>Feature sequence001 513 1193 gene locus_tag LOCUS_00010 513 1193 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_00010 1435 1247 gene locus_tag LOCUS_00020 1435 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1779 1603 gene locus_tag LOCUS_00030 1779 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2065 2535 gene locus_tag LOCUS_00040 2065 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2591 3064 gene locus_tag LOCUS_00050 2591 3064 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_00050 4900 3068 gene locus_tag LOCUS_00060 4900 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5574 6809 gene locus_tag LOCUS_00070 5574 6809 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941608.1 protein_id gnl|my_center|LOCUS_00070 6905 7258 gene locus_tag LOCUS_00080 6905 7258 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_00080 8927 7422 gene locus_tag LOCUS_00090 8927 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9363 10718 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggattgctcacgggccggggtcagttacact 13262 10695 gene locus_tag LOCUS_00100 13262 10695 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926995.1 protein_id gnl|my_center|LOCUS_00100 14835 13255 gene locus_tag LOCUS_00110 14835 13255 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_00110 15476 14832 gene locus_tag LOCUS_00120 15476 14832 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932831.1 protein_id gnl|my_center|LOCUS_00120 18068 15567 gene locus_tag LOCUS_00130 18068 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 19224 18370 gene locus_tag LOCUS_00140 19224 18370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 19415 19945 gene locus_tag LOCUS_00150 19415 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19938 20201 gene locus_tag LOCUS_00160 19938 20201 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 protein_id gnl|my_center|LOCUS_00160 20198 20614 gene locus_tag LOCUS_00170 20198 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21585 20542 gene locus_tag LOCUS_00180 21585 20542 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_00180 21728 22654 gene locus_tag LOCUS_00190 21728 22654 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_00190 23268 22702 gene locus_tag LOCUS_00200 23268 22702 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_00200 23504 23340 gene locus_tag LOCUS_00210 23504 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23433 24110 gene locus_tag LOCUS_00220 gene hisF 23433 24110 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_00220 24413 26380 gene locus_tag LOCUS_00230 24413 26380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27618 26401 gene locus_tag LOCUS_00240 27618 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28190 27669 gene locus_tag LOCUS_00250 gene infC 28190 27669 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 189 377 gene locus_tag LOCUS_00260 189 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 389 580 gene locus_tag LOCUS_00270 389 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 708 890 gene locus_tag LOCUS_00280 708 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 1012 1266 gene locus_tag LOCUS_00290 1012 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 1492 1280 gene locus_tag LOCUS_00300 1492 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 1374 2102 gene locus_tag LOCUS_00310 1374 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3795 2479 gene locus_tag LOCUS_00320 3795 2479 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_00320 3748 3957 gene locus_tag LOCUS_00330 3748 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 3961 4170 gene locus_tag LOCUS_00340 3961 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 5295 4234 gene locus_tag LOCUS_00350 5295 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5998 6615 gene locus_tag LOCUS_00360 5998 6615 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_00360 6615 7661 gene locus_tag LOCUS_00370 gene ruvB 6615 7661 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_00370 7654 8541 gene locus_tag LOCUS_00380 7654 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 8676 9416 gene locus_tag LOCUS_00390 8676 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 10551 9535 gene locus_tag LOCUS_00400 10551 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 11035 10613 gene locus_tag LOCUS_00410 11035 10613 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_00410 11759 11280 gene locus_tag LOCUS_00420 11759 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12198 15443 gene locus_tag LOCUS_00430 12198 15443 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 protein_id gnl|my_center|LOCUS_00430 15738 17687 gene locus_tag LOCUS_00440 gene acs 15738 17687 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_00440 19024 17801 gene locus_tag LOCUS_00450 19024 17801 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_00450 19409 19711 gene locus_tag LOCUS_00460 19409 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 19888 22260 gene locus_tag LOCUS_00470 19888 22260 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_00470 22418 23083 gene locus_tag LOCUS_00480 22418 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence003 1067 390 gene locus_tag LOCUS_00490 1067 390 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_00490 2497 1064 gene locus_tag LOCUS_00500 2497 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3628 2519 gene locus_tag LOCUS_00510 3628 2519 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_00510 4580 3741 gene locus_tag LOCUS_00520 4580 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 5494 4766 gene locus_tag LOCUS_00530 5494 4766 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_00530 5670 5527 gene locus_tag LOCUS_00540 5670 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7318 5957 gene locus_tag LOCUS_00550 7318 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10403 7404 gene locus_tag LOCUS_00560 10403 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 12387 10570 gene locus_tag LOCUS_00570 12387 10570 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582799.1 protein_id gnl|my_center|LOCUS_00570 13828 12545 gene locus_tag LOCUS_00580 13828 12545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_00580 14178 13825 gene locus_tag LOCUS_00590 14178 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 14564 14175 gene locus_tag LOCUS_00600 14564 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 15319 14561 gene locus_tag LOCUS_00610 15319 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 16679 15309 gene locus_tag LOCUS_00620 16679 15309 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_00620 18147 16750 gene locus_tag LOCUS_00630 gene hemL 18147 16750 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_00630 19455 18193 gene locus_tag LOCUS_00640 19455 18193 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_00640 20468 19710 gene locus_tag LOCUS_00650 20468 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 20596 21153 gene locus_tag LOCUS_00660 gene tadA 20596 21153 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325362.1 protein_id gnl|my_center|LOCUS_00660 22473 21187 gene locus_tag LOCUS_00670 22473 21187 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence004 722 931 gene locus_tag LOCUS_00680 722 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 1429 2514 gene locus_tag LOCUS_00690 gene queA 1429 2514 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_00690 2653 3579 gene locus_tag LOCUS_00700 2653 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 3592 4098 gene locus_tag LOCUS_00710 3592 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4137 6152 gene locus_tag LOCUS_00720 4137 6152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122293.1 protein_id gnl|my_center|LOCUS_00720 7822 6332 gene locus_tag LOCUS_00730 7822 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 8810 9580 gene locus_tag LOCUS_00740 8810 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9691 9473 gene locus_tag LOCUS_00750 9691 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9731 10084 gene locus_tag LOCUS_00760 9731 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10460 10263 gene locus_tag LOCUS_00770 10460 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10437 10910 gene locus_tag LOCUS_00780 10437 10910 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_00780 11017 12315 gene locus_tag LOCUS_00790 11017 12315 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_00790 12371 13288 gene locus_tag LOCUS_00800 12371 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 13743 13282 gene locus_tag LOCUS_00810 13743 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 14741 13779 gene locus_tag LOCUS_00820 14741 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14966 16204 gene locus_tag LOCUS_00830 14966 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 16233 17300 gene locus_tag LOCUS_00840 16233 17300 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896850.1 protein_id gnl|my_center|LOCUS_00840 18335 17469 gene locus_tag LOCUS_00850 18335 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 18817 19197 gene locus_tag LOCUS_00860 18817 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 19246 20346 gene locus_tag LOCUS_00870 19246 20346 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_00870 20946 20584 gene locus_tag LOCUS_00880 20946 20584 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_00880 22084 21092 gene locus_tag LOCUS_00890 22084 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 >Feature sequence005 3278 2718 gene locus_tag LOCUS_00900 3278 2718 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_00900 7361 4023 gene locus_tag LOCUS_00910 gene mfd 7361 4023 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_00910 8830 7463 gene locus_tag LOCUS_00920 gene hemL 8830 7463 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_00920 9049 9120 gene locus_tag LOCUS_t00010 9049 9120 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9573 9421 gene locus_tag LOCUS_00930 9573 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 10012 9617 gene locus_tag LOCUS_00940 10012 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12801 10645 gene locus_tag LOCUS_00950 12801 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13096 15264 gene locus_tag LOCUS_00960 13096 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 15894 15307 gene locus_tag LOCUS_00970 15894 15307 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_00970 16642 16016 gene locus_tag LOCUS_00980 gene lexA 16642 16016 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_00980 17658 18368 gene locus_tag LOCUS_00990 17658 18368 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355842.1 protein_id gnl|my_center|LOCUS_00990 18493 18750 gene locus_tag LOCUS_01000 18493 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 18921 20006 gene locus_tag LOCUS_01010 18921 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence006 346 906 gene locus_tag LOCUS_01020 346 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 962 1177 gene locus_tag LOCUS_01030 962 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1496 1996 gene locus_tag LOCUS_01040 1496 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2779 3636 gene locus_tag LOCUS_01050 2779 3636 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_01050 3817 4731 gene locus_tag LOCUS_01060 3817 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4763 6124 gene locus_tag LOCUS_01070 gene tssK 4763 6124 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616050.1 protein_id gnl|my_center|LOCUS_01070 6184 6855 gene locus_tag LOCUS_01080 6184 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 6911 11308 gene locus_tag LOCUS_01090 6911 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 11347 12345 gene locus_tag LOCUS_01100 11347 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 13749 12310 gene locus_tag LOCUS_01110 13749 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 13978 13802 gene locus_tag LOCUS_01120 13978 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 14045 15700 gene locus_tag LOCUS_01130 14045 15700 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_01130 16101 16469 gene locus_tag LOCUS_01140 16101 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16950 18644 gene locus_tag LOCUS_01150 16950 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence007 394 1077 gene locus_tag LOCUS_01160 394 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1597 2364 gene locus_tag LOCUS_01170 1597 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2583 3533 gene locus_tag LOCUS_01180 2583 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4998 3592 gene locus_tag LOCUS_01190 4998 3592 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_01190 6218 5160 gene locus_tag LOCUS_01200 6218 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7600 6332 gene locus_tag LOCUS_01210 7600 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 9235 8039 gene locus_tag LOCUS_01220 9235 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 10654 9506 gene locus_tag LOCUS_01230 10654 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 13432 10838 gene locus_tag LOCUS_01240 13432 10838 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_01240 14736 13726 gene locus_tag LOCUS_01250 14736 13726 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974942.1 protein_id gnl|my_center|LOCUS_01250 15028 16689 gene locus_tag LOCUS_01260 15028 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 16676 18514 gene locus_tag LOCUS_01270 16676 18514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 18511 18690 gene locus_tag LOCUS_01280 18511 18690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence008 1428 457 gene locus_tag LOCUS_01290 1428 457 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_01290 2570 1425 gene locus_tag LOCUS_01300 gene alr 2570 1425 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01300 3664 2567 gene locus_tag LOCUS_01310 3664 2567 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_01310 4464 3658 gene locus_tag LOCUS_01320 4464 3658 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258763.1 protein_id gnl|my_center|LOCUS_01320 5214 4522 gene locus_tag LOCUS_01330 gene rpe 5214 4522 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_01330 6423 5233 gene locus_tag LOCUS_01340 6423 5233 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_01340 6809 7117 gene locus_tag LOCUS_01350 6809 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7458 7385 gene locus_tag LOCUS_t00020 7458 7385 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7774 8643 gene locus_tag LOCUS_01360 7774 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 17394 8617 gene locus_tag LOCUS_01370 17394 8617 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence009 988 89 gene locus_tag LOCUS_01380 gene folD 988 89 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_01380 1183 2196 gene locus_tag LOCUS_01390 1183 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 2196 3392 gene locus_tag LOCUS_01400 2196 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3426 4757 gene locus_tag LOCUS_01410 3426 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 4819 5187 gene locus_tag LOCUS_01420 4819 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5197 5625 gene locus_tag LOCUS_01430 5197 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5799 6761 gene locus_tag LOCUS_01440 5799 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6820 7122 gene locus_tag LOCUS_01450 6820 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 7212 7841 gene locus_tag LOCUS_01460 7212 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 7912 8511 gene locus_tag LOCUS_01470 7912 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8565 10175 gene locus_tag LOCUS_01480 gene atpA 8565 10175 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_01480 10188 11072 gene locus_tag LOCUS_01490 gene atpG 10188 11072 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_01490 11149 12582 gene locus_tag LOCUS_01500 gene atpD 11149 12582 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_01500 12814 13146 gene locus_tag LOCUS_01510 12814 13146 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_01510 13160 13468 gene locus_tag LOCUS_01520 13160 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 14722 13493 gene locus_tag LOCUS_01530 gene carA 14722 13493 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921837.1 protein_id gnl|my_center|LOCUS_01530 14831 14914 gene locus_tag LOCUS_t00030 14831 14914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15362 17350 gene locus_tag LOCUS_01540 15362 17350 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228212.1 