE 38099 38563 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_01560 38649 39449 gene locus_tag LOCUS_01570 38649 39449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 39563 40900 gene locus_tag LOCUS_01580 39563 40900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 40936 43500 gene locus_tag LOCUS_01590 40936 43500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 43592 44080 gene locus_tag LOCUS_01600 gene greA 43592 44080 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933113.1 protein_id gnl|my_center|LOCUS_01600 44838 44398 gene locus_tag LOCUS_01610 44838 44398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 45253 45465 gene locus_tag LOCUS_01620 45253 45465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 55841 45408 gene locus_tag LOCUS_01630 55841 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 62938 56540 gene locus_tag LOCUS_01640 62938 56540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 63794 63991 gene locus_tag LOCUS_01650 63794 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 64072 64245 gene locus_tag LOCUS_01660 64072 64245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 65813 64434 gene locus_tag LOCUS_01670 65813 64434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 66233 67936 gene locus_tag LOCUS_01680 66233 67936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 67914 69341 gene locus_tag LOCUS_01690 67914 69341 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_01690 69727 71292 gene locus_tag LOCUS_01700 69727 71292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 72591 71641 gene locus_tag LOCUS_01710 gene arcC 72591 71641 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_01710 74056 72719 gene locus_tag LOCUS_01720 74056 72719 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_01720 75778 74243 gene locus_tag LOCUS_01730 75778 74243 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_01730 76165 77739 gene locus_tag LOCUS_01740 76165 77739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 78643 77843 gene locus_tag LOCUS_01750 78643 77843 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_01750 79434 78640 gene locus_tag LOCUS_01760 79434 78640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 81032 79773 gene locus_tag LOCUS_01770 81032 79773 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016225.1 protein_id gnl|my_center|LOCUS_01770 82216 81053 gene locus_tag LOCUS_01780 gene hadC 82216 81053 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_01780 83481 82459 gene locus_tag LOCUS_01790 83481 82459 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762008.1 protein_id gnl|my_center|LOCUS_01790 84253 83483 gene locus_tag LOCUS_01800 84253 83483 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_01800 85061 84306 gene locus_tag LOCUS_01810 gene fabG 85061 84306 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_01810 86042 85065 gene locus_tag LOCUS_01820 gene menB 86042 85065 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_01820 86719 86105 gene locus_tag LOCUS_01830 86719 86105 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 protein_id gnl|my_center|LOCUS_01830 87325 89643 gene locus_tag LOCUS_01840 87325 89643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_01840 89751 91112 gene locus_tag LOCUS_01850 89751 91112 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_01850 91262 92392 gene locus_tag LOCUS_01860 gene sucC 91262 92392 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_01860 92660 93766 gene locus_tag LOCUS_01870 gene sucD 92660 93766 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_01870 93922 94320 gene locus_tag LOCUS_01880 gene ndk 93922 94320 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 protein_id gnl|my_center|LOCUS_01880 94997 94428 gene locus_tag LOCUS_01890 94997 94428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 95588 95007 gene locus_tag LOCUS_01900 95588 95007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 96168 95578 gene locus_tag LOCUS_01910 96168 95578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 96679 96149 gene locus_tag LOCUS_01920 96679 96149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015938.1 protein_id gnl|my_center|LOCUS_01920 97139 98389 gene locus_tag LOCUS_01930 gene larA 97139 98389 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438088.1 protein_id gnl|my_center|LOCUS_01930 98432 99358 gene locus_tag LOCUS_01940 gene mdh 98432 99358 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_01940 99533 100798 gene locus_tag LOCUS_01950 gene icd 99533 100798 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_01950 100998 102647 gene locus_tag LOCUS_01960 100998 102647 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_01960 102809 103369 gene locus_tag LOCUS_01970 gene bstA 102809 103369 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_01970 103627 103388 gene locus_tag LOCUS_01980 103627 103388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 103913 105151 gene locus_tag LOCUS_01990 103913 105151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 105291 105854 gene locus_tag LOCUS_02000 gene efp 105291 105854 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_02000 107226 105913 gene locus_tag LOCUS_02010 107226 105913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 108580 107270 gene locus_tag LOCUS_02020 108580 107270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 110545 108722 gene locus_tag LOCUS_02030 110545 108722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 111082 110795 gene locus_tag LOCUS_02040 111082 110795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 112073 111171 gene locus_tag LOCUS_02050 gene sppA 112073 111171 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_02050 114019 112079 gene locus_tag LOCUS_02060 114019 112079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 115307 114345 gene locus_tag LOCUS_02070 gene miaA 115307 114345 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02070 115457 118078 gene locus_tag LOCUS_02080 gene mutS 115457 118078 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_02080 118244 120097 gene locus_tag LOCUS_02090 gene mutL 118244 120097 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_02090 120242 121429 gene locus_tag LOCUS_02100 120242 121429 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431263.1 protein_id gnl|my_center|LOCUS_02100 122730 121603 gene locus_tag LOCUS_02110 122730 121603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 123992 122841 gene locus_tag LOCUS_02120 gene lapB 123992 122841 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889971.1 protein_id gnl|my_center|LOCUS_02120 124622 124323 gene locus_tag LOCUS_02130 124622 124323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 125232 125411 gene locus_tag LOCUS_02140 125232 125411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 125441 125983 gene locus_tag LOCUS_02150 125441 125983 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546295.1 protein_id gnl|my_center|LOCUS_02150 126328 128583 gene locus_tag LOCUS_02160 gene mrfA 126328 128583 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_02160 128742 129842 gene locus_tag LOCUS_02170 gene per 128742 129842 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_02170 130049 130465 gene locus_tag LOCUS_02180 gene mce 130049 130465 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_02180 130575 131279 gene locus_tag LOCUS_02190 130575 131279 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_02190 131283 131939 gene locus_tag LOCUS_02200 131283 131939 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_02200 132224 133417 gene locus_tag LOCUS_02210 132224 133417 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_02210 134081 134926 gene locus_tag LOCUS_02220 134081 134926 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 protein_id gnl|my_center|LOCUS_02220 135061 136206 gene locus_tag LOCUS_02230 135061 136206 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_02230 136209 137408 gene locus_tag LOCUS_02240 gene acdA 136209 137408 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_02240 137417 137701 gene locus_tag LOCUS_02250 137417 137701 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810208.1 protein_id gnl|my_center|LOCUS_02250 138127 139077 gene locus_tag LOCUS_02260 138127 139077 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_02260 139092 139550 gene locus_tag LOCUS_02270 gene rpiB 139092 139550 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_02270 139547 139780 gene locus_tag LOCUS_02280 139547 139780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 140161 140844 gene locus_tag LOCUS_02290 140161 140844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 141457 142041 gene locus_tag LOCUS_02300 141457 142041 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence003 538 1398 gene locus_tag LOCUS_02310 gene hisG 538 1398 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_02310 1432 3114 gene locus_tag LOCUS_02320 1432 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3111 3701 gene locus_tag LOCUS_02330 gene hisB 3111 3701 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_02330 3694 4278 gene locus_tag LOCUS_02340 gene hisH 3694 4278 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_02340 4268 5029 gene locus_tag LOCUS_02350 gene hisF 4268 5029 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_02350 5026 6249 gene locus_tag LOCUS_02360 5026 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6246 7517 gene locus_tag LOCUS_02370 gene hisD 6246 7517 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_02370 7665 8597 gene locus_tag LOCUS_02380 7665 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8575 9105 gene locus_tag LOCUS_02390 8575 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 9115 9723 gene locus_tag LOCUS_02400 9115 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 10992 11402 gene locus_tag LOCUS_02410 10992 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11399 12535 gene locus_tag LOCUS_02420 11399 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 13024 12818 gene locus_tag LOCUS_02430 13024 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13109 13597 gene locus_tag LOCUS_02440 13109 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 13720 14217 gene locus_tag LOCUS_02450 13720 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 15126 14236 gene locus_tag LOCUS_02460 gene xerC 15126 14236 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_02460 15543 15397 gene locus_tag LOCUS_02470 15543 15397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 18309 15832 gene locus_tag LOCUS_02480 18309 15832 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 protein_id gnl|my_center|LOCUS_02480 18967 18275 gene locus_tag LOCUS_02490 18967 18275 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_02490 20345 19098 gene locus_tag LOCUS_02500 gene ccoG 20345 19098 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894876.1 protein_id gnl|my_center|LOCUS_02500 20529 20332 gene locus_tag LOCUS_02510 20529 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 21111 20566 gene locus_tag LOCUS_02520 gene ccoO 21111 20566 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300783.1 protein_id gnl|my_center|LOCUS_02520 22518 21124 gene locus_tag LOCUS_02530 gene ccoN 22518 21124 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157695.1 protein_id gnl|my_center|LOCUS_02530 24233 22515 gene locus_tag LOCUS_02540 24233 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 25580 24243 gene locus_tag LOCUS_02550 25580 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 26068 25577 gene locus_tag LOCUS_02560 26068 25577 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943564.1 protein_id gnl|my_center|LOCUS_02560 26213 26043 gene locus_tag LOCUS_02570 26213 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 28012 26210 gene locus_tag LOCUS_02580 28012 26210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 29641 28220 gene locus_tag LOCUS_02590 gene atoC 29641 28220 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389139.1 protein_id gnl|my_center|LOCUS_02590 31488 29638 gene locus_tag LOCUS_02600 31488 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 31627 31797 gene locus_tag LOCUS_02610 31627 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 31802 32539 gene locus_tag LOCUS_02620 31802 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 34466 32982 gene locus_tag LOCUS_02630 34466 32982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 37293 34612 gene locus_tag LOCUS_02640 37293 34612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 38633 38013 gene locus_tag LOCUS_02650 38633 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 38969 38745 gene locus_tag LOCUS_02660 38969 38745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 39472 40644 gene locus_tag LOCUS_02670 39472 40644 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073324.1 protein_id gnl|my_center|LOCUS_02670 40902 42026 gene locus_tag LOCUS_02680 40902 42026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 42223 42023 gene locus_tag LOCUS_02690 42223 42023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 43999 42782 gene locus_tag LOCUS_02700 43999 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 44661 44134 gene locus_tag LOCUS_02710 44661 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 45959 44682 gene locus_tag LOCUS_02720 gene hybB 45959 44682 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_02720 46759 45956 gene locus_tag LOCUS_02730 46759 45956 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_02730 49800 46756 gene locus_tag LOCUS_02740 gene fdnG 49800 46756 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:complement(49234..49236),aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02740 50741 49890 gene locus_tag LOCUS_02750 50741 49890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 51669 50734 gene locus_tag LOCUS_02760 gene fdhD 51669 50734 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 protein_id gnl|my_center|LOCUS_02760 52429 51791 gene locus_tag LOCUS_02770 52429 51791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 52946 53728 gene locus_tag LOCUS_02780 52946 53728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 53712 55658 gene locus_tag LOCUS_02790 53712 55658 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_02790 55767 55937 gene locus_tag LOCUS_02800 55767 55937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 55974 56486 gene locus_tag LOCUS_02810 gene mobB 55974 56486 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888886.1 protein_id gnl|my_center|LOCUS_02810 57441 56929 gene locus_tag LOCUS_02820 57441 56929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02820 57959 57480 gene locus_tag LOCUS_02830 57959 57480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 58659 60719 gene locus_tag LOCUS_02840 58659 60719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 60733 61155 gene locus_tag LOCUS_02850 60733 61155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 62788 61844 gene locus_tag LOCUS_02860 62788 61844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 64580 62769 gene locus_tag LOCUS_02870 64580 62769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 65998 65228 gene locus_tag LOCUS_02880 65998 65228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 66131 66343 gene locus_tag LOCUS_02890 66131 66343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 67975 66401 gene locus_tag LOCUS_02900 67975 66401 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_02900 68934 67972 gene locus_tag LOCUS_02910 68934 67972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 70653 69193 gene locus_tag LOCUS_02920 70653 69193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 71161 70646 gene locus_tag LOCUS_02930 71161 70646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 71838 71170 gene locus_tag LOCUS_02940 71838 71170 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228791.1 protein_id gnl|my_center|LOCUS_02940 72866 71835 gene locus_tag LOCUS_02950 72866 71835 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_02950 74254 72863 gene locus_tag LOCUS_02960 gene dnaB 74254 72863 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_02960 75288 74251 gene locus_tag LOCUS_02970 75288 74251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 75522 75289 gene locus_tag LOCUS_02980 75522 75289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 77340 75775 gene locus_tag LOCUS_02990 77340 75775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 78454 78080 gene locus_tag LOCUS_03000 78454 78080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 78890 79246 gene locus_tag LOCUS_03010 78890 79246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 80562 79669 gene locus_tag LOCUS_03020 gene xerC 80562 79669 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099257.1 protein_id gnl|my_center|LOCUS_03020 83586 80656 gene locus_tag LOCUS_03030 83586 80656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 84391 83579 gene locus_tag LOCUS_03040 84391 83579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 84766 85764 gene locus_tag LOCUS_03050 84766 85764 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267314.1 protein_id gnl|my_center|LOCUS_03050 86028 85756 gene locus_tag LOCUS_03060 86028 85756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 88019 86025 gene locus_tag LOCUS_03070 88019 86025 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_03070 88499 88846 gene locus_tag LOCUS_03080 88499 88846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 88932 89648 gene locus_tag LOCUS_03090 88932 89648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 89954 92488 gene locus_tag LOCUS_03100 89954 92488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 92493 93869 gene locus_tag LOCUS_03110 92493 93869 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_03110 94452 98063 gene locus_tag LOCUS_03120 94452 98063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 100351 101562 gene locus_tag LOCUS_03130 100351 101562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 102061 102648 gene locus_tag LOCUS_03140 102061 102648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 102804 103916 gene locus_tag LOCUS_03150 102804 103916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 104038 104493 gene locus_tag LOCUS_03160 104038 104493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 106522 105062 gene locus_tag LOCUS_03170 106522 105062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 106536 106736 gene locus_tag LOCUS_03180 106536 106736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 108281 106830 gene locus_tag LOCUS_03190 108281 106830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 110252 108678 gene locus_tag LOCUS_03200 110252 108678 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_03200 111223 110249 gene locus_tag LOCUS_03210 111223 110249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 111537 111220 gene locus_tag LOCUS_03220 111537 111220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 111768 113168 gene locus_tag LOCUS_03230 111768 113168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 113604 114032 gene locus_tag LOCUS_03240 113604 114032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 113992 115323 gene locus_tag LOCUS_03250 gene dnaB 113992 115323 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931899.1 protein_id gnl|my_center|LOCUS_03250 115364 116614 gene locus_tag LOCUS_03260 115364 116614 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_03260 116601 117113 gene locus_tag LOCUS_03270 116601 117113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 117880 117710 gene locus_tag LOCUS_03280 117880 117710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 118451 118903 gene locus_tag LOCUS_03290 118451 118903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 119751 119470 gene locus_tag LOCUS_03300 119751 119470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 120946 122577 gene locus_tag LOCUS_03310 120946 122577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 123671 122817 gene locus_tag LOCUS_03320 gene xerC 123671 122817 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_03320 126908 123870 gene locus_tag LOCUS_03330 126908 123870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 127722 126949 gene locus_tag LOCUS_03340 127722 126949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 130713 127759 gene locus_tag LOCUS_03350 130713 127759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 132502 131453 gene locus_tag LOCUS_03360 132502 131453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 132602 132862 gene locus_tag LOCUS_03370 132602 132862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 134438 133647 gene locus_tag LOCUS_03380 134438 133647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 135440 134496 gene locus_tag LOCUS_03390 135440 134496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence004 1528 3588 gene locus_tag LOCUS_03400 1528 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4106 3738 gene locus_tag LOCUS_03410 4106 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4544 4275 gene locus_tag LOCUS_03420 4544 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 5513 4683 gene locus_tag LOCUS_03430 5513 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5746 6366 gene locus_tag LOCUS_03440 gene lexA 5746 6366 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_03440 7344 6517 gene locus_tag LOCUS_03450 7344 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 8618 7899 gene locus_tag LOCUS_03460 8618 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10958 8622 gene locus_tag LOCUS_03470 10958 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 13294 11120 gene locus_tag LOCUS_03480 13294 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 13842 13309 gene locus_tag LOCUS_03490 13842 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 14130 15407 gene locus_tag LOCUS_03500 gene hisS 14130 15407 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_03500 15686 17518 gene locus_tag LOCUS_03510 gene aspS 15686 17518 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_03510 17858 18862 gene locus_tag LOCUS_03520 17858 18862 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_03520 18884 21217 gene locus_tag LOCUS_03530 18884 21217 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_03530 21246 21692 gene locus_tag LOCUS_03540 21246 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 21708 22991 gene locus_tag LOCUS_03550 21708 22991 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_03550 23368 23931 gene locus_tag LOCUS_03560 23368 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 24075 24473 gene locus_tag LOCUS_03570 24075 24473 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_03570 24575 24949 gene locus_tag LOCUS_03580 24575 24949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 25058 26284 gene locus_tag LOCUS_03590 25058 26284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_03590 27726 26365 gene locus_tag LOCUS_03600 27726 26365 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_03600 30842 27729 gene locus_tag LOCUS_03610 30842 27729 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_03610 31176 32267 gene locus_tag LOCUS_03620 31176 32267 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_03620 32493 33725 gene locus_tag LOCUS_03630 32493 33725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_03630 33741 34991 gene locus_tag LOCUS_03640 33741 34991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_03640 35100 35792 gene locus_tag LOCUS_03650 35100 35792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_03650 36972 35974 gene locus_tag LOCUS_03660 36972 35974 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_03660 37165 37812 gene locus_tag LOCUS_03670 37165 37812 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_03670 37828 38013 gene locus_tag LOCUS_03680 37828 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 38214 44075 gene locus_tag LOCUS_03690 38214 44075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 44731 45750 gene locus_tag LOCUS_03700 gene thiL 44731 45750 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_03700 46198 46716 gene locus_tag LOCUS_03710 46198 46716 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201132289.1 protein_id gnl|my_center|LOCUS_03710 48166 53415 gene locus_tag LOCUS_03720 48166 53415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 53537 54844 gene locus_tag LOCUS_03730 53537 54844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 55056 56162 gene locus_tag LOCUS_03740 55056 56162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 56267 57355 gene locus_tag LOCUS_03750 56267 57355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 57419 58423 gene locus_tag LOCUS_03760 57419 58423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 58877 58951 gene locus_tag LOCUS_t00030 58877 58951 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 59129 59461 gene locus_tag LOCUS_03770 59129 59461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 59670 59960 gene locus_tag LOCUS_03780 59670 59960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 61067 60246 gene locus_tag LOCUS_03790 61067 60246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 61665 61480 gene locus_tag LOCUS_03800 61665 61480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 62337 63671 gene locus_tag LOCUS_03810 62337 63671 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_03810 63674 65179 gene locus_tag LOCUS_03820 63674 65179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 66386 65742 gene locus_tag LOCUS_03830 66386 65742 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_03830 66634 67401 gene locus_tag LOCUS_03840 66634 67401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 68266 67385 gene locus_tag LOCUS_03850 68266 67385 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_03850 71437 68402 gene locus_tag LOCUS_03860 71437 68402 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_03860 72541 71480 gene locus_tag LOCUS_03870 72541 71480 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_03870 73885 72554 gene locus_tag LOCUS_03880 73885 72554 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_03880 74603 73986 gene locus_tag LOCUS_03890 74603 73986 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_03890 76414 74771 gene locus_tag LOCUS_03900 76414 74771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 76467 76745 gene locus_tag LOCUS_03910 76467 76745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 77058 76768 gene locus_tag LOCUS_03920 77058 76768 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_03920 78897 77152 gene locus_tag LOCUS_03930 78897 77152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 79650 78922 gene locus_tag LOCUS_03940 79650 78922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 79836 81107 gene locus_tag LOCUS_03950 79836 81107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 81253 82350 gene locus_tag LOCUS_03960 81253 82350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 83528 82395 gene locus_tag LOCUS_03970 83528 82395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 84201 83944 gene locus_tag LOCUS_03980 84201 83944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 84337 85728 gene locus_tag LOCUS_03990 84337 85728 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_03990 85743 88814 gene locus_tag LOCUS_04000 85743 88814 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_04000 89129 90532 gene locus_tag LOCUS_04010 89129 90532 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142321.1 protein_id gnl|my_center|LOCUS_04010 90786 90923 gene locus_tag LOCUS_04020 90786 90923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 91203 91547 gene locus_tag LOCUS_04030 91203 91547 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_04030 92647 91625 gene locus_tag LOCUS_04040 92647 91625 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_04040 93271 92651 gene locus_tag LOCUS_04050 93271 92651 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_04050 93628 93771 gene locus_tag LOCUS_04060 93628 93771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04060 94362 94574 gene locus_tag LOCUS_04070 94362 94574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 94823 95491 gene locus_tag LOCUS_04080 gene pth 94823 95491 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_04080 95488 95934 gene locus_tag LOCUS_04090 95488 95934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 95989 96312 gene locus_tag LOCUS_04100 95989 96312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 96352 96801 gene locus_tag LOCUS_04110 gene rplI 96352 96801 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_04110 96813 97301 gene locus_tag LOCUS_04120 96813 97301 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_04120 97594 97830 gene locus_tag LOCUS_04130 97594 97830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 97862 98365 gene locus_tag LOCUS_04140 97862 98365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 98362 98802 gene locus_tag LOCUS_04150 98362 98802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 98936 99484 gene locus_tag LOCUS_04160 98936 99484 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_04160 99773 101929 gene locus_tag LOCUS_04170 99773 101929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 102602 103690 gene locus_tag LOCUS_04180 gene speY 102602 103690 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence005 1417 503 gene locus_tag LOCUS_04190 1417 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3122 1482 gene locus_tag LOCUS_04200 3122 1482 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_04200 3497 4231 gene locus_tag LOCUS_04210 gene flgF 3497 4231 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_04210 4285 5073 gene locus_tag LOCUS_04220 gene flgG 4285 5073 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_04220 5223 5948 gene locus_tag LOCUS_04230 5223 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5990 6622 gene locus_tag LOCUS_04240 5990 6622 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_04240 6719 7861 gene locus_tag LOCUS_04250 6719 7861 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_04250 8033 8458 gene locus_tag LOCUS_04260 8033 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 8573 9073 gene locus_tag LOCUS_04270 8573 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9092 10483 gene locus_tag LOCUS_04280 gene flgK 9092 10483 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_04280 11807 10749 gene locus_tag LOCUS_04290 11807 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12005 12853 gene locus_tag LOCUS_04300 12005 12853 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_04300 12954 13631 gene locus_tag LOCUS_04310 12954 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 14562 13972 gene locus_tag LOCUS_04320 14562 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14640 14816 gene locus_tag LOCUS_04330 14640 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 16033 14780 gene locus_tag LOCUS_04340 16033 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16298 16373 gene locus_tag LOCUS_t00040 16298 16373 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16431 17252 gene locus_tag LOCUS_04350 16431 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 17288 18580 gene locus_tag LOCUS_04360 gene asnS 17288 18580 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870400.1 protein_id gnl|my_center|LOCUS_04360 18603 18803 gene locus_tag LOCUS_04370 18603 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 18945 19757 gene locus_tag LOCUS_04380 18945 19757 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_04380 19754 22264 gene locus_tag LOCUS_04390 gene leuS 19754 22264 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_04390 22341 23000 gene locus_tag LOCUS_04400 gene plsY 22341 23000 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_04400 23065 24090 gene locus_tag LOCUS_04410 23065 24090 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_04410 24577 24972 gene locus_tag LOCUS_04420 24577 24972 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_04420 25024 25100 gene locus_tag LOCUS_t00050 25024 25100 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25476 26144 gene locus_tag LOCUS_04430 25476 26144 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957975.1 protein_id gnl|my_center|LOCUS_04430 26167 26595 gene locus_tag LOCUS_04440 26167 26595 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_04440 26619 26951 gene locus_tag LOCUS_04450 26619 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 26955 27707 gene locus_tag LOCUS_04460 gene surE 26955 27707 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_04460 30246 27751 gene locus_tag LOCUS_04470 30246 27751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 30558 30782 gene locus_tag LOCUS_04480 30558 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 33294 30826 gene locus_tag LOCUS_04490 33294 30826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 33641 33717 gene locus_tag LOCUS_t00060 33641 33717 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34097 35176 gene locus_tag LOCUS_04500 34097 35176 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_04500 35173 37203 gene locus_tag LOCUS_04510 35173 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 38437 37244 gene locus_tag LOCUS_04520 38437 37244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 38746 39741 gene locus_tag LOCUS_04530 38746 39741 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_04530 40360 42639 gene locus_tag LOCUS_04540 40360 42639 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_04540 43586 42936 gene locus_tag LOCUS_04550 43586 42936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 43755 45656 gene locus_tag LOCUS_04560 43755 45656 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 protein_id gnl|my_center|LOCUS_04560 45809 45882 gene locus_tag LOCUS_t00070 45809 45882 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45961 46044 gene locus_tag LOCUS_t00080 45961 46044 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 47671 46178 gene locus_tag LOCUS_04570 47671 46178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 50211 47986 gene locus_tag LOCUS_04580 50211 47986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 50740 50444 gene locus_tag LOCUS_04590 50740 50444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975314.1 protein_id gnl|my_center|LOCUS_04590 50947 51738 gene locus_tag LOCUS_04600 50947 51738 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_04600 51824 52189 gene locus_tag LOCUS_04610 51824 52189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 52363 53412 gene locus_tag LOCUS_04620 gene tdh 52363 53412 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_04620 53683 54060 gene locus_tag LOCUS_04630 53683 54060 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_04630 54102 55802 gene locus_tag LOCUS_04640 gene acsA 54102 55802 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_04640 55817 56065 gene locus_tag LOCUS_04650 55817 56065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 56123 57370 gene locus_tag LOCUS_04660 gene kbl 56123 57370 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_04660 58188 57496 gene locus_tag LOCUS_04670 58188 57496 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_04670 59441 58185 gene locus_tag LOCUS_04680 59441 58185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04680 60877 59411 gene locus_tag LOCUS_04690 60877 59411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 61455 60874 gene locus_tag LOCUS_04700 gene kdpC 61455 60874 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_04700 63446 61455 gene locus_tag LOCUS_04710 gene kdpB 63446 61455 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529645.1 protein_id gnl|my_center|LOCUS_04710 65251 63560 gene locus_tag LOCUS_04720 gene kdpA 65251 63560 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_04720 66356 65529 gene locus_tag LOCUS_04730 66356 65529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 67924 66464 gene locus_tag LOCUS_04740 67924 66464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 68186 68836 gene locus_tag LOCUS_04750 68186 68836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 68915 69532 gene locus_tag LOCUS_04760 68915 69532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 69654 70787 gene locus_tag LOCUS_04770 69654 70787 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_04770 71084 73081 gene locus_tag LOCUS_04780 71084 73081 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839094.1 protein_id gnl|my_center|LOCUS_04780 73648 73259 gene locus_tag LOCUS_04790 73648 73259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 73980 74504 gene locus_tag LOCUS_04800 73980 74504 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_04800 74823 75857 gene locus_tag LOCUS_04810 gene plsX 74823 75857 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_04810 75862 76857 gene locus_tag LOCUS_04820 75862 76857 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_04820 77001 77948 gene locus_tag LOCUS_04830 gene fabD 77001 77948 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_04830 77983 78792 gene locus_tag LOCUS_04840 gene fabG 77983 78792 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_04840 78956 79195 gene locus_tag LOCUS_04850 gene acpP 78956 79195 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_04850 79302 80528 gene locus_tag LOCUS_04860 gene fabF 79302 80528 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_04860 80714 81484 gene locus_tag LOCUS_04870 gene rnc 80714 81484 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_04870 81481 82260 gene locus_tag LOCUS_04880 81481 82260 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_04880 82558 82941 gene locus_tag LOCUS_04890 82558 82941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 83177 85264 gene locus_tag LOCUS_04900 gene fusA 83177 85264 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_04900 85480 85301 gene locus_tag LOCUS_04910 85480 85301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 85670 89113 gene locus_tag LOCUS_04920 gene dnaE 85670 89113 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_04920 89181 89759 gene locus_tag LOCUS_04930 89181 89759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 90051 90653 gene locus_tag LOCUS_04940 90051 90653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 91190 91963 gene locus_tag LOCUS_04950 91190 91963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_04950 91966 92712 gene locus_tag LOCUS_04960 91966 92712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_04960 92936 95254 gene locus_tag LOCUS_04970 92936 95254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 95496 96146 gene locus_tag LOCUS_04980 95496 96146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 96452 97054 gene locus_tag LOCUS_04990 96452 97054 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_04990 97256 97732 gene locus_tag LOCUS_05000 97256 97732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 97857 98984 gene locus_tag LOCUS_05010 97857 98984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 99080 99637 gene locus_tag LOCUS_05020 gene cobO 99080 99637 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_05020 100161 101600 gene locus_tag LOCUS_05030 100161 101600 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257549.1 protein_id gnl|my_center|LOCUS_05030 102031 102450 gene locus_tag LOCUS_05040 102031 102450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence006 2352 175 gene locus_tag LOCUS_05050 2352 175 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_05050 3325 2732 gene locus_tag LOCUS_05060 3325 2732 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_05060 3830 3576 gene locus_tag LOCUS_05070 3830 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4292 3909 gene locus_tag LOCUS_05080 4292 3909 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_05080 5542 4364 gene locus_tag LOCUS_05090 5542 4364 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_05090 6072 5569 gene locus_tag LOCUS_05100 6072 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6356 6796 gene locus_tag LOCUS_05110 6356 6796 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_05110 7801 6857 gene locus_tag LOCUS_05120 7801 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8681 7803 gene locus_tag LOCUS_05130 8681 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 10717 8804 gene locus_tag LOCUS_05140 10717 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 11806 10727 gene locus_tag LOCUS_05150 11806 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13055 11928 gene locus_tag LOCUS_05160 13055 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14966 14115 gene locus_tag LOCUS_05170 gene motB 14966 14115 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_05170 15847 14990 gene locus_tag LOCUS_05180 gene motA 15847 14990 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_05180 16893 16132 gene locus_tag LOCUS_05190 16893 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 17654 16890 gene locus_tag LOCUS_05200 17654 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 22060 