protein_id gnl|my_center|LOCUS_01540 >Feature sequence010 1430 585 gene locus_tag LOCUS_01550 1430 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2320 2826 gene locus_tag LOCUS_01560 2320 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2946 4598 gene locus_tag LOCUS_01570 2946 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5610 4732 gene locus_tag LOCUS_01580 5610 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7004 6111 gene locus_tag LOCUS_01590 7004 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 8336 7386 gene locus_tag LOCUS_01600 8336 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9583 8768 gene locus_tag LOCUS_01610 9583 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9549 9878 gene locus_tag LOCUS_01620 9549 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 10385 11173 gene locus_tag LOCUS_01630 10385 11173 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_01630 11624 11235 gene locus_tag LOCUS_01640 11624 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11921 13297 gene locus_tag LOCUS_01650 11921 13297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963751.1 protein_id gnl|my_center|LOCUS_01650 13392 14354 gene locus_tag LOCUS_01660 13392 14354 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776936.1 protein_id gnl|my_center|LOCUS_01660 14351 15235 gene locus_tag LOCUS_01670 14351 15235 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_01670 15419 16123 gene locus_tag LOCUS_01680 15419 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 16270 16344 gene locus_tag LOCUS_t00040 16270 16344 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 847 293 gene locus_tag LOCUS_01690 847 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2684 984 gene locus_tag LOCUS_01700 2684 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4208 2805 gene locus_tag LOCUS_01710 gene lpdA 4208 2805 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_01710 5284 4412 gene locus_tag LOCUS_01720 5284 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7619 5562 gene locus_tag LOCUS_01730 7619 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8704 7721 gene locus_tag LOCUS_01740 8704 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8876 9067 gene locus_tag LOCUS_01750 8876 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9553 9107 gene locus_tag LOCUS_01760 9553 9107 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_01760 10219 9767 gene locus_tag LOCUS_01770 gene rpsI 10219 9767 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421105.1 protein_id gnl|my_center|LOCUS_01770 10764 10294 gene locus_tag LOCUS_01780 gene rplM 10764 10294 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258261.1 protein_id gnl|my_center|LOCUS_01780 11276 11031 gene locus_tag LOCUS_01790 11276 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11780 11430 gene locus_tag LOCUS_01800 11780 11430 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_01800 12358 11843 gene locus_tag LOCUS_01810 12358 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 12833 12444 gene locus_tag LOCUS_01820 12833 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 14001 13087 gene locus_tag LOCUS_01830 14001 13087 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979108.1 protein_id gnl|my_center|LOCUS_01830 14411 14064 gene locus_tag LOCUS_01840 14411 14064 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_01840 15809 14475 gene locus_tag LOCUS_01850 15809 14475 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_01850 <16864 16058 gene locus_tag LOCUS_01860 <16864 16058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121818.1:porin >Feature sequence012 915 2267 gene locus_tag LOCUS_01870 915 2267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_01870 2291 2839 gene locus_tag LOCUS_01880 2291 2839 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_01880 3020 3982 gene locus_tag LOCUS_01890 3020 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4006 5166 gene locus_tag LOCUS_01900 4006 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 6929 5223 gene locus_tag LOCUS_01910 6929 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8196 6988 gene locus_tag LOCUS_01920 8196 6988 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_01920 8446 9021 gene locus_tag LOCUS_01930 8446 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9553 10794 gene locus_tag LOCUS_01940 9553 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 11645 11088 gene locus_tag LOCUS_01950 11645 11088 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532305.1 protein_id gnl|my_center|LOCUS_01950 13356 11707 gene locus_tag LOCUS_01960 gene nadB 13356 11707 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_01960 13608 15443 gene locus_tag LOCUS_01970 gene sppA 13608 15443 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259833.1 protein_id gnl|my_center|LOCUS_01970 16087 16467 gene locus_tag LOCUS_01980 16087 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence013 225 1745 gene locus_tag LOCUS_01990 225 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4244 1875 gene locus_tag LOCUS_02000 4244 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5677 4229 gene locus_tag LOCUS_02010 5677 4229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946039.1 protein_id gnl|my_center|LOCUS_02010 6820 5684 gene locus_tag LOCUS_02020 6820 5684 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_02020 7496 7155 gene locus_tag LOCUS_02030 7496 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7377 10151 gene locus_tag LOCUS_02040 7377 10151 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_02040 10278 10547 gene locus_tag LOCUS_02050 10278 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 10665 11024 gene locus_tag LOCUS_02060 10665 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 11028 12389 gene locus_tag LOCUS_02070 11028 12389 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_02070 12386 13300 gene locus_tag LOCUS_02080 gene murQ 12386 13300 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_02080 13402 14970 gene locus_tag LOCUS_02090 gene guaA 13402 14970 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_02090 14974 15420 gene locus_tag LOCUS_02100 14974 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence014 5236 3692 gene locus_tag LOCUS_02110 5236 3692 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_02110 6776 5370 gene locus_tag LOCUS_02120 gene murD 6776 5370 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256652.1 protein_id gnl|my_center|LOCUS_02120 7783 6854 gene locus_tag LOCUS_02130 gene pyrF 7783 6854 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_02130 8288 8530 gene locus_tag LOCUS_02140 8288 8530 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_02140 11543 8673 gene locus_tag LOCUS_02150 11543 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 11787 13112 gene locus_tag LOCUS_02160 11787 13112 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_02160 13303 14208 gene locus_tag LOCUS_02170 13303 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15011 14247 gene locus_tag LOCUS_02180 gene kdsB 15011 14247 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422541.1 protein_id gnl|my_center|LOCUS_02180 15571 15026 gene locus_tag LOCUS_02190 15571 15026 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence015 1454 3055 gene locus_tag LOCUS_02200 gene cimA 1454 3055 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_02200 3140 5962 gene locus_tag LOCUS_02210 3140 5962 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_02210 6035 7165 gene locus_tag LOCUS_02220 6035 7165 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_02220 8903 7176 gene locus_tag LOCUS_02230 gene poxB 8903 7176 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424086.1 protein_id gnl|my_center|LOCUS_02230 9391 9026 gene locus_tag LOCUS_02240 9391 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 11023 9413 gene locus_tag LOCUS_02250 gene serA 11023 9413 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 protein_id gnl|my_center|LOCUS_02250 11196 11729 gene locus_tag LOCUS_02260 11196 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12412 12723 gene locus_tag LOCUS_02270 12412 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202204201.1 protein_id gnl|my_center|LOCUS_02270 12926 13321 gene locus_tag LOCUS_02280 12926 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 13348 14376 gene locus_tag LOCUS_02290 13348 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence016 538 924 gene locus_tag LOCUS_02300 538 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1000 4707 gene locus_tag LOCUS_02310 1000 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4759 6099 gene locus_tag LOCUS_02320 gene der 4759 6099 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_02320 6368 6604 gene locus_tag LOCUS_02330 6368 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7616 7996 gene locus_tag LOCUS_02340 7616 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8155 8508 gene locus_tag LOCUS_02350 8155 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8555 9943 gene locus_tag LOCUS_02360 8555 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10259 11182 gene locus_tag LOCUS_02370 10259 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12278 13963 gene locus_tag LOCUS_02380 12278 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14020 15417 gene locus_tag LOCUS_02390 14020 15417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence017 <1 884 gene locus_tag LOCUS_02400 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase 1066 2880 gene locus_tag LOCUS_02410 1066 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5846 2982 gene locus_tag LOCUS_02420 5846 2982 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_02420 8646 5854 gene locus_tag LOCUS_02430 8646 5854 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555785.1 protein_id gnl|my_center|LOCUS_02430 9993 9214 gene locus_tag LOCUS_02440 9993 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11786 10443 gene locus_tag LOCUS_02450 gene hemA 11786 10443 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_02450 12662 11793 gene locus_tag LOCUS_02460 12662 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13301 12666 gene locus_tag LOCUS_02470 13301 12666 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_02470 13463 15559 gene locus_tag LOCUS_02480 13463 15559 CDS product NERD domain-containing protein/DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024133114.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence018 1468 560 gene locus_tag LOCUS_02490 gene ubiA 1468 560 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792606.1 protein_id gnl|my_center|LOCUS_02490 2124 1528 gene locus_tag LOCUS_02500 2124 1528 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_02500 2469 2140 gene locus_tag LOCUS_02510 2469 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3136 2462 gene locus_tag LOCUS_02520 gene ubiE 3136 2462 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_02520 4052 3345 gene locus_tag LOCUS_02530 4052 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5077 4265 gene locus_tag LOCUS_02540 5077 4265 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_02540 7236 6550 gene locus_tag LOCUS_02550 gene hypB 7236 6550 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939602.1 protein_id gnl|my_center|LOCUS_02550 7639 7286 gene locus_tag LOCUS_02560 7639 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8665 7673 gene locus_tag LOCUS_02570 8665 7673 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_02570 12275 8670 gene locus_tag LOCUS_02580 gene nifJ 12275 8670 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237703763.1 protein_id gnl|my_center|LOCUS_02580 12849 12301 gene locus_tag LOCUS_02590 12849 12301 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_02590 14260 12830 gene locus_tag LOCUS_02600 14260 12830 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_02600 14874 14308 gene locus_tag LOCUS_02610 14874 14308 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943354.1 protein_id gnl|my_center|LOCUS_02610 <15512 14871 gene locus_tag LOCUS_02620 <15512 14871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943355.1:bidirectional hydrogenase complex protein HoxU >Feature sequence019 2 481 gene locus_tag LOCUS_02630 2 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 883 1281 gene locus_tag LOCUS_02640 883 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1278 1718 gene locus_tag LOCUS_02650 1278 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1768 2229 gene locus_tag LOCUS_02660 1768 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2553 3011 gene locus_tag LOCUS_02670 2553 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3053 3448 gene locus_tag LOCUS_02680 3053 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 4530 3769 gene locus_tag LOCUS_02690 4530 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5866 4601 gene locus_tag LOCUS_02700 5866 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6535 5915 gene locus_tag LOCUS_02710 6535 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 7395 6547 gene locus_tag LOCUS_02720 7395 6547 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946566.1 protein_id gnl|my_center|LOCUS_02720 8411 7422 gene locus_tag LOCUS_02730 8411 7422 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_02730 9936 8587 gene locus_tag LOCUS_02740 9936 8587 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_02740 10349 9987 gene locus_tag LOCUS_02750 10349 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 11205 10555 gene locus_tag LOCUS_02760 11205 10555 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_02760 11503 11940 gene locus_tag LOCUS_02770 11503 11940 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_02770 11937 12662 gene locus_tag LOCUS_02780 11937 12662 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_02780 12819 13874 gene locus_tag LOCUS_02790 12819 13874 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 protein_id gnl|my_center|LOCUS_02790 14074 14520 gene locus_tag LOCUS_02800 14074 14520 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_02800 14798 15130 gene locus_tag LOCUS_02810 gene trxA 14798 15130 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence020 40 1314 gene locus_tag LOCUS_02820 40 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1311 2444 gene locus_tag LOCUS_02830 1311 2444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_02830 2446 3558 gene locus_tag LOCUS_02840 2446 3558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_02840 7581 3613 gene locus_tag LOCUS_02850 7581 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7827 7615 gene locus_tag LOCUS_02860 7827 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8864 7878 gene locus_tag LOCUS_02870 8864 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9151 8879 gene locus_tag LOCUS_02880 9151 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 9868 9233 gene locus_tag LOCUS_02890 gene sodA 9868 9233 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_02890 11640 10000 gene locus_tag LOCUS_02900 11640 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12196 11654 gene locus_tag LOCUS_02910 12196 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02910 12231 12240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13396 12245 gene locus_tag LOCUS_02920 13396 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02920 14716 13568 gene locus_tag LOCUS_02930 14716 13568 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_02930 15430 14741 gene locus_tag LOCUS_02940 gene bshB1 15430 14741 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333027.