17651 gene locus_tag LOCUS_05210 22060 17651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 23176 22064 gene locus_tag LOCUS_05220 23176 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 25380 23209 gene locus_tag LOCUS_05230 gene vgrG1b 25380 23209 CDS product type VI secretion system spike protein VgrG1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147059.1 protein_id gnl|my_center|LOCUS_05230 28350 25663 gene locus_tag LOCUS_05240 gene tssH 28350 25663 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_05240 29416 28415 gene locus_tag LOCUS_05250 gene tssG 29416 28415 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941101.1 protein_id gnl|my_center|LOCUS_05250 31125 29380 gene locus_tag LOCUS_05260 gene tssF 31125 29380 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480666.1 protein_id gnl|my_center|LOCUS_05260 31566 31147 gene locus_tag LOCUS_05270 gene tssE 31566 31147 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105491.1 protein_id gnl|my_center|LOCUS_05270 32181 31693 gene locus_tag LOCUS_05280 32181 31693 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_05280 33936 32455 gene locus_tag LOCUS_05290 gene tssC 33936 32455 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943793.1 protein_id gnl|my_center|LOCUS_05290 34465 33971 gene locus_tag LOCUS_05300 gene tssB 34465 33971 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480589.1 protein_id gnl|my_center|LOCUS_05300 36147 34567 gene locus_tag LOCUS_05310 gene tssA 36147 34567 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097814.1 protein_id gnl|my_center|LOCUS_05310 37138 36164 gene locus_tag LOCUS_05320 37138 36164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 40624 37229 gene locus_tag LOCUS_05330 40624 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 41342 40656 gene locus_tag LOCUS_05340 gene icmH 41342 40656 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521948.1 protein_id gnl|my_center|LOCUS_05340 42748 41390 gene locus_tag LOCUS_05350 gene tssK 42748 41390 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521949.1 protein_id gnl|my_center|LOCUS_05350 43341 42793 gene locus_tag LOCUS_05360 43341 42793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 44087 43338 gene locus_tag LOCUS_05370 44087 43338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 44333 44246 gene locus_tag LOCUS_t00090 44333 44246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45065 44367 gene locus_tag LOCUS_05380 45065 44367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 45547 45074 gene locus_tag LOCUS_05390 45547 45074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 46060 45563 gene locus_tag LOCUS_05400 gene tadA 46060 45563 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386764.1 protein_id gnl|my_center|LOCUS_05400 47440 46136 gene locus_tag LOCUS_05410 47440 46136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 48186 47437 gene locus_tag LOCUS_05420 48186 47437 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_05420 49681 48218 gene locus_tag LOCUS_05430 49681 48218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 51016 49691 gene locus_tag LOCUS_05440 51016 49691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 52421 51171 gene locus_tag LOCUS_05450 52421 51171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_05450 53678 52458 gene locus_tag LOCUS_05460 53678 52458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_05460 54374 53682 gene locus_tag LOCUS_05470 54374 53682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_05470 55772 54420 gene locus_tag LOCUS_05480 55772 54420 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_05480 57284 55950 gene locus_tag LOCUS_05490 57284 55950 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762063.1 protein_id gnl|my_center|LOCUS_05490 58079 57324 gene locus_tag LOCUS_05500 58079 57324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 59594 58401 gene locus_tag LOCUS_05510 59594 58401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 63448 60044 gene locus_tag LOCUS_05520 63448 60044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_05520 64322 63603 gene locus_tag LOCUS_05530 64322 63603 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_05530 64869 64408 gene locus_tag LOCUS_05540 64869 64408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 65891 64962 gene locus_tag LOCUS_05550 gene secF 65891 64962 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_05550 67644 65944 gene locus_tag LOCUS_05560 gene secD 67644 65944 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_05560 67854 67928 gene locus_tag LOCUS_t00100 67854 67928 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67984 69657 gene locus_tag LOCUS_05570 67984 69657 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_05570 69752 71038 gene locus_tag LOCUS_05580 69752 71038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 72100 71045 gene locus_tag LOCUS_05590 gene hypE 72100 71045 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_05590 73226 72141 gene locus_tag LOCUS_05600 gene hypD 73226 72141 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_05600 73495 73223 gene locus_tag LOCUS_05610 73495 73223 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_05610 75841 73499 gene locus_tag LOCUS_05620 gene hypF 75841 73499 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_05620 76341 75850 gene locus_tag LOCUS_05630 76341 75850 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_05630 77650 76367 gene locus_tag LOCUS_05640 77650 76367 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_05640 77376 77385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78419 77640 gene locus_tag LOCUS_05650 78419 77640 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_05650 79284 78421 gene locus_tag LOCUS_05660 79284 78421 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_05660 79729 79268 gene locus_tag LOCUS_05670 79729 79268 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_05670 80894 79716 gene locus_tag LOCUS_05680 80894 79716 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_05680 81944 81027 gene locus_tag LOCUS_05690 81944 81027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 85292 81954 gene locus_tag LOCUS_05700 85292 81954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 85808 85620 gene locus_tag LOCUS_05710 85808 85620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 85728 86180 gene locus_tag LOCUS_05720 85728 86180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 86612 86244 gene locus_tag LOCUS_05730 86612 86244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 86614 87858 gene locus_tag LOCUS_05740 86614 87858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 87988 88524 gene locus_tag LOCUS_05750 87988 88524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 88640 89557 gene locus_tag LOCUS_05760 88640 89557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 89569 90048 gene locus_tag LOCUS_05770 89569 90048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 90827 92152 gene locus_tag LOCUS_05780 90827 92152 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143607.1 protein_id gnl|my_center|LOCUS_05780 92159 93160 gene locus_tag LOCUS_05790 92159 93160 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_05790 93171 93512 gene locus_tag LOCUS_05800 93171 93512 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_05800 93525 96707 gene locus_tag LOCUS_05810 93525 96707 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_05810 98030 96900 gene locus_tag LOCUS_05820 98030 96900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_05820 98046 98243 gene locus_tag LOCUS_05830 98046 98243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 99466 98261 gene locus_tag LOCUS_05840 gene nrfD 99466 98261 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_05840 100243 99470 gene locus_tag LOCUS_05850 100243 99470 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_05850 101007 100240 gene locus_tag LOCUS_05860 101007 100240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 101175 101393 gene locus_tag LOCUS_05870 101175 101393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence007 1063 206 gene locus_tag LOCUS_05880 1063 206 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_05880 2337 1087 gene locus_tag LOCUS_05890 2337 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4309 2504 gene locus_tag LOCUS_05900 gene phoR 4309 2504 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398493.1 protein_id gnl|my_center|LOCUS_05900 5005 4313 gene locus_tag LOCUS_05910 5005 4313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_05910 5212 8535 gene locus_tag LOCUS_05920 5212 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8532 10073 gene locus_tag LOCUS_05930 8532 10073 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_05930 10404 10625 gene locus_tag LOCUS_05940 10404 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 10613 11374 gene locus_tag LOCUS_05950 10613 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11475 11699 gene locus_tag LOCUS_05960 11475 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 11850 12596 gene locus_tag LOCUS_05970 11850 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12722 13561 gene locus_tag LOCUS_05980 12722 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 14181 13573 gene locus_tag LOCUS_05990 14181 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 14270 14650 gene locus_tag LOCUS_06000 14270 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 15131 14745 gene locus_tag LOCUS_06010 15131 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 18553 15194 gene locus_tag LOCUS_06020 18553 15194 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_06020 19801 18563 gene locus_tag LOCUS_06030 19801 18563 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_06030 21254 20001 gene locus_tag LOCUS_06040 21254 20001 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_06040 23940 21763 gene locus_tag LOCUS_06050 23940 21763 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_06050 24001 24234 gene locus_tag LOCUS_06060 24001 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 26741 24186 gene locus_tag LOCUS_06070 26741 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 27973 27113 gene locus_tag LOCUS_06080 27973 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 28247 30760 gene locus_tag LOCUS_06090 gene gyrA 28247 30760 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_06090 31010 32890 gene locus_tag LOCUS_06100 31010 32890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 33010 34560 gene locus_tag LOCUS_06110 33010 34560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828678.1 protein_id gnl|my_center|LOCUS_06110 35363 35022 gene locus_tag LOCUS_06120 35363 35022 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_06120 35744 35373 gene locus_tag LOCUS_06130 gene crcB 35744 35373 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_06130 36132 37289 gene locus_tag LOCUS_06140 gene moeB 36132 37289 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_06140 37291 37533 gene locus_tag LOCUS_06150 gene moaD 37291 37533 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_06150 37533 37964 gene locus_tag LOCUS_06160 37533 37964 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_06160 39196 38102 gene locus_tag LOCUS_06170 39196 38102 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_06170 40746 39208 gene locus_tag LOCUS_06180 40746 39208 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_06180 42060 40789 gene locus_tag LOCUS_06190 42060 40789 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_06190 43236 42247 gene locus_tag LOCUS_06200 gene selD 43236 42247 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_06200 44697 43768 gene locus_tag LOCUS_06210 gene cysK 44697 43768 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_06210 45371 44694 gene locus_tag LOCUS_06220 45371 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 46312 45689 gene locus_tag LOCUS_06230 46312 45689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 46931 48556 gene locus_tag LOCUS_06240 gene pruA 46931 48556 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_06240 48632 50380 gene locus_tag LOCUS_06250 48632 50380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_06250 50429 51250 gene locus_tag LOCUS_06260 50429 51250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 52224 51529 gene locus_tag LOCUS_06270 52224 51529 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024068.1 protein_id gnl|my_center|LOCUS_06270 53097 52231 gene locus_tag LOCUS_06280 53097 52231 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_06280 54081 53188 gene locus_tag LOCUS_06290 54081 53188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 65707 54188 gene locus_tag LOCUS_06300 65707 54188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 66225 66046 gene locus_tag LOCUS_06310 66225 66046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 68196 67273 gene locus_tag LOCUS_06320 68196 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 68924 68358 gene locus_tag LOCUS_06330 gene sigR 68924 68358 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_06330 69670 69275 gene locus_tag LOCUS_06340 69670 69275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 70414 69761 gene locus_tag LOCUS_06350 70414 69761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_06350 71903 70539 gene locus_tag LOCUS_06360 71903 70539 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_06360 72826 71951 gene locus_tag LOCUS_06370 72826 71951 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878017.1 protein_id gnl|my_center|LOCUS_06370 73586 74341 gene locus_tag LOCUS_06380 gene fabG 73586 74341 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_06380 74493 76205 gene locus_tag LOCUS_06390 74493 76205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 76537 76286 gene locus_tag LOCUS_06400 76537 76286 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272468.1 protein_id gnl|my_center|LOCUS_06400 77421 77059 gene locus_tag LOCUS_06410 77421 77059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 77330 77791 gene locus_tag LOCUS_06420 77330 77791 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918009.1 protein_id gnl|my_center|LOCUS_06420 78969 78799 gene locus_tag LOCUS_06430 78969 78799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 78890 79942 gene locus_tag LOCUS_06440 gene bpsA 78890 79942 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_06440 80262 81122 gene locus_tag LOCUS_06450 80262 81122 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_06450 81301 81483 gene locus_tag LOCUS_06460 81301 81483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 81597 81941 gene locus_tag LOCUS_06470 81597 81941 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879095.1 protein_id gnl|my_center|LOCUS_06470 83674 82337 gene locus_tag LOCUS_06480 83674 82337 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_06480 84041 83787 gene locus_tag LOCUS_06490 84041 83787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 84153 85862 gene locus_tag LOCUS_06500 84153 85862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 86017 86292 gene locus_tag LOCUS_06510 86017 86292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 86377 87489 gene locus_tag LOCUS_06520 86377 87489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 87542 88459 gene locus_tag LOCUS_06530 87542 88459 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_06530 88456 89301 gene locus_tag LOCUS_06540 88456 89301 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_06540 90515 89874 gene locus_tag LOCUS_06550 90515 89874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 90834 90664 gene locus_tag LOCUS_06560 90834 90664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 91537 91151 gene locus_tag LOCUS_06570 91537 91151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 92888 91527 gene locus_tag LOCUS_06580 92888 91527 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615609.1 protein_id gnl|my_center|LOCUS_06580 93280 92888 gene locus_tag LOCUS_06590 93280 92888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 93512 94588 gene locus_tag LOCUS_06600 93512 94588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 97135 94727 gene locus_tag LOCUS_06610 gene lon 97135 94727 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_06610 97932 97480 gene locus_tag LOCUS_06620 97932 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 98960 98583 gene locus_tag LOCUS_06630 98960 98583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 99756 101228 gene locus_tag LOCUS_06640 99756 101228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence008 7 489 gene locus_tag LOCUS_06650 7 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 918 2186 gene locus_tag LOCUS_06660 918 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2208 3620 gene locus_tag LOCUS_06670 2208 3620 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_06670 3617 4033 gene locus_tag LOCUS_06680 3617 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4706 6709 gene locus_tag LOCUS_06690 4706 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6672 6914 gene locus_tag LOCUS_06700 6672 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 6932 7963 gene locus_tag LOCUS_06710 6932 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8072 9361 gene locus_tag LOCUS_06720 8072 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 9354 10505 gene locus_tag LOCUS_06730 9354 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10777 11856 gene locus_tag LOCUS_06740 10777 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 12331 11951 gene locus_tag LOCUS_06750 12331 11951 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_06750 13691 12714 gene locus_tag LOCUS_06760 13691 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 15293 13719 gene locus_tag LOCUS_06770 15293 13719 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_06770 16037 15312 gene locus_tag LOCUS_06780 16037 15312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_06780 17014 16034 gene locus_tag LOCUS_06790 17014 16034 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_06790 17949 17308 gene locus_tag LOCUS_06800 17949 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 18972 18157 gene locus_tag LOCUS_06810 18972 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19685 18999 gene locus_tag LOCUS_06820 19685 18999 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_06820 21037 19769 gene locus_tag LOCUS_06830 21037 19769 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_06830 21732 21034 gene locus_tag LOCUS_06840 21732 21034 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_06840 23691 21829 gene locus_tag LOCUS_06850 gene uvrC 23691 21829 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_06850 24409 23777 gene locus_tag LOCUS_06860 24409 23777 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298673.1 protein_id gnl|my_center|LOCUS_06860 25419 24424 gene locus_tag LOCUS_06870 25419 24424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 25857 25633 gene locus_tag LOCUS_06880 25857 25633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 26678 25872 gene locus_tag LOCUS_06890 26678 25872 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_06890 27557 26745 gene locus_tag LOCUS_06900 27557 26745 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_06900 28115 27558 gene locus_tag LOCUS_06910 gene frr 28115 27558 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_06910 29120 28392 gene locus_tag LOCUS_06920 gene pyrH 29120 28392 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_06920 30299 29706 gene locus_tag LOCUS_06930 gene tsf 30299 29706 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_06930 31130 30336 gene locus_tag LOCUS_06940 gene rpsB 31130 30336 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_06940 31656 31264 gene locus_tag LOCUS_06950 gene rpsI 31656 31264 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_06950 32147 31716 gene locus_tag LOCUS_06960 gene rplM 32147 31716 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_06960 33050 32241 gene locus_tag LOCUS_06970 33050 32241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_06970 33198 33512 gene locus_tag LOCUS_06980 33198 33512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 36790 33965 gene locus_tag LOCUS_06990 36790 33965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 39741 36799 gene locus_tag LOCUS_07000 39741 36799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 39792 39971 gene locus_tag LOCUS_07010 39792 39971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 41798 40083 gene locus_tag LOCUS_07020 41798 40083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 44261 42174 gene locus_tag LOCUS_07030 44261 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 45261 44290 gene locus_tag LOCUS_07040 45261 44290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 48001 45278 gene locus_tag LOCUS_07050 48001 45278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 51473 48021 gene locus_tag LOCUS_07060 51473 48021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 52622 51786 gene locus_tag LOCUS_07070 52622 51786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 55641 52711 gene locus_tag LOCUS_07080 55641 52711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 56017 55673 gene locus_tag LOCUS_07090 56017 55673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 56745 58556 gene locus_tag LOCUS_07100 56745 58556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 58553 59806 gene locus_tag LOCUS_07110 58553 59806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 59818 61515 gene locus_tag LOCUS_07120 59818 61515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 61566 62321 gene locus_tag LOCUS_07130 61566 62321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 62625 63530 gene locus_tag LOCUS_07140 62625 63530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 63712 63891 gene locus_tag LOCUS_07150 63712 63891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 63900 64940 gene locus_tag LOCUS_07160 63900 64940 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896514.1 protein_id gnl|my_center|LOCUS_07160 66284 65361 gene locus_tag LOCUS_07170 66284 65361 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_07170 67094 66621 gene locus_tag LOCUS_07180 67094 66621 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_07180 68499 67501 gene locus_tag LOCUS_07190 68499 67501 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393827.1 protein_id gnl|my_center|LOCUS_07190 69521 68586 gene locus_tag LOCUS_07200 69521 68586 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_07200 69874 69518 gene locus_tag LOCUS_07210 69874 69518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 70207 69884 gene locus_tag LOCUS_07220 70207 69884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 70444 70289 gene locus_tag LOCUS_07230 70444 70289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 71214 70456 gene locus_tag LOCUS_07240 71214 70456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_07240 71431 71246 gene locus_tag LOCUS_07250 71431 71246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 72204 71428 gene locus_tag LOCUS_07260 72204 71428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545754.1 protein_id gnl|my_center|LOCUS_07260 72522 75008 gene locus_tag LOCUS_07270 72522 75008 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_07270 75051 76448 gene locus_tag LOCUS_07280 75051 76448 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_07280 77495 76467 gene locus_tag LOCUS_07290 77495 76467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_07290 79316 77886 gene locus_tag LOCUS_07300 79316 77886 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_07300 80932 79313 gene locus_tag LOCUS_07310 80932 79313 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_07310 82872 80938 gene locus_tag LOCUS_07320 gene nuoL 82872 80938 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence009 387 61 gene locus_tag LOCUS_07330 387 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 992 1549 gene locus_tag LOCUS_07340 992 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3221 1875 gene locus_tag LOCUS_07350 3221 1875 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_07350 4267 3314 gene locus_tag LOCUS_07360 4267 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6013 4655 gene locus_tag LOCUS_07370 gene zraR 6013 4655 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148553.1 protein_id gnl|my_center|LOCUS_07370 7856 6522 gene locus_tag LOCUS_07380 7856 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8298 9461 gene locus_tag LOCUS_07390 8298 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10481 10254 gene locus_tag LOCUS_07400 10481 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12044 11088 gene locus_tag LOCUS_07410 12044 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12393 12001 gene locus_tag LOCUS_07420 12393 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12377 12592 gene locus_tag LOCUS_07430 12377 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 12822 13364 gene locus_tag LOCUS_07440 12822 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13410 14441 gene locus_tag LOCUS_07450 gene queG 13410 14441 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141464.1 protein_id gnl|my_center|LOCUS_07450 14568 15527 gene locus_tag LOCUS_07460 14568 15527 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_07460 15561 17573 gene locus_tag LOCUS_07470 gene dxs 15561 17573 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880536.1 protein_id gnl|my_center|LOCUS_07470 17787 18668 gene locus_tag LOCUS_07480 17787 18668 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_07480 18843 21350 gene locus_tag LOCUS_07490 18843 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 23469 21628 gene locus_tag LOCUS_07500 23469 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 23631 25634 gene locus_tag LOCUS_07510 23631 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 25850 26782 gene locus_tag LOCUS_07520 25850 26782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 26773 27522 gene locus_tag LOCUS_07530 26773 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 27679 28197 gene locus_tag LOCUS_07540 27679 28197 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_07540 28234 31392 gene locus_tag LOCUS_07550 28234 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 32880 31414 gene locus_tag LOCUS_07560 gene purF 32880 31414 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086941.1 protein_id gnl|my_center|LOCUS_07560 34338 33139 gene locus_tag LOCUS_07570 34338 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 35004 34558 gene locus_tag LOCUS_07580 35004 34558 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140739.1 protein_id gnl|my_center|LOCUS_07580 35460 36245 gene locus_tag LOCUS_07590 35460 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 36442 37746 gene locus_tag LOCUS_07600 36442 37746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 38084 39433 gene locus_tag LOCUS_07610 38084 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 39536 40681 gene locus_tag LOCUS_07620 39536 40681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 42975 40882 gene locus_tag LOCUS_07630 42975 40882 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_07630 45324 43555 gene locus_tag LOCUS_07640 45324 43555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 45664 47703 gene locus_tag LOCUS_07650 45664 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 47954 48457 gene locus_tag LOCUS_07660 47954 48457 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804487.1 protein_id gnl|my_center|LOCUS_07660 48743 48489 gene locus_tag LOCUS_07670 48743 48489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 49267 48704 gene locus_tag LOCUS_07680 49267 48704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 49578 50753 gene locus_tag LOCUS_07690 49578 50753 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_07690 50780 51523 gene locus_tag LOCUS_07700 gene fabG 50780 51523 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_07700 51643 52422 gene locus_tag LOCUS_07710 51643 52422 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_07710 52523 53239 gene locus_tag LOCUS_07720 gene cmk 52523 53239 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_07720 53283 53930 gene locus_tag LOCUS_07730 53283 53930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 54063 56093 gene locus_tag LOCUS_07740 gene rpsA 54063 56093 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_07740 57224 56517 gene locus_tag LOCUS_07750 57224 56517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 57671 59959 gene locus_tag LOCUS_07760 57671 59959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 60355 60933 gene locus_tag LOCUS_07770 60355 60933 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_07770 61537 60938 gene locus_tag LOCUS_07780 61537 60938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 62269 61883 gene locus_tag LOCUS_07790 62269 61883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 62642 62280 gene locus_tag LOCUS_07800 62642 62280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 65192 62646 gene locus_tag LOCUS_07810 65192 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 67531 65189 gene locus_tag LOCUS_07820 67531 65189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 68409 68008 gene locus_tag LOCUS_07830 68409 68008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 68326 68592 gene locus_tag LOCUS_07840 68326 68592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 69136 69651 gene locus_tag LOCUS_07850 69136 69651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 69697 70236 gene locus_tag LOCUS_07860 69697 70236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 70725 70453 gene locus_tag LOCUS_07870 70725 70453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 70964 71203 gene locus_tag LOCUS_07880 70964 71203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 72016 72276 gene locus_tag LOCUS_07890 72016 72276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 72774 72442 gene locus_tag LOCUS_07900 72774 72442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 73068 72784 gene locus_tag LOCUS_07910 73068 72784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 73006 73212 gene locus_tag LOCUS_07920 73006 73212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 73629 73429 gene locus_tag LOCUS_07930 73629 73429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 73528 73800 gene locus_tag LOCUS_07940 73528 73800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 73835 74059 gene locus_tag LOCUS_07950 73835 74059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 74893 74579 gene locus_tag LOCUS_07960 74893 74579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 74960 75295 gene locus_tag LOCUS_07970 74960 75295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 75593 75760 gene locus_tag LOCUS_07980 75593 75760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 75770 76099 gene locus_tag LOCUS_07990 75770 76099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 76642 76406 gene locus_tag LOCUS_08000 76642 76406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 76764 77060 gene locus_tag LOCUS_08010 76764 77060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 77347 81267 gene locus_tag LOCUS_08020 77347 81267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence010 352 681 gene locus_tag LOCUS_08030 352 681 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816257.1 protein_id gnl|my_center|LOCUS_08030 721 1056 gene locus_tag LOCUS_08040 721 1056 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042653643.1 protein_id gnl|my_center|LOCUS_08040 1095 1640 gene locus_tag LOCUS_08050 1095 1640 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_08050 1823 2299 gene locus_tag LOCUS_08060 1823 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2302 2673 gene locus_tag LOCUS_08070 2302 2673 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_08070 3023 3811 gene locus_tag LOCUS_08080 3023 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4559 5956 gene locus_tag LOCUS_08090 4559 5956 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_08090 6180 6974 gene locus_tag LOCUS_08100 gene lpxA 6180 6974 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_08100 6971 7978 gene locus_tag LOCUS_08110 6971 7978 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_08110 8062 9201 gene locus_tag LOCUS_08120 gene lpxB 8062 9201 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_08120 9198 10544 gene locus_tag LOCUS_08130 gene waaA 9198 10544 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_08130 10945 10634 gene locus_tag LOCUS_08140 10945 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10913 11644 gene locus_tag LOCUS_08150 10913 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 11677 13272 gene locus_tag LOCUS_08160 gene nadB 11677 13272 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_08160 13680 15191 gene locus_tag LOCUS_08170 gene guaA 13680 15191 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_08170 15746 15384 gene locus_tag LOCUS_08180 15746 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 17136 16276 gene locus_tag LOCUS_08190 17136 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 17785 17471 gene locus_tag LOCUS_08200 17785 17471 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_08200 20218 17939 gene locus_tag LOCUS_08210 20218 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 20598 22151 gene locus_tag LOCUS_08220 20598 22151 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_08220 22392 23924 gene locus_tag LOCUS_08230 22392 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 24018 25925 gene locus_tag LOCUS_08240 24018 25925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 26027 26920 gene locus_tag LOCUS_08250 26027 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 27007 27849 gene locus_tag LOCUS_08260 27007 27849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 27875 29917 gene locus_tag LOCUS_08270 27875 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 30089 31123 gene locus_tag LOCUS_08280 gene hrcA 30089 31123 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_08280 31120 31752 gene locus_tag LOCUS_08290 31120 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 32496 34430 gene locus_tag LOCUS_08300 gene dnaK 32496 34430 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_08300 34515 35687 gene locus_tag LOCUS_08310 gene dnaJ 34515 35687 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_08310 35965 36735 gene locus_tag LOCUS_08320 35965 36735 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404844.1 protein_id gnl|my_center|LOCUS_08320 36732 37079 gene locus_tag LOCUS_08330 36732 37079 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_08330 37532 38017 gene locus_tag LOCUS_08340 37532 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 38687 40249 gene locus_tag LOCUS_08350 38687 40249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 40926 40246 gene locus_tag LOCUS_08360 40926 40246 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404449.1 protein_id gnl|my_center|LOCUS_08360 42678 40933 gene locus_tag LOCUS_08370 42678 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 43715 42756 gene locus_tag LOCUS_08380 43715 42756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 44491 44075 gene locus_tag LOCUS_08390 44491 44075 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_08390 46660 44504 gene locus_tag LOCUS_08400 46660 44504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 50552 48864 gene locus_tag LOCUS_08410 50552 48864 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_08410 52020 50749 gene locus_tag LOCUS_08420 52020 50749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 53436 52156 gene locus_tag LOCUS_08430 53436 52156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 54375 53461 gene locus_tag LOCUS_08440 54375 53461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 56429 54399 gene locus_tag LOCUS_08450 56429 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 58250 56505 gene locus_tag LOCUS_08460 58250 56505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 60595 58268 gene locus_tag LOCUS_08470 60595 58268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 61696 60806 gene locus_tag LOCUS_08480 61696 60806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 62473 61721 gene locus_tag LOCUS_08490 62473 61721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 63174 62470 gene locus_tag LOCUS_08500 63174 62470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 63368 64426 gene locus_tag LOCUS_08510 63368 64426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 65904 64693 gene locus_tag LOCUS_08520 65904 64693 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_08520 67085 66264 gene locus_tag LOCUS_08530 67085 66264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 67290 67883 gene locus_tag LOCUS_08540 67290 67883 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770533.1 protein_id gnl|my_center|LOCUS_08540 69499 68609 gene locus_tag LOCUS_08550 69499 68609 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08550 70433 69528 gene locus_tag LOCUS_08560 70433 69528 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_08560 70654 70430 gene locus_tag LOCUS_08570 70654 70430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 72009 70771 gene locus_tag LOCUS_08580 gene xseA 72009 70771 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_08580 72162 73592 gene locus_tag LOCUS_08590 72162 73592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 75046 73634 gene locus_tag LOCUS_08600 75046 73634 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_08600 75672 75166 gene locus_tag LOCUS_08610 75672 75166 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_08610 77255 75699 gene locus_tag LOCUS_08620 gene accC 77255 75699 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_08620 78165 77557 gene locus_tag LOCUS_08630 78165 77557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence011 342 1 gene locus_tag LOCUS_08640 342 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1499 1311 gene locus_tag LOCUS_08650 1499 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1570 3318 gene locus_tag LOCUS_08660 gene dnaX 1570 3318 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_08660 3346 3660 gene locus_tag LOCUS_08670 3346 3660 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_08670 3688 4287 gene locus_tag LOCUS_08680 gene recR 3688 4287 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_08680 4394 7408 gene locus_tag LOCUS_08690 gene secA 4394 7408 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_08690 8885 7716 gene locus_tag LOCUS_08700 8885 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 9165 10730 gene locus_tag LOCUS_08710 9165 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10794 11744 gene locus_tag LOCUS_08720 gene nagZ 10794 11744 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 protein_id gnl|my_center|LOCUS_08720 11741 12940 gene locus_tag LOCUS_08730 11741 12940 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405142.1 protein_id gnl|my_center|LOCUS_08730 13128 12946 gene locus_tag LOCUS_08740 13128 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 13123 14223 gene locus_tag LOCUS_08750 13123 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 14701 15381 gene locus_tag LOCUS_08760 14701 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 16609 15554 gene locus_tag LOCUS_08770 16609 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 18048 16759 gene locus_tag LOCUS_08780 18048 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 19589 18369 gene locus_tag LOCUS_08790 19589 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 21016 19715 gene locus_tag LOCUS_08800 21016 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 22089 21013 gene locus_tag LOCUS_08810 22089 21013 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_08810 22508 22086 gene locus_tag LOCUS_08820 22508 22086 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_08820 23064 22549 gene locus_tag LOCUS_08830 23064 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 24340 23441 gene locus_tag LOCUS_08840 24340 23441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 24420 27077 gene locus_tag LOCUS_08850 24420 27077 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_08850 27182 28525 gene locus_tag LOCUS_08860 27182 28525 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_08860 28662 30032 gene locus_tag LOCUS_08870 28662 30032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 30166 32646 gene locus_tag LOCUS_08880 gene priA 30166 32646 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_08880 32774 33820 gene locus_tag LOCUS_08890 gene purM 32774 33820 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_08890 33852 35420 gene locus_tag LOCUS_08900 gene lnt 33852 35420 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_08900 35435 37681 gene locus_tag LOCUS_08910 35435 37681 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_08910 37709 38701 gene locus_tag LOCUS_08920 37709 