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence021 702 1079 gene locus_tag LOCUS_02950 702 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 1153 1572 gene locus_tag LOCUS_02960 1153 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02960 4077 1576 gene locus_tag LOCUS_02970 4077 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6036 5029 gene locus_tag LOCUS_02980 gene floA 6036 5029 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_02980 6311 7225 gene locus_tag LOCUS_02990 6311 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7941 7276 gene locus_tag LOCUS_03000 7941 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9313 8045 gene locus_tag LOCUS_03010 gene truD 9313 8045 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_03010 10380 9445 gene locus_tag LOCUS_03020 gene yitU 10380 9445 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 protein_id gnl|my_center|LOCUS_03020 11673 10651 gene locus_tag LOCUS_03030 11673 10651 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_03030 12226 13188 gene locus_tag LOCUS_03040 12226 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 13242 14219 gene locus_tag LOCUS_03050 13242 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence022 1342 443 gene locus_tag LOCUS_03060 1342 443 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_03060 1427 3064 gene locus_tag LOCUS_03070 1427 3064 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921384.1 protein_id gnl|my_center|LOCUS_03070 3064 5619 gene locus_tag LOCUS_03080 3064 5619 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_03080 5705 7123 gene locus_tag LOCUS_03090 5705 7123 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_03090 7357 7151 gene locus_tag LOCUS_03100 gene yacG 7357 7151 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530195.1 protein_id gnl|my_center|LOCUS_03100 7731 7354 gene locus_tag LOCUS_03110 7731 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8317 7769 gene locus_tag LOCUS_03120 gene grpE 8317 7769 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_03120 9495 8344 gene locus_tag LOCUS_03130 gene dnaJ 9495 8344 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_03130 11262 9649 gene locus_tag LOCUS_03140 gene groL 11262 9649 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_03140 11603 11313 gene locus_tag LOCUS_03150 gene groES 11603 11313 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_03150 13442 11745 gene locus_tag LOCUS_03160 gene groL 13442 11745 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939262.1 protein_id gnl|my_center|LOCUS_03160 14745 14026 gene locus_tag LOCUS_03170 14745 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 >Feature sequence023 2026 818 gene locus_tag LOCUS_03180 2026 818 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_03180 2170 3348 gene locus_tag LOCUS_03190 gene obgE 2170 3348 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_03190 3381 4145 gene locus_tag LOCUS_03200 3381 4145 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_03200 5671 4256 gene locus_tag LOCUS_03210 5671 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4273 4345 gene locus_tag LOCUS_t00050 4273 4345 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5872 5675 gene locus_tag LOCUS_03220 5872 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8363 6015 gene locus_tag LOCUS_03230 8363 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8946 8344 gene locus_tag LOCUS_03240 8946 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9251 9000 gene locus_tag LOCUS_03250 9251 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9472 9248 gene locus_tag LOCUS_03260 9472 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 10277 9648 gene locus_tag LOCUS_03270 10277 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10929 10693 gene locus_tag LOCUS_03280 10929 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 12160 10865 gene locus_tag LOCUS_03290 12160 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12210 12401 gene locus_tag LOCUS_03300 12210 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 14484 12343 gene locus_tag LOCUS_03310 14484 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence024 614 2260 gene locus_tag LOCUS_03320 614 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3732 2797 gene locus_tag LOCUS_03330 3732 2797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089011.1 protein_id gnl|my_center|LOCUS_03330 3959 3735 gene locus_tag LOCUS_03340 3959 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4193 4750 gene locus_tag LOCUS_03350 4193 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4813 5832 gene locus_tag LOCUS_03360 gene argC 4813 5832 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_03360 5865 6308 gene locus_tag LOCUS_03370 5865 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6395 9343 gene locus_tag LOCUS_03380 gene purL 6395 9343 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_03380 9738 9481 gene locus_tag LOCUS_03390 9738 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 10125 9865 gene locus_tag LOCUS_03400 10125 9865 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_03400 10569 10306 gene locus_tag LOCUS_03410 10569 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10634 11374 gene locus_tag LOCUS_03420 10634 11374 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_03420 11388 13061 gene locus_tag LOCUS_03430 11388 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence025 <1 612 gene locus_tag LOCUS_03440 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793275.1:glycogen/starch synthase 872 3193 gene locus_tag LOCUS_03450 872 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 3394 3323 gene locus_tag LOCUS_t00060 3394 3323 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3755 5146 gene locus_tag LOCUS_03460 3755 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5070 6161 gene locus_tag LOCUS_03470 5070 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6848 6120 gene locus_tag LOCUS_03480 6848 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7522 7022 gene locus_tag LOCUS_03490 7522 7022 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040149.1 protein_id gnl|my_center|LOCUS_03490 7775 7566 gene locus_tag LOCUS_03500 7775 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8672 7788 gene locus_tag LOCUS_03510 gene hisG 8672 7788 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_03510 9590 8742 gene locus_tag LOCUS_03520 9590 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 10039 9587 gene locus_tag LOCUS_03530 10039 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10405 10106 gene locus_tag LOCUS_03540 10405 10106 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_03540 13292 10431 gene locus_tag LOCUS_03550 13292 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 <14547 13418 gene locus_tag LOCUS_03560 <14547 13418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120487.1:transcription termination factor NusA >Feature sequence026 311 598 gene locus_tag LOCUS_03570 311 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1936 1058 gene locus_tag LOCUS_03580 1936 1058 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_03580 2778 1933 gene locus_tag LOCUS_03590 2778 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3143 3544 gene locus_tag LOCUS_03600 3143 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3584 4153 gene locus_tag LOCUS_03610 3584 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4487 5707 gene locus_tag LOCUS_03620 4487 5707 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929138.1 protein_id gnl|my_center|LOCUS_03620 5852 6244 gene locus_tag LOCUS_03630 5852 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7892 6735 gene locus_tag LOCUS_03640 7892 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8889 7885 gene locus_tag LOCUS_03650 8889 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9805 9978 gene locus_tag LOCUS_03660 9805 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10420 9941 gene locus_tag LOCUS_03670 10420 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 10521 10712 gene locus_tag LOCUS_03680 10521 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 11310 12914 gene locus_tag LOCUS_03690 11310 12914 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973731.1 protein_id gnl|my_center|LOCUS_03690 13314 14399 gene locus_tag LOCUS_03700 13314 14399 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence027 574 1194 gene locus_tag LOCUS_03710 574 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1367 2725 gene locus_tag LOCUS_03720 1367 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2725 3165 gene locus_tag LOCUS_03730 2725 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3405 4652 gene locus_tag LOCUS_03740 3405 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4649 5233 gene locus_tag LOCUS_03750 4649 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5431 5904 gene locus_tag LOCUS_03760 5431 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7336 5909 gene locus_tag LOCUS_03770 7336 5909 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_03770 7564 8274 gene locus_tag LOCUS_03780 7564 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8996 8271 gene locus_tag LOCUS_03790 8996 8271 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_03790 9348 9857 gene locus_tag LOCUS_03800 gene infC 9348 9857 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869472.1 protein_id gnl|my_center|LOCUS_03800 10976 9963 gene locus_tag LOCUS_03810 10976 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 13055 10989 gene locus_tag LOCUS_03820 gene metG 13055 10989 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_03820 13786 14034 gene locus_tag LOCUS_03830 13786 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence028 1229 1960 gene locus_tag LOCUS_03840 1229 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1993 2736 gene locus_tag LOCUS_03850 1993 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2733 2990 gene locus_tag LOCUS_03860 2733 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3010 3840 gene locus_tag LOCUS_03870 3010 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3944 5119 gene locus_tag LOCUS_03880 3944 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5235 5044 gene locus_tag LOCUS_03890 5235 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5457 7478 gene locus_tag LOCUS_03900 5457 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 7588 8490 gene locus_tag LOCUS_03910 7588 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 8529 10457 gene locus_tag LOCUS_03920 gene sdhA 8529 10457 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_03920 10481 11260 gene locus_tag LOCUS_03930 gene sdhB 10481 11260 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139712.1 protein_id gnl|my_center|LOCUS_03930 12665 11673 gene locus_tag LOCUS_03940 12665 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence029 282 587 gene locus_tag LOCUS_03950 282 587 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_03950 1373 744 gene locus_tag LOCUS_03960 gene purN 1373 744 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_03960 2614 1370 gene locus_tag LOCUS_03970 2614 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3933 2611 gene locus_tag LOCUS_03980 gene gdhA 3933 2611 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_03980 4919 3930 gene locus_tag LOCUS_03990 4919 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6022 4880 gene locus_tag LOCUS_04000 gene mnmA 6022 4880 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_04000 6209 6580 gene locus_tag LOCUS_04010 6209 6580 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_04010 6596 7150 gene locus_tag LOCUS_04020 6596 7150 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_04020 7387 7794 gene locus_tag LOCUS_04030 7387 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7808 8437 gene locus_tag LOCUS_04040 7808 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 8528 9343 gene locus_tag LOCUS_04050 8528 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9429 9851 gene locus_tag LOCUS_04060 9429 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 10467 10778 gene locus_tag LOCUS_04070 10467 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 11434 11703 gene locus_tag LOCUS_04080 11434 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence030 <1 2114 gene locus_tag LOCUS_04090 <1 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein 2266 3600 gene locus_tag LOCUS_04100 2266 3600 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_04100 3795 3868 gene locus_tag LOCUS_t00070 3795 3868 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5115 4051 gene locus_tag LOCUS_04110 5115 4051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5236 5511 gene locus_tag LOCUS_04120 5236 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6519 5455 gene locus_tag LOCUS_04130 6519 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7206 7655 gene locus_tag LOCUS_04140 7206 7655 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_04140 8257 7712 gene locus_tag LOCUS_04150 8257 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9607 8372 gene locus_tag LOCUS_04160 9607 8372 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_04160 9736 11115 gene locus_tag LOCUS_04170 9736 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 12208 11105 gene locus_tag LOCUS_04180 12208 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 12900 12283 gene locus_tag LOCUS_04190 12900 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence031 592 1557 gene locus_tag LOCUS_04200 592 1557 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_04200 1586 2776 gene locus_tag LOCUS_04210 1586 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 2913 4142 gene locus_tag LOCUS_04220 gene nadA 2913 4142 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389688.1 protein_id gnl|my_center|LOCUS_04220 4196 5437 gene locus_tag LOCUS_04230 4196 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5671 6741 gene locus_tag LOCUS_04240 gene leuB 5671 6741 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940244.1 protein_id gnl|my_center|LOCUS_04240 7964 6924 gene locus_tag LOCUS_04250 7964 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 8245 9381 gene locus_tag LOCUS_04260 gene rho 8245 9381 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_04260 9485 9910 gene locus_tag LOCUS_04270 9485 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 11873 10062 gene locus_tag LOCUS_04280 11873 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 13122 12115 gene locus_tag LOCUS_04290 13122 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13574 13380 gene locus_tag LOCUS_04300 13574 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence032 546 475 gene locus_tag LOCUS_t00080 546 475 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1111 4062 gene locus_tag LOCUS_04310 1111 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5461 4199 gene locus_tag LOCUS_04320 5461 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 7164 5458 gene locus_tag LOCUS_04330 7164 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9080 7176 gene locus_tag LOCUS_04340 9080 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 9231 10469 gene locus_tag LOCUS_04350 9231 10469 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_04350 10817 11692 gene locus_tag LOCUS_04360 10817 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 11689 12594 gene locus_tag LOCUS_04370 11689 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence033 5297 711 gene locus_tag LOCUS_04380 gene gltB 5297 711 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120560.1 protein_id gnl|my_center|LOCUS_04380 5698 6159 gene locus_tag LOCUS_04390 5698 6159 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_04390 7062 6223 gene locus_tag LOCUS_04400 7062 6223 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_04400 7390 8322 gene locus_tag LOCUS_04410 7390 8322 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_04410 8325 9344 gene locus_tag LOCUS_04420 8325 9344 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_04420 9399 10652 gene locus_tag LOCUS_04430 9399 10652 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_04430 11928 10753 gene locus_tag LOCUS_04440 11928 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 12712 11999 gene locus_tag LOCUS_04450 12712 11999 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence034 <1 506 gene locus_tag LOCUS_04460 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148264.