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 38787 39899 gene locus_tag LOCUS_08930 gene wlbH 38787 39899 CDS product O-antigen biosynthesis protein WlbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929609.1 protein_id gnl|my_center|LOCUS_08930 39905 41179 gene locus_tag LOCUS_08940 39905 41179 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_08940 41176 42054 gene locus_tag LOCUS_08950 41176 42054 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_08950 44505 42103 gene locus_tag LOCUS_08960 44505 42103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 44723 44505 gene locus_tag LOCUS_08970 44723 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 45064 45501 gene locus_tag LOCUS_08980 gene mraZ 45064 45501 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_08980 45543 46487 gene locus_tag LOCUS_08990 gene rsmH 45543 46487 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_08990 46484 46879 gene locus_tag LOCUS_09000 46484 46879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 46939 49041 gene locus_tag LOCUS_09010 46939 49041 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_09010 49020 50588 gene locus_tag LOCUS_09020 49020 50588 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_09020 50631 52028 gene locus_tag LOCUS_09030 gene murF 50631 52028 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595957.1 protein_id gnl|my_center|LOCUS_09030 52088 53173 gene locus_tag LOCUS_09040 gene mraY 52088 53173 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_09040 53201 54640 gene locus_tag LOCUS_09050 gene murD 53201 54640 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_09050 54640 55797 gene locus_tag LOCUS_09060 gene ftsW 54640 55797 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_09060 55805 56911 gene locus_tag LOCUS_09070 gene murG 55805 56911 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_09070 56898 58313 gene locus_tag LOCUS_09080 gene murC 56898 58313 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_09080 58310 59395 gene locus_tag LOCUS_09090 58310 59395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 59392 60618 gene locus_tag LOCUS_09100 gene ftsA 59392 60618 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_09100 60671 61897 gene locus_tag LOCUS_09110 gene ftsZ 60671 61897 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_09110 62321 64762 gene locus_tag LOCUS_09120 62321 64762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 65366 66601 gene locus_tag LOCUS_09130 65366 66601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 66705 68840 gene locus_tag LOCUS_09140 gene recG 66705 68840 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_09140 68944 69276 gene locus_tag LOCUS_09150 68944 69276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 69318 70220 gene locus_tag LOCUS_09160 gene murB 69318 70220 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142314.1 protein_id gnl|my_center|LOCUS_09160 70492 76764 gene locus_tag LOCUS_09170 70492 76764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence012 917 555 gene locus_tag LOCUS_09180 917 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2119 3945 gene locus_tag LOCUS_09190 2119 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5639 4131 gene locus_tag LOCUS_09200 5639 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7435 5636 gene locus_tag LOCUS_09210 7435 5636 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940958.1 protein_id gnl|my_center|LOCUS_09210 7926 7489 gene locus_tag LOCUS_09220 7926 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7831 8019 gene locus_tag LOCUS_09230 7831 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8524 9978 gene locus_tag LOCUS_09240 8524 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9983 10882 gene locus_tag LOCUS_09250 gene ispE 9983 10882 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_09250 10946 11320 gene locus_tag LOCUS_09260 10946 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11463 11537 gene locus_tag LOCUS_t00110 11463 11537 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11571 12602 gene locus_tag LOCUS_09270 11571 12602 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_09270 12636 13358 gene locus_tag LOCUS_09280 12636 13358 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_09280 13598 14602 gene locus_tag LOCUS_09290 13598 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 15266 14736 gene locus_tag LOCUS_09300 15266 14736 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_09300 16862 15681 gene locus_tag LOCUS_09310 16862 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 19480 17333 gene locus_tag LOCUS_09320 19480 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 20570 19737 gene locus_tag LOCUS_09330 20570 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 21679 20633 gene locus_tag LOCUS_09340 21679 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 21997 23691 gene locus_tag LOCUS_09350 21997 23691 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_09350 23730 24941 gene locus_tag LOCUS_09360 gene mshG 23730 24941 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_09360 25116 25550 gene locus_tag LOCUS_09370 25116 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 25675 26112 gene locus_tag LOCUS_09380 25675 26112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 26131 27291 gene locus_tag LOCUS_09390 26131 27291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 27307 29007 gene locus_tag LOCUS_09400 27307 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 29004 29612 gene locus_tag LOCUS_09410 29004 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29614 30108 gene locus_tag LOCUS_09420 29614 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 30105 31421 gene locus_tag LOCUS_09430 30105 31421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 31474 32238 gene locus_tag LOCUS_09440 gene lptB 31474 32238 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_09440 32419 33384 gene locus_tag LOCUS_09450 32419 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 33353 34396 gene locus_tag LOCUS_09460 gene tsaD 33353 34396 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_09460 34450 35346 gene locus_tag LOCUS_09470 gene nadC 34450 35346 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_09470 35343 36332 gene locus_tag LOCUS_09480 35343 36332 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_09480 36438 36638 gene locus_tag LOCUS_09490 36438 36638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 37537 36710 gene locus_tag LOCUS_09500 37537 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 41691 37765 gene locus_tag LOCUS_09510 41691 37765 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170848661.1 protein_id gnl|my_center|LOCUS_09510 43096 41732 gene locus_tag LOCUS_09520 43096 41732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 44599 43112 gene locus_tag LOCUS_09530 gene gguA 44599 43112 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_09530 45675 44707 gene locus_tag LOCUS_09540 45675 44707 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_09540 45862 47370 gene locus_tag LOCUS_09550 45862 47370 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251170.1 protein_id gnl|my_center|LOCUS_09550 49093 47441 gene locus_tag LOCUS_09560 gene groL 49093 47441 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_09560 49437 49147 gene locus_tag LOCUS_09570 gene groES 49437 49147 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970827.1 protein_id gnl|my_center|LOCUS_09570 50483 49713 gene locus_tag LOCUS_09580 50483 49713 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_09580 50593 51156 gene locus_tag LOCUS_09590 50593 51156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 52731 51178 gene locus_tag LOCUS_09600 52731 51178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 54225 52921 gene locus_tag LOCUS_09610 54225 52921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 54484 54245 gene locus_tag LOCUS_09620 54484 54245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 55767 54622 gene locus_tag LOCUS_09630 55767 54622 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_09630 56649 55864 gene locus_tag LOCUS_09640 56649 55864 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_09640 57525 56665 gene locus_tag LOCUS_09650 57525 56665 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_09650 59071 57815 gene locus_tag LOCUS_09660 59071 57815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 59757 59101 gene locus_tag LOCUS_09670 59757 59101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 60992 59781 gene locus_tag LOCUS_09680 60992 59781 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_09680 61110 61535 gene locus_tag LOCUS_09690 61110 61535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 61552 62652 gene locus_tag LOCUS_09700 gene mutY 61552 62652 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_09700 62919 62686 gene locus_tag LOCUS_09710 62919 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 63009 65249 gene locus_tag LOCUS_09720 63009 65249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 65543 65265 gene locus_tag LOCUS_09730 65543 65265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 66781 65618 gene locus_tag LOCUS_09740 66781 65618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 67626 66829 gene locus_tag LOCUS_09750 67626 66829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 69116 67869 gene locus_tag LOCUS_09760 69116 67869 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_09760 69688 69176 gene locus_tag LOCUS_09770 69688 69176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 70394 69909 gene locus_tag LOCUS_09780 70394 69909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 71460 70462 gene locus_tag LOCUS_09790 71460 70462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 72058 73119 gene locus_tag LOCUS_09800 72058 73119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 73289 74821 gene locus_tag LOCUS_09810 73289 74821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 75289 76431 gene locus_tag LOCUS_09820 75289 76431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence013 129 1016 gene locus_tag LOCUS_09830 gene speB 129 1016 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_09830 1150 2352 gene locus_tag LOCUS_09840 1150 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2349 5774 gene locus_tag LOCUS_09850 gene mfd 2349 5774 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_09850 6105 7865 gene locus_tag LOCUS_09860 6105 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7881 9314 gene locus_tag LOCUS_09870 7881 9314 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_09870 9622 10686 gene locus_tag LOCUS_09880 gene hflX 9622 10686 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_09880 10809 11294 gene locus_tag LOCUS_09890 10809 11294 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_09890 11617 12369 gene locus_tag LOCUS_09900 gene bshB1 11617 12369 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_09900 12404 13387 gene locus_tag LOCUS_09910 gene ilvC 12404 13387 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_09910 13500 14615 gene locus_tag LOCUS_09920 13500 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16119 14902 gene locus_tag LOCUS_09930 16119 14902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_09930 16904 16116 gene locus_tag LOCUS_09940 16904 16116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_09940 18304 16904 gene locus_tag LOCUS_09950 18304 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 18637 18368 gene locus_tag LOCUS_09960 18637 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 19706 18687 gene locus_tag LOCUS_09970 19706 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 21475 20009 gene locus_tag LOCUS_09980 21475 20009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_09980 22179 21472 gene locus_tag LOCUS_09990 22179 21472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_09990 22791 25070 gene locus_tag LOCUS_10000 22791 25070 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_10000 25299 26288 gene locus_tag LOCUS_10010 25299 26288 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_10010 27453 26545 gene locus_tag LOCUS_10020 27453 26545 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_10020 27873 29495 gene locus_tag LOCUS_10030 27873 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 30453 29599 gene locus_tag LOCUS_10040 30453 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 30980 30456 gene locus_tag LOCUS_10050 30980 30456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 31714 31271 gene locus_tag LOCUS_10060 31714 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 32105 32497 gene locus_tag LOCUS_10070 32105 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 33034 32579 gene locus_tag LOCUS_10080 33034 32579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 33922 33242 gene locus_tag LOCUS_10090 33922 33242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 34707 33952 gene locus_tag LOCUS_10100 34707 33952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021857.1 protein_id gnl|my_center|LOCUS_10100 36636 34804 gene locus_tag LOCUS_10110 36636 34804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 37422 36838 gene locus_tag LOCUS_10120 37422 36838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 37982 37419 gene locus_tag LOCUS_10130 37982 37419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 38466 37972 gene locus_tag LOCUS_10140 38466 37972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 39569 38427 gene locus_tag LOCUS_10150 39569 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 42703 39716 gene locus_tag LOCUS_10160 42703 39716 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_10160 43269 44324 gene locus_tag LOCUS_10170 43269 44324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 44874 46229 gene locus_tag LOCUS_10180 gene gdhA 44874 46229 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_10180 46323 48422 gene locus_tag LOCUS_10190 46323 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 48419 49768 gene locus_tag LOCUS_10200 48419 49768 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_10200 50143 51810 gene locus_tag LOCUS_10210 50143 51810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 51817 53262 gene locus_tag LOCUS_10220 51817 53262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 55043 53322 gene locus_tag LOCUS_10230 55043 53322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 55691 55233 gene locus_tag LOCUS_10240 55691 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 56657 55707 gene locus_tag LOCUS_10250 56657 55707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 57098 56874 gene locus_tag LOCUS_10260 57098 56874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 57994 57095 gene locus_tag LOCUS_10270 57994 57095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 58613 58155 gene locus_tag LOCUS_10280 58613 58155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 59580 58627 gene locus_tag LOCUS_10290 59580 58627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 60485 61090 gene locus_tag LOCUS_10300 60485 61090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 61190 62110 gene locus_tag LOCUS_10310 61190 62110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 62310 65066 gene locus_tag LOCUS_10320 62310 65066 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929325.1 protein_id gnl|my_center|LOCUS_10320 65876 65622 gene locus_tag LOCUS_10330 65876 65622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 66287 66108 gene locus_tag LOCUS_10340 66287 66108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 66819 67256 gene locus_tag LOCUS_10350 66819 67256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 67401 67739 gene locus_tag LOCUS_10360 67401 67739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 67779 68132 gene locus_tag LOCUS_10370 67779 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 68505 69194 gene locus_tag LOCUS_10380 68505 69194 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_10380 69456 71051 gene locus_tag LOCUS_10390 69456 71051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 71097 71411 gene locus_tag LOCUS_10400 71097 71411 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_10400 71707 71504 gene locus_tag LOCUS_10410 71707 71504 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_10410 72507 72007 gene locus_tag LOCUS_10420 72507 72007 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_10420 73206 73409 gene locus_tag LOCUS_10430 73206 73409 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence014 671 3331 gene locus_tag LOCUS_10440 671 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3655 3930 gene locus_tag LOCUS_10450 3655 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6710 3954 gene locus_tag LOCUS_10460 6710 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7333 7163 gene locus_tag LOCUS_10470 7333 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 8357 7836 gene locus_tag LOCUS_10480 8357 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 9185 8400 gene locus_tag LOCUS_10490 9185 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 9516 11234 gene locus_tag LOCUS_10500 9516 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 11516 11677 gene locus_tag LOCUS_10510 11516 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 11812 12198 gene locus_tag LOCUS_10520 11812 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 14720 12330 gene locus_tag LOCUS_10530 14720 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 15574 14972 gene locus_tag LOCUS_10540 15574 14972 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_10540 16065 15571 gene locus_tag LOCUS_10550 16065 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 17662 16241 gene locus_tag LOCUS_10560 17662 16241 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_10560 18277 17861 gene locus_tag LOCUS_10570 18277 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 19101 18397 gene locus_tag LOCUS_10580 19101 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 20707 19175 gene locus_tag LOCUS_10590 20707 19175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 22805 21105 gene locus_tag LOCUS_10600 22805 21105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 23045 25525 gene locus_tag LOCUS_10610 23045 25525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_10610 25785 25708 gene locus_tag LOCUS_t00120 25785 25708 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26347 25817 gene locus_tag LOCUS_10620 26347 25817 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_10620 26646 26374 gene locus_tag LOCUS_10630 26646 26374 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_10630 27133 26651 gene locus_tag LOCUS_10640 27133 26651 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_10640 28994 27213 gene locus_tag LOCUS_10650 28994 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 31450 29027 gene locus_tag LOCUS_10660 31450 29027 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_10660 32987 31551 gene locus_tag LOCUS_10670 32987 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 33718 33140 gene locus_tag LOCUS_10680 33718 33140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 34206 33715 gene locus_tag LOCUS_10690 34206 33715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 35095 34445 gene locus_tag LOCUS_10700 35095 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 35701 35234 gene locus_tag LOCUS_10710 35701 35234 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582556.1 protein_id gnl|my_center|LOCUS_10710 35892 35701 gene locus_tag LOCUS_10720 gene rpsU 35892 35701 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_10720 36156 36824 gene locus_tag LOCUS_10730 36156 36824 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_10730 36821 37828 gene locus_tag LOCUS_10740 36821 37828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 38940 37888 gene locus_tag LOCUS_10750 38940 37888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 44660 39090 gene locus_tag LOCUS_10760 44660 39090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 45554 44706 gene locus_tag LOCUS_10770 45554 44706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 45835 46071 gene locus_tag LOCUS_10780 45835 46071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 47852 46026 gene locus_tag LOCUS_10790 47852 46026 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_10790 48932 47967 gene locus_tag LOCUS_10800 48932 47967 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584104.1 protein_id gnl|my_center|LOCUS_10800 49982 48990 gene locus_tag LOCUS_10810 49982 48990 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_10810 51296 50085 gene locus_tag LOCUS_10820 gene aroC 51296 50085 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_10820 53347 51302 gene locus_tag LOCUS_10830 53347 51302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 53605 55584 gene locus_tag LOCUS_10840 53605 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 55844 56407 gene locus_tag LOCUS_10850 55844 56407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 56935 56435 gene locus_tag LOCUS_10860 gene moaC 56935 56435 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_10860 57197 59440 gene locus_tag LOCUS_10870 57197 59440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 59957 62302 gene locus_tag LOCUS_10880 59957 62302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 62627 63016 gene locus_tag LOCUS_10890 62627 63016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 63240 63515 gene locus_tag LOCUS_10900 63240 63515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 64031 64741 gene locus_tag LOCUS_10910 64031 64741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_10910 64738 66654 gene locus_tag LOCUS_10920 64738 66654 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_10920 66654 67391 gene locus_tag LOCUS_10930 66654 67391 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_10930 67642 68646 gene locus_tag LOCUS_10940 gene mtnA 67642 68646 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_10940 71537 68679 gene locus_tag LOCUS_10950 71537 68679 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528450.1 protein_id gnl|my_center|LOCUS_10950 72179 71595 gene locus_tag LOCUS_10960 gene pgsA 72179 71595 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524157.1 protein_id gnl|my_center|LOCUS_10960 72672 72268 gene locus_tag LOCUS_10970 72672 72268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence015 1905 265 gene locus_tag LOCUS_10980 gene pckA 1905 265 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_10980 3119 1902 gene locus_tag LOCUS_10990 3119 1902 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_10990 4826 3750 gene locus_tag LOCUS_11000 4826 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7031 5337 gene locus_tag LOCUS_11010 7031 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9374 7368 gene locus_tag LOCUS_11020 gene ligA 9374 7368 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_11020 9681 10436 gene locus_tag LOCUS_11030 gene tolQ 9681 10436 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_11030 10405 10839 gene locus_tag LOCUS_11040 gene tolR 10405 10839 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_11040 10843 11544 gene locus_tag LOCUS_11050 10843 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 11558 12853 gene locus_tag LOCUS_11060 gene tolB 11558 12853 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_11060 13190 13705 gene locus_tag LOCUS_11070 gene pal 13190 13705 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940363.1 protein_id gnl|my_center|LOCUS_11070 13816 14559 gene locus_tag LOCUS_11080 gene ybgF 13816 14559 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940701.1 protein_id gnl|my_center|LOCUS_11080 14566 15273 gene locus_tag LOCUS_11090 14566 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 15406 15478 gene locus_tag LOCUS_t00130 15406 15478 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15564 16766 gene locus_tag LOCUS_11100 gene tuf 15564 16766 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_11100 17053 17127 gene locus_tag LOCUS_t00140 17053 17127 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17153 17344 gene locus_tag LOCUS_11110 17153 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 17341 17877 gene locus_tag LOCUS_11120 gene nusG 17341 17877 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_11120 17901 18326 gene locus_tag LOCUS_11130 gene rplK 17901 18326 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_11130 18440 19144 gene locus_tag LOCUS_11140 gene rplA 18440 19144 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989382.1 protein_id gnl|my_center|LOCUS_11140 19196 19771 gene locus_tag LOCUS_11150 gene rplJ 19196 19771 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_11150 19842 20225 gene locus_tag LOCUS_11160 gene rplL 19842 20225 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_11160 20343 24119 gene locus_tag LOCUS_11170 gene rpoB 20343 24119 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_11170 24206 28297 gene locus_tag LOCUS_11180 gene rpoC 24206 28297 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_11180 28406 28780 gene locus_tag LOCUS_11190 gene rpsL 28406 28780 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_11190 28840 29310 gene locus_tag LOCUS_11200 gene rpsG 28840 29310 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624018.1 protein_id gnl|my_center|LOCUS_11200 29583 31676 gene locus_tag LOCUS_11210 gene fusA 29583 31676 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11210 31872 32183 gene locus_tag LOCUS_11220 gene rpsJ 31872 32183 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_11220 32202 32834 gene locus_tag LOCUS_11230 gene rplC 32202 32834 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_11230 32882 33514 gene locus_tag LOCUS_11240 gene rplD 32882 33514 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_11240 33511 33804 gene locus_tag LOCUS_11250 gene rplW 33511 33804 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_11250 33846 34670 gene locus_tag LOCUS_11260 gene rplB 33846 34670 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_11260 34728 35021 gene locus_tag LOCUS_11270 gene rpsS 34728 35021 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_11270 35058 35489 gene locus_tag LOCUS_11280 gene rplV 35058 35489 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727673.1 protein_id gnl|my_center|LOCUS_11280 35543 36328 gene locus_tag LOCUS_11290 gene rpsC 35543 36328 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_11290 36394 36813 gene locus_tag LOCUS_11300 gene rplP 36394 36813 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_11300 36830 37063 gene locus_tag LOCUS_11310 36830 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 37063 37350 gene locus_tag LOCUS_11320 gene rpsQ 37063 37350 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_11320 37428 37796 gene locus_tag LOCUS_11330 gene rplN 37428 37796 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_11330 37830 38054 gene locus_tag LOCUS_11340 37830 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 38073 38615 gene locus_tag LOCUS_11350 gene rplE 38073 38615 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143903.1 protein_id gnl|my_center|LOCUS_11350 38649 38834 gene locus_tag LOCUS_11360 38649 38834 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_11360 38869 39267 gene locus_tag LOCUS_11370 gene rpsH 38869 39267 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_11370 39280 39816 gene locus_tag LOCUS_11380 gene rplF 39280 39816 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_11380 39871 40230 gene locus_tag LOCUS_11390 gene rplR 39871 40230 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_11390 40303 40854 gene locus_tag LOCUS_11400 gene rpsE 40303 40854 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_11400 40861 41043 gene locus_tag LOCUS_11410 gene rpmD 40861 41043 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869911.1 protein_id gnl|my_center|LOCUS_11410 41090 41572 gene locus_tag LOCUS_11420 gene rplO 41090 41572 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_11420 41629 42942 gene locus_tag LOCUS_11430 gene secY 41629 42942 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_11430 42966 43529 gene locus_tag LOCUS_11440 42966 43529 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_11440 43526 44284 gene locus_tag LOCUS_11450 gene map 43526 44284 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_11450 44244 44504 gene locus_tag LOCUS_11460 gene infA 44244 44504 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_11460 44737 45111 gene locus_tag LOCUS_11470 gene rpsM 44737 45111 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_11470 45181 45573 gene locus_tag LOCUS_11480 gene rpsK 45181 45573 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_11480 45638 46267 gene locus_tag LOCUS_11490 gene rpsD 45638 46267 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_11490 46298 47305 gene locus_tag LOCUS_11500 46298 47305 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_11500 47331 47798 gene locus_tag LOCUS_11510 47331 47798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 47991 48302 gene locus_tag LOCUS_11520 47991 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 48304 49482 gene locus_tag LOCUS_11530 48304 49482 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_11530 49501 50163 gene locus_tag LOCUS_11540 gene deoC 49501 50163 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_11540 52373 50199 gene locus_tag LOCUS_11550 52373 50199 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_11550 52529 53746 gene locus_tag LOCUS_11560 gene tyrS 52529 53746 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_11560 53846 54874 gene locus_tag LOCUS_11570 gene prfB 53846 54874 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_11570 54906 55262 gene locus_tag LOCUS_11580 54906 55262 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_11580 55698 56093 gene locus_tag LOCUS_11590 55698 56093 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_11590 57358 56090 gene locus_tag LOCUS_11600 gene miaB 57358 56090 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_11600 59027 57648 gene locus_tag LOCUS_11610 gene mtaB 59027 57648 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_11610 61765 59024 gene locus_tag LOCUS_11620 61765 59024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 62484 61933 gene locus_tag LOCUS_11630 gene def 62484 61933 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_11630 62736 62999 gene locus_tag LOCUS_11640 62736 62999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 63049 66654 gene locus_tag LOCUS_11650 gene nifJ 63049 66654 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_11650 66717 67715 gene locus_tag LOCUS_11660 66717 67715 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_11660 67889 67966 gene locus_tag LOCUS_t00150 67889 67966 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 68013 68576 gene locus_tag LOCUS_11670 68013 68576 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence016 1524 871 gene locus_tag LOCUS_11680 1524 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2125 1481 gene locus_tag LOCUS_11690 2125 1481 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_11690 2431 3768 gene locus_tag LOCUS_11700 gene pabB 2431 3768 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_11700 3795 4673 gene locus_tag LOCUS_11710 3795 4673 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_11710 4832 5650 gene locus_tag LOCUS_11720 4832 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5984 6718 gene locus_tag LOCUS_11730 5984 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6785 8065 gene locus_tag LOCUS_11740 6785 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 9048 8314 gene locus_tag LOCUS_11750 9048 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 10006 9248 gene locus_tag LOCUS_11760 10006 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 10649 10071 gene locus_tag LOCUS_11770 gene nadD 10649 10071 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922150.1 protein_id gnl|my_center|LOCUS_11770 11471 10653 gene locus_tag LOCUS_11780 11471 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12271 11630 gene locus_tag LOCUS_11790 12271 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13094 12438 gene locus_tag LOCUS_11800 13094 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 14521 13130 gene locus_tag LOCUS_11810 gene rimO 14521 13130 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_11810 15262 14594 gene locus_tag LOCUS_11820 15262 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 17674 15374 gene locus_tag LOCUS_11830 17674 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 18089 18736 gene locus_tag LOCUS_11840 18089 18736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 22095 18820 gene locus_tag LOCUS_11850 22095 18820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 23300 22332 gene locus_tag LOCUS_11860 23300 22332 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141968.1 protein_id gnl|my_center|LOCUS_11860 27098 23418 gene locus_tag LOCUS_11870 27098 23418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 28752 27379 gene locus_tag LOCUS_11880 28752 27379 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_11880 30979 28766 gene locus_tag LOCUS_11890 30979 28766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 32500 31121 gene locus_tag LOCUS_11900 32500 31121 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763445.1 protein_id gnl|my_center|LOCUS_11900 33062 32625 gene locus_tag LOCUS_11910 gene aroQ 33062 32625 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_11910 33196 33059 gene locus_tag LOCUS_11920 33196 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 34302 33193 gene locus_tag LOCUS_11930 gene aroB 34302 33193 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_11930 34942 34364 gene locus_tag LOCUS_11940 34942 34364 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942669.1 protein_id gnl|my_center|LOCUS_11940 35412 34939 gene locus_tag LOCUS_11950 35412 34939 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925080.1 protein_id gnl|my_center|LOCUS_11950 35883 35437 gene locus_tag LOCUS_11960 35883 35437 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868940.1 protein_id gnl|my_center|LOCUS_11960 36770 35880 gene locus_tag LOCUS_11970 gene aroE 36770 35880 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933469.1 protein_id gnl|my_center|LOCUS_11970 38208 36811 gene locus_tag LOCUS_11980 gene aroA 38208 36811 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_11980 39235 38219 gene locus_tag LOCUS_11990 gene aroF 39235 38219 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_11990 41026 39287 gene locus_tag LOCUS_12000 gene argS 41026 39287 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_12000 41849 41043 gene locus_tag LOCUS_12010 gene trpA 41849 41043 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392849.1 protein_id gnl|my_center|LOCUS_12010 43323 42043 gene locus_tag LOCUS_12020 gene trpB 43323 42043 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173169.1 protein_id gnl|my_center|LOCUS_12020 43974 43333 gene locus_tag LOCUS_12030 43974 43333 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_12030 44805 43978 gene locus_tag LOCUS_12040 44805 43978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 46070 44805 gene locus_tag LOCUS_12050 46070 44805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_12050 47217 46201 gene locus_tag LOCUS_12060 gene trpD 47217 46201 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_12060 47891 47325 gene locus_tag LOCUS_12070 47891 47325 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_12070 49372 47888 gene locus_tag LOCUS_12080 gene trpE 49372 47888 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826697.1 protein_id gnl|my_center|LOCUS_12080 50333 49527 gene locus_tag LOCUS_12090 gene dapF 50333 49527 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064712.1 protein_id gnl|my_center|LOCUS_12090 51976 50747 gene locus_tag LOCUS_12100 51976 50747 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_12100 53791 52592 gene locus_tag LOCUS_12110 gene dinB 53791 52592 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_12110 54285 54037 gene locus_tag LOCUS_12120 54285 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 54926 54417 gene locus_tag LOCUS_12130 54926 54417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 56261 55509 gene locus_tag LOCUS_12140 gene larB 56261 55509 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_12140 57274 56426 gene locus_tag LOCUS_12150 gene larE 57274 56426 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_12150 57945 57463 gene locus_tag LOCUS_12160 57945 57463 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941845.1 protein_id gnl|my_center|LOCUS_12160 60131 58158 gene locus_tag LOCUS_12170 60131 58158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 60613 60203 gene locus_tag LOCUS_12180 60613 60203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 61361 60675 gene locus_tag LOCUS_12190 gene nth 61361 60675 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12190 61645 62856 gene locus_tag LOCUS_12200 gene alr 61645 62856 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12200 63218 62904 gene locus_tag LOCUS_12210 63218 62904 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 protein_id gnl|my_center|LOCUS_12210 64502 63435 gene locus_tag LOCUS_12220 gene apbC 64502 63435 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_12220 66004 64955 gene locus_tag LOCUS_12230 66004 64955 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_12230 67860 66007 gene locus_tag LOCUS_12240 67860 66007 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_12240 68109 67939 gene locus_tag LOCUS_12250 68109 67939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 68378 68052 gene locus_tag LOCUS_12260 68378 68052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 68653 69099 gene locus_tag LOCUS_12270 68653 69099 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558152.