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 513 1772 gene locus_tag LOCUS_04470 gene mnmE 513 1772 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_04470 3632 1761 gene locus_tag LOCUS_04480 3632 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4645 3629 gene locus_tag LOCUS_04490 4645 3629 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_04490 5530 4973 gene locus_tag LOCUS_04500 5530 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 7346 5772 gene locus_tag LOCUS_04510 gene aroE 7346 5772 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_04510 8356 7343 gene locus_tag LOCUS_04520 8356 7343 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_04520 9554 9105 gene locus_tag LOCUS_04530 9554 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 11670 9586 gene locus_tag LOCUS_04540 11670 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12799 12239 gene locus_tag LOCUS_04550 12799 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence035 966 1040 gene locus_tag LOCUS_t00090 966 1040 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1121 2080 gene locus_tag LOCUS_04560 1121 2080 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_04560 3546 2026 gene locus_tag LOCUS_04570 gene xylB 3546 2026 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04570 6923 3621 gene locus_tag LOCUS_04580 6923 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7334 8626 gene locus_tag LOCUS_04590 gene metK 7334 8626 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_04590 9114 10079 gene locus_tag LOCUS_04600 9114 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10659 10174 gene locus_tag LOCUS_04610 10659 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 12771 10774 gene locus_tag LOCUS_04620 12771 10774 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence036 3186 352 gene locus_tag LOCUS_04630 gene uvrA 3186 352 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_04630 4167 3565 gene locus_tag LOCUS_04640 4167 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 6475 4289 gene locus_tag LOCUS_04650 6475 4289 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_04650 6933 7577 gene locus_tag LOCUS_04660 6933 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7627 8181 gene locus_tag LOCUS_04670 7627 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 8439 8648 gene locus_tag LOCUS_04680 8439 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8710 9702 gene locus_tag LOCUS_04690 gene plsX 8710 9702 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 protein_id gnl|my_center|LOCUS_04690 9796 10788 gene locus_tag LOCUS_04700 9796 10788 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_04700 10822 11751 gene locus_tag LOCUS_04710 gene fabD 10822 11751 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_04710 11777 12523 gene locus_tag LOCUS_04720 gene fabG 11777 12523 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence037 2976 802 gene locus_tag LOCUS_04730 2976 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4106 2973 gene locus_tag LOCUS_04740 4106 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4932 4093 gene locus_tag LOCUS_04750 4932 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5460 6401 gene locus_tag LOCUS_04760 5460 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 7092 6457 gene locus_tag LOCUS_04770 7092 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7295 10273 gene locus_tag LOCUS_04780 gene leuS 7295 10273 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_04780 10310 11404 gene locus_tag LOCUS_04790 gene lpxK 10310 11404 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence038 1594 581 gene locus_tag LOCUS_04800 1594 581 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_04800 2041 4893 gene locus_tag LOCUS_04810 2041 4893 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_04810 5019 6293 gene locus_tag LOCUS_04820 gene odhB 5019 6293 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110041.1 protein_id gnl|my_center|LOCUS_04820 6332 6931 gene locus_tag LOCUS_04830 6332 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 7786 7079 gene locus_tag LOCUS_04840 7786 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9265 8090 gene locus_tag LOCUS_04850 9265 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 10030 9317 gene locus_tag LOCUS_04860 10030 9317 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327156.1 protein_id gnl|my_center|LOCUS_04860 10349 11836 gene locus_tag LOCUS_04870 10349 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence039 <1 3357 gene locus_tag LOCUS_04880 <1 3357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572274.1:helicase-exonuclease AddAB subunit AddA 3878 3405 gene locus_tag LOCUS_04890 3878 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 5504 3906 gene locus_tag LOCUS_04900 5504 3906 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_04900 6200 5571 gene locus_tag LOCUS_04910 gene recR 6200 5571 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_04910 6560 6213 gene locus_tag LOCUS_04920 6560 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6897 7487 gene locus_tag LOCUS_04930 6897 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 7521 8081 gene locus_tag LOCUS_04940 7521 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 8078 8863 gene locus_tag LOCUS_04950 8078 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 9396 8890 gene locus_tag LOCUS_04960 9396 8890 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_04960 10762 9440 gene locus_tag LOCUS_04970 10762 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12011 11034 gene locus_tag LOCUS_04980 12011 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence040 638 2746 gene locus_tag LOCUS_04990 638 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3341 2814 gene locus_tag LOCUS_05000 3341 2814 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_05000 3941 3375 gene locus_tag LOCUS_05010 3941 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 4186 6942 gene locus_tag LOCUS_05020 gene acnA 4186 6942 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_05020 7936 6974 gene locus_tag LOCUS_05030 gene pfkB 7936 6974 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206967.1 protein_id gnl|my_center|LOCUS_05030 7929 8249 gene locus_tag LOCUS_05040 7929 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 8539 9771 gene locus_tag LOCUS_05050 8539 9771 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_05050 9907 12444 gene locus_tag LOCUS_05060 gene hrpB 9907 12444 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence041 845 213 gene locus_tag LOCUS_05070 845 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3363 1939 gene locus_tag LOCUS_05080 3363 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4498 3554 gene locus_tag LOCUS_05090 4498 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4580 4888 gene locus_tag LOCUS_05100 4580 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5336 4854 gene locus_tag LOCUS_05110 5336 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5772 6845 gene locus_tag LOCUS_05120 5772 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6829 7977 gene locus_tag LOCUS_05130 6829 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7980 8807 gene locus_tag LOCUS_05140 7980 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 8837 10033 gene locus_tag LOCUS_05150 8837 10033 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_05150 10303 10046 gene locus_tag LOCUS_05160 10303 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10361 11017 gene locus_tag LOCUS_05170 10361 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 12347 11295 gene locus_tag LOCUS_05180 12347 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence042 235 1827 gene locus_tag LOCUS_05190 gene miaB 235 1827 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_05190 2023 2892 gene locus_tag LOCUS_05200 2023 2892 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_05200 5379 2896 gene locus_tag LOCUS_05210 5379 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5699 6592 gene locus_tag LOCUS_05220 5699 6592 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_05220 6715 7059 gene locus_tag LOCUS_05230 6715 7059 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_05230 7103 7549 gene locus_tag LOCUS_05240 7103 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7602 8102 gene locus_tag LOCUS_05250 7602 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8170 8412 gene locus_tag LOCUS_05260 8170 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8477 11371 gene locus_tag LOCUS_05270 gene polA 8477 11371 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_05270 11477 12037 gene locus_tag LOCUS_05280 11477 12037 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence043 1926 1573 gene locus_tag LOCUS_05290 1926 1573 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_05290 2366 2013 gene locus_tag LOCUS_05300 2366 2013 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767694.1 protein_id gnl|my_center|LOCUS_05300 4082 2529 gene locus_tag LOCUS_05310 4082 2529 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_05310 3825 3915 gene locus_tag LOCUS_t00100 3825 3915 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5366 6127 gene locus_tag LOCUS_05320 5366 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6131 6562 gene locus_tag LOCUS_05330 6131 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6562 6990 gene locus_tag LOCUS_05340 6562 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 8074 7061 gene locus_tag LOCUS_05350 gene xerC 8074 7061 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_05350 9809 8427 gene locus_tag LOCUS_05360 9809 8427 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_05360 10323 11768 gene locus_tag LOCUS_05370 gene sufB 10323 11768 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence044 9 434 gene locus_tag LOCUS_05380 9 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 431 1099 gene locus_tag LOCUS_05390 431 1099 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_05390 1104 1913 gene locus_tag LOCUS_05400 gene map 1104 1913 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_05400 2072 2287 gene locus_tag LOCUS_05410 gene infA 2072 2287 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829792.1 protein_id gnl|my_center|LOCUS_05410 2580 2966 gene locus_tag LOCUS_05420 gene rpsM 2580 2966 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_05420 3046 3426 gene locus_tag LOCUS_05430 gene rpsK 3046 3426 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_05430 3602 4642 gene locus_tag LOCUS_05440 3602 4642 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_05440 4737 5183 gene locus_tag LOCUS_05450 gene rplQ 4737 5183 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957469.1 protein_id gnl|my_center|LOCUS_05450 6448 5249 gene locus_tag LOCUS_05460 6448 5249 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_05460 7860 6523 gene locus_tag LOCUS_05470 7860 6523 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_05470 9006 7987 gene locus_tag LOCUS_05480 9006 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10970 9942 gene locus_tag LOCUS_05490 gene fba 10970 9942 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence045 367 4917 gene locus_tag LOCUS_05500 367 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5013 6011 gene locus_tag LOCUS_05510 5013 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6030 7667 gene locus_tag LOCUS_05520 6030 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8895 7612 gene locus_tag LOCUS_05530 8895 7612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193486.1 protein_id gnl|my_center|LOCUS_05530 9202 10212 gene locus_tag LOCUS_05540 9202 10212 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_05540 10246 10782 gene locus_tag LOCUS_05550 10246 10782 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence046 <1 2933 gene locus_tag LOCUS_05560 <1 2933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919601.1:AMP-binding protein 3189 6572 gene locus_tag LOCUS_05570 3189 6572 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_05570 6618 9161 gene locus_tag LOCUS_05580 6618 9161 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_05580 9213 10118 gene locus_tag LOCUS_05590 9213 10118 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_05590 11245 10190 gene locus_tag LOCUS_05600 11245 10190 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence047 293 1438 gene locus_tag LOCUS_05610 293 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1553 2815 gene locus_tag LOCUS_05620 1553 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2878 3099 gene locus_tag LOCUS_05630 2878 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3373 3059 gene locus_tag LOCUS_05640 3373 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3680 5176 gene locus_tag LOCUS_05650 3680 5176 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_05650 5466 6908 gene locus_tag LOCUS_05660 gene bioA 5466 6908 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_05660 6938 7726 gene locus_tag LOCUS_05670 gene bioD 6938 7726 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_05670 7928 8371 gene locus_tag LOCUS_05680 7928 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9369 8389 gene locus_tag LOCUS_05690 9369 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 11053 9428 gene locus_tag LOCUS_05700 gene lnt 11053 9428 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence048 881 168 gene locus_tag LOCUS_05710 881 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 1861 1016 gene locus_tag LOCUS_05720 1861 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2508 1927 gene locus_tag LOCUS_05730 2508 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2566 2943 gene locus_tag LOCUS_05740 2566 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3800 3258 gene locus_tag LOCUS_05750 3800 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5170 4031 gene locus_tag LOCUS_05760 5170 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5870 5151 gene locus_tag LOCUS_05770 5870 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7466 6051 gene locus_tag LOCUS_05780 gene lpdA 7466 6051 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597690.1 protein_id gnl|my_center|LOCUS_05780 7765 8520 gene locus_tag LOCUS_05790 7765 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9260 8583 gene locus_tag LOCUS_05800 9260 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 9592 10803 gene locus_tag LOCUS_05810 9592 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence049 659 12 gene locus_tag LOCUS_05820 659 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4060 656 gene locus_tag LOCUS_05830 gene addB 4060 656 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_05830 4324 4929 gene locus_tag LOCUS_05840 gene tsaB 4324 4929 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_05840 5337 6128 gene locus_tag LOCUS_05850 5337 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6325 6651 gene locus_tag LOCUS_05860 6325 6651 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_05860 6732 7070 gene locus_tag LOCUS_05870 gene arsD 6732 7070 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540111.1 protein_id gnl|my_center|LOCUS_05870 7159 7353 gene locus_tag LOCUS_05880 7159 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7354 7539 gene locus_tag LOCUS_05890 7354 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7624 9399 gene locus_tag LOCUS_05900 gene arsA 7624 9399 CDS product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 protein_id gnl|my_center|LOCUS_05900 9564 10598 gene locus_tag LOCUS_05910 9564 10598 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence050 685 200 gene locus_tag LOCUS_05920 gene ispF 685 200 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367570.1 protein_id gnl|my_center|LOCUS_05920 2122 716 gene locus_tag LOCUS_05930 2122 716 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_05930 2867 2205 gene locus_tag LOCUS_05940 2867 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_05940 3513 2881 gene locus_tag LOCUS_05950 3513 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4447 3494 gene locus_tag LOCUS_05960 gene cysK 4447 3494 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_05960 5345 4563 gene locus_tag LOCUS_05970 5345 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6271 5405 gene locus_tag LOCUS_05980 6271 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6970 6284 gene locus_tag LOCUS_05990 6970 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 7794 6967 gene locus_tag LOCUS_06000 7794 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7771 7980 gene locus_tag LOCUS_06010 7771 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 8429 8304 gene locus_tag LOCUS_06020 8429 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8547 10862 gene locus_tag LOCUS_06030 8547 10862 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence051 164 1003 gene locus_tag LOCUS_06040 164 1003 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_06040 1062 2027 gene locus_tag LOCUS_06050 1062 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_06050 3259 2282 gene locus_tag LOCUS_06060 3259 2282 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 4306 3488 gene locus_tag LOCUS_06070 4306 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4196 4435 gene locus_tag LOCUS_06080 4196 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 5257 4415 gene locus_tag LOCUS_06090 5257 4415 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729831.1 protein_id gnl|my_center|LOCUS_06090 6092 5301 gene locus_tag LOCUS_06100 6092 5301 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_06100 6389 6120 gene locus_tag LOCUS_06110 6389 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8656 6527 gene locus_tag LOCUS_06120 gene pnp 8656 6527 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_06120 9105 8839 gene locus_tag LOCUS_06130 gene rpsO 9105 8839 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_06130 10352 9792 gene locus_tag LOCUS_06140 gene aroL 10352 9792 