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence017 810 655 gene locus_tag LOCUS_12280 810 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1659 2360 gene locus_tag LOCUS_12290 1659 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2764 3423 gene locus_tag LOCUS_12300 2764 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3563 4192 gene locus_tag LOCUS_12310 3563 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4452 5696 gene locus_tag LOCUS_12320 4452 5696 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_12320 5714 6388 gene locus_tag LOCUS_12330 5714 6388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_12330 6423 7580 gene locus_tag LOCUS_12340 6423 7580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_12340 7593 8762 gene locus_tag LOCUS_12350 7593 8762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_12350 8894 9190 gene locus_tag LOCUS_12360 8894 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10171 9209 gene locus_tag LOCUS_12370 10171 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 10453 11031 gene locus_tag LOCUS_12380 10453 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 11098 11616 gene locus_tag LOCUS_12390 11098 11616 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_12390 11648 11896 gene locus_tag LOCUS_12400 11648 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 12012 13505 gene locus_tag LOCUS_12410 12012 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 14361 13543 gene locus_tag LOCUS_12420 14361 13543 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131999511.1 protein_id gnl|my_center|LOCUS_12420 15713 14394 gene locus_tag LOCUS_12430 15713 14394 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_12430 17779 16067 gene locus_tag LOCUS_12440 17779 16067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 18449 17805 gene locus_tag LOCUS_12450 gene rpe 18449 17805 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_12450 19972 18599 gene locus_tag LOCUS_12460 19972 18599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_12460 20520 20912 gene locus_tag LOCUS_12470 20520 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 21206 22351 gene locus_tag LOCUS_12480 21206 22351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 23833 22526 gene locus_tag LOCUS_12490 23833 22526 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_12490 25203 23830 gene locus_tag LOCUS_12500 25203 23830 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_12500 26544 25351 gene locus_tag LOCUS_12510 26544 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 27788 26541 gene locus_tag LOCUS_12520 27788 26541 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_12520 28465 27800 gene locus_tag LOCUS_12530 28465 27800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786282.1 protein_id gnl|my_center|LOCUS_12530 29753 28509 gene locus_tag LOCUS_12540 29753 28509 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107845.1 protein_id gnl|my_center|LOCUS_12540 30790 31440 gene locus_tag LOCUS_12550 30790 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 31555 32280 gene locus_tag LOCUS_12560 31555 32280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080310.1 protein_id gnl|my_center|LOCUS_12560 32526 34238 gene locus_tag LOCUS_12570 32526 34238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 34207 35610 gene locus_tag LOCUS_12580 34207 35610 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080304.1 protein_id gnl|my_center|LOCUS_12580 35778 36320 gene locus_tag LOCUS_12590 35778 36320 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815410.1 protein_id gnl|my_center|LOCUS_12590 36424 38451 gene locus_tag LOCUS_12600 36424 38451 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_12600 39721 38522 gene locus_tag LOCUS_12610 39721 38522 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_12610 40955 39711 gene locus_tag LOCUS_12620 40955 39711 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_12620 42132 40924 gene locus_tag LOCUS_12630 42132 40924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 45851 42129 gene locus_tag LOCUS_12640 45851 42129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 46925 45867 gene locus_tag LOCUS_12650 46925 45867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 47392 46922 gene locus_tag LOCUS_12660 47392 46922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 50678 47394 gene locus_tag LOCUS_12670 50678 47394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 52856 51363 gene locus_tag LOCUS_12680 52856 51363 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_12680 53957 52881 gene locus_tag LOCUS_12690 53957 52881 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_12690 54832 53954 gene locus_tag LOCUS_12700 54832 53954 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_12700 55680 54859 gene locus_tag LOCUS_12710 gene menB 55680 54859 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_12710 56562 55726 gene locus_tag LOCUS_12720 gene menH 56562 55726 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_12720 58331 56562 gene locus_tag LOCUS_12730 gene menD 58331 56562 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_12730 59713 58328 gene locus_tag LOCUS_12740 59713 58328 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_12740 60685 60029 gene locus_tag LOCUS_12750 gene phoU 60685 60029 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_12750 61525 60701 gene locus_tag LOCUS_12760 gene pstB 61525 60701 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_12760 62510 61515 gene locus_tag LOCUS_12770 gene pstA 62510 61515 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962534.1 protein_id gnl|my_center|LOCUS_12770 63526 62507 gene locus_tag LOCUS_12780 63526 62507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 64380 63523 gene locus_tag LOCUS_12790 64380 63523 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_12790 65449 64421 gene locus_tag LOCUS_12800 65449 64421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 66642 65614 gene locus_tag LOCUS_12810 66642 65614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence018 871 89 gene locus_tag LOCUS_12820 871 89 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_12820 2018 1149 gene locus_tag LOCUS_12830 2018 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2803 2015 gene locus_tag LOCUS_12840 2803 2015 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_12840 3556 5247 gene locus_tag LOCUS_12850 3556 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875631.1 protein_id gnl|my_center|LOCUS_12850 6130 5624 gene locus_tag LOCUS_12860 6130 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_12860 6556 6146 gene locus_tag LOCUS_12870 6556 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7844 6717 gene locus_tag LOCUS_12880 7844 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8890 8174 gene locus_tag LOCUS_12890 8890 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9526 9753 gene locus_tag LOCUS_12900 9526 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 10159 9938 gene locus_tag LOCUS_12910 10159 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10594 12102 gene locus_tag LOCUS_12920 10594 12102 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_12920 12152 12796 gene locus_tag LOCUS_12930 12152 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 12811 13494 gene locus_tag LOCUS_12940 12811 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13491 15092 gene locus_tag LOCUS_12950 13491 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 15152 15979 gene locus_tag LOCUS_12960 15152 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 16089 17162 gene locus_tag LOCUS_12970 16089 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17243 17614 gene locus_tag LOCUS_12980 17243 17614 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_12980 17640 18824 gene locus_tag LOCUS_12990 17640 18824 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_12990 18939 20018 gene locus_tag LOCUS_13000 18939 20018 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_13000 20018 21274 gene locus_tag LOCUS_13010 20018 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 21306 21378 gene locus_tag LOCUS_t00160 21306 21378 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21591 22262 gene locus_tag LOCUS_13020 21591 22262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 22259 23632 gene locus_tag LOCUS_13030 22259 23632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 23629 24615 gene locus_tag LOCUS_13040 23629 24615 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_13040 24618 25556 gene locus_tag LOCUS_13050 24618 25556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_13050 25553 26497 gene locus_tag LOCUS_13060 25553 26497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_13060 26693 27811 gene locus_tag LOCUS_13070 26693 27811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_13070 27811 28926 gene locus_tag LOCUS_13080 27811 28926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_13080 30551 29091 gene locus_tag LOCUS_13090 30551 29091 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_13090 31616 30858 gene locus_tag LOCUS_13100 31616 30858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 31743 32483 gene locus_tag LOCUS_13110 31743 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 32488 33378 gene locus_tag LOCUS_13120 32488 33378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 33382 34191 gene locus_tag LOCUS_13130 33382 34191 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13130 35063 34827 gene locus_tag LOCUS_13140 35063 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 36876 35506 gene locus_tag LOCUS_13150 gene gnfM 36876 35506 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_13150 37250 37588 gene locus_tag LOCUS_13160 37250 37588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 38037 37744 gene locus_tag LOCUS_13170 38037 37744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 38982 38047 gene locus_tag LOCUS_13180 gene pbpG 38982 38047 CDS product D-alanyl-D-alanine endopeptidase PBP7/8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121158.1 protein_id gnl|my_center|LOCUS_13180 39931 39155 gene locus_tag LOCUS_13190 39931 39155 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_13190 40723 40124 gene locus_tag LOCUS_13200 40723 40124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 41538 40720 gene locus_tag LOCUS_13210 41538 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 42160 41540 gene locus_tag LOCUS_13220 42160 41540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 42844 42170 gene locus_tag LOCUS_13230 42844 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_13230 44206 43319 gene locus_tag LOCUS_13240 44206 43319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582975.1 protein_id gnl|my_center|LOCUS_13240 45338 44313 gene locus_tag LOCUS_13250 45338 44313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 48001 45362 gene locus_tag LOCUS_13260 48001 45362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 49143 48154 gene locus_tag LOCUS_13270 49143 48154 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869082.1 protein_id gnl|my_center|LOCUS_13270 50477 49143 gene locus_tag LOCUS_13280 50477 49143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 51760 50546 gene locus_tag LOCUS_13290 51760 50546 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_13290 52275 52883 gene locus_tag LOCUS_13300 52275 52883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 53719 52997 gene locus_tag LOCUS_13310 53719 52997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 55203 54217 gene locus_tag LOCUS_13320 55203 54217 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_13320 56400 55207 gene locus_tag LOCUS_13330 gene larC 56400 55207 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_13330 57442 56405 gene locus_tag LOCUS_13340 gene dusB 57442 56405 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_13340 57589 58293 gene locus_tag LOCUS_13350 57589 58293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 58365 60908 gene locus_tag LOCUS_13360 58365 60908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 61545 61102 gene locus_tag LOCUS_13370 61545 61102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 61886 61575 gene locus_tag LOCUS_13380 61886 61575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 62408 62115 gene locus_tag LOCUS_13390 62408 62115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 63151 62405 gene locus_tag LOCUS_13400 gene purQ 63151 62405 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_13400 63543 63148 gene locus_tag LOCUS_13410 63543 63148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 64070 63567 gene locus_tag LOCUS_13420 64070 63567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 64317 64105 gene locus_tag LOCUS_13430 64317 64105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence019 3102 250 gene locus_tag LOCUS_13440 3102 250 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_13440 3797 3288 gene locus_tag LOCUS_13450 3797 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5528 3987 gene locus_tag LOCUS_13460 5528 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 6811 5696 gene locus_tag LOCUS_13470 gene dnaN 6811 5696 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_13470 8572 7139 gene locus_tag LOCUS_13480 gene dnaA 8572 7139 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_13480 11944 9272 gene locus_tag LOCUS_13490 11944 9272 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_13490 12293 12003 gene locus_tag LOCUS_13500 gene cas2 12293 12003 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546007.1 protein_id gnl|my_center|LOCUS_13500 14039 12312 gene locus_tag LOCUS_13510 gene cas1 14039 12312 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_13510 14318 15206 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtcagccgatcaggagtgcgccgaattcggcgcc 19785 15592 gene locus_tag LOCUS_13520 19785 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21185 19986 gene locus_tag LOCUS_13530 21185 19986 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925262.1 protein_id gnl|my_center|LOCUS_13530 21184 21420 gene locus_tag LOCUS_13540 21184 21420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 22521 21424 gene locus_tag LOCUS_13550 gene nadA 22521 21424 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_13550 23062 22670 gene locus_tag LOCUS_13560 gene nifU 23062 22670 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_13560 24683 23190 gene locus_tag LOCUS_13570 24683 23190 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_13570 26142 24673 gene locus_tag LOCUS_13580 26142 24673 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_13580 28252 26336 gene locus_tag LOCUS_13590 gene nuoL 28252 26336 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_13590 28751 28437 gene locus_tag LOCUS_13600 gene nuoK 28751 28437 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_13600 29319 28762 gene locus_tag LOCUS_13610 29319 28762 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_13610 30367 29324 gene locus_tag LOCUS_13620 gene nuoH 30367 29324 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_13620 30757 30401 gene locus_tag LOCUS_13630 30757 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 31428 31102 gene locus_tag LOCUS_13640 31428 31102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 31887 31447 gene locus_tag LOCUS_13650 31887 31447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 32619 32056 gene locus_tag LOCUS_13660 32619 32056 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_13660 33966 32623 gene locus_tag LOCUS_13670 33966 32623 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_13670 35603 33939 gene locus_tag LOCUS_13680 35603 33939 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_13680 36372 35707 gene locus_tag LOCUS_13690 36372 35707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 37631 36429 gene locus_tag LOCUS_13700 gene hybB 37631 36429 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815882.1 protein_id gnl|my_center|LOCUS_13700 38437 37628 gene locus_tag LOCUS_13710 38437 37628 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_13710 39335 38649 gene locus_tag LOCUS_13720 39335 38649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 39517 39687 gene locus_tag LOCUS_13730 39517 39687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 40041 41075 gene locus_tag LOCUS_13740 40041 41075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 41431 41234 gene locus_tag LOCUS_13750 41431 41234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 41333 41620 gene locus_tag LOCUS_13760 41333 41620 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_13760 44765 43401 gene locus_tag LOCUS_13770 44765 43401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 45856 44765 gene locus_tag LOCUS_13780 45856 44765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 46689 45853 gene locus_tag LOCUS_13790 46689 45853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 48429 46699 gene locus_tag LOCUS_13800 48429 46699 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249724.1 protein_id gnl|my_center|LOCUS_13800 49481 48627 gene locus_tag LOCUS_13810 49481 48627 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_13810 50257 49478 gene locus_tag LOCUS_13820 gene soj 50257 49478 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_13820 50991 50317 gene locus_tag LOCUS_13830 50991 50317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 52955 51111 gene locus_tag LOCUS_13840 gene mnmG 52955 51111 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402846.1 protein_id gnl|my_center|LOCUS_13840 54526 53045 gene locus_tag LOCUS_13850 gene mnmE 54526 53045 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831768.1 protein_id gnl|my_center|LOCUS_13850 56301 54535 gene locus_tag LOCUS_13860 gene yidC 56301 54535 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_13860 56720 57022 gene locus_tag LOCUS_13870 56720 57022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 57484 57074 gene locus_tag LOCUS_13880 gene rnpA 57484 57074 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256030.1 protein_id gnl|my_center|LOCUS_13880 57654 57505 gene locus_tag LOCUS_13890 gene rpmH 57654 57505 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100258.1 protein_id gnl|my_center|LOCUS_13890 57803 58516 gene locus_tag LOCUS_13900 57803 58516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 58914 58555 gene locus_tag LOCUS_13910 58914 58555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 59421 59942 gene locus_tag LOCUS_13920 59421 59942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 60208 62061 gene locus_tag LOCUS_13930 60208 62061 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_13930 62063 62380 gene locus_tag LOCUS_13940 62063 62380 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence020 316 750 gene locus_tag LOCUS_13950 316 750 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248960.1 protein_id gnl|my_center|LOCUS_13950 775 2715 gene locus_tag LOCUS_13960 775 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3643 2972 gene locus_tag LOCUS_13970 3643 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4122 3640 gene locus_tag LOCUS_13980 4122 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4737 4135 gene locus_tag LOCUS_13990 4737 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5009 6937 gene locus_tag LOCUS_14000 5009 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7078 7163 gene locus_tag LOCUS_t00170 7078 7163 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7853 12919 gene locus_tag LOCUS_14010 7853 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13159 13899 gene locus_tag LOCUS_14020 13159 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14146 15327 gene locus_tag LOCUS_14030 14146 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17117 15411 gene locus_tag LOCUS_14040 17117 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17523 20804 gene locus_tag LOCUS_14050 17523 20804 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_14050 21047 21529 gene locus_tag LOCUS_14060 21047 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 21721 22680 gene locus_tag LOCUS_14070 21721 22680 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_14070 23135 22791 gene locus_tag LOCUS_14080 23135 22791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 23551 24675 gene locus_tag LOCUS_14090 23551 24675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 24879 25148 gene locus_tag LOCUS_14100 24879 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 25296 25709 gene locus_tag LOCUS_14110 25296 25709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 26002 26760 gene locus_tag LOCUS_14120 26002 26760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 27010 28533 gene locus_tag LOCUS_14130 gene hutH 27010 28533 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_14130 28651 29793 gene locus_tag LOCUS_14140 28651 29793 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_14140 29816 31765 gene locus_tag LOCUS_14150 29816 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 31794 32561 gene locus_tag LOCUS_14160 31794 32561 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_14160 32585 33607 gene locus_tag LOCUS_14170 gene rtcA 32585 33607 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387129.1 protein_id gnl|my_center|LOCUS_14170 33608 34738 gene locus_tag LOCUS_14180 33608 34738 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266942.1 protein_id gnl|my_center|LOCUS_14180 34945 36384 gene locus_tag LOCUS_14190 34945 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 36549 37259 gene locus_tag LOCUS_14200 36549 37259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_14200 37256 38722 gene locus_tag LOCUS_14210 37256 38722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 38913 40868 gene locus_tag LOCUS_14220 38913 40868 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_14220 41114 40926 gene locus_tag LOCUS_14230 41114 40926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 41082 41975 gene locus_tag LOCUS_14240 41082 41975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_14240 42103 43731 gene locus_tag LOCUS_14250 42103 43731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402932.1 protein_id gnl|my_center|LOCUS_14250 44708 43740 gene locus_tag LOCUS_14260 44708 43740 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_14260 45140 45769 gene locus_tag LOCUS_14270 45140 45769 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_14270 45772 46800 gene locus_tag LOCUS_14280 45772 46800 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_14280 47047 49620 gene locus_tag LOCUS_14290 47047 49620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 50003 49641 gene locus_tag LOCUS_14300 50003 49641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_14300 50279 50785 gene locus_tag LOCUS_14310 50279 50785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 50834 51019 gene locus_tag LOCUS_14320 50834 51019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 52297 51311 gene locus_tag LOCUS_14330 52297 51311 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403825.1 protein_id gnl|my_center|LOCUS_14330 52366 53592 gene locus_tag LOCUS_14340 gene dinB 52366 53592 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_14340 53589 56717 gene locus_tag LOCUS_14350 53589 56717 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_14350 58310 57081 gene locus_tag LOCUS_14360 58310 57081 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence021 114 1487 gene locus_tag LOCUS_14370 gene ltrA 114 1487 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_14370 4666 1580 gene locus_tag LOCUS_14380 4666 1580 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_14380 7114 4775 gene locus_tag LOCUS_14390 7114 4775 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_14390 8701 7469 gene locus_tag LOCUS_14400 8701 7469 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_14400 8824 9492 gene locus_tag LOCUS_14410 8824 9492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9473 10237 gene locus_tag LOCUS_14420 9473 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 10942 10664 gene locus_tag LOCUS_14430 10942 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11092 11790 gene locus_tag LOCUS_14440 11092 11790 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_14440 11851 13104 gene locus_tag LOCUS_14450 11851 13104 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530038.1 protein_id gnl|my_center|LOCUS_14450 13117 13497 gene locus_tag LOCUS_14460 gene folB 13117 13497 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_14460 13720 14256 gene locus_tag LOCUS_14470 gene folK 13720 14256 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_14470 14262 14912 gene locus_tag LOCUS_14480 14262 14912 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194274.1 protein_id gnl|my_center|LOCUS_14480 14899 15738 gene locus_tag LOCUS_14490 gene panB 14899 15738 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_14490 15793 16653 gene locus_tag LOCUS_14500 gene panC 15793 16653 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_14500 16675 17022 gene locus_tag LOCUS_14510 16675 17022 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_14510 17107 17838 gene locus_tag LOCUS_14520 17107 17838 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_14520 18087 18599 gene locus_tag LOCUS_14530 18087 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 18661 19173 gene locus_tag LOCUS_14540 18661 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 19222 19557 gene locus_tag LOCUS_14550 19222 19557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 19711 20958 gene locus_tag LOCUS_14560 gene rho 19711 20958 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_14560 21004 22074 gene locus_tag LOCUS_14570 21004 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 22165 23088 gene locus_tag LOCUS_14580 22165 23088 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_14580 23193 25121 gene locus_tag LOCUS_14590 gene metG 23193 25121 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_14590 25118 25888 gene locus_tag LOCUS_14600 25118 25888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 26009 26887 gene locus_tag LOCUS_14610 gene rsmA 26009 26887 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_14610 26802 28673 gene locus_tag LOCUS_14620 26802 28673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 28670 29260 gene locus_tag LOCUS_14630 28670 29260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 29290 29853 gene locus_tag LOCUS_14640 29290 29853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 29982 30188 gene locus_tag LOCUS_14650 29982 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 30268 33159 gene locus_tag LOCUS_14660 30268 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 33189 36191 gene locus_tag LOCUS_14670 33189 36191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 36222 37259 gene locus_tag LOCUS_14680 36222 37259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 37390 38409 gene locus_tag LOCUS_14690 37390 38409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942090.1 protein_id gnl|my_center|LOCUS_14690 38430 40157 gene locus_tag LOCUS_14700 38430 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 40315 40713 gene locus_tag LOCUS_14710 40315 40713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 41327 41136 gene locus_tag LOCUS_14720 41327 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 41596 43437 gene locus_tag LOCUS_14730 41596 43437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 43823 43752 gene locus_tag LOCUS_t00180 43823 43752 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44464 43922 gene locus_tag LOCUS_14740 44464 43922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 44770 45795 gene locus_tag LOCUS_14750 gene pdhA 44770 45795 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_14750 45928 46911 gene locus_tag LOCUS_14760 45928 46911 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257563.1 protein_id gnl|my_center|LOCUS_14760 46973 48277 gene locus_tag LOCUS_14770 gene odhB 46973 48277 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259557.1 protein_id gnl|my_center|LOCUS_14770 48576 49211 gene locus_tag LOCUS_14780 gene lipB 48576 49211 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_14780 49904 49257 gene locus_tag LOCUS_14790 49904 49257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 50575 49913 gene locus_tag LOCUS_14800 50575 49913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 51648 50572 gene locus_tag LOCUS_14810 51648 50572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 52380 51775 gene locus_tag LOCUS_14820 52380 51775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 52978 53754 gene locus_tag LOCUS_14830 gene fabL 52978 53754 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_14830 53767 54165 gene locus_tag LOCUS_14840 53767 54165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 54405 54677 gene locus_tag LOCUS_14850 54405 54677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 54674 55846 gene locus_tag LOCUS_14860 54674 55846 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_14860 55843 56757 gene locus_tag LOCUS_14870 55843 56757 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_14870 56754 57326 gene locus_tag LOCUS_14880 56754 57326 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_14880 57552 58205 gene locus_tag LOCUS_14890 57552 58205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence022 605 1117 gene locus_tag LOCUS_14900 605 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3804 1423 gene locus_tag LOCUS_14910 3804 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 4265 4157 gene locus_tag LOCUS_r00010 4265 4157 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8214 4537 gene locus_tag LOCUS_r00020 8214 4537 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8443 8369 gene locus_tag LOCUS_t00190 8443 8369 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8699 8625 gene locus_tag LOCUS_t00200 8699 8625 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 10505 8942 gene locus_tag LOCUS_r00030 10505 8942 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11112 11040 gene locus_tag LOCUS_t00210 11112 11040 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11269 12858 gene locus_tag LOCUS_14920 11269 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 12962 12889 gene locus_tag LOCUS_t00220 12962 12889 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13764 13195 gene locus_tag LOCUS_14930 13764 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 15396 13924 gene locus_tag LOCUS_14940 15396 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 15895 15437 gene locus_tag LOCUS_14950 15895 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 16767 15892 gene locus_tag LOCUS_14960 16767 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 17270 16803 gene locus_tag LOCUS_14970 17270 16803 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256140.1 protein_id gnl|my_center|LOCUS_14970 17632 17285 gene locus_tag LOCUS_14980 17632 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 18894 17905 gene locus_tag LOCUS_14990 18894 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 19682 19065 gene locus_tag LOCUS_15000 19682 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 20944 19679 gene locus_tag LOCUS_15010 gene hutI 20944 19679 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_15010 23254 20966 gene locus_tag LOCUS_15020 23254 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 23933 23742 gene locus_tag LOCUS_15030 23933 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 26599 24197 gene locus_tag LOCUS_15040 gene pheT 26599 24197 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_15040 28157 27141 gene locus_tag LOCUS_15050 gene pheS 28157 27141 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_15050 28451 28176 gene locus_tag LOCUS_15060 28451 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 28894 28544 gene locus_tag LOCUS_15070 gene rplT 28894 28544 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948412.1 protein_id gnl|my_center|LOCUS_15070 29125 28928 gene locus_tag LOCUS_15080 gene rpmI 29125 28928 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_15080 30490 29825 gene locus_tag LOCUS_15090 30490 29825 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967700.1 protein_id gnl|my_center|LOCUS_15090 30890 31861 gene locus_tag LOCUS_15100 30890 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 31837 32556 gene locus_tag LOCUS_15110 31837 32556 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_15110 32774 34570 gene locus_tag LOCUS_15120 32774 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 35321 34761 gene locus_tag LOCUS_15130 gene infC 35321 34761 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071997922.1 protein_id gnl|my_center|LOCUS_15130 37397 35451 gene locus_tag LOCUS_15140 gene thrS 37397 35451 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_15140 37584 37508 gene locus_tag LOCUS_t00230 37584 37508 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 39015 38113 gene locus_tag LOCUS_15150 39015 38113 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_15150 39509 39123 gene locus_tag LOCUS_15160 39509 39123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 39930 42644 gene locus_tag LOCUS_15170 39930 42644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 42775 42587 gene locus_tag LOCUS_15180 42775 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 42880 43266 gene locus_tag LOCUS_15190 42880 43266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 43764 43270 gene locus_tag LOCUS_15200 43764 43270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 44184 43855 gene locus_tag LOCUS_15210 44184 43855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 45430 44366 gene locus_tag LOCUS_15220 45430 44366 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_15220 45997 45653 gene locus_tag LOCUS_15230 45997 45653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 46463 45990 gene locus_tag LOCUS_15240 46463 45990 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940796.1 protein_id gnl|my_center|LOCUS_15240 48014 46548 gene locus_tag LOCUS_15250 48014 46548 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_15250 49000 48017 gene locus_tag LOCUS_15260 49000 48017 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_15260 49482 49000 gene locus_tag LOCUS_15270 49482 49000 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_15270 51469 49475 gene locus_tag LOCUS_15280 gene hdrA 51469 49475 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_15280 53352 51457 gene locus_tag LOCUS_15290 53352 51457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 54333 53359 gene locus_tag LOCUS_15300 54333 53359 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_15300 55130 54345 gene locus_tag LOCUS_15310 55130 54345 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_15310 56259 55135 gene locus_tag LOCUS_15320 56259 55135 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_15320 56458 56279 gene locus_tag LOCUS_15330 56458 56279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 58237 57035 gene locus_tag LOCUS_15340 58237 57035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence023 <1 1156 gene locus_tag LOCUS_15350 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140584.1:S9 family peptidase 1256 1606 gene locus_tag LOCUS_15360 1256 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3260 1635 gene locus_tag LOCUS_15370 gene zwf 3260 1635 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_15370 4045 3257 gene locus_tag LOCUS_15380 gene pgl 4045 3257 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_15380 5189 4206 gene locus_tag LOCUS_15390 gene gnd 5189 4206 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089498.1 protein_id gnl|my_center|LOCUS_15390 5414 5968 gene locus_tag LOCUS_15400 5414 5968 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965775.1 protein_id gnl|my_center|LOCUS_15400 6098 6352 gene locus_tag LOCUS_15410 6098 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6738 6367 gene locus_tag LOCUS_15420 6738 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 8729 6927 gene locus_tag LOCUS_15430 8729 6927 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016358.1 protein_id gnl|my_center|LOCUS_15430 8983 9351 gene locus_tag LOCUS_15440 8983 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10991 9441 gene locus_tag LOCUS_15450 10991 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 11087 12727 gene locus_tag LOCUS_15460 gene boxC 11087 12727 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921378.1 protein_id gnl|my_center|LOCUS_15460 12749 14170 gene locus_tag LOCUS_15470 gene boxB 12749 14170 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_15470 14176 14541 gene locus_tag LOCUS_15480 14176 14541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 15336 14644 gene locus_tag LOCUS_15490 15336 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 15851 17527 gene locus_tag LOCUS_15500 15851 17527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 18415 17855 gene locus_tag LOCUS_15510 18415 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 19075 18578 gene locus_tag LOCUS_15520 19075 18578 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_15520 19473 20567 gene locus_tag LOCUS_15530 19473 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 20878 21789 gene locus_tag LOCUS_15540 20878 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 22583 27940 gene locus_tag LOCUS_15550 22583 27940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 28041 28775 gene locus_tag LOCUS_15560 28041 28775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 28803 29549 gene locus_tag LOCUS_15570 28803 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 29898 32552 gene locus_tag LOCUS_15580 29898 32552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 32646 32834 gene locus_tag LOCUS_15590 32646 32834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 33198 37202 gene locus_tag LOCUS_15600 33198 37202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 38333 37389 gene locus_tag LOCUS_15610 gene nhaR 38333 37389 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_15610 39494 39916 gene locus_tag LOCUS_15620 39494 39916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15620 39935 40846 gene locus_tag LOCUS_15630 39935 40846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15630 40834 43704 gene locus_tag LOCUS_15640 40834 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 44040 45191 gene locus_tag LOCUS_15650 44040 45191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 45557 45484 gene locus_tag LOCUS_t00240 45557 45484 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 45812 45624 gene locus_tag LOCUS_15660 45812 45624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 46229 45885 gene locus_tag LOCUS_15670 46229 45885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 47294 46374 gene locus_tag LOCUS_15680 gene murQ 47294 46374 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_15680 49048 48110 gene locus_tag LOCUS_15690 49048 48110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 49437 49117 gene locus_tag LOCUS_15700 49437 49117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 49891 50313 gene locus_tag LOCUS_15710 49891 50313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 54168 50449 gene locus_tag LOCUS_15720 54168 50449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 54581 55171 gene locus_tag LOCUS_15730 54581 55171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 55218 56474 gene locus_tag LOCUS_15740 55218 56474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 57331 56798 gene locus_tag LOCUS_15750 57331 56798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 57716 57303 gene locus_tag LOCUS_15760 57716 57303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence024 164 1108 gene locus_tag LOCUS_15770 164 1108 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_15770 1521 1201 gene locus_tag LOCUS_15780 1521 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2841 2059 gene locus_tag LOCUS_15790 2841 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4106 2916 gene locus_tag LOCUS_15800 gene hemH 4106 2916 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_15800 4093 4254 gene locus_tag LOCUS_15810 4093 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4564 5898 gene locus_tag LOCUS_15820 4564 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5895 6902 gene locus_tag LOCUS_15830 5895 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_15830 7508 7038 gene locus_tag LOCUS_15840 7508 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8318 7653 gene locus_tag LOCUS_15850 8318 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222748.1 protein_id gnl|my_center|LOCUS_15850 8494 9072 gene locus_tag LOCUS_15860 8494 9072 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_15860 9208 9792 gene locus_tag LOCUS_15870 9208 9792 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_15870 9825 10970 gene locus_tag LOCUS_15880 9825 10970 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_15880 11105 11698 gene locus_tag LOCUS_15890 11105 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 11709 12728 gene locus_tag LOCUS_15900 11709 12728 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_15900 13369 14145 gene locus_tag LOCUS_15910 13369 14145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 15338 14247 gene locus_tag LOCUS_15920 15338 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 15782 15399 gene locus_tag LOCUS_15930 15782 15399 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966538.1 protein_id gnl|my_center|LOCUS_15930 16464 15784 gene locus_tag LOCUS_15940 16464 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 16932 17711 gene locus_tag LOCUS_15950 16932 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 18508 18095 gene locus_tag LOCUS_15960 18508 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 18991 19311 gene locus_tag LOCUS_15970 18991 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 19386 19787 gene locus_tag LOCUS_15980 19386 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 20791 20105 gene locus_tag LOCUS_15990 20791 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 21496 20999 gene locus_tag LOCUS_16000 21496 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_16000 22249 23259 gene locus_tag LOCUS_16010 22249 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23835 24722 gene locus_tag LOCUS_16020 23835 24722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 25010 25447 gene locus_tag LOCUS_16030 gene mscL 25010 25447 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_16030 25756 26076 gene locus_tag LOCUS_16040 25756 26076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 26325 27461 gene locus_tag LOCUS_16050 26325 27461 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_16050 27470 28219 gene locus_tag LOCUS_16060 27470 28219 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_16060 28506 30224 gene locus_tag LOCUS_16070 28506 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 31753 30464 gene locus_tag LOCUS_16080 31753 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 32967 31759 gene locus_tag LOCUS_16090 32967 31759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 33871 32972 gene locus_tag LOCUS_16100 33871 32972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 35001 33868 gene locus_tag LOCUS_16110 gene pgsW 35001 33868 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078607.1 protein_id gnl|my_center|LOCUS_16110 35492 34998 gene locus_tag LOCUS_16120 gene pgsC 35492 34998 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_16120 36660 35470 gene locus_tag LOCUS_16130 gene pgsB 36660 35470 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_16130 36559 36777 gene locus_tag LOCUS_16140 36559 36777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 38954 36717 gene locus_tag LOCUS_16150 38954 36717 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294690.1 protein_id gnl|my_center|LOCUS_16150 39765 39675 gene locus_tag LOCUS_t00250 39765 39675 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39940 41109 gene locus_tag LOCUS_16160 39940 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 41233 42588 gene locus_tag LOCUS_16170 41233 42588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_16170 43575 42607 gene locus_tag LOCUS_16180 43575 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 protein_id gnl|my_center|LOCUS_16180 45139 43613 gene locus_tag LOCUS_16190 45139 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 46736 45885 gene locus_tag LOCUS_16200 46736 45885 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958159.1 protein_id gnl|my_center|LOCUS_16200 47671 46781 gene locus_tag LOCUS_16210 47671 46781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 47861 50131 gene locus_tag LOCUS_16220 gene pcrA 47861 50131 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_16220 50527 51393 gene locus_tag LOCUS_16230 gene moaA 50527 51393 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_16230 51536 52906 gene locus_tag LOCUS_16240 51536 52906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 53052 54209 gene locus_tag LOCUS_16250 53052 54209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 54247 56970 gene locus_tag LOCUS_16260 54247 56970 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_16260 56967 57527 gene locus_tag LOCUS_16270 56967 57527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence025 1383 1631 gene locus_tag LOCUS_16280 1383 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1739 2371 gene locus_tag LOCUS_16290 1739 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3160 2468 gene locus_tag LOCUS_16300 3160 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3426 3339 gene locus_tag LOCUS_t00260 3426 3339 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4849 4088 gene locus_tag LOCUS_16310 4849 4088 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_16310 5968 4853 gene locus_tag LOCUS_16320 gene gcvT 5968 4853 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_16320 6156 5992 gene locus_tag LOCUS_16330 6156 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 8074 6149 gene locus_tag LOCUS_16340 8074 6149 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_16340 11054 8163 gene locus_tag LOCUS_16350 gene uvrA 11054 8163 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_16350 11445 12980 gene locus_tag LOCUS_16360 11445 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 12995 14332 gene locus_tag LOCUS_16370 12995 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 16021 14429 gene locus_tag LOCUS_16380 16021 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 17600 16251 gene locus_tag LOCUS_16390 17600 16251 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_16390 18755 17649 gene locus_tag LOCUS_16400 gene ald 18755 17649 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_16400 20288 18843 gene locus_tag LOCUS_16410 20288 18843 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_16410 21340 20285 gene locus_tag LOCUS_16420 21340 20285 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_16420 21664 21389 gene locus_tag LOCUS_16430 21664 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 23342 21966 gene locus_tag LOCUS_16440 23342 21966 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_16440 23921 25699 gene locus_tag LOCUS_16450 23921 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 25909 27033 gene locus_tag LOCUS_16460 25909 27033 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_16460 27033 27212 gene locus_tag LOCUS_16470 27033 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 27237 28304 gene locus_tag LOCUS_16480 27237 28304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 28967 29890 gene locus_tag LOCUS_16490 28967 29890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 30059 31813 gene locus_tag LOCUS_16500 30059 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 31810 33234 gene locus_tag LOCUS_16510 gene tilS 31810 33234 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_16510 33288 33827 gene locus_tag LOCUS_16520 gene hpt 33288 33827 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115408.1 protein_id gnl|my_center|LOCUS_16520 33820 35811 gene locus_tag LOCUS_16530 gene ftsH 33820 35811 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_16530 35870 36673 gene locus_tag LOCUS_16540 gene folP 35870 36673 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_16540 36821 37582 gene locus_tag LOCUS_16550 gene cdaA 36821 37582 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_16550 37651 38640 gene locus_tag LOCUS_16560 gene obgE 37651 38640 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_16560 38676 39845 gene locus_tag LOCUS_16570 gene dprA 38676 39845 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_16570 39899 40150 gene locus_tag LOCUS_16580 39899 40150 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_16580 40156 41922 gene locus_tag LOCUS_16590 gene ptsP 40156 41922 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_16590 41960 43066 gene locus_tag LOCUS_16600 41960 43066 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_16600 43063 44082 gene locus_tag LOCUS_16610 43063 44082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 44105 44725 gene locus_tag LOCUS_16620 44105 44725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 44728 45597 gene locus_tag LOCUS_16630 44728 45597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 45604 46221 gene locus_tag LOCUS_16640 45604 46221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 46314 47075 gene locus_tag LOCUS_16650 46314 47075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 47340 48110 gene locus_tag LOCUS_16660 47340 48110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 48342 49319 gene locus_tag LOCUS_16670 48342 49319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 49558 49806 gene locus_tag LOCUS_16680 49558 49806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 49926 51683 gene locus_tag LOCUS_16690 49926 51683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 51727 52464 gene locus_tag LOCUS_16700 51727 52464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 52617 53357 gene locus_tag LOCUS_16710 52617 53357 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933250.1 protein_id gnl|my_center|LOCUS_16710 53361 53873 gene locus_tag LOCUS_16720 53361 53873 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933249.1 protein_id gnl|my_center|LOCUS_16720 53988 54584 gene locus_tag LOCUS_16730 53988 54584 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933248.1 protein_id gnl|my_center|LOCUS_16730 54581 55333 gene locus_tag LOCUS_16740 54581 55333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 55516 56298 gene locus_tag LOCUS_16750 55516 56298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence026 2055 598 gene locus_tag LOCUS_16760 gene gcvPB 2055 598 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933777.1 protein_id gnl|my_center|LOCUS_16760 3011 2085 gene locus_tag LOCUS_16770 3011 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4426 3011 gene locus_tag LOCUS_16780 gene gcvPA 4426 3011 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933289.1 protein_id gnl|my_center|LOCUS_16780 4836 4456 gene locus_tag LOCUS_16790 gene gcvH 4836 4456 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_16790 6330 4912 gene locus_tag LOCUS_16800 gene accC 6330 4912 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_16800 7398 6637 gene locus_tag LOCUS_16810 7398 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7934 7761 gene locus_tag LOCUS_16820 7934 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9555 8416 gene locus_tag LOCUS_16830 9555 8416 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_16830 10231 9737 gene locus_tag LOCUS_16840 gene accB 10231 9737 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_16840 11391 10282 gene locus_tag LOCUS_16850 11391 10282 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_16850 12015 11554 gene locus_tag LOCUS_16860 gene rfaE2 12015 11554 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_16860 13128 12097 gene locus_tag LOCUS_16870 gene rfaE1 13128 12097 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_16870 13230 13532 gene locus_tag LOCUS_16880 13230 13532 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_16880 15385 13817 gene locus_tag LOCUS_16890 15385 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 15558 15926 gene locus_tag LOCUS_16900 15558 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 16150 18123 gene locus_tag LOCUS_16910 16150 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 19966 18179 gene locus_tag LOCUS_16920 19966 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 21516 20164 gene locus_tag LOCUS_16930 21516 20164 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_16930 22955 21513 gene locus_tag LOCUS_16940 22955 21513 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_16940 23922 23047 gene locus_tag LOCUS_16950 23922 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 25035 23971 gene locus_tag LOCUS_16960 gene waaF 25035 23971 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16960 25911 25039 gene locus_tag LOCUS_16970 25911 25039 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_16970 26926 25919 gene locus_tag LOCUS_16980 26926 25919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 29361 26923 gene locus_tag LOCUS_16990 29361 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 30056 29370 gene locus_tag LOCUS_17000 30056 29370 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_17000 30925 30200 gene locus_tag LOCUS_17010 30925 30200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 32100 31156 gene locus_tag LOCUS_17020 32100 31156 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_17020 32498 32358 gene locus_tag LOCUS_17030 32498 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 32837 33346 gene locus_tag LOCUS_17040 32837 33346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 33348 34016 gene locus_tag LOCUS_17050 33348 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 34153 34722 gene locus_tag LOCUS_17060 34153 34722 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_17060 34788 36005 gene locus_tag LOCUS_17070 34788 36005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 36016 37428 gene locus_tag LOCUS_17080 36016 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 38600 37827 gene locus_tag LOCUS_17090 38600 37827 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_17090 40182 38710 gene locus_tag LOCUS_17100 40182 38710 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_17100 42830 40590 gene locus_tag LOCUS_17110 42830 40590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 43983 43006 gene locus_tag LOCUS_17120 43983 43006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 46576 44210 gene locus_tag LOCUS_17130 46576 44210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 50505 46936 gene locus_tag LOCUS_17140 50505 46936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 <56245 51648 gene locus_tag LOCUS_17150 <56245 51648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence027 279 2033 gene locus_tag LOCUS_17160 279 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4969 2429 gene locus_tag LOCUS_17170 4969 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5704 4988 gene locus_tag LOCUS_17180 5704 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6154 5813 gene locus_tag LOCUS_17190 6154 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 8800 7190 gene locus_tag LOCUS_17200 8800 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 9405 8797 gene locus_tag LOCUS_17210 9405 8797 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_17210 9656 9402 gene locus_tag LOCUS_17220 9656 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 10959 9862 gene locus_tag LOCUS_17230 10959 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11369 10956 gene locus_tag LOCUS_17240 11369 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 11511 11738 gene locus_tag LOCUS_17250 11511 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 11794 12087 gene locus_tag LOCUS_17260 11794 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 12246 12833 gene locus_tag LOCUS_17270 12246 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 13004 13303 gene locus_tag LOCUS_17280 13004 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 13300 15543 gene locus_tag LOCUS_17290 13300 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 15987 17237 gene locus_tag LOCUS_17300 15987 17237 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_17300 17224 17811 gene locus_tag LOCUS_17310 17224 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 17783 18307 gene locus_tag LOCUS_17320 17783 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 18279 18761 gene locus_tag LOCUS_17330 18279 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 19659 19102 gene locus_tag LOCUS_17340 19659 19102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 20595 20104 gene locus_tag LOCUS_17350 20595 20104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 21315 20713 gene locus_tag LOCUS_17360 21315 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 22404 21970 gene locus_tag LOCUS_17370 22404 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 23973 22687 gene locus_tag LOCUS_17380 23973 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 24831 24358 gene locus_tag LOCUS_17390 24831 24358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 25943 25050 gene locus_tag LOCUS_17400 gene xerC 25943 25050 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_17400 26222 26554 gene locus_tag LOCUS_17410 26222 26554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 29709 26452 gene locus_tag LOCUS_17420 29709 26452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 30283 29723 gene locus_tag LOCUS_17430 30283 29723 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_17430 34559 30429 gene locus_tag LOCUS_17440 34559 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 34782 35360 gene locus_tag LOCUS_17450 34782 35360 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147798296.1 protein_id gnl|my_center|LOCUS_17450 35497 36291 gene locus_tag LOCUS_17460 35497 36291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 36302 36616 gene locus_tag LOCUS_17470 36302 36616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 36603 37241 gene locus_tag LOCUS_17480 36603 37241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 37332 37805 gene locus_tag LOCUS_17490 37332 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 38659 38952 gene locus_tag LOCUS_17500 38659 38952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 40721 42841 gene locus_tag LOCUS_17510 40721 42841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 43566 43243 gene locus_tag LOCUS_17520 43566 43243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 45827 43887 gene locus_tag LOCUS_17530 45827 43887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 47772 46159 gene locus_tag LOCUS_17540 47772 46159 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_17540 48464 47790 gene locus_tag LOCUS_17550 48464 47790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037774.1 protein_id gnl|my_center|LOCUS_17550 48921 48481 gene locus_tag LOCUS_17560 48921 48481 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_17560 50077 50475 gene locus_tag LOCUS_17570 50077 50475 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974247.1 protein_id gnl|my_center|LOCUS_17570 50769 50506 gene locus_tag LOCUS_17580 50769 50506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 51790 51149 gene locus_tag LOCUS_17590 51790 51149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 52455 51787 gene locus_tag LOCUS_17600 52455 51787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 <53394 52530 gene locus_tag LOCUS_17610 <53394 52530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092958.1:nitrate reductase subunit beta >Feature sequence028 3017 2370 gene locus_tag LOCUS_17620 gene pghL 3017 2370 CDS product gamma-polyglutamate hydrolase PghL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245793.1 protein_id gnl|my_center|LOCUS_17620 4641 3199 gene locus_tag LOCUS_17630 4641 3199 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_17630 4970 5740 gene locus_tag LOCUS_17640 4970 5740 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245119.1 protein_id gnl|my_center|LOCUS_17640 5759 7849 gene locus_tag LOCUS_17650 5759 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8254 9333 gene locus_tag LOCUS_17660 8254 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 9482 10720 gene locus_tag LOCUS_17670 9482 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 11008 11478 gene locus_tag LOCUS_17680 11008 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 12986 11589 gene locus_tag LOCUS_17690 12986 11589 CDS product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 protein_id gnl|my_center|LOCUS_17690 15619 12983 gene locus_tag LOCUS_17700 gene mprF 15619 12983 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022655.1 protein_id gnl|my_center|LOCUS_17700 15989 16762 gene locus_tag LOCUS_17710 15989 16762 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_17710 17390 16845 gene locus_tag LOCUS_17720 17390 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 18211 17393 gene locus_tag LOCUS_17730 18211 17393 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_17730 20119 18452 gene locus_tag LOCUS_17740 gene rng 20119 18452 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_17740 20798 20436 gene locus_tag LOCUS_17750 20798 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 21911 20949 gene locus_tag LOCUS_17760 gene fmt 21911 20949 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404897.1 protein_id gnl|my_center|LOCUS_17760 22462 21908 gene locus_tag LOCUS_17770 gene def 22462 21908 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869773.1 protein_id gnl|my_center|LOCUS_17770 22929 22597 gene locus_tag LOCUS_17780 gene yajC 22929 22597 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809416.1 protein_id gnl|my_center|LOCUS_17780 24069 22939 gene locus_tag LOCUS_17790 gene tgt 24069 22939 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_17790 24970 24218 gene locus_tag LOCUS_17800 24970 24218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 25582 25082 gene locus_tag LOCUS_17810 25582 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 25518 25718 gene locus_tag LOCUS_17820 25518 25718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 26488 25973 gene locus_tag LOCUS_17830 26488 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 27328 26696 gene locus_tag LOCUS_17840 27328 26696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 27967 27449 gene locus_tag LOCUS_17850 27967 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 28566 28021 gene locus_tag LOCUS_17860 28566 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 29117 28722 gene locus_tag LOCUS_17870 29117 28722 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_17870 30560 29373 gene locus_tag LOCUS_17880 30560 29373 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_17880 31126 30662 gene locus_tag LOCUS_17890 31126 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 31639 31208 gene locus_tag LOCUS_17900 31639 31208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 33162 31675 gene locus_tag LOCUS_17910 33162 31675 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_17910 34271 33219 gene locus_tag LOCUS_17920 34271 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 34480 34409 gene locus_tag LOCUS_t00270 34480 34409 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35553 34594 gene locus_tag LOCUS_17930 35553 34594 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_17930 39495 35740 gene locus_tag LOCUS_17940 39495 35740 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_17940 39923 43117 gene locus_tag LOCUS_17950 39923 43117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 44744 43416 gene locus_tag LOCUS_17960 44744 43416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 45070 45771 gene locus_tag LOCUS_17970 45070 45771 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_17970 47691 45832 gene locus_tag LOCUS_17980 47691 45832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 47825 47739 gene locus_tag LOCUS_t00280 47825 47739 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47947 48417 gene locus_tag LOCUS_17990 gene smpB 47947 48417 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_17990 48532 49053 gene locus_tag LOCUS_18000 48532 49053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 49102 49941 gene locus_tag LOCUS_18010 gene murI 49102 49941 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_18010 49990 50592 gene locus_tag LOCUS_18020 49990 50592 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392057.1 protein_id gnl|my_center|LOCUS_18020 50664 50739 gene locus_tag LOCUS_t00290 50664 50739 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50828 51232 gene locus_tag LOCUS_18030 50828 51232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 51254 51328 gene locus_tag LOCUS_t00300 51254 51328 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 699 214 gene locus_tag LOCUS_18040 699 214 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_18040 2099 1149 gene locus_tag LOCUS_18050 2099 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4973 2475 gene locus_tag LOCUS_18060 4973 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5862 4981 gene locus_tag LOCUS_18070 5862 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6162 6043 gene locus_tag LOCUS_18080 6162 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6193 6339 gene locus_tag LOCUS_18090 6193 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6403 6582 gene locus_tag LOCUS_18100 6403 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 6703 6993 gene locus_tag LOCUS_18110 6703 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7357 9993 gene locus_tag LOCUS_18120 7357 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 10020 10796 gene locus_tag LOCUS_18130 10020 10796 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_18130 10961 11113 gene locus_tag LOCUS_18140 10961 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 11165 12151 gene locus_tag LOCUS_18150 11165 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 12304 12852 gene locus_tag LOCUS_18160 12304 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12860 13396 gene locus_tag LOCUS_18170 12860 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13880 13470 gene locus_tag LOCUS_18180 13880 13470 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272792.1 protein_id gnl|my_center|LOCUS_18180 14850 14032 gene locus_tag LOCUS_18190 gene mutM 14850 14032 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837245.1 protein_id gnl|my_center|LOCUS_18190 15946 14870 gene locus_tag LOCUS_18200 15946 14870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311909.1 protein_id gnl|my_center|LOCUS_18200 16104 17549 gene locus_tag LOCUS_18210 16104 17549 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_18210 17542 18306 gene locus_tag LOCUS_18220 17542 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 19239 18418 gene locus_tag LOCUS_18230 19239 18418 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_18230 19393 19232 gene locus_tag LOCUS_18240 19393 19232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 21207 19390 gene locus_tag LOCUS_18250 21207 19390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_18250 22962 21214 gene locus_tag LOCUS_18260 22962 21214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 protein_id gnl|my_center|LOCUS_18260 23192 23548 gene locus_tag LOCUS_18270 23192 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 24711 23809 gene locus_tag LOCUS_18280 24711 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 25918 24950 gene locus_tag LOCUS_18290 gene hprK 25918 24950 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_18290 26354 25998 gene locus_tag LOCUS_18300 26354 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 27368 26403 gene locus_tag LOCUS_18310 gene glpX 27368 26403 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_18310 29099 27498 gene locus_tag LOCUS_18320 gene rpoN 29099 27498 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_18320 30824 29412 gene locus_tag LOCUS_18330 gene glnA 30824 29412 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_18330 31426 32142 gene locus_tag LOCUS_18340 31426 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 32333 33154 gene locus_tag LOCUS_18350 32333 33154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 33151 35325 gene locus_tag LOCUS_18360 33151 35325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 35426 36187 gene locus_tag LOCUS_18370 35426 36187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 37251 36397 gene locus_tag LOCUS_18380 37251 36397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 38091 37273 gene locus_tag LOCUS_18390 38091 37273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_18390 39286 38252 gene locus_tag LOCUS_18400 39286 38252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_18400 39863 42034 gene locus_tag LOCUS_18410 gene ccsA 39863 42034 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_18410 42293 43123 gene locus_tag LOCUS_18420 42293 43123 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_18420 43120 43596 gene locus_tag LOCUS_18430 43120 43596 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_18430 43593 44603 gene locus_tag LOCUS_18440 gene rfbB 43593 44603 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_18440 44593 45504 gene locus_tag LOCUS_18450 44593 45504 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_18450 46181 47074 gene locus_tag LOCUS_18460 46181 47074 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_18460 47097 47996 gene locus_tag LOCUS_18470 47097 47996 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_18470 48198 48929 gene locus_tag LOCUS_18480 48198 48929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 48850 49086 gene locus_tag LOCUS_18490 48850 49086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 49091 49306 gene locus_tag LOCUS_18500 49091 49306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 49372 49587 gene locus_tag LOCUS_18510 49372 49587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence030 1521 1315 gene locus_tag LOCUS_18520 1521 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2358 3593 gene locus_tag LOCUS_18530 2358 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3686 4378 gene locus_tag LOCUS_18540 3686 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4368 5252 gene locus_tag LOCUS_18550 4368 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5258 5947 gene locus_tag LOCUS_18560 5258 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 6001 7254 gene locus_tag LOCUS_18570 6001 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 7269 8057 gene locus_tag LOCUS_18580 7269 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 8197 9075 gene locus_tag LOCUS_18590 8197 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 9068 9841 gene locus_tag LOCUS_18600 9068 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10394 10594 gene locus_tag LOCUS_18610 10394 10594 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_18610 11883 12077 gene locus_tag LOCUS_18620 11883 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 12838 13122 gene locus_tag LOCUS_18630 12838 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 13430 13630 gene locus_tag LOCUS_18640 13430 13630 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_18640 13764 15128 gene locus_tag LOCUS_18650 13764 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 15146 15769 gene locus_tag LOCUS_18660 15146 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 15773 16621 gene locus_tag LOCUS_18670 15773 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 16642 17277 gene locus_tag LOCUS_18680 16642 17277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 17569 17291 gene locus_tag LOCUS_18690 17569 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 18014 18241 gene locus_tag LOCUS_18700 18014 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 18566 18889 gene locus_tag LOCUS_18710 18566 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 20165 22471 gene locus_tag LOCUS_18720 20165 22471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 23686 24807 gene locus_tag LOCUS_18730 23686 24807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 24862 25332 gene locus_tag LOCUS_18740 24862 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 25558 26652 gene locus_tag LOCUS_18750 25558 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 26712 28601 gene locus_tag LOCUS_18760 26712 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 32154 28801 gene locus_tag LOCUS_18770 32154 28801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 33145 32345 gene locus_tag LOCUS_18780 33145 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 33410 34258 gene locus_tag LOCUS_18790 33410 34258 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_18790 34675 34271 gene locus_tag LOCUS_18800 34675 34271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 36032 35121 gene locus_tag LOCUS_18810 36032 35121 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_18810 36236 36658 gene locus_tag LOCUS_18820 36236 36658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 36678 37727 gene locus_tag LOCUS_18830 gene ychF 36678 37727 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_18830 37731 39773 gene locus_tag LOCUS_18840 37731 39773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 38775 38863 gene locus_tag LOCUS_t00310 38775 38863 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 40391 39942 gene locus_tag LOCUS_18850 40391 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 42991 40517 gene locus_tag LOCUS_18860 42991 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 43610 42993 gene locus_tag LOCUS_18870 43610 42993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 44161 43736 gene locus_tag LOCUS_18880 44161 43736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 47178 44653 gene locus_tag LOCUS_18890 47178 44653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 47521 47261 gene locus_tag LOCUS_18900 47521 47261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 48705 48091 gene locus_tag LOCUS_18910 48705 48091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence031 1216 296 gene locus_tag LOCUS_18920 1216 296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 protein_id gnl|my_center|LOCUS_18920 2818 1241 gene locus_tag LOCUS_18930 2818 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3440 3003 gene locus_tag LOCUS_18940 3440 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 4188 3493 gene locus_tag LOCUS_18950 4188 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4895 4185 gene locus_tag LOCUS_18960 gene queC 4895 4185 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_18960 5548 4892 gene locus_tag LOCUS_18970 gene queE 5548 4892 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_18970 6612 6100 gene locus_tag LOCUS_18980 6612 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 8023 6623 gene locus_tag LOCUS_18990 8023 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10692 8182 gene locus_tag LOCUS_19000 10692 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11008 15453 gene locus_tag LOCUS_19010 11008 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 15582 16652 gene locus_tag LOCUS_19020 15582 16652 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_19020 16868 17683 gene locus_tag LOCUS_19030 16868 17683 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320045.1 protein_id gnl|my_center|LOCUS_19030 17680 18306 gene locus_tag LOCUS_19040 gene mobA 17680 18306 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 protein_id gnl|my_center|LOCUS_19040 18333 19529 gene locus_tag LOCUS_19050 18333 19529 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_19050 19635 21947 gene locus_tag LOCUS_19060 19635 21947 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_19060 22256 22462 gene locus_tag LOCUS_19070 22256 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 26066 22548 gene locus_tag LOCUS_19080 26066 22548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 27916 26126 gene locus_tag LOCUS_19090 27916 26126 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_19090 29789 28143 gene locus_tag LOCUS_19100 29789 28143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 30460 29930 gene locus_tag LOCUS_19110 30460 29930 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267657.1 protein_id gnl|my_center|LOCUS_19110 32843 30573 gene locus_tag LOCUS_19120 32843 30573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 33306 32875 gene locus_tag LOCUS_19130 33306 32875 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_19130 33699 33346 gene locus_tag LOCUS_19140 33699 33346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 36186 34096 gene locus_tag LOCUS_19150 36186 34096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 36815 36183 gene locus_tag LOCUS_19160 36815 36183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 37726 36812 gene locus_tag LOCUS_19170 37726 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 38340 37912 gene locus_tag LOCUS_19180 38340 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 39080 38424 gene locus_tag LOCUS_19190 39080 38424 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_19190 42223 39296 gene locus_tag LOCUS_19200 gene ppdK 42223 39296 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_19200 42794 42441 gene locus_tag LOCUS_19210 42794 42441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 43360 44451 gene locus_tag LOCUS_19220 43360 44451 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_19220 44461 46059 gene locus_tag LOCUS_19230 gene serA 44461 46059 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_19230 46089 46610 gene locus_tag LOCUS_19240 46089 46610 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_19240 46651 47178 gene locus_tag LOCUS_19250 46651 47178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 47202 48023 gene locus_tag LOCUS_19260 47202 48023 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence032 226 405 gene locus_tag LOCUS_19270 226 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 602 1162 gene locus_tag LOCUS_19280 602 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19280 1134 1712 gene locus_tag LOCUS_19290 1134 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 3114 2137 gene locus_tag LOCUS_19300 gene trpS 3114 2137 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_19300 3442 4662 gene locus_tag LOCUS_19310 3442 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5320 5553 gene locus_tag LOCUS_19320 5320 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5732 6331 gene locus_tag LOCUS_19330 5732 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7477 6410 gene locus_tag LOCUS_19340 7477 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 8750 7491 gene locus_tag LOCUS_19350 8750 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9520 8765 gene locus_tag LOCUS_19360 9520 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9933 9520 gene locus_tag LOCUS_19370 9933 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 9820 10212 gene locus_tag LOCUS_19380 9820 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 10343 10822 gene locus_tag LOCUS_19390 10343 10822 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887487.1 protein_id gnl|my_center|LOCUS_19390 11124 10825 gene locus_tag LOCUS_19400 11124 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 11282 11521 gene locus_tag LOCUS_19410 11282 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 12525 11746 gene locus_tag LOCUS_19420 12525 11746 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_19420 12738 12920 gene locus_tag LOCUS_19430 12738 12920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 13514 12840 gene locus_tag LOCUS_19440 13514 12840 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_19440 14230 13511 gene locus_tag LOCUS_19450 14230 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 15643 14237 gene locus_tag LOCUS_19460 15643 14237 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_19460 16781 15750 gene locus_tag LOCUS_19470 16781 15750 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532676.1 protein_id gnl|my_center|LOCUS_19470 18065 16896 gene locus_tag LOCUS_19480 18065 16896 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_19480 19130 18135 gene locus_tag LOCUS_19490 19130 18135 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_19490 20727 19387 gene locus_tag LOCUS_19500 20727 19387 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_19500 21147 21863 gene locus_tag LOCUS_19510 gene nfi 21147 21863 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_19510 25752 21967 gene locus_tag LOCUS_19520 25752 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 26050 26271 gene locus_tag LOCUS_19530 26050 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 26308 27105 gene locus_tag LOCUS_19540 26308 27105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 28627 27149 gene locus_tag LOCUS_19550 28627 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 29394 30515 gene locus_tag LOCUS_19560 29394 30515 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829662.1 protein_id gnl|my_center|LOCUS_19560 31357 30659 gene locus_tag LOCUS_19570 31357 30659 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_19570 33222 31804 gene locus_tag LOCUS_19580 gene hemG 33222 31804 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_19580 34737 33334 gene locus_tag LOCUS_19590 gene hemN 34737 33334 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256540.1 protein_id gnl|my_center|LOCUS_19590 35817 34777 gene locus_tag LOCUS_19600 gene hemE 35817 34777 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_19600 36570 35863 gene locus_tag LOCUS_19610 36570 35863 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_19610 37937 36585 gene locus_tag LOCUS_19620 37937 36585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 39238 37934 gene locus_tag LOCUS_19630 gene hemL 39238 37934 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_19630 40275 39292 gene locus_tag LOCUS_19640 gene hemB 40275 39292 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_19640 41899 40256 gene locus_tag LOCUS_19650 41899 40256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 43236 41896 gene locus_tag LOCUS_19660 gene hemA 43236 41896 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_19660 44785 43550 gene locus_tag LOCUS_19670 44785 43550 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530104.1 protein_id gnl|my_center|LOCUS_19670 45544 44855 gene locus_tag LOCUS_19680 45544 44855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 45857 46951 gene locus_tag LOCUS_19690 45857 46951 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243654.