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_06140 <11014 10470 gene locus_tag LOCUS_06150 <11014 10470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545208.1:ATP-binding protein >Feature sequence052 68 943 gene locus_tag LOCUS_06160 68 943 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120018.1 protein_id gnl|my_center|LOCUS_06160 3619 1022 gene locus_tag LOCUS_06170 gene clpB 3619 1022 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_06170 5548 4046 gene locus_tag LOCUS_06180 gene crtI 5548 4046 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_06180 6706 5606 gene locus_tag LOCUS_06190 6706 5606 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615986.1 protein_id gnl|my_center|LOCUS_06190 8633 7056 gene locus_tag LOCUS_06200 8633 7056 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_06200 10035 8845 gene locus_tag LOCUS_06210 gene nirJ1 10035 8845 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_06210 <10840 10029 gene locus_tag LOCUS_06220 <10840 10029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001046898.1:TIGR04053 family radical SAM/SPASM domain-containing protein >Feature sequence053 1207 20 gene locus_tag LOCUS_06230 1207 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1775 1197 gene locus_tag LOCUS_06240 1775 1197 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_06240 2776 1850 gene locus_tag LOCUS_06250 gene thpD 2776 1850 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_06250 3219 2821 gene locus_tag LOCUS_06260 3219 2821 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_06260 4516 3200 gene locus_tag LOCUS_06270 gene ectB 4516 3200 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_06270 5121 4537 gene locus_tag LOCUS_06280 gene ectA 5121 4537 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_06280 6696 6187 gene locus_tag LOCUS_06290 6696 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7549 6704 gene locus_tag LOCUS_06300 7549 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 9150 8824 gene locus_tag LOCUS_06310 9150 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9503 9147 gene locus_tag LOCUS_06320 9503 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10396 9731 gene locus_tag LOCUS_06330 10396 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence054 262 1350 gene locus_tag LOCUS_06340 262 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4051 1484 gene locus_tag LOCUS_06350 4051 1484 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_06350 5321 4323 gene locus_tag LOCUS_06360 5321 4323 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_06360 6835 5318 gene locus_tag LOCUS_06370 6835 5318 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_06370 7890 6901 gene locus_tag LOCUS_06380 7890 6901 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_06380 8347 9522 gene locus_tag LOCUS_06390 gene galK 8347 9522 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_06390 9569 10600 gene locus_tag LOCUS_06400 gene trpD 9569 10600 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence055 58 243 gene locus_tag LOCUS_06410 58 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 995 4000 gene locus_tag LOCUS_06420 995 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4409 5689 gene locus_tag LOCUS_06430 4409 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6057 5686 gene locus_tag LOCUS_06440 6057 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6258 7409 gene locus_tag LOCUS_06450 6258 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7869 9488 gene locus_tag LOCUS_06460 7869 9488 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974395.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence056 861 31 gene locus_tag LOCUS_06470 861 31 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225614.1 protein_id gnl|my_center|LOCUS_06470 887 1156 gene locus_tag LOCUS_06480 887 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1216 2397 gene locus_tag LOCUS_06490 1216 2397 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_06490 4142 2598 gene locus_tag LOCUS_06500 4142 2598 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_06500 5336 4344 gene locus_tag LOCUS_06510 5336 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6331 5816 gene locus_tag LOCUS_06520 gene rplI 6331 5816 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_06520 6870 6403 gene locus_tag LOCUS_06530 6870 6403 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_06530 7393 6956 gene locus_tag LOCUS_06540 7393 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8141 7557 gene locus_tag LOCUS_06550 gene pth 8141 7557 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_06550 8909 8187 gene locus_tag LOCUS_06560 8909 8187 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_06560 10007 8979 gene locus_tag LOCUS_06570 10007 8979 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence057 696 247 gene locus_tag LOCUS_06580 696 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1064 2284 gene locus_tag LOCUS_06590 gene lpxB 1064 2284 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_06590 2323 3897 gene locus_tag LOCUS_06600 gene cysS 2323 3897 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_06600 4899 3964 gene locus_tag LOCUS_06610 4899 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5193 4987 gene locus_tag LOCUS_06620 5193 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5159 6082 gene locus_tag LOCUS_06630 5159 6082 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_06630 6140 7384 gene locus_tag LOCUS_06640 6140 7384 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_06640 7222 7321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7324 7548 gene locus_tag LOCUS_06650 7324 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 <10141 7736 gene locus_tag LOCUS_06660 <10141 7736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941243.1:pyruvate, phosphate dikinase >Feature sequence058 4619 1989 gene locus_tag LOCUS_06670 4619 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4903 5523 gene locus_tag LOCUS_06680 gene wrbA 4903 5523 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_06680 6275 5556 gene locus_tag LOCUS_06690 6275 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7037 6297 gene locus_tag LOCUS_06700 7037 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 7925 7185 gene locus_tag LOCUS_06710 gene accD 7925 7185 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence059 1994 540 gene locus_tag LOCUS_06720 1994 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3124 2120 gene locus_tag LOCUS_06730 3124 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3661 3978 gene locus_tag LOCUS_06740 3661 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3997 5946 gene locus_tag LOCUS_06750 3997 5946 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_06750 5979 7505 gene locus_tag LOCUS_06760 5979 7505 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_06760 7552 8976 gene locus_tag LOCUS_06770 gene murF 7552 8976 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence060 2207 459 gene locus_tag LOCUS_06780 2207 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2980 2204 gene locus_tag LOCUS_06790 gene cas5c 2980 2204 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_06790 4252 3038 gene locus_tag LOCUS_06800 4252 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4343 4528 gene locus_tag LOCUS_06810 4343 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4718 5092 gene locus_tag LOCUS_06820 4718 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5377 5667 gene locus_tag LOCUS_06830 5377 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5660 7144 gene locus_tag LOCUS_06840 5660 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7131 8102 gene locus_tag LOCUS_06850 7131 8102 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_06850 8099 9409 gene locus_tag LOCUS_06860 8099 9409 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence061 4195 2033 gene locus_tag LOCUS_06870 4195 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 4586 6049 gene locus_tag LOCUS_06880 4586 6049 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_06880 6072 6464 gene locus_tag LOCUS_06890 6072 6464 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_06890 6500 6877 gene locus_tag LOCUS_06900 6500 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 8232 7123 gene locus_tag LOCUS_06910 8232 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 8900 8241 gene locus_tag LOCUS_06920 8900 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9247 9522 gene locus_tag LOCUS_06930 gene rpmB 9247 9522 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290463.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence062 1080 4706 gene locus_tag LOCUS_06940 1080 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4887 5828 gene locus_tag LOCUS_06950 gene nadC 4887 5828 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920753.1 protein_id gnl|my_center|LOCUS_06950 5825 6670 gene locus_tag LOCUS_06960 5825 6670 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_06960 6729 7253 gene locus_tag LOCUS_06970 6729 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7407 8804 gene locus_tag LOCUS_06980 gene dnaB 7407 8804 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence063 504 431 gene locus_tag LOCUS_t00110 504 431 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 786 1862 gene locus_tag LOCUS_06990 786 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2321 2572 gene locus_tag LOCUS_07000 2321 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2766 4091 gene locus_tag LOCUS_07010 2766 4091 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_07010 4136 5143 gene locus_tag LOCUS_07020 4136 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5492 5226 gene locus_tag LOCUS_07030 5492 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5442 5978 gene locus_tag LOCUS_07040 5442 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5995 6969 gene locus_tag LOCUS_07050 5995 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7830 7063 gene locus_tag LOCUS_07060 7830 7063 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence064 360 2108 gene locus_tag LOCUS_07070 360 2108 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_07070 3891 2398 gene locus_tag LOCUS_07080 gene hpnE 3891 2398 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_07080 4806 3907 gene locus_tag LOCUS_07090 gene hpnD 4806 3907 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_07090 5832 4825 gene locus_tag LOCUS_07100 5832 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6031 6981 gene locus_tag LOCUS_07110 gene ispH 6031 6981 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence065 <1 667 gene locus_tag LOCUS_07120 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391643.1:menaquinone biosynthesis decarboxylase 699 2303 gene locus_tag LOCUS_07130 gene gltX 699 2303 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_07130 2349 3320 gene locus_tag LOCUS_07140 2349 3320 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_07140 3494 4648 gene locus_tag LOCUS_07150 gene nifS 3494 4648 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_07150 4700 5506 gene locus_tag LOCUS_07160 gene dapB 4700 5506 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_07160 5560 6834 gene locus_tag LOCUS_07170 gene murA 5560 6834 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_07170 8679 6850 gene locus_tag LOCUS_07180 8679 6850 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence066 332 700 gene locus_tag LOCUS_07190 332 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1057 2715 gene locus_tag LOCUS_07200 1057 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4739 2892 gene locus_tag LOCUS_07210 4739 2892 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_07210 6600 5239 gene locus_tag LOCUS_07220 6600 5239 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_07220 7213 7674 gene locus_tag LOCUS_07230 7213 7674 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001875.1 protein_id gnl|my_center|LOCUS_07230 7764 8153 gene locus_tag LOCUS_07240 7764 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 <9007 8322 gene locus_tag LOCUS_07250 <9007 8322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256749.1:FKBP-type peptidyl-prolyl cis-trans isomerase >Feature sequence067 557 2341 gene locus_tag LOCUS_07260 557 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4965 2653 gene locus_tag LOCUS_07270 gene metE 4965 2653 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918370.1 protein_id gnl|my_center|LOCUS_07270 6061 5006 gene locus_tag LOCUS_07280 6061 5006 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883618.1 protein_id gnl|my_center|LOCUS_07280 8955 6112 gene locus_tag LOCUS_07290 8955 6112 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883617.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence068 1421 5734 gene locus_tag LOCUS_07300 1421 5734 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626303.1 protein_id gnl|my_center|LOCUS_07300 8011 6191 gene locus_tag LOCUS_07310 8011 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 8806 8336 gene locus_tag LOCUS_07320 8806 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence069 <1 654 gene locus_tag LOCUS_07330 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121727.1:replication-associated recombination protein A note possible pseudo, internal stop codon 697 963 gene locus_tag LOCUS_07340 697 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07340 960 1535 gene locus_tag LOCUS_07350 960 1535 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_07350 1716 2678 gene locus_tag LOCUS_07360 1716 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3319 2993 gene locus_tag LOCUS_07370 3319 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3278 3871 gene locus_tag LOCUS_07380 3278 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5585 3924 gene locus_tag LOCUS_07390 5585 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6897 5689 gene locus_tag LOCUS_07400 6897 5689 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_07400 7149 7724 gene locus_tag LOCUS_07410 7149 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8615 8058 gene locus_tag LOCUS_07420 8615 8058 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932347.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence070 517 1278 gene locus_tag LOCUS_07430 517 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1790 1602 gene locus_tag LOCUS_07440 1790 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2346 1828 gene locus_tag LOCUS_07450 2346 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3073 2618 gene locus_tag LOCUS_07460 3073 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3236 4327 gene locus_tag LOCUS_07470 3236 4327 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 protein_id gnl|my_center|LOCUS_07470 4317 5303 gene locus_tag LOCUS_07480 4317 5303 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921310.1 protein_id gnl|my_center|LOCUS_07480 5312 7552 gene locus_tag LOCUS_07490 5312 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence071 <1 2179 gene locus_tag LOCUS_07500 <1 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120163.1:phosphoketolase family protein 4901 2217 gene locus_tag LOCUS_07510 4901 2217 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_07510 5269 6282 gene locus_tag LOCUS_07520 gene pdhA 5269 6282 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_07520 6390 7376 gene locus_tag LOCUS_07530 6390 7376 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_07530 7493 8317 gene locus_tag LOCUS_07540 gene pgeF 7493 8317 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence072 890 660 gene locus_tag LOCUS_07550 890 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1730 1095 gene locus_tag LOCUS_07560 1730 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2322 1876 gene locus_tag LOCUS_07570 2322 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3116 2319 gene locus_tag LOCUS_07580 3116 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3704 3498 gene locus_tag LOCUS_07590 3704 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3999 3694 gene locus_tag LOCUS_07600 3999 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5522 4323 gene locus_tag LOCUS_07610 5522 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6743 5562 gene locus_tag LOCUS_07620 6743 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7486 7019 gene locus_tag LOCUS_07630 7486 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence073 <1 872 gene locus_tag LOCUS_07640 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974307.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein 1026 953 gene locus_tag LOCUS_t00120 1026 953 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1316 2041 gene locus_tag LOCUS_07650 1316 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2085 2687 gene locus_tag LOCUS_07660 2085 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2977 3732 gene locus_tag LOCUS_07670 2977 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3953 6196 gene locus_tag LOCUS_07680 3953 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 6258 6911 gene locus_tag LOCUS_07690 6258 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7000 8052 gene locus_tag LOCUS_07700 gene lpxD 7000 8052 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence074 2568 748 gene locus_tag LOCUS_07710 gene aspS 2568 748 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_07710 3789 2665 gene locus_tag LOCUS_07720 3789 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3784 4014 gene locus_tag LOCUS_07730 3784 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4296 6809 gene locus_tag LOCUS_07740 4296 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 7595 7362 gene locus_tag LOCUS_07750 7595 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence075 1498 698 gene locus_tag LOCUS_07760 1498 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1833 1543 gene locus_tag LOCUS_07770 1833 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2041 2112 gene locus_tag LOCUS_t00130 2041 2112 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2711 2208 gene locus_tag LOCUS_07780 2711 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921922.1 protein_id gnl|my_center|LOCUS_07780 3342 2767 gene locus_tag LOCUS_07790 3342 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3774 3702 gene locus_tag LOCUS_t00140 3774 3702 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4025 4930 gene locus_tag LOCUS_07800 gene cysD 4025 4930 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_07800 4999 6930 gene locus_tag LOCUS_07810 gene cysN 4999 6930 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_07810 7100 7825 gene locus_tag LOCUS_07820 7100 7825 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence076 1620 505 gene locus_tag LOCUS_07830 1620 505 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_07830 2816 1791 gene locus_tag LOCUS_07840 2816 1791 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_07840 3883 2813 gene locus_tag LOCUS_07850 3883 2813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_07850 5130 3898 gene locus_tag LOCUS_07860 5130 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6133 5123 gene locus_tag LOCUS_07870 6133 5123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_07870 8028 6169 gene locus_tag LOCUS_07880 8028 6169 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence077 376 1674 gene locus_tag LOCUS_07890 376 1674 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_07890 1678 3195 gene locus_tag LOCUS_07900 1678 3195 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828472.1 protein_id gnl|my_center|LOCUS_07900 3305 3433 gene locus_tag LOCUS_07910 3305 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3441 3617 gene locus_tag LOCUS_07920 3441 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 7047 3796 gene locus_tag LOCUS_07930 7047 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8188 7136 gene locus_tag LOCUS_07940 gene hemB 8188 7136 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958218.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence078 97 1989 gene locus_tag LOCUS_07950 gene asnB 97 1989 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_07950 2360 3361 gene locus_tag LOCUS_07960 2360 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3422 4120 gene locus_tag LOCUS_07970 3422 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4120 4788 gene locus_tag LOCUS_07980 4120 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5168 6562 gene locus_tag LOCUS_07990 5168 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6559 7413 gene locus_tag LOCUS_08000 6559 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence079 1357 494 gene locus_tag LOCUS_08010 1357 494 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_08010 5350 1904 gene locus_tag LOCUS_08020 5350 1904 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_08020 6501 5395 gene locus_tag LOCUS_08030 6501 5395 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_08030 6766 6548 gene locus_tag LOCUS_08040 6766 6548 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151363.1 protein_id gnl|my_center|LOCUS_08040 6879 7232 gene locus_tag LOCUS_08050 6879 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7855 7778 gene locus_tag LOCUS_t00150 7855 7778 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence080 <1 675 gene locus_tag LOCUS_08060 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582726.1:glycoside hydrolase family 3 protein 946 1824 gene locus_tag LOCUS_08070 946 1824 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_08070 1931 3985 gene locus_tag LOCUS_08080 gene mrdA 1931 3985 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869951.1 protein_id gnl|my_center|LOCUS_08080 3985 5202 gene locus_tag LOCUS_08090 gene rodA 3985 5202 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_08090 5576 6412 gene locus_tag LOCUS_08100 5576 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6850 7662 gene locus_tag LOCUS_08110 6850 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7825 7643 gene locus_tag LOCUS_08120 7825 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence081 1378 98 gene locus_tag LOCUS_08130 gene lysA 1378 98 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_08130 2237 1413 gene locus_tag LOCUS_08140 2237 1413 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_08140 2840 2409 gene locus_tag LOCUS_08150 gene rplK 2840 2409 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_08150 3213 2935 gene locus_tag LOCUS_08160 3213 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3832 3227 gene locus_tag LOCUS_08170 gene nusG 3832 3227 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_08170 4314 3901 gene locus_tag LOCUS_08180 4314 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4451 4377 gene locus_tag LOCUS_t00160 4451 4377 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4640 4482 gene locus_tag LOCUS_08190 4640 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6091 4880 gene locus_tag LOCUS_08200 gene tuf 6091 4880 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_08200 6327 6255 gene locus_tag LOCUS_t00170 6327 6255 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6642 7724 gene locus_tag LOCUS_08210 6642 7724 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence082 17 613 gene locus_tag LOCUS_08220 17 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 645 1871 gene locus_tag LOCUS_08230 645 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2531 3229 gene locus_tag LOCUS_08240 2531 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3454 3864 gene locus_tag LOCUS_08250 3454 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3886 4818 gene locus_tag LOCUS_08260 3886 4818 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_08260 4834 7404 gene locus_tag LOCUS_08270 4834 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence083 1612 2937 gene locus_tag LOCUS_08280 1612 2937 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081430802.1 protein_id gnl|my_center|LOCUS_08280 3538 3041 gene locus_tag LOCUS_08290 3538 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4350 3679 gene locus_tag LOCUS_08300 4350 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4755 4555 gene locus_tag LOCUS_08310 gene rpsU 4755 4555 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656880.1 protein_id gnl|my_center|LOCUS_08310 4951 5124 gene locus_tag LOCUS_08320 4951 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5351 5929 gene locus_tag LOCUS_08330 gene rpoE 5351 5929 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_08330 5916 6527 gene locus_tag LOCUS_08340 5916 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6644 7228 gene locus_tag LOCUS_08350 6644 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence084 <1 617 gene locus_tag LOCUS_08360 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937368.1:CerR family C-terminal domain-containing protein 720 2114 gene locus_tag LOCUS_08370 720 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2111 3697 gene locus_tag LOCUS_08380 2111 3697 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_08380 3703 5154 gene locus_tag LOCUS_08390 3703 5154 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_08390 5771 5217 gene locus_tag LOCUS_08400 5771 5217 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_08400 6028 6606 gene locus_tag LOCUS_08410 6028 6606 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_08410 <7400 6667 gene locus_tag LOCUS_08420 <7400 6667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792164.1:TIGR04282 family arsenosugar biosynthesis glycosyltransferase >Feature sequence085 1696 722 gene locus_tag LOCUS_08430 1696 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1901 3685 gene locus_tag LOCUS_08440 1901 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3848 6775 gene locus_tag LOCUS_08450 3848 6775 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence086 2328 4724 gene locus_tag LOCUS_08460 2328 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5177 4728 gene locus_tag LOCUS_08470 5177 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 5387 5632 gene locus_tag LOCUS_08480 5387 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence087 <1 3068 gene locus_tag LOCUS_08490 <1 3068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202205.1:DUF5107 domain-containing protein 3061 4512 gene locus_tag LOCUS_08500 3061 4512 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_08500 4674 6947 gene locus_tag LOCUS_08510 4674 6947 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206292570.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence088 365 1168 gene locus_tag LOCUS_08520 365 1168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_08520 1266 2576 gene locus_tag LOCUS_08530 1266 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2642 4174 gene locus_tag LOCUS_08540 2642 4174 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_08540 4318 4725 gene locus_tag LOCUS_08550 4318 4725 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_08550 6011 4788 gene locus_tag LOCUS_08560 gene bioF 6011 4788 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_08560 6422 6015 gene locus_tag LOCUS_08570 6422 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7063 6623 gene locus_tag LOCUS_08580 7063 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence089 466 2025 gene locus_tag LOCUS_08590 466 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1925 2560 gene locus_tag LOCUS_08600 1925 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3634 2585 gene locus_tag LOCUS_08610 3634 2585 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928642.1 protein_id gnl|my_center|LOCUS_08610 4745 3924 gene locus_tag LOCUS_08620 gene folE2 4745 3924 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_08620 5274 4870 gene locus_tag LOCUS_08630 gene hisI 5274 4870 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_08630 5404 6720 gene locus_tag LOCUS_08640 gene waaF 5404 6720 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence090 217 1461 gene locus_tag LOCUS_08650 217 1461 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436542.1 protein_id gnl|my_center|LOCUS_08650 1694 1428 gene locus_tag LOCUS_08660 1694 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2872 1862 gene locus_tag LOCUS_08670 2872 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3543 3031 gene locus_tag LOCUS_08680 3543 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3871 4062 gene locus_tag LOCUS_08690 3871 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5274 4834 gene locus_tag LOCUS_08700 5274 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7017 5305 gene locus_tag LOCUS_08710 7017 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence091 1419 4946 gene locus_tag LOCUS_08720 1419 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5086 5622 gene locus_tag LOCUS_08730 5086 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence092 321 1034 gene locus_tag LOCUS_08740 gene clpP 321 1034 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_08740 1113 1733 gene locus_tag LOCUS_08750 1113 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1816 2664 gene locus_tag LOCUS_08760 1816 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2562 3746 gene locus_tag LOCUS_08770 2562 3746 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_08770 4116 4934 gene locus_tag LOCUS_08780 4116 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5063 6067 gene locus_tag LOCUS_08790 5063 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence093 2109 181 gene locus_tag LOCUS_08800 2109 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2878 4188 gene locus_tag LOCUS_08810 gene mnmE 2878 4188 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_08810 4678 5922 gene locus_tag LOCUS_08820 4678 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 6628 5969 gene locus_tag LOCUS_08830 6628 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence094 195 1181 gene locus_tag LOCUS_08840 195 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1421 2377 gene locus_tag LOCUS_08850 1421 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3808 2420 gene locus_tag LOCUS_08860 gene melA 3808 2420 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986606.1 protein_id gnl|my_center|LOCUS_08860 3712 3721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4054 4632 gene locus_tag LOCUS_08870 4054 4632 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_08870 4883 4647 gene locus_tag LOCUS_08880 4883 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 5272 5180 gene locus_tag LOCUS_t00180 5272 5180 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6318 5524 gene locus_tag LOCUS_08890 6318 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence095 277 50 gene locus_tag LOCUS_08900 277 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 501 1328 gene locus_tag LOCUS_08910 501 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1325 1624 gene locus_tag LOCUS_08920 1325 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2818 2153 gene locus_tag LOCUS_08930 2818 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3549 3031 gene locus_tag LOCUS_08940 3549 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3431 3640 gene locus_tag LOCUS_08950 3431 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4073 3744 gene locus_tag LOCUS_08960 4073 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5016 4111 gene locus_tag LOCUS_08970 5016 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 5167 5000 gene locus_tag LOCUS_08980 5167 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence096 117 611 gene locus_tag LOCUS_08990 117 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1962 706 gene locus_tag LOCUS_09000 1962 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2352 2029 gene locus_tag LOCUS_09010 2352 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3105 2431 gene locus_tag LOCUS_09020 3105 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4555 3206 gene locus_tag LOCUS_09030 4555 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5701 4844 gene locus_tag LOCUS_09040 5701 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence097 1538 153 gene locus_tag LOCUS_09050 1538 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2684 1656 gene locus_tag LOCUS_09060 gene hemW 2684 1656 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_09060 2988 3479 gene locus_tag LOCUS_09070 2988 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4304 3759 gene locus_tag LOCUS_09080 4304 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 5992 4457 gene locus_tag LOCUS_09090 5992 4457 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530067.