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence033 1384 641 gene locus_tag LOCUS_19700 gene lepB 1384 641 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_19700 2609 1545 gene locus_tag LOCUS_19710 gene rseP 2609 1545 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942559.1 protein_id gnl|my_center|LOCUS_19710 3846 2647 gene locus_tag LOCUS_19720 3846 2647 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142249.1 protein_id gnl|my_center|LOCUS_19720 4829 3930 gene locus_tag LOCUS_19730 4829 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5376 4957 gene locus_tag LOCUS_19740 5376 4957 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_19740 6834 5416 gene locus_tag LOCUS_19750 gene atpD 6834 5416 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_19750 7918 7052 gene locus_tag LOCUS_19760 gene atpG 7918 7052 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_19760 9453 7945 gene locus_tag LOCUS_19770 gene atpA 9453 7945 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_19770 10112 9555 gene locus_tag LOCUS_19780 10112 9555 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064896.1 protein_id gnl|my_center|LOCUS_19780 10630 10130 gene locus_tag LOCUS_19790 gene atpF 10630 10130 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462233.1 protein_id gnl|my_center|LOCUS_19790 10954 10721 gene locus_tag LOCUS_19800 10954 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 11900 11040 gene locus_tag LOCUS_19810 11900 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 12316 11900 gene locus_tag LOCUS_19820 12316 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 12539 12333 gene locus_tag LOCUS_19830 12539 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 14103 13015 gene locus_tag LOCUS_19840 gene lpxD 14103 13015 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_19840 14705 14100 gene locus_tag LOCUS_19850 14705 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 17107 14708 gene locus_tag LOCUS_19860 gene bamA 17107 14708 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_19860 17508 17191 gene locus_tag LOCUS_19870 gene rplU 17508 17191 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 protein_id gnl|my_center|LOCUS_19870 18185 20185 gene locus_tag LOCUS_19880 gene uvrB 18185 20185 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_19880 20464 21102 gene locus_tag LOCUS_19890 20464 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 22898 21216 gene locus_tag LOCUS_19900 22898 21216 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_19900 23158 23481 gene locus_tag LOCUS_19910 23158 23481 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_19910 23546 23794 gene locus_tag LOCUS_19920 23546 23794 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 protein_id gnl|my_center|LOCUS_19920 23910 24905 gene locus_tag LOCUS_19930 23910 24905 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660365.1 protein_id gnl|my_center|LOCUS_19930 24919 25380 gene locus_tag LOCUS_19940 24919 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 25377 26063 gene locus_tag LOCUS_19950 25377 26063 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_19950 26850 26134 gene locus_tag LOCUS_19960 26850 26134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_19960 28068 26854 gene locus_tag LOCUS_19970 28068 26854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_19970 28634 28086 gene locus_tag LOCUS_19980 28634 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 29412 28636 gene locus_tag LOCUS_19990 29412 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 30449 29964 gene locus_tag LOCUS_20000 30449 29964 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_20000 31495 30446 gene locus_tag LOCUS_20010 gene arsB 31495 30446 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_20010 31883 31488 gene locus_tag LOCUS_20020 31883 31488 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_20020 32228 32695 gene locus_tag LOCUS_20030 32228 32695 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_20030 32784 34766 gene locus_tag LOCUS_20040 gene feoB 32784 34766 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_20040 34754 34942 gene locus_tag LOCUS_20050 34754 34942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 34977 35639 gene locus_tag LOCUS_20060 34977 35639 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_20060 37505 36159 gene locus_tag LOCUS_20070 37505 36159 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_20070 37773 38663 gene locus_tag LOCUS_20080 37773 38663 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_20080 39005 38760 gene locus_tag LOCUS_20090 39005 38760 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216696.1 protein_id gnl|my_center|LOCUS_20090 40491 39019 gene locus_tag LOCUS_20100 40491 39019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_20100 40396 40665 gene locus_tag LOCUS_20110 40396 40665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 42065 40797 gene locus_tag LOCUS_20120 42065 40797 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015415380.1 protein_id gnl|my_center|LOCUS_20120 43891 42503 gene locus_tag LOCUS_20130 gene fumC 43891 42503 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence034 2649 1279 gene locus_tag LOCUS_20140 2649 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3166 2780 gene locus_tag LOCUS_20150 3166 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3678 3298 gene locus_tag LOCUS_20160 3678 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4538 3714 gene locus_tag LOCUS_20170 4538 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4855 4700 gene locus_tag LOCUS_20180 4855 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6347 4917 gene locus_tag LOCUS_20190 6347 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 7581 6475 gene locus_tag LOCUS_20200 7581 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 8078 7656 gene locus_tag LOCUS_20210 8078 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8405 8121 gene locus_tag LOCUS_20220 8405 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8670 8398 gene locus_tag LOCUS_20230 8670 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 9635 8727 gene locus_tag LOCUS_20240 9635 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 10036 10488 gene locus_tag LOCUS_20250 gene tnpA 10036 10488 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_20250 12426 10723 gene locus_tag LOCUS_20260 gene recN 12426 10723 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_20260 13069 12587 gene locus_tag LOCUS_20270 13069 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 13262 13074 gene locus_tag LOCUS_20280 13262 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 14953 13406 gene locus_tag LOCUS_20290 14953 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 16371 15028 gene locus_tag LOCUS_20300 16371 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 17448 20495 gene locus_tag LOCUS_20310 17448 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 21439 20798 gene locus_tag LOCUS_20320 21439 20798 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943253.1 protein_id gnl|my_center|LOCUS_20320 21633 23495 gene locus_tag LOCUS_20330 21633 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 24921 23713 gene locus_tag LOCUS_20340 24921 23713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_20340 26379 25153 gene locus_tag LOCUS_20350 26379 25153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807909.1 protein_id gnl|my_center|LOCUS_20350 27013 26582 gene locus_tag LOCUS_20360 27013 26582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 30146 27264 gene locus_tag LOCUS_20370 30146 27264 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_20370 33418 30686 gene locus_tag LOCUS_20380 33418 30686 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_20380 34564 33716 gene locus_tag LOCUS_20390 34564 33716 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_20390 34740 34561 gene locus_tag LOCUS_20400 34740 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 36122 34737 gene locus_tag LOCUS_20410 36122 34737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_20410 36499 37725 gene locus_tag LOCUS_20420 36499 37725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 37803 39722 gene locus_tag LOCUS_20430 37803 39722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 39774 40523 gene locus_tag LOCUS_20440 39774 40523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 40860 42620 gene locus_tag LOCUS_20450 40860 42620 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058229.1 protein_id gnl|my_center|LOCUS_20450 42629 43936 gene locus_tag LOCUS_20460 42629 43936 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056736.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence035 461 282 gene locus_tag LOCUS_20470 461 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 1037 465 gene locus_tag LOCUS_20480 1037 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1293 1120 gene locus_tag LOCUS_20490 1293 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1824 1294 gene locus_tag LOCUS_20500 1824 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2050 3429 gene locus_tag LOCUS_20510 2050 3429 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_20510 3470 4612 gene locus_tag LOCUS_20520 3470 4612 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_20520 4818 4609 gene locus_tag LOCUS_20530 4818 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5232 5627 gene locus_tag LOCUS_20540 5232 5627 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_20540 5697 8027 gene locus_tag LOCUS_20550 5697 8027 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_20550 8439 8059 gene locus_tag LOCUS_20560 8439 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10333 11697 gene locus_tag LOCUS_20570 gene rlmD 10333 11697 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938223.1 protein_id gnl|my_center|LOCUS_20570 11753 12238 gene locus_tag LOCUS_20580 11753 12238 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_20580 12495 13964 gene locus_tag LOCUS_20590 12495 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 14825 14139 gene locus_tag LOCUS_20600 14825 14139 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_20600 14721 15047 gene locus_tag LOCUS_20610 14721 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 15066 16331 gene locus_tag LOCUS_20620 gene murA 15066 16331 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_20620 16507 19773 gene locus_tag LOCUS_20630 16507 19773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19926 22178 gene locus_tag LOCUS_20640 gene purL 19926 22178 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_20640 22332 23906 gene locus_tag LOCUS_20650 gene hutU 22332 23906 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_20650 24004 25410 gene locus_tag LOCUS_20660 gene rsmB 24004 25410 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_20660 25407 26171 gene locus_tag LOCUS_20670 25407 26171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 27615 26710 gene locus_tag LOCUS_20680 27615 26710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 28905 27652 gene locus_tag LOCUS_20690 28905 27652 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 protein_id gnl|my_center|LOCUS_20690 29201 29046 gene locus_tag LOCUS_20700 29201 29046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 29191 29379 gene locus_tag LOCUS_20710 29191 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 29429 30748 gene locus_tag LOCUS_20720 gene ffh 29429 30748 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546620.1 protein_id gnl|my_center|LOCUS_20720 30885 31229 gene locus_tag LOCUS_20730 30885 31229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 31281 31787 gene locus_tag LOCUS_20740 gene rimM 31281 31787 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_20740 31819 32592 gene locus_tag LOCUS_20750 gene trmD 31819 32592 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_20750 32595 32948 gene locus_tag LOCUS_20760 gene rplS 32595 32948 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_20760 33015 33671 gene locus_tag LOCUS_20770 33015 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 33727 34137 gene locus_tag LOCUS_20780 33727 34137 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_20780 34682 34209 gene locus_tag LOCUS_20790 34682 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 35145 34732 gene locus_tag LOCUS_20800 35145 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 36928 35210 gene locus_tag LOCUS_20810 36928 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 37211 37963 gene locus_tag LOCUS_20820 37211 37963 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_20820 38056 38577 gene locus_tag LOCUS_20830 38056 38577 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010664.1 protein_id gnl|my_center|LOCUS_20830 38687 39043 gene locus_tag LOCUS_20840 38687 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 39271 41565 gene locus_tag LOCUS_20850 gene topA 39271 41565 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_20850 41700 42599 gene locus_tag LOCUS_20860 gene xerC 41700 42599 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence036 1349 471 gene locus_tag LOCUS_20870 1349 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2390 1446 gene locus_tag LOCUS_20880 2390 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4140 2473 gene locus_tag LOCUS_20890 gene hreP 4140 2473 CDS product subtilisin/kexin-like serine protease HreP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816615.1 protein_id gnl|my_center|LOCUS_20890 5573 4440 gene locus_tag LOCUS_20900 5573 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7213 6092 gene locus_tag LOCUS_20910 7213 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 8727 7990 gene locus_tag LOCUS_20920 8727 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 9538 9918 gene locus_tag LOCUS_20930 9538 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 9896 10897 gene locus_tag LOCUS_20940 9896 10897 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_20940 10898 13642 gene locus_tag LOCUS_20950 10898 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 13639 14466 gene locus_tag LOCUS_20960 13639 14466 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_20960 14472 15401 gene locus_tag LOCUS_20970 14472 15401 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_20970 16022 16855 gene locus_tag LOCUS_20980 gene pyrF 16022 16855 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_20980 16882 18450 gene locus_tag LOCUS_20990 16882 18450 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_20990 18462 18680 gene locus_tag LOCUS_21000 18462 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 19115 18705 gene locus_tag LOCUS_21010 19115 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 21418 19211 gene locus_tag LOCUS_21020 gene recQ 21418 19211 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_21020 21625 21837 gene locus_tag LOCUS_21030 21625 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 21919 22539 gene locus_tag LOCUS_21040 21919 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 22922 22569 gene locus_tag LOCUS_21050 22922 22569 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_21050 23239 23919 gene locus_tag LOCUS_21060 23239 23919 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_21060 23970 24581 gene locus_tag LOCUS_21070 23970 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 24647 25261 gene locus_tag LOCUS_21080 24647 25261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 25258 25608 gene locus_tag LOCUS_21090 25258 25608 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 protein_id gnl|my_center|LOCUS_21090 25630 26214 gene locus_tag LOCUS_21100 25630 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 26266 28578 gene locus_tag LOCUS_21110 26266 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 28572 29396 gene locus_tag LOCUS_21120 28572 29396 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_21120 29401 30657 gene locus_tag LOCUS_21130 29401 30657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 30742 30960 gene locus_tag LOCUS_21140 30742 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 32590 31076 gene locus_tag LOCUS_21150 32590 31076 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_21150 32750 33427 gene locus_tag LOCUS_21160 32750 33427 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439746.1 protein_id gnl|my_center|LOCUS_21160 33698 35728 gene locus_tag LOCUS_21170 33698 35728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 37438 35774 gene locus_tag LOCUS_21180 37438 35774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 37908 37513 gene locus_tag LOCUS_21190 37908 37513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 39416 38391 gene locus_tag LOCUS_21200 39416 38391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 40148 40064 gene locus_tag LOCUS_t00320 40148 40064 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence037 913 539 gene locus_tag LOCUS_21210 913 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1450 998 gene locus_tag LOCUS_21220 1450 998 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454293.1 protein_id gnl|my_center|LOCUS_21220 1700 1461 gene locus_tag LOCUS_21230 1700 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3258 1939 gene locus_tag LOCUS_21240 gene orpR 3258 1939 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_21240 3240 3383 gene locus_tag LOCUS_21250 3240 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 3812 4528 gene locus_tag LOCUS_21260 3812 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4531 4947 gene locus_tag LOCUS_21270 4531 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5026 5766 gene locus_tag LOCUS_21280 5026 5766 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_21280 7285 6197 gene locus_tag LOCUS_21290 7285 6197 CDS product IS5-like element ISGsu2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 protein_id gnl|my_center|LOCUS_21290 7439 8521 gene locus_tag LOCUS_21300 7439 8521 CDS product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085265.1 protein_id gnl|my_center|LOCUS_21300 8666 9493 gene locus_tag LOCUS_21310 8666 9493 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_21310 9665 11908 gene locus_tag LOCUS_21320 9665 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 12012 12278 gene locus_tag LOCUS_21330 12012 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 13270 12320 gene locus_tag LOCUS_21340 13270 12320 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 protein_id gnl|my_center|LOCUS_21340 13483 13863 gene locus_tag LOCUS_21350 13483 13863 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 protein_id gnl|my_center|LOCUS_21350 13820 14353 gene locus_tag LOCUS_21360 13820 14353 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_21360 14388 14888 gene locus_tag LOCUS_21370 14388 14888 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799620.1 protein_id gnl|my_center|LOCUS_21370 14909 15313 gene locus_tag LOCUS_21380 14909 15313 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 protein_id gnl|my_center|LOCUS_21380 15428 15772 gene locus_tag LOCUS_21390 15428 15772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 16376 17545 gene locus_tag LOCUS_21400 16376 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 17746 18726 gene locus_tag LOCUS_21410 17746 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 18707 20767 gene locus_tag LOCUS_21420 18707 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 21126 20926 gene locus_tag LOCUS_21430 21126 20926 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941064.1 protein_id gnl|my_center|LOCUS_21430 24438 21151 gene locus_tag LOCUS_21440 24438 21151 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_21440 25469 24438 gene locus_tag LOCUS_21450 25469 24438 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_21450 26239 25562 gene locus_tag LOCUS_21460 26239 25562 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_21460 27534 26743 gene locus_tag LOCUS_21470 27534 26743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 29675 27576 gene locus_tag LOCUS_21480 29675 27576 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_21480 30361 31782 gene locus_tag LOCUS_21490 30361 31782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 31807 32703 gene locus_tag LOCUS_21500 31807 32703 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_21500 33561 32680 gene locus_tag LOCUS_21510 33561 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 35958 33769 gene locus_tag LOCUS_21520 35958 33769 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_21520 36668 37501 gene locus_tag LOCUS_21530 36668 37501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence038 172 447 gene locus_tag LOCUS_21540 172 447 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_21540 584 952 gene locus_tag LOCUS_21550 584 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 939 1934 gene locus_tag LOCUS_21560 939 1934 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_21560 1948 2934 gene locus_tag LOCUS_21570 gene truB 1948 2934 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908397.1 protein_id gnl|my_center|LOCUS_21570 2931 3935 gene locus_tag LOCUS_21580 2931 3935 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918589.1 protein_id gnl|my_center|LOCUS_21580 3946 4215 gene locus_tag LOCUS_21590 gene rpsO 3946 4215 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_21590 4395 6581 gene locus_tag LOCUS_21600 gene pnp 4395 6581 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_21600 6769 8115 gene locus_tag LOCUS_21610 6769 8115 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_21610 8183 8635 gene locus_tag LOCUS_21620 8183 8635 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_21620 8792 8866 gene locus_tag LOCUS_t00330 8792 8866 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8920 10230 gene locus_tag LOCUS_21630 8920 10230 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_21630 10669 11712 gene locus_tag LOCUS_21640 gene ltaE 10669 11712 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_21640 12045 12818 gene locus_tag LOCUS_21650 12045 12818 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_21650 12964 13224 gene locus_tag LOCUS_21660 12964 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 13364 13681 gene locus_tag LOCUS_21670 gene zapA 13364 13681 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808223.1 protein_id gnl|my_center|LOCUS_21670 13784 15358 gene locus_tag LOCUS_21680 gene rny 13784 15358 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_21680 15444 16313 gene locus_tag LOCUS_21690 15444 16313 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_21690 16448 17335 gene locus_tag LOCUS_21700 gene folD 16448 17335 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_21700 17348 18814 gene locus_tag LOCUS_21710 gene radA 17348 18814 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_21710 20075 19140 gene locus_tag LOCUS_21720 20075 19140 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_21720 20529 20605 gene locus_tag LOCUS_t00340 20529 20605 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20721 20797 gene locus_tag LOCUS_t00350 20721 20797 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20974 21690 gene locus_tag LOCUS_21730 20974 21690 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_21730 21695 23248 gene locus_tag LOCUS_21740 gene guaB 21695 23248 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_21740 23992 25749 gene locus_tag LOCUS_21750 gene recJ 23992 25749 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_21750 25775 26041 gene locus_tag LOCUS_21760 25775 26041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 26085 27047 gene locus_tag LOCUS_21770 gene meaB 26085 27047 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_21770 27205 28929 gene locus_tag LOCUS_21780 27205 28929 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_21780 29129 29917 gene locus_tag LOCUS_21790 29129 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 29924 30337 gene locus_tag LOCUS_21800 29924 30337 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_21800 30569 30342 gene locus_tag LOCUS_21810 30569 30342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 30793 31950 gene locus_tag LOCUS_21820 30793 31950 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_21820 32178 33050 gene locus_tag LOCUS_21830 32178 33050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_21830 33202 34752 gene locus_tag LOCUS_21840 33202 34752 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence039 264 626 gene locus_tag LOCUS_21850 264 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 623 829 gene locus_tag LOCUS_21860 623 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 820 2739 gene locus_tag LOCUS_21870 820 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2759 3262 gene locus_tag LOCUS_21880 2759 3262 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943666.1 protein_id gnl|my_center|LOCUS_21880 3378 3199 gene locus_tag LOCUS_21890 3378 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 3427 6978 gene locus_tag LOCUS_21900 3427 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 7051 9876 gene locus_tag LOCUS_21910 7051 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 9873 10544 gene locus_tag LOCUS_21920 9873 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 10525 11136 gene locus_tag LOCUS_21930 10525 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 11574 13763 gene locus_tag LOCUS_21940 11574 13763 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921668.1 protein_id gnl|my_center|LOCUS_21940 13845 14243 gene locus_tag LOCUS_21950 13845 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 14353 16686 gene locus_tag LOCUS_21960 14353 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 16701 17162 gene locus_tag LOCUS_21970 16701 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 17198 17644 gene locus_tag LOCUS_21980 17198 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 17983 19707 gene locus_tag LOCUS_21990 17983 19707 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_21990 22153 19853 gene locus_tag LOCUS_22000 22153 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 22710 23336 gene locus_tag LOCUS_22010 22710 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 24025 25572 gene locus_tag LOCUS_22020 24025 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 25621 27555 gene locus_tag LOCUS_22030 25621 27555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 27552 28106 gene locus_tag LOCUS_22040 27552 28106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 28055 30127 gene locus_tag LOCUS_22050 28055 30127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 30155 30523 gene locus_tag LOCUS_22060 gene aroH 30155 30523 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_22060 30589 31392 gene locus_tag LOCUS_22070 30589 31392 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394668.1 protein_id gnl|my_center|LOCUS_22070 31517 32437 gene locus_tag LOCUS_22080 31517 32437 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_22080 32434 32619 gene locus_tag LOCUS_22090 32434 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 32658 33920 gene locus_tag LOCUS_22100 32658 33920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence040 1803 1543 gene locus_tag LOCUS_22110 1803 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2010 2420 gene locus_tag LOCUS_22120 2010 2420 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_22120 4859 2469 gene locus_tag LOCUS_22130 gene tkt 4859 2469 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482487.1 protein_id gnl|my_center|LOCUS_22130 5197 6435 gene locus_tag LOCUS_22140 5197 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 7478 8848 gene locus_tag LOCUS_22150 7478 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 9006 10889 gene locus_tag LOCUS_22160 9006 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140922.1 protein_id gnl|my_center|LOCUS_22160 11332 11108 gene locus_tag LOCUS_22170 11332 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 11632 11474 gene locus_tag LOCUS_22180 11632 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 12561 12875 gene locus_tag LOCUS_22190 12561 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 13398 14819 gene locus_tag LOCUS_22200 13398 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 14816 15211 gene locus_tag LOCUS_22210 14816 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 15171 15719 gene locus_tag LOCUS_22220 15171 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 15751 16200 gene locus_tag LOCUS_22230 15751 16200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 17553 16345 gene locus_tag LOCUS_22240 17553 16345 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_22240 18314 19495 gene locus_tag LOCUS_22250 18314 19495 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_22250 19516 20226 gene locus_tag LOCUS_22260 19516 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 20273 22390 gene locus_tag LOCUS_22270 20273 22390 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_22270 22866 23507 gene locus_tag LOCUS_22280 22866 23507 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259362.1 protein_id gnl|my_center|LOCUS_22280 25949 23523 gene locus_tag LOCUS_22290 25949 23523 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_22290 27887 25962 gene locus_tag LOCUS_22300 gene glgB 27887 25962 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_22300 28597 29472 gene locus_tag LOCUS_22310 28597 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 31193 29661 gene locus_tag LOCUS_22320 gene malQ 31193 29661 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_22320 31155 31352 gene locus_tag LOCUS_22330 31155 31352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 31734 31369 gene locus_tag LOCUS_22340 31734 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence041 410 1330 gene locus_tag LOCUS_22350 410 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2504 1983 gene locus_tag LOCUS_22360 2504 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3302 2517 gene locus_tag LOCUS_22370 3302 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3859 3341 gene locus_tag LOCUS_22380 3859 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5077 3905 gene locus_tag LOCUS_22390 5077 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5403 5074 gene locus_tag LOCUS_22400 5403 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5773 5438 gene locus_tag LOCUS_22410 5773 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6631 5789 gene locus_tag LOCUS_22420 gene whiG 6631 5789 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_22420 7435 6647 gene locus_tag LOCUS_22430 7435 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 8625 7432 gene locus_tag LOCUS_22440 8625 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 10763 8640 gene locus_tag LOCUS_22450 gene flhA 10763 8640 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_22450 11869 10760 gene locus_tag LOCUS_22460 gene flhB 11869 10760 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_22460 12676 11888 gene locus_tag LOCUS_22470 gene fliR 12676 11888 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_22470 13171 12902 gene locus_tag LOCUS_22480 gene fliQ 13171 12902 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392308.1 protein_id gnl|my_center|LOCUS_22480 13968 13207 gene locus_tag LOCUS_22490 gene fliP 13968 13207 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_22490 14552 13998 gene locus_tag LOCUS_22500 14552 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 15168 14584 gene locus_tag LOCUS_22510 15168 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 16184 15207 gene locus_tag LOCUS_22520 gene fliM 16184 15207 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_22520 16656 16189 gene locus_tag LOCUS_22530 16656 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 16870 16664 gene locus_tag LOCUS_22540 16870 16664 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816224.1 protein_id gnl|my_center|LOCUS_22540 18848 16920 gene locus_tag LOCUS_22550 18848 16920 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870070.1 protein_id gnl|my_center|LOCUS_22550 19342 18845 gene locus_tag LOCUS_22560 19342 18845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 20041 19358 gene locus_tag LOCUS_22570 20041 19358 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_22570 21124 20057 gene locus_tag LOCUS_22580 21124 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 21348 21899 gene locus_tag LOCUS_22590 21348 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 22718 21951 gene locus_tag LOCUS_22600 22718 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 23360 22890 gene locus_tag LOCUS_22610 23360 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 25196 23772 gene locus_tag LOCUS_22620 gene fliI 25196 23772 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_22620 25914 25177 gene locus_tag LOCUS_22630 25914 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 26929 25901 gene locus_tag LOCUS_22640 gene fliG 26929 25901 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_22640 28463 26934 gene locus_tag LOCUS_22650 gene fliF 28463 26934 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_22650 28834 28523 gene locus_tag LOCUS_22660 gene fliE 28834 28523 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_22660 29058 28831 gene locus_tag LOCUS_22670 29058 28831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 29942 29442 gene locus_tag LOCUS_22680 gene flgC 29942 29442 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_22680 30363 29950 gene locus_tag LOCUS_22690 gene flgB 30363 29950 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_22690 31557 30769 gene locus_tag LOCUS_22700 31557 30769 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_22700 32349 31558 gene locus_tag LOCUS_22710 32349 31558 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence042 643 813 gene locus_tag LOCUS_22720 643 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3479 3733 gene locus_tag LOCUS_22730 3479 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3889 4266 gene locus_tag LOCUS_22740 3889 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 4285 4536 gene locus_tag LOCUS_22750 4285 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 5073 5492 gene locus_tag LOCUS_22760 5073 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 5505 5867 gene locus_tag LOCUS_22770 5505 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 7249 6041 gene locus_tag LOCUS_22780 7249 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8031 9341 gene locus_tag LOCUS_22790 8031 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 10590 9688 gene locus_tag LOCUS_22800 10590 9688 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_22800 10721 12232 gene locus_tag LOCUS_22810 10721 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 12207 13595 gene locus_tag LOCUS_22820 12207 13595 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_22820 13839 15254 gene locus_tag LOCUS_22830 13839 15254 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_22830 15260 16618 gene locus_tag LOCUS_22840 15260 16618 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061529.1 protein_id gnl|my_center|LOCUS_22840 16630 17916 gene locus_tag LOCUS_22850 16630 17916 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_22850 17916 19163 gene locus_tag LOCUS_22860 17916 19163 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_22860 19160 21007 gene locus_tag LOCUS_22870 19160 21007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_22870 21014 22402 gene locus_tag LOCUS_22880 21014 22402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 22384 23718 gene locus_tag LOCUS_22890 22384 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 23730 24305 gene locus_tag LOCUS_22900 23730 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 24298 26265 gene locus_tag LOCUS_22910 24298 26265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 26405 28597 gene locus_tag LOCUS_22920 26405 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 30113 28977 gene locus_tag LOCUS_22930 gene moaA 30113 28977 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_22930 30394 30795 gene locus_tag LOCUS_22940 30394 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 30792 32687 gene locus_tag LOCUS_22950 30792 32687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 32672 33139 gene locus_tag LOCUS_22960 32672 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence043 <1 820 gene locus_tag LOCUS_22970 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444546.1:Do family serine endopeptidase 930 4403 gene locus_tag LOCUS_22980 930 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4418 6304 gene locus_tag LOCUS_22990 4418 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 6389 7147 gene locus_tag LOCUS_23000 6389 7147 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908409.1 protein_id gnl|my_center|LOCUS_23000 7181 8341 gene locus_tag LOCUS_23010 gene nifS 7181 8341 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_23010 8351 9490 gene locus_tag LOCUS_23020 gene mnmA 8351 9490 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_23020 9669 9487 gene locus_tag LOCUS_23030 9669 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 10014 9682 gene locus_tag LOCUS_23040 10014 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 10265 10011 gene locus_tag LOCUS_23050 10265 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 10639 10460 gene locus_tag LOCUS_23060 10639 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 11307 10738 gene locus_tag LOCUS_23070 11307 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 11810 11343 gene locus_tag LOCUS_23080 gene paaI 11810 11343 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_23080 13007 11829 gene locus_tag LOCUS_23090 13007 11829 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_23090 13159 13452 gene locus_tag LOCUS_23100 gene gatC 13159 13452 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_23100 13746 14480 gene locus_tag LOCUS_23110 gene kdsB 13746 14480 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870025.1 protein_id gnl|my_center|LOCUS_23110 14506 16170 gene locus_tag LOCUS_23120 14506 16170 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_23120 16414 16566 gene locus_tag LOCUS_23130 16414 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 16541 18751 gene locus_tag LOCUS_23140 16541 18751 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_23140 20394 20966 gene locus_tag LOCUS_23150 20394 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 21195 22052 gene locus_tag LOCUS_23160 gene kdsA 21195 22052 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931782.1 protein_id gnl|my_center|LOCUS_23160 22045 22581 gene locus_tag LOCUS_23170 22045 22581 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_23170 22578 23621 gene locus_tag LOCUS_23180 22578 23621 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_23180 23775 24302 gene locus_tag LOCUS_23190 gene lptC 23775 24302 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813036.1 protein_id gnl|my_center|LOCUS_23190 25882 24764 gene locus_tag LOCUS_23200 25882 24764 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870110.1 protein_id gnl|my_center|LOCUS_23200 26144 27709 gene locus_tag LOCUS_23210 26144 27709 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_23210 27796 28722 gene locus_tag LOCUS_23220 27796 28722 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_23220 28761 29540 gene locus_tag LOCUS_23230 28761 29540 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_23230 29799 30332 gene locus_tag LOCUS_23240 29799 30332 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_23240 30424 32361 gene locus_tag LOCUS_23250 30424 32361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 32484 32732 gene locus_tag LOCUS_23260 gene rpmE 32484 32732 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence044 587 273 gene locus_tag LOCUS_23270 gene nuoK 587 273 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_23270 1126 584 gene locus_tag LOCUS_23280 1126 584 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_23280 1396 1169 gene locus_tag LOCUS_23290 1396 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3054 1468 gene locus_tag LOCUS_23300 3054 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4578 3067 gene locus_tag LOCUS_23310 4578 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 5374 4850 gene locus_tag LOCUS_23320 5374 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 7886 6402 gene locus_tag LOCUS_23330 7886 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 9977 8388 gene locus_tag LOCUS_23340 9977 8388 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_23340 11578 11048 gene locus_tag LOCUS_23350 11578 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 12186 11671 gene locus_tag LOCUS_23360 12186 11671 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_23360 13445 12183 gene locus_tag LOCUS_23370 13445 12183 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_23370 14192 13743 gene locus_tag LOCUS_23380 14192 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 14739 14200 gene locus_tag LOCUS_23390 14739 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 15166 15513 gene locus_tag LOCUS_23400 15166 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 15556 18201 gene locus_tag LOCUS_23410 15556 18201 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_23410 18367 19542 gene locus_tag LOCUS_23420 18367 19542 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_23420 19532 20572 gene locus_tag LOCUS_23430 19532 20572 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_23430 20757 23036 gene locus_tag LOCUS_23440 20757 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 23060 24076 gene locus_tag LOCUS_23450 23060 24076 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_23450 24292 25749 gene locus_tag LOCUS_23460 gene dnaB 24292 25749 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_23460 26683 25991 gene locus_tag LOCUS_23470 26683 25991 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_23470 28046 27054 gene locus_tag LOCUS_23480 28046 27054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 28516 29013 gene locus_tag LOCUS_23490 28516 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 29601 30035 gene locus_tag LOCUS_23500 29601 30035 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583243.1 protein_id gnl|my_center|LOCUS_23500 30467 30168 gene locus_tag LOCUS_23510 30467 30168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 31913 30573 gene locus_tag LOCUS_23520 gene der 31913 30573 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence045 998 144 gene locus_tag LOCUS_23530 998 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1161 2525 gene locus_tag LOCUS_23540 gene glmM 1161 2525 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_23540 2536 4362 gene locus_tag LOCUS_23550 gene glmS 2536 4362 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_23550 5138 4434 gene locus_tag LOCUS_23560 5138 4434 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_23560 6013 5312 gene locus_tag LOCUS_23570 6013 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 6406 6032 gene locus_tag LOCUS_23580 6406 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 6673 7041 gene locus_tag LOCUS_23590 6673 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 7859 7098 gene locus_tag LOCUS_23600 7859 7098 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_23600 9444 7873 gene locus_tag LOCUS_23610 9444 7873 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_23610 10880 9447 gene locus_tag LOCUS_23620 10880 9447 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_23620 11537 10884 gene locus_tag LOCUS_23630 11537 10884 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_23630 12454 11534 gene locus_tag LOCUS_23640 12454 11534 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_23640 14446 12458 gene locus_tag LOCUS_23650 14446 12458 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_23650 15162 14446 gene locus_tag LOCUS_23660 15162 14446 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_23660 17178 15292 gene locus_tag LOCUS_23670 gene typA 17178 15292 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925120.1 protein_id gnl|my_center|LOCUS_23670 17729 17565 gene locus_tag LOCUS_23680 17729 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 18146 19114 gene locus_tag LOCUS_23690 18146 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 19149 20837 gene locus_tag LOCUS_23700 19149 20837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 20834 25762 gene locus_tag LOCUS_23710 20834 25762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 25759 27402 gene locus_tag LOCUS_23720 25759 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 27442 28875 gene locus_tag LOCUS_23730 27442 28875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 31503 28903 gene locus_tag LOCUS_23740 31503 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence046 2550 13 gene locus_tag LOCUS_23750 2550 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4194 2803 gene locus_tag LOCUS_23760 gene nusA 4194 2803 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_23760 4707 4255 gene locus_tag LOCUS_23770 gene rimP 4707 4255 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_23770 4829 5086 gene locus_tag LOCUS_23780 4829 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 7708 5315 gene locus_tag LOCUS_23790 7708 5315 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_23790 8809 8135 gene locus_tag LOCUS_23800 8809 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 9290 8877 gene locus_tag LOCUS_23810 9290 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 11827 9617 gene locus_tag LOCUS_23820 11827 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 12651 11923 gene locus_tag LOCUS_23830 12651 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 13112 12684 gene locus_tag LOCUS_23840 13112 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 13738 13220 gene locus_tag LOCUS_23850 13738 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 14733 14221 gene locus_tag LOCUS_23860 14733 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 14662 16812 gene locus_tag LOCUS_23870 14662 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 17825 16890 gene locus_tag LOCUS_23880 17825 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 18419 17868 gene locus_tag LOCUS_23890 18419 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 18463 18642 gene locus_tag LOCUS_23900 18463 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 19672 18725 gene locus_tag LOCUS_23910 19672 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_23910 20571 19669 gene locus_tag LOCUS_23920 20571 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 21356 20817 gene locus_tag LOCUS_23930 21356 20817 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_23930 22042 21377 gene locus_tag LOCUS_23940 22042 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 23310 22231 gene locus_tag LOCUS_23950 23310 22231 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_23950 24058 23378 gene locus_tag LOCUS_23960 24058 23378 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931900.1 protein_id gnl|my_center|LOCUS_23960 25288 24071 gene locus_tag LOCUS_23970 gene coaBC 25288 24071 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_23970 26916 25297 gene locus_tag LOCUS_23980 gene purH 26916 25297 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175670.1 protein_id gnl|my_center|LOCUS_23980 27895 26969 gene locus_tag LOCUS_23990 27895 26969 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_23990 28639 27962 gene locus_tag LOCUS_24000 gene purN 28639 27962 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_24000 30096 28636 gene locus_tag LOCUS_24010 gene gatB 30096 28636 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_24010 31590 30202 gene locus_tag LOCUS_24020 gene gatA 31590 30202 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence047 3087 1066 gene locus_tag LOCUS_24030 3087 1066 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_24030 3326 3664 gene locus_tag LOCUS_24040 3326 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3998 4312 gene locus_tag LOCUS_24050 3998 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 5593 4319 gene locus_tag LOCUS_24060 5593 4319 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_24060 5647 5808 gene locus_tag LOCUS_24070 5647 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5805 6509 gene locus_tag LOCUS_24080 5805 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 6779 6985 gene locus_tag LOCUS_24090 6779 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 7227 8735 gene locus_tag LOCUS_24100 7227 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 8739 9083 gene locus_tag LOCUS_24110 8739 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 9173 13189 gene locus_tag LOCUS_24120 9173 13189 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257283.1 protein_id gnl|my_center|LOCUS_24120 13842 13270 gene locus_tag LOCUS_24130 13842 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 14523 15707 gene locus_tag LOCUS_24140 14523 15707 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_24140 17057 15747 gene locus_tag LOCUS_24150 17057 15747 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_24150 17189 17377 gene locus_tag LOCUS_24160 17189 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 19312 17405 gene locus_tag LOCUS_24170 19312 17405 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_24170 22040 19890 gene locus_tag LOCUS_24180 22040 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 23991 22075 gene locus_tag LOCUS_24190 23991 22075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 24881 24006 gene locus_tag LOCUS_24200 24881 24006 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_24200 25829 24930 gene locus_tag LOCUS_24210 25829 24930 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_24210 27105 26110 gene locus_tag LOCUS_24220 27105 26110 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_24220 27950 27276 gene locus_tag LOCUS_24230 27950 27276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 28632 28099 gene locus_tag LOCUS_24240 28632 28099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 29159 29932 gene locus_tag LOCUS_24250 29159 29932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354257.1 protein_id gnl|my_center|LOCUS_24250 30159 29980 gene locus_tag LOCUS_24260 30159 29980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence048 160 786 gene locus_tag LOCUS_24270 160 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1563 802 gene locus_tag LOCUS_24280 1563 802 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_24280 1798 5109 gene locus_tag LOCUS_24290 1798 5109 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_24290 5250 7043 gene locus_tag LOCUS_24300 5250 7043 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_24300 7063 7230 gene locus_tag LOCUS_24310 7063 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 7244 8671 gene locus_tag LOCUS_24320 7244 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 8922 11327 gene locus_tag LOCUS_24330 8922 11327 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 protein_id gnl|my_center|LOCUS_24330 11362 13929 gene locus_tag LOCUS_24340 11362 13929 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_24340 14349 13987 gene locus_tag LOCUS_24350 14349 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 15123 14359 gene locus_tag LOCUS_24360 15123 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 17659 15365 gene locus_tag LOCUS_24370 gene ccsA 17659 15365 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_24370 18993 17815 gene locus_tag LOCUS_24380 gene ispG 18993 17815 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_24380 19925 18990 gene locus_tag LOCUS_24390 gene lipA 19925 18990 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_24390 20449 20030 gene locus_tag LOCUS_24400 20449 20030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 20432 20737 gene locus_tag LOCUS_24410 20432 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 21594 20716 gene locus_tag LOCUS_24420 gene pdxS 21594 20716 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_24420 21819 22754 gene locus_tag LOCUS_24430 21819 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 24407 23013 gene locus_tag LOCUS_24440 24407 23013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_24440 26050 24437 gene locus_tag LOCUS_24450 26050 24437 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_24450 27587 26181 gene locus_tag LOCUS_24460 gene lpdA 27587 26181 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_24460 28053 28127 gene locus_tag LOCUS_t00360 28053 28127 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 28383 28159 gene locus_tag LOCUS_24470 28383 28159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 29889 28633 gene locus_tag LOCUS_24480 29889 28633 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 protein_id gnl|my_center|LOCUS_24480 30073 30148 gene locus_tag LOCUS_t00370 30073 30148 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 <1 1214 gene locus_tag LOCUS_24490 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867819.1:Glu-tRNA(Gln) amidotransferase subunit GatD 2079 1342 gene locus_tag LOCUS_24500 2079 1342 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_24500 3015 2221 gene locus_tag LOCUS_24510 3015 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4496 3168 gene locus_tag LOCUS_24520 4496 3168 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_24520 5042 5881 gene locus_tag LOCUS_24530 5042 5881 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140557.1 protein_id gnl|my_center|LOCUS_24530 5999 7084 gene locus_tag LOCUS_24540 5999 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 7549 9984 gene locus_tag LOCUS_24550 7549 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 10097 10573 gene locus_tag LOCUS_24560 10097 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 10683 11195 gene locus_tag LOCUS_24570 10683 11195 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_24570 11411 12496 gene locus_tag LOCUS_24580 11411 12496 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_24580 12493 13872 gene locus_tag LOCUS_24590 12493 13872 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_24590 15018 13921 gene locus_tag LOCUS_24600 15018 13921 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926818.1 protein_id gnl|my_center|LOCUS_24600 15179 15880 gene locus_tag LOCUS_24610 15179 15880 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_24610 16084 16659 gene locus_tag LOCUS_24620 16084 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 16890 17711 gene locus_tag LOCUS_24630 16890 17711 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_24630 17961 18782 gene locus_tag LOCUS_24640 17961 18782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 18847 19683 gene locus_tag LOCUS_24650 18847 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 19907 23092 gene locus_tag LOCUS_24660 gene ileS 19907 23092 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_24660 23126 23521 gene locus_tag LOCUS_24670 23126 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 23529 24182 gene locus_tag LOCUS_24680 23529 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 24227 25213 gene locus_tag LOCUS_24690 24227 25213 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_24690 25478 27466 gene locus_tag LOCUS_24700 25478 27466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 27681 29483 gene locus_tag LOCUS_24710 gene lepA 27681 29483 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence050 67 1974 gene locus_tag LOCUS_24720 67 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2066 2140 gene locus_tag LOCUS_t00380 2066 2140 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2283 2354 gene locus_tag LOCUS_t00390 2283 2354 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2439 2526 gene locus_tag LOCUS_t00400 2439 2526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3007 4374 gene locus_tag LOCUS_24730 3007 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 4437 4676 gene locus_tag LOCUS_24740 4437 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 4773 6128 gene locus_tag LOCUS_24750 4773 6128 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_24750 6441 6608 gene locus_tag LOCUS_24760 6441 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 6611 7552 gene locus_tag LOCUS_24770 6611 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 7549 10740 gene locus_tag LOCUS_24780 7549 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 10737 11414 gene locus_tag LOCUS_24790 10737 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 11499 13154 gene locus_tag LOCUS_24800 11499 13154 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_24800 15705 13570 gene locus_tag LOCUS_24810 15705 13570 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_24810 17220 15937 gene locus_tag LOCUS_24820 17220 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 18787 17915 gene locus_tag LOCUS_24830 18787 17915 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405089.1 protein_id gnl|my_center|LOCUS_24830 19758 18784 gene locus_tag LOCUS_24840 19758 18784 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123496.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence051 3409 314 gene locus_tag LOCUS_24850 3409 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4705 3659 gene locus_tag LOCUS_24860 4705 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 4817 5056 gene locus_tag LOCUS_24870 4817 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5867 5016 gene locus_tag LOCUS_24880 5867 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7111 5906 gene locus_tag LOCUS_24890 7111 5906 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_24890 8134 7121 gene locus_tag LOCUS_24900 8134 7121 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_24900 9087 10193 gene locus_tag LOCUS_24910 9087 10193 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_24910 10193 13282 gene locus_tag LOCUS_24920 10193 13282 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_24920 14959 13364 gene locus_tag LOCUS_24930 14959 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 15866 15495 gene locus_tag LOCUS_24940 15866 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 16794 15931 gene locus_tag LOCUS_24950 16794 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 17242 17024 gene locus_tag LOCUS_24960 17242 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 17606 19156 gene locus_tag LOCUS_24970 17606 19156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 20715 19462 gene locus_tag LOCUS_24980 20715 19462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_24980 21931 20708 gene locus_tag LOCUS_24990 21931 20708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_24990 22540 21953 gene locus_tag LOCUS_25000 22540 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence052 1392 124 gene locus_tag LOCUS_25010 1392 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2476 1406 gene locus_tag LOCUS_25020 2476 1406 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_25020 2859 3044 gene locus_tag LOCUS_25030 2859 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 6680 3018 gene locus_tag LOCUS_25040 gene smc 6680 3018 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_25040 7551 7006 gene locus_tag LOCUS_25050 7551 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 8602 7598 gene locus_tag LOCUS_25060 8602 7598 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812890.1 protein_id gnl|my_center|LOCUS_25060 9237 8599 gene locus_tag LOCUS_25070 9237 8599 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_25070 9727 9263 gene locus_tag LOCUS_25080 gene dtd 9727 9263 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869956.1 protein_id gnl|my_center|LOCUS_25080 11308 10034 gene locus_tag LOCUS_25090 11308 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13311 11332 gene locus_tag LOCUS_25100 13311 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13935 13339 gene locus_tag LOCUS_25110 13935 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 14718 13966 gene locus_tag LOCUS_25120 14718 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 15778 14720 gene locus_tag LOCUS_25130 gene pilM 15778 14720 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181416674.1 protein_id gnl|my_center|LOCUS_25130 17714 16275 gene locus_tag LOCUS_25140 17714 16275 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942297.1 protein_id gnl|my_center|LOCUS_25140 21341 17856 gene locus_tag LOCUS_25150 21341 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 22134 23537 gene locus_tag LOCUS_25160 22134 23537 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_25160 23780 24316 gene locus_tag LOCUS_25170 23780 24316 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_25170 25282 24434 gene locus_tag LOCUS_25180 25282 24434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence053 372 2717 gene locus_tag LOCUS_25190 372 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3186 5156 gene locus_tag LOCUS_25200 3186 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 7484 5250 gene locus_tag LOCUS_25210 7484 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 9370 7640 gene locus_tag LOCUS_25220 9370 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 12023 9537 gene locus_tag LOCUS_25230 gene lon 12023 9537 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_25230 12503 12285 gene locus_tag LOCUS_25240 12503 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 13677 12985 gene locus_tag LOCUS_25250 13677 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 14303 13854 gene locus_tag LOCUS_25260 gene nrdR 14303 13854 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_25260 15163 14300 gene locus_tag LOCUS_25270 15163 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 15433 16047 gene locus_tag LOCUS_25280 15433 16047 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_25280 16199 16960 gene locus_tag LOCUS_25290 16199 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 17126 17434 gene locus_tag LOCUS_25300 17126 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 17839 17495 gene locus_tag LOCUS_25310 17839 17495 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_25310 18144 17839 gene locus_tag LOCUS_25320 18144 17839 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_25320 19570 18314 gene locus_tag LOCUS_25330 19570 18314 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_25330 22658 19692 gene locus_tag LOCUS_25340 22658 19692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 23001 22765 gene locus_tag LOCUS_25350 23001 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 24478 23309 gene locus_tag LOCUS_25360 24478 23309 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112008.1 protein_id gnl|my_center|LOCUS_25360 24435 24623 gene locus_tag LOCUS_25370 24435 24623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 25295 24639 gene locus_tag LOCUS_25380 25295 24639 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_25380 26143 25292 gene locus_tag LOCUS_25390 26143 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 27195 26140 gene locus_tag LOCUS_25400 gene gtdA 27195 26140 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence054 1292 1612 gene locus_tag LOCUS_25410 1292 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1759 2337 gene locus_tag LOCUS_25420 1759 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3375 2428 gene locus_tag LOCUS_25430 3375 2428 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921406.1 protein_id gnl|my_center|LOCUS_25430 4216 3746 gene locus_tag LOCUS_25440 gene bfr 4216 3746 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677991.1 protein_id gnl|my_center|LOCUS_25440 4849 4931 gene locus_tag LOCUS_t00410 4849 4931 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5013 6275 gene locus_tag LOCUS_25450 gene tig 5013 6275 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208322.1 protein_id gnl|my_center|LOCUS_25450 6416 7018 gene locus_tag LOCUS_25460 gene clpP 6416 7018 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_25460 7135 8409 gene locus_tag LOCUS_25470 gene clpX 7135 8409 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312723.1 protein_id gnl|my_center|LOCUS_25470 8477 9088 gene locus_tag LOCUS_25480 gene yihA 8477 9088 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_25480 9101 10405 gene locus_tag LOCUS_25490 9101 10405 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_25490 10777 11484 gene locus_tag LOCUS_25500 10777 11484 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931060.1 protein_id gnl|my_center|LOCUS_25500 12153 11569 gene locus_tag LOCUS_25510 12153 11569 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_25510 12233 12309 gene locus_tag LOCUS_t00420 12233 12309 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13142 12534 gene locus_tag LOCUS_25520 13142 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 13569 13240 gene locus_tag LOCUS_25530 13569 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 13946 13572 gene locus_tag LOCUS_25540 13946 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 15177 14200 gene locus_tag LOCUS_25550 15177 14200 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_25550 15408 16340 gene locus_tag LOCUS_25560 gene cysK 15408 16340 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_25560 16522 20103 gene locus_tag LOCUS_25570 16522 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 21262 20234 gene locus_tag LOCUS_25580 21262 20234 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090603.1 protein_id gnl|my_center|LOCUS_25580 22656 21523 gene locus_tag LOCUS_25590 22656 21523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 22783 23205 gene locus_tag LOCUS_25600 22783 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 24475 23183 gene locus_tag LOCUS_25610 24475 23183 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_25610 24878 25360 gene locus_tag LOCUS_25620 24878 25360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 26900 25353 gene locus_tag LOCUS_25630 26900 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence055 2226 1735 gene locus_tag LOCUS_25640 2226 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 4826 2529 gene locus_tag LOCUS_25650 4826 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5572 9558 gene locus_tag LOCUS_25660 gene porU 5572 9558 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_25660 9694 12360 gene locus_tag LOCUS_25670 9694 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 12396 15737 gene locus_tag LOCUS_25680 12396 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 15859 16854 gene locus_tag LOCUS_25690 15859 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 17358 17987 gene locus_tag LOCUS_25700 17358 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 18067 19056 gene locus_tag LOCUS_25710 18067 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 19147 22542 gene locus_tag LOCUS_25720 19147 22542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 22752 24227 gene locus_tag LOCUS_25730 22752 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 24234 25082 gene locus_tag LOCUS_25740 24234 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence056 1683 4034 gene locus_tag LOCUS_25750 1683 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 4311 6095 gene locus_tag LOCUS_25760 4311 6095 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_25760 7652 6315 gene locus_tag LOCUS_25770 7652 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 9190 7964 gene locus_tag LOCUS_25780 9190 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 9501 12377 gene locus_tag LOCUS_25790 9501 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 14808 12700 gene locus_tag LOCUS_25800 14808 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 17850 15184 gene locus_tag LOCUS_25810 gene clpB 17850 15184 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_25810 18477 18184 gene locus_tag LOCUS_25820 18477 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 19107 18661 gene locus_tag LOCUS_25830 19107 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 20455 19343 gene locus_tag LOCUS_25840 20455 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 23364 20566 gene locus_tag LOCUS_25850 23364 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 23588 23361 gene locus_tag LOCUS_25860 23588 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 25728 23509 gene locus_tag LOCUS_25870 25728 23509 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_25870 <26285 25732 gene locus_tag LOCUS_25880 <26285 25732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532743.1:glycosyltransferase family 9 protein >Feature sequence057 3533 1374 gene locus_tag LOCUS_25890 3533 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3881 5023 gene locus_tag LOCUS_25900 3881 5023 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_25900 7011 5083 gene locus_tag LOCUS_25910 7011 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 8996 7203 gene locus_tag LOCUS_25920 8996 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 9641 10630 gene locus_tag LOCUS_25930 9641 10630 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_25930 10627 11532 gene locus_tag LOCUS_25940 gene cyoE 10627 11532 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_25940 12193 11585 gene locus_tag LOCUS_25950 12193 11585 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255319.1 protein_id gnl|my_center|LOCUS_25950 12549 12190 gene locus_tag LOCUS_25960 12549 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 13278 12562 gene locus_tag LOCUS_25970 13278 12562 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_25970 14986 13304 gene locus_tag LOCUS_25980 14986 13304 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_25980 15984 15001 gene locus_tag LOCUS_25990 gene coxB 15984 15001 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_25990 16817 15981 gene locus_tag LOCUS_26000 16817 15981 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885550.1 protein_id gnl|my_center|LOCUS_26000 17137 16814 gene locus_tag LOCUS_26010 17137 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 18371 17160 gene locus_tag LOCUS_26020 18371 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_26020 19088 18378 gene locus_tag LOCUS_26030 19088 18378 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_26030 19680 19093 gene locus_tag LOCUS_26040 19680 19093 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_26040 21146 19677 gene locus_tag LOCUS_26050 gene nrfD 21146 19677 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_26050 24199 21152 gene locus_tag LOCUS_26060 24199 21152 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_26060 24837 24187 gene locus_tag LOCUS_26070 24837 24187 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123848.1 protein_id gnl|my_center|LOCUS_26070 25208 25135 gene locus_tag LOCUS_t00430 25208 25135 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 25533 25270 gene locus_tag LOCUS_26080 25533 25270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence058 757 1257 gene locus_tag LOCUS_26090 757 1257 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020686.1 protein_id gnl|my_center|LOCUS_26090 1455 2603 gene locus_tag LOCUS_26100 1455 2603 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948101.1 protein_id gnl|my_center|LOCUS_26100 2783 4600 gene locus_tag LOCUS_26110 2783 4600 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990142.1 protein_id gnl|my_center|LOCUS_26110 4727 5989 gene locus_tag LOCUS_26120 4727 5989 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_26120 7143 6010 gene locus_tag LOCUS_26130 7143 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 8522 7158 gene locus_tag LOCUS_26140 8522 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 9619 8540 gene locus_tag LOCUS_26150 9619 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 10009 10656 gene locus_tag LOCUS_26160 gene kynB 10009 10656 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_26160 10846 11367 gene locus_tag LOCUS_26170 10846 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 11621 12421 gene locus_tag LOCUS_26180 11621 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 12523 15621 gene locus_tag LOCUS_26190 12523 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 16466 15999 gene locus_tag LOCUS_26200 gene ribE 16466 15999 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_26200 17784 16537 gene locus_tag LOCUS_26210 17784 16537 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_26210 18449 17805 gene locus_tag LOCUS_26220 18449 17805 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932438.1 protein_id gnl|my_center|LOCUS_26220 19657 18449 gene locus_tag LOCUS_26230 gene ribD 19657 18449 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_26230 21030 20287 gene locus_tag LOCUS_26240 21030 20287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_26240 22569 21094 gene locus_tag LOCUS_26250 22569 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 23764 23042 gene locus_tag LOCUS_26260 23764 23042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 23994 24383 gene locus_tag LOCUS_26270 23994 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 24801 24568 gene locus_tag LOCUS_26280 24801 24568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence059 2209 773 gene locus_tag LOCUS_26290 gene sufB 2209 773 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_26290 2985 2212 gene locus_tag LOCUS_26300 gene sufC 2985 2212 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_26300 3660 3142 gene locus_tag LOCUS_26310 3660 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4684 4397 gene locus_tag LOCUS_26320 4684 4397 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_26320 7976 4896 gene locus_tag LOCUS_26330 7976 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 8744 9757 gene locus_tag LOCUS_26340 8744 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 10717 9905 gene locus_tag LOCUS_26350 10717 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 10939 11316 gene locus_tag LOCUS_26360 10939 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 12595 11585 gene locus_tag LOCUS_26370 12595 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 14088 12799 gene locus_tag LOCUS_26380 14088 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 16168 14114 gene locus_tag LOCUS_26390 16168 14114 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143261.1 protein_id gnl|my_center|LOCUS_26390 17293 16478 gene locus_tag LOCUS_26400 17293 16478 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_26400 17856 17368 gene locus_tag LOCUS_26410 17856 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 17815 18321 gene locus_tag LOCUS_26420 17815 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 18384 19349 gene locus_tag LOCUS_26430 18384 19349 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_26430 19551 20849 gene locus_tag LOCUS_26440 19551 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 24587 21297 gene locus_tag LOCUS_26450 gene carB 24587 21297 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257643.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence060 3257 144 gene locus_tag LOCUS_26460 3257 144 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_26460 4307 3285 gene locus_tag LOCUS_26470 4307 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4622 4470 gene locus_tag LOCUS_26480 4622 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26480 4777 5244 gene locus_tag LOCUS_26490 4777 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 11143 5330 gene locus_tag LOCUS_26500 11143 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 12235 11570 gene locus_tag LOCUS_26510 12235 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 12918 12403 gene locus_tag LOCUS_26520 12918 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 13890 13153 gene locus_tag LOCUS_26530 13890 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 14512 14108 gene locus_tag LOCUS_26540 14512 14108 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090553.1 protein_id gnl|my_center|LOCUS_26540 15197 15505 gene locus_tag LOCUS_26550 15197 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 15566 16435 gene locus_tag LOCUS_26560 15566 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 16456 18096 gene locus_tag LOCUS_26570 16456 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 18627 19034 gene locus_tag LOCUS_26580 18627 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 19049 19918 gene locus_tag LOCUS_26590 19049 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 20015 22099 gene locus_tag LOCUS_26600 20015 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 22243 23355 gene locus_tag LOCUS_26610 22243 23355 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_26610 23854 23384 gene locus_tag LOCUS_26620 23854 23384 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_26620 24791 23868 gene locus_tag LOCUS_26630 gene ftsY 24791 23868 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence061 1790 465 gene locus_tag LOCUS_26640 gene glnA 1790 465 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_26640 3100 2318 gene locus_tag LOCUS_26650 3100 2318 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_26650 4378 3110 gene locus_tag LOCUS_26660 4378 3110 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_26660 6535 4937 gene locus_tag LOCUS_26670 6535 4937 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_26670 8581 6701 gene locus_tag LOCUS_26680 gene selB 8581 6701 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_26680 10222 8864 gene locus_tag LOCUS_26690 gene selA 10222 8864 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_26690 10347 10251 gene locus_tag LOCUS_t00440 10347 10251 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11304 10579 gene locus_tag LOCUS_26700 gene bshB1 11304 10579 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_26700 12800 11655 gene locus_tag LOCUS_26710 gene bshA 12800 11655 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_26710 14583 12952 gene locus_tag LOCUS_26720 gene bshC 14583 12952 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_26720 17952 14845 gene locus_tag LOCUS_26730 17952 14845 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207561.1 protein_id gnl|my_center|LOCUS_26730 19021 17978 gene locus_tag LOCUS_26740 19021 17978 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_26740 20414 19056 gene locus_tag LOCUS_26750 20414 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 21111 20431 gene locus_tag LOCUS_26760 21111 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 21347 22324 gene locus_tag LOCUS_26770 21347 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 <24540 22429 gene locus_tag LOCUS_26780 <24540 22429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence062 471 124 gene locus_tag LOCUS_26790 471 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1117 1713 gene locus_tag LOCUS_26800 1117 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26800 1778 1978 gene locus_tag LOCUS_26810 1778 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2198 2872 gene locus_tag LOCUS_26820 2198 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3272 2862 gene locus_tag LOCUS_26830 3272 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 3750 3154 gene locus_tag LOCUS_26840 3750 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26840 4158 4730 gene locus_tag LOCUS_26850 4158 4730 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_26850 4768 5358 gene locus_tag LOCUS_26860 4768 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 5355 8117 gene locus_tag LOCUS_26870 5355 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 8129 9568 gene locus_tag LOCUS_26880 8129 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 10028 11866 gene locus_tag LOCUS_26890 10028 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 13483 12071 gene locus_tag LOCUS_26900 13483 12071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_26900 14161 13484 gene locus_tag LOCUS_26910 14161 13484 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_26910 14384 14923 gene locus_tag LOCUS_26920 14384 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 15153 16307 gene locus_tag LOCUS_26930 15153 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 16326 17336 gene locus_tag LOCUS_26940 16326 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 17333 20416 gene locus_tag LOCUS_26950 17333 20416 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_26950 21113 21925 gene locus_tag LOCUS_26960 21113 21925 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_26960 21922 22803 gene locus_tag LOCUS_26970 21922 22803 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence063 114 3215 gene locus_tag LOCUS_26980 114 3215 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963680.1 protein_id gnl|my_center|LOCUS_26980 3341 4006 gene locus_tag LOCUS_26990 3341 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 4209 3985 gene locus_tag LOCUS_27000 4209 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 5201 6691 gene locus_tag LOCUS_27010 5201 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 6886 7488 gene locus_tag LOCUS_27020 gene pyrR 6886 7488 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_27020 7531 8583 gene locus_tag LOCUS_27030 7531 8583 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_27030 8580 9965 gene locus_tag LOCUS_27040 8580 9965 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_27040 9978 11075 gene locus_tag LOCUS_27050 9978 11075 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_27050 11102 13315 gene locus_tag LOCUS_27060 11102 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 13312 14832 gene locus_tag LOCUS_27070 13312 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 14810 16036 gene locus_tag LOCUS_27080 gene bshA 14810 16036 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_27080 16033 17001 gene locus_tag LOCUS_27090 16033 17001 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_27090 17079 17792 gene locus_tag LOCUS_27100 17079 17792 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_27100 17789 18691 gene locus_tag LOCUS_27110 17789 18691 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_27110 18684 19769 gene locus_tag LOCUS_27120 18684 19769 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_27120 19770 20750 gene locus_tag LOCUS_27130 19770 20750 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_27130 20771 20935 gene locus_tag LOCUS_27140 20771 20935 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_27140 21027 21479 gene locus_tag LOCUS_27150 21027 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 21554 22354 gene locus_tag LOCUS_27160 21554 22354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 22351 22893 gene locus_tag LOCUS_27170 22351 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence064 <1 2506 gene locus_tag LOCUS_27180 <1 2506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210266672.1:DEAD/DEAH box helicase 2425 3234 gene locus_tag LOCUS_27190 2425 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3312 3578 gene locus_tag LOCUS_27200 3312 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3779 4051 gene locus_tag LOCUS_27210 3779 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 4801 4022 gene locus_tag LOCUS_27220 4801 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5345 7780 gene locus_tag LOCUS_27230 5345 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 7768 8427 gene locus_tag LOCUS_27240 7768 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 8428 9870 gene locus_tag LOCUS_27250 8428 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9867 10316 gene locus_tag LOCUS_27260 9867 10316 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_27260 10502 10705 gene locus_tag LOCUS_27270 10502 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 11282 10635 gene locus_tag LOCUS_27280 11282 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 11744 11286 gene locus_tag LOCUS_27290 11744 11286 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_27290 12987 11731 gene locus_tag LOCUS_27300 12987 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 13141 13536 gene locus_tag LOCUS_27310 13141 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 14369 13800 gene locus_tag LOCUS_27320 14369 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 15028 16947 gene locus_tag LOCUS_27330 15028 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 16944 17456 gene locus_tag LOCUS_27340 16944 17456 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_27340 17551 19266 gene locus_tag LOCUS_27350 17551 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 