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence098 465 1946 gene locus_tag LOCUS_09100 465 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2034 4124 gene locus_tag LOCUS_09110 gene metG 2034 4124 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_09110 4223 5236 gene locus_tag LOCUS_09120 4223 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence099 432 268 gene locus_tag LOCUS_09130 432 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1434 721 gene locus_tag LOCUS_09140 1434 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3210 1450 gene locus_tag LOCUS_09150 3210 1450 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_09150 3975 3238 gene locus_tag LOCUS_09160 3975 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4236 6227 gene locus_tag LOCUS_09170 4236 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence100 328 1335 gene locus_tag LOCUS_09180 328 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4007 1437 gene locus_tag LOCUS_09190 4007 1437 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence101 <1 692 gene locus_tag LOCUS_09200 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921555.1:7-carboxy-7-deazaguanine synthase QueE 822 1187 gene locus_tag LOCUS_09210 822 1187 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_09210 1372 2802 gene locus_tag LOCUS_09220 1372 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3281 2883 gene locus_tag LOCUS_09230 3281 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence102 589 1188 gene locus_tag LOCUS_09240 589 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1443 1805 gene locus_tag LOCUS_09250 1443 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2379 2089 gene locus_tag LOCUS_09260 2379 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3893 2556 gene locus_tag LOCUS_09270 gene radA 3893 2556 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_09270 5151 4405 gene locus_tag LOCUS_09280 5151 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5517 5269 gene locus_tag LOCUS_09290 5517 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 6118 5528 gene locus_tag LOCUS_09300 6118 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence103 2455 3378 gene locus_tag LOCUS_09310 2455 3378 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence104 <1 1248 gene locus_tag LOCUS_09320 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein 1984 3000 gene locus_tag LOCUS_09330 1984 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3915 3016 gene locus_tag LOCUS_09340 3915 3016 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_09340 4322 4407 gene locus_tag LOCUS_t00190 4322 4407 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5556 4495 gene locus_tag LOCUS_09350 5556 4495 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930114.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence105 476 1582 gene locus_tag LOCUS_09360 476 1582 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_09360 3080 1554 gene locus_tag LOCUS_09370 gene dnaA 3080 1554 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229057.1 protein_id gnl|my_center|LOCUS_09370 4592 3636 gene locus_tag LOCUS_09380 4592 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4741 5634 gene locus_tag LOCUS_09390 gene argB 4741 5634 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence106 64 912 gene locus_tag LOCUS_09400 64 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 982 1866 gene locus_tag LOCUS_09410 gene hisG 982 1866 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_09410 1879 2088 gene locus_tag LOCUS_09420 1879 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2132 2632 gene locus_tag LOCUS_09430 2132 2632 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040149.1 protein_id gnl|my_center|LOCUS_09430 2645 2794 gene locus_tag LOCUS_09440 2645 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2757 3533 gene locus_tag LOCUS_09450 2757 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4583 3492 gene locus_tag LOCUS_09460 4583 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 6072 4507 gene locus_tag LOCUS_09470 6072 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence107 1290 136 gene locus_tag LOCUS_09480 gene dnaN 1290 136 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385124.1 protein_id gnl|my_center|LOCUS_09480 2578 1403 gene locus_tag LOCUS_09490 2578 1403 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_09490 2765 3454 gene locus_tag LOCUS_09500 2765 3454 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187259.1 protein_id gnl|my_center|LOCUS_09500 3976 3551 gene locus_tag LOCUS_09510 3976 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4369 3983 gene locus_tag LOCUS_09520 4369 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5130 4369 gene locus_tag LOCUS_09530 5130 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <6078 5270 gene locus_tag LOCUS_09540 <6078 5270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940791.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence108 1467 2384 gene locus_tag LOCUS_09550 gene cdsA 1467 2384 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212137.1 protein_id gnl|my_center|LOCUS_09550 2568 4058 gene locus_tag LOCUS_09560 2568 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 5287 4127 gene locus_tag LOCUS_09570 5287 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence109 633 211 gene locus_tag LOCUS_09580 633 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1216 653 gene locus_tag LOCUS_09590 1216 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2325 1471 gene locus_tag LOCUS_09600 2325 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3029 2325 gene locus_tag LOCUS_09610 3029 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3769 3413 gene locus_tag LOCUS_09620 3769 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4154 3810 gene locus_tag LOCUS_09630 4154 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4372 4154 gene locus_tag LOCUS_09640 4372 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4916 4515 gene locus_tag LOCUS_09650 4916 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 5908 4991 gene locus_tag LOCUS_09660 5908 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence110 2 625 gene locus_tag LOCUS_09670 2 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 683 1072 gene locus_tag LOCUS_09680 683 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1657 1067 gene locus_tag LOCUS_09690 1657 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2042 1776 gene locus_tag LOCUS_09700 2042 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2245 2937 gene locus_tag LOCUS_09710 gene ric 2245 2937 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_09710 3385 3870 gene locus_tag LOCUS_09720 3385 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3882 4589 gene locus_tag LOCUS_09730 3882 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 4619 4912 gene locus_tag LOCUS_09740 4619 4912 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_09740 4929 5555 gene locus_tag LOCUS_09750 4929 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 5386 5395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5494 5841 gene locus_tag LOCUS_09760 5494 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09760 >Feature sequence111 196 984 gene locus_tag LOCUS_09770 196 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1934 1188 gene locus_tag LOCUS_09780 1934 1188 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_09780 3852 2035 gene locus_tag LOCUS_09790 3852 2035 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 protein_id gnl|my_center|LOCUS_09790 3919 4018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4472 4945 gene locus_tag LOCUS_09800 4472 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <5870 4968 gene locus_tag LOCUS_09810 <5870 4968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764761.1:putative sulfate exporter family transporter >Feature sequence112 346 1242 gene locus_tag LOCUS_09820 346 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1636 3987 gene locus_tag LOCUS_09830 1636 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5430 4129 gene locus_tag LOCUS_09840 5430 4129 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence113 <1 809 gene locus_tag LOCUS_09850 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122076.1:cofactor-independent phosphoglycerate mutase 1566 859 gene locus_tag LOCUS_09860 1566 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2024 1572 gene locus_tag LOCUS_09870 2024 1572 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_09870 3280 2024 gene locus_tag LOCUS_09880 3280 2024 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09880 4620 3277 gene locus_tag LOCUS_09890 gene sufD 4620 3277 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_09890 5417 4665 gene locus_tag LOCUS_09900 gene sufC 5417 4665 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence114 715 1743 gene locus_tag LOCUS_09910 715 1743 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_09910 1961 3292 gene locus_tag LOCUS_09920 1961 3292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_09920 3466 4431 gene locus_tag LOCUS_09930 3466 4431 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704945.1 protein_id gnl|my_center|LOCUS_09930 4445 5563 gene locus_tag LOCUS_09940 4445 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence115 <1 3079 gene locus_tag LOCUS_09950 <1 3079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003862217.1:carbamoyl-phosphate synthase large subunit 3295 4704 gene locus_tag LOCUS_09960 3295 4704 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 protein_id gnl|my_center|LOCUS_09960 5476 4769 gene locus_tag LOCUS_09970 5476 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence116 994 1746 gene locus_tag LOCUS_09980 994 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2850 3653 gene locus_tag LOCUS_09990 2850 3653 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_09990 3822 4676 gene locus_tag LOCUS_10000 gene cdaA 3822 4676 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence117 98 1063 gene locus_tag LOCUS_10010 98 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1105 2436 gene locus_tag LOCUS_10020 gene serS 1105 2436 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_10020 3244 2459 gene locus_tag LOCUS_10030 3244 2459 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_10030 4976 3294 gene locus_tag LOCUS_10040 4976 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence118 1824 223 gene locus_tag LOCUS_10050 1824 223 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539579.1 protein_id gnl|my_center|LOCUS_10050 1823 2032 gene locus_tag LOCUS_10060 1823 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3985 2060 gene locus_tag LOCUS_10070 3985 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5474 4197 gene locus_tag LOCUS_10080 5474 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence119 <1 659 gene locus_tag LOCUS_10090 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405880.1:decarboxylating 6-phosphogluconate dehydrogenase 726 2120 gene locus_tag LOCUS_10100 gene zwf 726 2120 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_10100 3428 2214 gene locus_tag LOCUS_10110 gene kch 3428 2214 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064633.1 protein_id gnl|my_center|LOCUS_10110 4597 3494 gene locus_tag LOCUS_10120 4597 3494 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence120 574 1527 gene locus_tag LOCUS_10130 574 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2689 1610 gene locus_tag LOCUS_10140 2689 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3305 2769 gene locus_tag LOCUS_10150 3305 2769 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_10150 3368 5146 gene locus_tag LOCUS_10160 3368 5146 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence121 46 702 gene locus_tag LOCUS_10170 46 702 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_10170 699 1814 gene locus_tag LOCUS_10180 gene pdxA 699 1814 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_10180 2558 1857 gene locus_tag LOCUS_10190 2558 1857 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258566.1 protein_id gnl|my_center|LOCUS_10190 2745 3920 gene locus_tag LOCUS_10200 2745 3920 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_10200 4033 5187 gene locus_tag LOCUS_10210 gene dnaN 4033 5187 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385124.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence122 275 1009 gene locus_tag LOCUS_10220 275 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1460 1020 gene locus_tag LOCUS_10230 1460 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1948 1457 gene locus_tag LOCUS_10240 1948 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2313 1945 gene locus_tag LOCUS_10250 2313 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3515 2310 gene locus_tag LOCUS_10260 3515 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4811 3582 gene locus_tag LOCUS_10270 gene pilG 4811 3582 CDS product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216405.1 protein_id gnl|my_center|LOCUS_10270 <5313 4804 gene locus_tag LOCUS_10280 <5313 4804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533577.1:GspE/PulE family protein >Feature sequence123 4734 1216 gene locus_tag LOCUS_10290 4734 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence124 776 261 gene locus_tag LOCUS_10300 776 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 768 1205 gene locus_tag LOCUS_10310 768 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 4300 1505 gene locus_tag LOCUS_10320 4300 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence125 764 375 gene locus_tag LOCUS_10330 764 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2733 823 gene locus_tag LOCUS_10340 gene shc 2733 823 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_10340 3205 4143 gene locus_tag LOCUS_10350 3205 4143 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_10350 4921 4091 gene locus_tag LOCUS_10360 4921 4091 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_10360 5272 5015 gene locus_tag LOCUS_10370 5272 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence126 86 853 gene locus_tag LOCUS_10380 gene tpiA 86 853 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_10380 898 1353 gene locus_tag LOCUS_10390 898 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1404 2297 gene locus_tag LOCUS_10400 1404 2297 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615387.1 protein_id gnl|my_center|LOCUS_10400 2394 2981 gene locus_tag LOCUS_10410 gene gmk 2394 2981 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_10410 3014 3250 gene locus_tag LOCUS_10420 3014 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3288 3848 gene locus_tag LOCUS_10430 3288 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3964 5181 gene locus_tag LOCUS_10440 3964 5181 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence127 40 113 gene locus_tag LOCUS_t00200 40 113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 233 496 gene locus_tag LOCUS_10450 233 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10450 1022 2548 gene locus_tag LOCUS_10460 1022 2548 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268315.1 protein_id gnl|my_center|LOCUS_10460 2545 3597 gene locus_tag LOCUS_10470 2545 3597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_10470 3640 4593 gene locus_tag LOCUS_10480 3640 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10480 >Feature sequence128 63 980 gene locus_tag LOCUS_10490 63 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1150 1929 gene locus_tag LOCUS_10500 1150 1929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943189.1 protein_id gnl|my_center|LOCUS_10500 1992 2843 gene locus_tag LOCUS_10510 gene lpxA 1992 2843 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921002.1 protein_id gnl|my_center|LOCUS_10510 2840 3919 gene locus_tag LOCUS_10520 2840 3919 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence129 425 1066 gene locus_tag LOCUS_10530 425 1066 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_10530 1072 2511 gene locus_tag LOCUS_10540 1072 2511 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_10540 2508 4055 gene locus_tag LOCUS_10550 2508 4055 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_10550 4110 4880 gene locus_tag LOCUS_10560 4110 4880 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence130 351 1412 gene locus_tag LOCUS_10570 351 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1414 2172 gene locus_tag LOCUS_10580 1414 2172 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908409.1 protein_id gnl|my_center|LOCUS_10580 2193 2789 gene locus_tag LOCUS_10590 2193 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2786 3544 gene locus_tag LOCUS_10600 2786 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence131 100 309 gene locus_tag LOCUS_10610 100 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 311 1588 gene locus_tag LOCUS_10620 311 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1623 1551 gene locus_tag LOCUS_t00210 1623 1551 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3174 1726 gene locus_tag LOCUS_10630 3174 1726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_10630 5034 3505 gene locus_tag LOCUS_10640 gene trpE 5034 3505 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence132 <1 531 gene locus_tag LOCUS_10650 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933664.