19279 21285 gene locus_tag LOCUS_27360 19279 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence065 773 6 gene locus_tag LOCUS_27370 773 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 1726 1992 gene locus_tag LOCUS_27380 1726 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 3925 3158 gene locus_tag LOCUS_27390 gene arsM 3925 3158 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_27390 4226 3951 gene locus_tag LOCUS_27400 4226 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 4861 5514 gene locus_tag LOCUS_27410 gene lepB 4861 5514 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_27410 5750 5454 gene locus_tag LOCUS_27420 5750 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 6629 5775 gene locus_tag LOCUS_27430 6629 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 7409 7669 gene locus_tag LOCUS_27440 7409 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7819 8112 gene locus_tag LOCUS_27450 7819 8112 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_27450 8103 8609 gene locus_tag LOCUS_27460 8103 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 8617 9150 gene locus_tag LOCUS_27470 8617 9150 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_27470 9177 10559 gene locus_tag LOCUS_27480 9177 10559 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_27480 10574 11062 gene locus_tag LOCUS_27490 gene nuoE 10574 11062 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_27490 11181 12488 gene locus_tag LOCUS_27500 gene nuoF 11181 12488 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_27500 12537 14177 gene locus_tag LOCUS_27510 12537 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 14189 15280 gene locus_tag LOCUS_27520 gene nuoH 14189 15280 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_27520 15286 15870 gene locus_tag LOCUS_27530 15286 15870 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_27530 15955 16512 gene locus_tag LOCUS_27540 15955 16512 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_27540 16524 17099 gene locus_tag LOCUS_27550 16524 17099 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_27550 17128 17634 gene locus_tag LOCUS_27560 17128 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 17671 18237 gene locus_tag LOCUS_27570 17671 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 18267 19490 gene locus_tag LOCUS_27580 18267 19490 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_27580 19693 20238 gene locus_tag LOCUS_27590 19693 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 20687 21163 gene locus_tag LOCUS_27600 20687 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence066 1846 92 gene locus_tag LOCUS_27610 1846 92 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207976.1 protein_id gnl|my_center|LOCUS_27610 2050 1889 gene locus_tag LOCUS_27620 2050 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2155 5331 gene locus_tag LOCUS_27630 2155 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5340 6464 gene locus_tag LOCUS_27640 5340 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6587 8122 gene locus_tag LOCUS_27650 6587 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 8133 8714 gene locus_tag LOCUS_27660 8133 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 8711 9538 gene locus_tag LOCUS_27670 8711 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 10081 11073 gene locus_tag LOCUS_27680 10081 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 11120 12127 gene locus_tag LOCUS_27690 11120 12127 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943138.1 protein_id gnl|my_center|LOCUS_27690 12311 13426 gene locus_tag LOCUS_27700 12311 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 13762 15762 gene locus_tag LOCUS_27710 13762 15762 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_27710 15773 18550 gene locus_tag LOCUS_27720 15773 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 18602 20596 gene locus_tag LOCUS_27730 18602 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence067 1339 344 gene locus_tag LOCUS_27740 gene mltG 1339 344 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_27740 1505 1341 gene locus_tag LOCUS_27750 1505 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1962 1498 gene locus_tag LOCUS_27760 gene ruvX 1962 1498 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_27760 2240 2905 gene locus_tag LOCUS_27770 2240 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 3071 4075 gene locus_tag LOCUS_27780 3071 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 4443 4829 gene locus_tag LOCUS_27790 4443 4829 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_27790 4885 5313 gene locus_tag LOCUS_27800 4885 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 5460 6662 gene locus_tag LOCUS_27810 5460 6662 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_27810 6875 7741 gene locus_tag LOCUS_27820 6875 7741 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_27820 8428 7823 gene locus_tag LOCUS_27830 gene pyrE 8428 7823 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_27830 9031 8447 gene locus_tag LOCUS_27840 9031 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 10044 9262 gene locus_tag LOCUS_27850 10044 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 10438 10896 gene locus_tag LOCUS_27860 10438 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 11085 12608 gene locus_tag LOCUS_27870 11085 12608 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_27870 12977 12609 gene locus_tag LOCUS_27880 12977 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 14257 13145 gene locus_tag LOCUS_27890 14257 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 14665 15543 gene locus_tag LOCUS_27900 14665 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 16240 15680 gene locus_tag LOCUS_27910 16240 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 19514 16254 gene locus_tag LOCUS_27920 19514 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence068 759 298 gene locus_tag LOCUS_27930 759 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 961 2277 gene locus_tag LOCUS_27940 961 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2408 3316 gene locus_tag LOCUS_27950 2408 3316 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 protein_id gnl|my_center|LOCUS_27950 5993 3294 gene locus_tag LOCUS_27960 5993 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 6373 6759 gene locus_tag LOCUS_27970 6373 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 6820 7623 gene locus_tag LOCUS_27980 6820 7623 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_27980 7620 8567 gene locus_tag LOCUS_27990 7620 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 8564 8983 gene locus_tag LOCUS_28000 8564 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28000 8970 9428 gene locus_tag LOCUS_28010 8970 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28010 9464 10030 gene locus_tag LOCUS_28020 gene folE 9464 10030 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_28020 10299 10853 gene locus_tag LOCUS_28030 gene dcd 10299 10853 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_28030 11576 10881 gene locus_tag LOCUS_28040 11576 10881 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_28040 12535 11603 gene locus_tag LOCUS_28050 12535 11603 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928785.1 protein_id gnl|my_center|LOCUS_28050 12959 12576 gene locus_tag LOCUS_28060 12959 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064249.1 protein_id gnl|my_center|LOCUS_28060 13892 13077 gene locus_tag LOCUS_28070 13892 13077 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_28070 14274 13981 gene locus_tag LOCUS_28080 14274 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28080 14839 14396 gene locus_tag LOCUS_28090 14839 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 15477 14842 gene locus_tag LOCUS_28100 15477 14842 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258089.1 protein_id gnl|my_center|LOCUS_28100 16426 15491 gene locus_tag LOCUS_28110 gene trxB 16426 15491 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_28110 17563 16694 gene locus_tag LOCUS_28120 17563 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence069 2 190 gene locus_tag LOCUS_28130 2 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 250 1218 gene locus_tag LOCUS_28140 250 1218 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 protein_id gnl|my_center|LOCUS_28140 1226 2329 gene locus_tag LOCUS_28150 gene prfA 1226 2329 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_28150 2615 4075 gene locus_tag LOCUS_28160 2615 4075 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_28160 4089 5432 gene locus_tag LOCUS_28170 4089 5432 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582601.1 protein_id gnl|my_center|LOCUS_28170 5429 5650 gene locus_tag LOCUS_28180 5429 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 5761 6537 gene locus_tag LOCUS_28190 gene prmC 5761 6537 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_28190 7614 10544 gene locus_tag LOCUS_28200 7614 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 10834 11289 gene locus_tag LOCUS_28210 10834 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 12562 12774 gene locus_tag LOCUS_28220 12562 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 12843 15422 gene locus_tag LOCUS_28230 12843 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence070 1476 214 gene locus_tag LOCUS_28240 1476 214 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_28240 2009 1473 gene locus_tag LOCUS_28250 2009 1473 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870384.1 protein_id gnl|my_center|LOCUS_28250 2593 2006 gene locus_tag LOCUS_28260 gene pgsA 2593 2006 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_28260 4892 2844 gene locus_tag LOCUS_28270 4892 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 5954 5037 gene locus_tag LOCUS_28280 5954 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 6845 5976 gene locus_tag LOCUS_28290 6845 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 7557 9410 gene locus_tag LOCUS_28300 7557 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 9674 10015 gene locus_tag LOCUS_28310 9674 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 10107 10268 gene locus_tag LOCUS_28320 10107 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 10429 11019 gene locus_tag LOCUS_28330 gene thpR 10429 11019 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_28330 11244 12329 gene locus_tag LOCUS_28340 gene recA 11244 12329 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_28340 12663 13304 gene locus_tag LOCUS_28350 12663 13304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 14897 13572 gene locus_tag LOCUS_28360 14897 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 16424 15003 gene locus_tag LOCUS_28370 16424 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence071 3431 1290 gene locus_tag LOCUS_28380 3431 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 4720 3428 gene locus_tag LOCUS_28390 4720 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 4884 5186 gene locus_tag LOCUS_28400 4884 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 5497 5081 gene locus_tag LOCUS_28410 5497 5081 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_28410 6271 5609 gene locus_tag LOCUS_28420 6271 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 7528 6845 gene locus_tag LOCUS_28430 7528 6845 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_28430 8132 7497 gene locus_tag LOCUS_28440 gene ccmA 8132 7497 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_28440 10578 8332 gene locus_tag LOCUS_28450 10578 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 12538 11057 gene locus_tag LOCUS_28460 gene gltA 12538 11057 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_28460 13406 12561 gene locus_tag LOCUS_28470 13406 12561 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_28470 13767 14321 gene locus_tag LOCUS_28480 13767 14321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 14481 14556 gene locus_tag LOCUS_t00450 14481 14556 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14900 14673 gene locus_tag LOCUS_28490 14900 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 14932 16146 gene locus_tag LOCUS_28500 14932 16146 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141450.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28500 16513 16196 gene locus_tag LOCUS_28510 16513 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence072 177 1436 gene locus_tag LOCUS_28520 177 1436 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_28520 1647 2198 gene locus_tag LOCUS_28530 1647 2198 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_28530 3769 2360 gene locus_tag LOCUS_28540 gene cysS 3769 2360 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883567.1 protein_id gnl|my_center|LOCUS_28540 4878 3766 gene locus_tag LOCUS_28550 4878 3766 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_28550 6874 5378 gene locus_tag LOCUS_28560 6874 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 7899 7084 gene locus_tag LOCUS_28570 7899 7084 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679505.1 protein_id gnl|my_center|LOCUS_28570 9164 8094 gene locus_tag LOCUS_28580 9164 8094 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_28580 10107 9502 gene locus_tag LOCUS_28590 10107 9502 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_28590 11300 10104 gene locus_tag LOCUS_28600 11300 10104 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_28600 12362 11403 gene locus_tag LOCUS_28610 gene queA 12362 11403 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_28610 13576 12512 gene locus_tag LOCUS_28620 gene ruvB 13576 12512 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_28620 14236 13637 gene locus_tag LOCUS_28630 gene ruvA 14236 13637 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_28630 14733 14233 gene locus_tag LOCUS_28640 gene ruvC 14733 14233 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_28640 15667 14915 gene locus_tag LOCUS_28650 15667 14915 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence073 1295 2830 gene locus_tag LOCUS_28660 1295 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2869 3342 gene locus_tag LOCUS_28670 2869 3342 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_28670 3623 4420 gene locus_tag LOCUS_28680 3623 4420 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_28680 4616 5287 gene locus_tag LOCUS_28690 4616 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 5700 6545 gene locus_tag LOCUS_28700 gene htpX 5700 6545 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_28700 7109 8407 gene locus_tag LOCUS_28710 7109 8407 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941517.1 protein_id gnl|my_center|LOCUS_28710 8555 9346 gene locus_tag LOCUS_28720 8555 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 11319 9358 gene locus_tag LOCUS_28730 gene gyrB 11319 9358 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_28730 11761 11462 gene locus_tag LOCUS_28740 11761 11462 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405456.1 protein_id gnl|my_center|LOCUS_28740 12674 11982 gene locus_tag LOCUS_28750 12674 11982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_28750 12726 12962 gene locus_tag LOCUS_28760 12726 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 13053 14681 gene locus_tag LOCUS_28770 13053 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 14825 15364 gene locus_tag LOCUS_28780 14825 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 15388 15693 gene locus_tag LOCUS_28790 15388 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence074 4488 1189 gene locus_tag LOCUS_28800 4488 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 4885 6939 gene locus_tag LOCUS_28810 4885 6939 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_28810 7227 7553 gene locus_tag LOCUS_28820 7227 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 7771 8919 gene locus_tag LOCUS_28830 7771 8919 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_28830 8938 9846 gene locus_tag LOCUS_28840 8938 9846 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_28840 9850 10845 gene locus_tag LOCUS_28850 9850 10845 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_28850 10842 11627 gene locus_tag LOCUS_28860 10842 11627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_28860 11645 12388 gene locus_tag LOCUS_28870 11645 12388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944002.1 protein_id gnl|my_center|LOCUS_28870 12504 13421 gene locus_tag LOCUS_28880 12504 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 14554 13649 gene locus_tag LOCUS_28890 14554 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 15295 14609 gene locus_tag LOCUS_28900 15295 14609 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence075 65 1642 gene locus_tag LOCUS_28910 65 1642 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_28910 2093 1704 gene locus_tag LOCUS_28920 2093 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3002 6040 gene locus_tag LOCUS_28930 3002 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 6080 6325 gene locus_tag LOCUS_28940 6080 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 7508 6870 gene locus_tag LOCUS_28950 7508 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 10689 7573 gene locus_tag LOCUS_28960 10689 7573 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_28960 12242 10686 gene locus_tag LOCUS_28970 12242 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 13510 12239 gene locus_tag LOCUS_28980 13510 12239 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence076 444 1376 gene locus_tag LOCUS_28990 444 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 1373 1879 gene locus_tag LOCUS_29000 1373 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2042 3178 gene locus_tag LOCUS_29010 2042 3178 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_29010 3283 3897 gene locus_tag LOCUS_29020 3283 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3966 4730 gene locus_tag LOCUS_29030 gene yqeB 3966 4730 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_29030 6250 4922 gene locus_tag LOCUS_29040 6250 4922 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_29040 7476 6499 gene locus_tag LOCUS_29050 7476 6499 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_29050 8010 7498 gene locus_tag LOCUS_29060 8010 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 9037 8063 gene locus_tag LOCUS_29070 gene gmd 9037 8063 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_29070 9276 11192 gene locus_tag LOCUS_29080 9276 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 11520 11248 gene locus_tag LOCUS_29090 11520 11248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 11696 14245 gene locus_tag LOCUS_29100 11696 14245 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence077 102 752 gene locus_tag LOCUS_29110 102 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 792 1205 gene locus_tag LOCUS_29120 792 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1292 2305 gene locus_tag LOCUS_29130 1292 2305 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_29130 3343 2357 gene locus_tag LOCUS_29140 3343 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 4442 3732 gene locus_tag LOCUS_29150 4442 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 8218 5132 gene locus_tag LOCUS_29160 8218 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 8404 9294 gene locus_tag LOCUS_29170 gene xerC 8404 9294 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141123.1 protein_id gnl|my_center|LOCUS_29170 9559 10719 gene locus_tag LOCUS_29180 9559 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678794.1 protein_id gnl|my_center|LOCUS_29180 11399 11695 gene locus_tag LOCUS_29190 11399 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 11875 12861 gene locus_tag LOCUS_29200 11875 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 12858 13292 gene locus_tag LOCUS_29210 12858 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 13289 13798 gene locus_tag LOCUS_29220 13289 13798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence078 2795 519 gene locus_tag LOCUS_29230 gene gatE 2795 519 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_29230 3006 4742 gene locus_tag LOCUS_29240 3006 4742 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_29240 5041 6186 gene locus_tag LOCUS_29250 5041 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7421 6447 gene locus_tag LOCUS_29260 7421 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 7639 8052 gene locus_tag LOCUS_29270 7639 8052 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_29270 8259 8759 gene locus_tag LOCUS_29280 8259 8759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 8837 10294 gene locus_tag LOCUS_29290 gene gltX 8837 10294 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_29290 10328 10801 gene locus_tag LOCUS_29300 10328 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 11000 12310 gene locus_tag LOCUS_29310 11000 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 12396 13694 gene locus_tag LOCUS_29320 12396 13694 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence079 629 1756 gene locus_tag LOCUS_29330 629 1756 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975137.1 protein_id gnl|my_center|LOCUS_29330 1777 2565 gene locus_tag LOCUS_29340 1777 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 4156 2624 gene locus_tag LOCUS_29350 4156 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 5685 4198 gene locus_tag LOCUS_29360 5685 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 6857 5682 gene locus_tag LOCUS_29370 6857 5682 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_29370 7300 6893 gene locus_tag LOCUS_29380 7300 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 8337 7312 gene locus_tag LOCUS_29390 8337 7312 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_29390 8490 9710 gene locus_tag LOCUS_29400 8490 9710 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_29400 9851 10306 gene locus_tag LOCUS_29410 9851 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 10291 10515 gene locus_tag LOCUS_29420 10291 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 10809 10399 gene locus_tag LOCUS_29430 10809 10399 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088276.1 protein_id gnl|my_center|LOCUS_29430 11227 10907 gene locus_tag LOCUS_29440 11227 10907 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_29440 11827 11342 gene locus_tag LOCUS_29450 11827 11342 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_29450 13094 11814 gene locus_tag LOCUS_29460 13094 11814 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_29460 13417 13091 gene locus_tag LOCUS_29470 13417 13091 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_29470 <13983 13410 gene locus_tag LOCUS_29480 <13983 13410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173864.1:Fe-S cluster assembly protein SufD >Feature sequence080 272 817 gene locus_tag LOCUS_29490 272 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 916 992 gene locus_tag LOCUS_t00460 916 992 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1063 1638 gene locus_tag LOCUS_29500 1063 1638 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_29500 1897 1685 gene locus_tag LOCUS_29510 1897 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1978 3711 gene locus_tag LOCUS_29520 1978 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 4919 3846 gene locus_tag LOCUS_29530 4919 3846 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_29530 6265 5189 gene locus_tag LOCUS_29540 gene rlmN 6265 5189 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_29540 6594 6995 gene locus_tag LOCUS_29550 6594 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 7146 7802 gene locus_tag LOCUS_29560 7146 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 7820 8623 gene locus_tag LOCUS_29570 7820 8623 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403116.1 protein_id gnl|my_center|LOCUS_29570 8663 9688 gene locus_tag LOCUS_29580 8663 9688 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_29580 9681 10280 gene locus_tag LOCUS_29590 gene gmhB 9681 10280 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_29590 10405 11637 gene locus_tag LOCUS_29600 10405 11637 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence081 1253 198 gene locus_tag LOCUS_29610 1253 198 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_29610 1735 1250 gene locus_tag LOCUS_29620 1735 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2114 1686 gene locus_tag LOCUS_29630 2114 1686 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_29630 2611 2156 gene locus_tag LOCUS_29640 2611 2156 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_29640 3546 2662 gene locus_tag LOCUS_29650 3546 2662 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_29650 5764 3608 gene locus_tag LOCUS_29660 5764 3608 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037047.1 protein_id gnl|my_center|LOCUS_29660 7010 5916 gene locus_tag LOCUS_29670 7010 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 7573 6995 gene locus_tag LOCUS_29680 7573 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 9857 7620 gene locus_tag LOCUS_29690 9857 7620 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839903.1 protein_id gnl|my_center|LOCUS_29690 10383 9979 gene locus_tag LOCUS_29700 10383 9979 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_29700 11203 10376 gene locus_tag LOCUS_29710 11203 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 11338 11541 gene locus_tag LOCUS_29720 11338 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11954 12883 gene locus_tag LOCUS_29730 11954 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence082 2528 366 gene locus_tag LOCUS_29740 2528 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2654 3505 gene locus_tag LOCUS_29750 2654 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 3519 4262 gene locus_tag LOCUS_29760 gene truA 3519 4262 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_29760 4403 5050 gene locus_tag LOCUS_29770 gene fsa 4403 5050 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_29770 5072 5236 gene locus_tag LOCUS_29780 5072 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 5290 6582 gene locus_tag LOCUS_29790 gene purB 5290 6582 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_29790 6822 7457 gene locus_tag LOCUS_29800 6822 7457 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_29800 7823 7548 gene locus_tag LOCUS_29810 7823 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 8261 8998 gene locus_tag LOCUS_29820 gene pssA 8261 8998 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_29820 9805 9969 gene locus_tag LOCUS_29830 9805 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 >Feature sequence083 <1 1873 gene locus_tag LOCUS_29840 <1 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943528.1:CxxxxCH/CxxCH domain-containing protein 3333 2278 gene locus_tag LOCUS_29850 3333 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 6656 3726 gene locus_tag LOCUS_29860 6656 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 8361 8035 gene locus_tag LOCUS_29870 8361 8035 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384063.1 protein_id gnl|my_center|LOCUS_29870 9655 8519 gene locus_tag LOCUS_29880 9655 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 10104 9652 gene locus_tag LOCUS_29890 10104 9652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_29890 11446 10013 gene locus_tag LOCUS_29900 11446 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 11918 11619 gene locus_tag LOCUS_29910 11918 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence084 272 673 gene locus_tag LOCUS_29920 272 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 950 2095 gene locus_tag LOCUS_29930 950 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 2092 2451 gene locus_tag LOCUS_29940 2092 2451 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921246.1 protein_id gnl|my_center|LOCUS_29940 2781 2563 gene locus_tag LOCUS_29950 2781 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2905 4650 gene locus_tag LOCUS_29960 2905 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4878 5612 gene locus_tag LOCUS_29970 4878 5612 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_29970 5785 6096 gene locus_tag LOCUS_29980 5785 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 6273 7967 gene locus_tag LOCUS_29990 6273 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9185 8307 gene locus_tag LOCUS_30000 9185 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 9464 9949 gene locus_tag LOCUS_30010 9464 9949 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_30010 11193 10171 gene locus_tag LOCUS_30020 11193 10171 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_30020 >Feature sequence085 641 934 gene locus_tag LOCUS_30030 641 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 4432 4830 gene locus_tag LOCUS_30040 4432 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 4858 8187 gene locus_tag LOCUS_30050 4858 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 8564 8209 gene locus_tag LOCUS_tm00010 8564 8209 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9354 8599 gene locus_tag LOCUS_30060 9354 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 9414 10334 gene locus_tag LOCUS_30070 9414 10334 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence086 5 763 gene locus_tag LOCUS_30080 5 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 5546 993 gene locus_tag LOCUS_30090 5546 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 9337 5768 gene locus_tag LOCUS_30100 9337 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 <10243 9433 gene locus_tag LOCUS_30110 <10243 9433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763529.1:S8 family peptidase >Feature sequence087 1282 2493 gene locus_tag LOCUS_30120 1282 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2441 3511 gene locus_tag LOCUS_30130 2441 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3748 4374 gene locus_tag LOCUS_30140 3748 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4387 4713 gene locus_tag LOCUS_30150 4387 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 4710 6866 gene locus_tag LOCUS_30160 4710 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 6984 8228 gene locus_tag LOCUS_30170 6984 8228 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_30170 8218 8811 gene locus_tag LOCUS_30180 8218 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 8783 9304 gene locus_tag LOCUS_30190 8783 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence088 1042 215 gene locus_tag LOCUS_30200 1042 215 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_30200 2498 1128 gene locus_tag LOCUS_30210 2498 1128 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_30210 4036 3080 gene locus_tag LOCUS_30220 4036 3080 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064366.1 protein_id gnl|my_center|LOCUS_30220 5377 4562 gene locus_tag LOCUS_30230 gene mpgP 5377 4562 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_30230 6109 8193 gene locus_tag LOCUS_30240 6109 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 8243 9460 gene locus_tag LOCUS_30250 8243 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence089 1119 2987 gene locus_tag LOCUS_30260 1119 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3110 3982 gene locus_tag LOCUS_30270 3110 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 4360 4130 gene locus_tag LOCUS_30280 4360 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 4322 4471 gene locus_tag LOCUS_30290 4322 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 7082 4764 gene locus_tag LOCUS_30300 7082 4764 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_30300 7446 8738 gene locus_tag LOCUS_30310 7446 8738 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_30310 8751 8963 gene locus_tag LOCUS_30320 8751 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence090 139 360 gene locus_tag LOCUS_30330 139 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 951 292 gene locus_tag LOCUS_30340 951 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2525 1533 gene locus_tag LOCUS_30350 2525 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 4012 3071 gene locus_tag LOCUS_30360 4012 3071 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_30360 4594 4824 gene locus_tag LOCUS_30370 4594 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 4933 5472 gene locus_tag LOCUS_30380 4933 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 5472 5660 gene locus_tag LOCUS_30390 5472 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 6131 5682 gene locus_tag LOCUS_30400 6131 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 6406 6996 gene locus_tag LOCUS_30410 6406 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 7262 8593 gene locus_tag LOCUS_30420 7262 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence091 209 1294 gene locus_tag LOCUS_30430 209 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 2243 1317 gene locus_tag LOCUS_30440 2243 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 3348 2353 gene locus_tag LOCUS_30450 gene xerD 3348 2353 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_30450 4152 3364 gene locus_tag LOCUS_30460 4152 3364 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066731.1 protein_id gnl|my_center|LOCUS_30460 5333 4152 gene locus_tag LOCUS_30470 gene rodA 5333 4152 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_30470 5629 6801 gene locus_tag LOCUS_30480 5629 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 7294 6938 gene locus_tag LOCUS_30490 7294 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 7574 7275 gene locus_tag LOCUS_30500 7574 7275 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence092 1958 903 gene locus_tag LOCUS_30510 1958 903 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_30510 2140 2066 gene locus_tag LOCUS_t00470 2140 2066 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2255 2178 gene locus_tag LOCUS_t00480 2255 2178 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2626 2300 gene locus_tag LOCUS_30520 2626 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3403 2807 gene locus_tag LOCUS_30530 gene gmhA 3403 2807 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_30530 4164 3400 gene locus_tag LOCUS_30540 4164 3400 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_30540 6743 4161 gene locus_tag LOCUS_30550 gene alaS 6743 4161 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_30550 7037 7987 gene locus_tag LOCUS_30560 7037 7987 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence093 749 132 gene locus_tag LOCUS_30570 749 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1986 736 gene locus_tag LOCUS_30580 1986 736 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_30580 4262 2178 gene locus_tag LOCUS_30590 4262 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4626 4468 gene locus_tag LOCUS_30600 4626 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 4965 4684 gene locus_tag LOCUS_30610 4965 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 5740 4994 gene locus_tag LOCUS_30620 5740 4994 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_30620 6203 5829 gene locus_tag LOCUS_30630 6203 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6331 6552 gene locus_tag LOCUS_30640 6331 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 6554 7459 gene locus_tag LOCUS_30650 6554 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence094 1067 258 gene locus_tag LOCUS_30660 1067 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 1234 1243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3151 1751 gene locus_tag LOCUS_30670 gene sthA 3151 1751 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_30670 4093 3287 gene locus_tag LOCUS_30680 4093 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 4331 5290 gene locus_tag LOCUS_30690 4331 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 7138 5546 gene locus_tag LOCUS_30700 7138 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence095 61 1611 gene locus_tag LOCUS_30710 61 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1628 3139 gene locus_tag LOCUS_30720 1628 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3226 6033 gene locus_tag LOCUS_30730 3226 6033 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence096 135 653 gene locus_tag LOCUS_30740 135 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1532 1158 gene locus_tag LOCUS_30750 1532 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2687 1653 gene locus_tag LOCUS_30760 2687 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 3264 2653 gene locus_tag LOCUS_30770 3264 2653 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_30770 3446 6448 gene locus_tag LOCUS_30780 3446 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence097 1606 833 gene locus_tag LOCUS_30790 1606 833 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 protein_id gnl|my_center|LOCUS_30790 3137 1941 gene locus_tag LOCUS_30800 3137 1941 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_30800 5083 3188 gene locus_tag LOCUS_30810 5083 3188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_30810 6210 5080 gene locus_tag LOCUS_30820 6210 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence098 2734 1127 gene locus_tag LOCUS_30830 2734 1127 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_30830 5934 2863 gene locus_tag LOCUS_30840 5934 2863 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence099 2124 277 gene locus_tag LOCUS_30850 2124 277 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_30850 2452 2243 gene locus_tag LOCUS_30860 2452 2243 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173482.1 protein_id gnl|my_center|LOCUS_30860 4114 3239 gene locus_tag LOCUS_30870 4114 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 4780 4118 gene locus_tag LOCUS_30880 4780 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 >Feature sequence100 367 1908 gene locus_tag LOCUS_30890 367 1908 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_30890 1905 2576 gene locus_tag LOCUS_30900 1905 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2913 3374 gene locus_tag LOCUS_30910 2913 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3648 4172 gene locus_tag LOCUS_30920 3648 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 4176 4400 gene locus_tag LOCUS_30930 4176 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence101 916 716 gene locus_tag LOCUS_30940 gene rpmB 916 716 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_30940 1135 2430 gene locus_tag LOCUS_30950 1135 2430 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_30950 2448 3344 gene locus_tag LOCUS_30960 2448 3344 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_30960 3341 4150 gene locus_tag LOCUS_30970 3341 4150 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804269.1 protein_id gnl|my_center|LOCUS_30970 4730 4125 gene locus_tag LOCUS_30980 4730 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence102 651 2390 gene locus_tag LOCUS_30990 651 2390 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942011.1 protein_id gnl|my_center|LOCUS_30990 2585 3808 gene locus_tag LOCUS_31000 2585 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_31000 >Feature sequence103 <1 1018 gene locus_tag LOCUS_31010 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007757189.1:JAB-like toxin 1 domain-containing protein 1795 2877 gene locus_tag LOCUS_31020 1795 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 2861 3217 gene locus_tag LOCUS_31030 2861 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 3555 3992 gene locus_tag LOCUS_31040 3555 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 >Feature sequence104 405 1229 gene locus_tag LOCUS_31050 405 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1282 1482 gene locus_tag LOCUS_31060 1282 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1559 3034 gene locus_tag LOCUS_31070 1559 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3215 3634 gene locus_tag LOCUS_31080 3215 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence105 557 1852 gene locus_tag LOCUS_31090 557 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_31090 2620 2108 gene locus_tag LOCUS_31100 2620 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31100 3138 2659 gene locus_tag LOCUS_31110 3138 2659 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888396.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence106 312 79 gene locus_tag LOCUS_31120 312 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1786 758 gene locus_tag LOCUS_31130 gene amrS 1786 758 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_31130 2799 2047 gene locus_tag LOCUS_31140 2799 2047 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence107 <1 841 gene locus_tag LOCUS_31150 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797516.1:M28 family peptidase 845 1387 gene locus_tag LOCUS_31160 845 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1384 2034 gene locus_tag LOCUS_31170 gene rsmD 1384 2034 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_31170 1985 2518 gene locus_tag LOCUS_31180 gene coaD 1985 2518 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932645.1 protein_id gnl|my_center|LOCUS_31180