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase 521 1582 gene locus_tag LOCUS_10660 521 1582 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_10660 2363 1587 gene locus_tag LOCUS_10670 2363 1587 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_10670 2902 4920 gene locus_tag LOCUS_10680 2902 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence133 686 1306 gene locus_tag LOCUS_10690 gene wrbA 686 1306 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_10690 2061 1342 gene locus_tag LOCUS_10700 2061 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2868 2083 gene locus_tag LOCUS_10710 2868 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3718 2978 gene locus_tag LOCUS_10720 gene accD 3718 2978 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence134 1325 51 gene locus_tag LOCUS_10730 gene purD 1325 51 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_10730 1928 1371 gene locus_tag LOCUS_10740 1928 1371 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_10740 2661 2035 gene locus_tag LOCUS_10750 gene ilvN 2661 2035 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_10750 4646 2739 gene locus_tag LOCUS_10760 gene ilvB 4646 2739 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence135 1069 1599 gene locus_tag LOCUS_10770 1069 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3184 2015 gene locus_tag LOCUS_10780 3184 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3741 4484 gene locus_tag LOCUS_10790 3741 4484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence136 1216 491 gene locus_tag LOCUS_10800 1216 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1321 1701 gene locus_tag LOCUS_10810 1321 1701 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_10810 2094 1705 gene locus_tag LOCUS_10820 2094 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2554 2141 gene locus_tag LOCUS_10830 2554 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2919 2581 gene locus_tag LOCUS_10840 2919 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3745 2933 gene locus_tag LOCUS_10850 3745 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4960 3959 gene locus_tag LOCUS_10860 4960 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence137 282 1166 gene locus_tag LOCUS_10870 282 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1177 1851 gene locus_tag LOCUS_10880 1177 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1936 2226 gene locus_tag LOCUS_10890 1936 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2223 2435 gene locus_tag LOCUS_10900 2223 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2443 3813 gene locus_tag LOCUS_10910 2443 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3936 4250 gene locus_tag LOCUS_10920 3936 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence138 340 645 gene locus_tag LOCUS_10930 gene raiA 340 645 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_10930 750 1226 gene locus_tag LOCUS_10940 750 1226 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_10940 1329 1601 gene locus_tag LOCUS_10950 1329 1601 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_10950 1681 4029 gene locus_tag LOCUS_10960 1681 4029 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206292570.1 protein_id gnl|my_center|LOCUS_10960 4581 4072 gene locus_tag LOCUS_10970 4581 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence139 226 474 gene locus_tag LOCUS_10980 226 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 994 1911 gene locus_tag LOCUS_10990 994 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1911 2672 gene locus_tag LOCUS_11000 1911 2672 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_11000 3687 2725 gene locus_tag LOCUS_11010 3687 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <4860 3773 gene locus_tag LOCUS_11020 <4860 3773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941969.1:mercuric reductase >Feature sequence140 1301 738 gene locus_tag LOCUS_11030 1301 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2431 1298 gene locus_tag LOCUS_11040 2431 1298 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_11040 3736 2585 gene locus_tag LOCUS_11050 3736 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4317 4075 gene locus_tag LOCUS_11060 4317 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence141 317 4114 gene locus_tag LOCUS_11070 317 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence142 909 73 gene locus_tag LOCUS_11080 gene ehuB 909 73 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064045.1 protein_id gnl|my_center|LOCUS_11080 1822 1220 gene locus_tag LOCUS_11090 1822 1220 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_11090 3287 1932 gene locus_tag LOCUS_11100 gene glmM 3287 1932 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_11100 4143 3364 gene locus_tag LOCUS_11110 4143 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence143 2167 1940 gene locus_tag LOCUS_11120 2167 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4212 2164 gene locus_tag LOCUS_11130 4212 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence144 1112 294 gene locus_tag LOCUS_11140 1112 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1401 1171 gene locus_tag LOCUS_11150 gene csrA 1401 1171 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_11150 1905 1504 gene locus_tag LOCUS_11160 1905 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2131 2868 gene locus_tag LOCUS_11170 2131 2868 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 protein_id gnl|my_center|LOCUS_11170 3186 4268 gene locus_tag LOCUS_11180 3186 4268 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence145 1034 804 gene locus_tag LOCUS_11190 1034 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1485 2531 gene locus_tag LOCUS_11200 1485 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2569 3891 gene locus_tag LOCUS_11210 gene aroA 2569 3891 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262299.1 protein_id gnl|my_center|LOCUS_11210 4334 3909 gene locus_tag LOCUS_11220 4334 3909 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence146 101 955 gene locus_tag LOCUS_11230 101 955 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203387.1 protein_id gnl|my_center|LOCUS_11230 1025 1900 gene locus_tag LOCUS_11240 1025 1900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_11240 1946 3190 gene locus_tag LOCUS_11250 1946 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence147 <1 1099 gene locus_tag LOCUS_11260 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331356.1:response regulator 2156 1287 gene locus_tag LOCUS_11270 2156 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4377 2347 gene locus_tag LOCUS_11280 4377 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence148 952 71 gene locus_tag LOCUS_11290 952 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2076 1516 gene locus_tag LOCUS_11300 gene frr 2076 1516 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_11300 2866 2123 gene locus_tag LOCUS_11310 gene pyrH 2866 2123 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_11310 3793 2921 gene locus_tag LOCUS_11320 gene tsf 3793 2921 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880428.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence149 703 1425 gene locus_tag LOCUS_11330 703 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1748 2287 gene locus_tag LOCUS_11340 1748 2287 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338731.1 protein_id gnl|my_center|LOCUS_11340 2437 3837 gene locus_tag LOCUS_11350 2437 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence150 1673 405 gene locus_tag LOCUS_11360 1673 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2436 2020 gene locus_tag LOCUS_11370 2436 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3934 2753 gene locus_tag LOCUS_11380 3934 2753 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence151 232 672 gene locus_tag LOCUS_11390 232 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 716 1192 gene locus_tag LOCUS_11400 716 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2062 1235 gene locus_tag LOCUS_11410 2062 1235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_11410 3181 2405 gene locus_tag LOCUS_11420 3181 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3926 4054 gene locus_tag LOCUS_11430 3926 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence152 2740 2021 gene locus_tag LOCUS_11440 2740 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3322 4344 gene locus_tag LOCUS_11450 3322 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence153 651 1508 gene locus_tag LOCUS_11460 651 1508 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_11460 1587 2567 gene locus_tag LOCUS_11470 1587 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 3620 2634 gene locus_tag LOCUS_11480 3620 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence154 1477 308 gene locus_tag LOCUS_11490 1477 308 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_11490 1601 2779 gene locus_tag LOCUS_11500 1601 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3505 2786 gene locus_tag LOCUS_11510 3505 2786 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence155 2059 785 gene locus_tag LOCUS_11520 2059 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3732 2062 gene locus_tag LOCUS_11530 3732 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence156 637 350 gene locus_tag LOCUS_11540 637 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1086 634 gene locus_tag LOCUS_11550 1086 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1340 1412 gene locus_tag LOCUS_t00220 1340 1412 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1698 1525 gene locus_tag LOCUS_11560 1698 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 2330 1695 gene locus_tag LOCUS_11570 2330 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 2990 2334 gene locus_tag LOCUS_11580 gene ehuD 2990 2334 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401287.1 protein_id gnl|my_center|LOCUS_11580 3643 2987 gene locus_tag LOCUS_11590 gene ehuC 3643 2987 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812581.1 protein_id gnl|my_center|LOCUS_11590 <4334 3688 gene locus_tag LOCUS_11600 <4334 3688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930396.1:ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB >Feature sequence157 3345 1957 gene locus_tag LOCUS_11610 3345 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4162 3575 gene locus_tag LOCUS_11620 4162 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence158 736 551 gene locus_tag LOCUS_11630 736 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1113 1919 gene locus_tag LOCUS_11640 1113 1919 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_11640 1967 2089 gene locus_tag LOCUS_11650 1967 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2320 2592 gene locus_tag LOCUS_11660 2320 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3181 2594 gene locus_tag LOCUS_11670 3181 2594 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_11670 4172 3789 gene locus_tag LOCUS_11680 4172 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence159 <1 527 gene locus_tag LOCUS_11690 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417249.1:phosphatidylinositol-3-phosphatase 599 1351 gene locus_tag LOCUS_11700 599 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1348 1980 gene locus_tag LOCUS_11710 1348 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2425 3312 gene locus_tag LOCUS_11720 gene rpsB 2425 3312 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence160 1286 684 gene locus_tag LOCUS_11730 1286 684 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_11730 2739 1381 gene locus_tag LOCUS_11740 gene glmM 2739 1381 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_11740 2287 2296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3595 2816 gene locus_tag LOCUS_11750 3595 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence161 <1 544 gene locus_tag LOCUS_11760 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943695.1:putative lipid II flippase FtsW 541 1779 gene locus_tag LOCUS_11770 gene murG 541 1779 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_11770 1815 3266 gene locus_tag LOCUS_11780 gene murC 1815 3266 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence162 579 1817 gene locus_tag LOCUS_11790 579 1817 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_11790 2168 3043 gene locus_tag LOCUS_11800 2168 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3040 3945 gene locus_tag LOCUS_11810 3040 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence163 523 605 gene locus_tag LOCUS_t00230 523 605 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2882 783 gene locus_tag LOCUS_11820 2882 783 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_11820 <4075 2916 gene locus_tag LOCUS_11830 <4075 2916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861463.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence164 263 1102 gene locus_tag LOCUS_11840 263 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1110 1757 gene locus_tag LOCUS_11850 1110 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1926 3029 gene locus_tag LOCUS_11860 1926 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence165 555 785 gene locus_tag LOCUS_11870 555 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1459 1130 gene locus_tag LOCUS_11880 1459 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1571 2032 gene locus_tag LOCUS_11890 1571 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 2143 2709 gene locus_tag LOCUS_11900 2143 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 >Feature sequence166 265 639 gene locus_tag LOCUS_11910 265 639 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804871.1 protein_id gnl|my_center|LOCUS_11910 733 2151 gene locus_tag LOCUS_11920 733 2151 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_11920 2240 3736 gene locus_tag LOCUS_11930 2240 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence167 1518 631 gene locus_tag LOCUS_11940 1518 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2551 1661 gene locus_tag LOCUS_11950 2551 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3214 2588 gene locus_tag LOCUS_11960 3214 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence168 982 3393 gene locus_tag LOCUS_11970 982 3393 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928791.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence169 <1 1194 gene locus_tag LOCUS_11980 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942252.1:serine hydroxymethyltransferase 1276 1650 gene locus_tag LOCUS_11990 1276 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1654 1974 gene locus_tag LOCUS_12000 gene yidD 1654 1974 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_12000 2221 2487 gene locus_tag LOCUS_12010 2221 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2556 3293 gene locus_tag LOCUS_12020 gene trmD 2556 3293 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_12020 3375 3758 gene locus_tag LOCUS_12030 gene rplS 3375 3758 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence170 209 898 gene locus_tag LOCUS_12040 209 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1178 1456 gene locus_tag LOCUS_12050 1178 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1623 2945 gene locus_tag LOCUS_12060 1623 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3604 3044 gene locus_tag LOCUS_12070 3604 3044 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence171 1078 3069 gene locus_tag LOCUS_12080 gene shc 1078 3069 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_12080 3128 3517 gene locus_tag LOCUS_12090 3128 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence172 2355 1738 gene locus_tag LOCUS_12100 2355 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2888 2352 gene locus_tag LOCUS_12110 2888 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence173 643 897 gene locus_tag LOCUS_12120 643 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1323 2342 gene locus_tag LOCUS_12130 1323 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3157 2402 gene locus_tag LOCUS_12140 3157 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3744 3244 gene locus_tag LOCUS_12150 gene tpx 3744 3244 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence174 330 1295 gene locus_tag LOCUS_12160 330 1295 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_12160 1316 2215 gene locus_tag LOCUS_12170 1316 2215 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_12170 2236 3051 gene locus_tag LOCUS_12180 2236 3051 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_12180 3522 3340 gene locus_tag LOCUS_12190 3522 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence175 397 828 gene locus_tag LOCUS_12200 397 828 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094294.1 protein_id gnl|my_center|LOCUS_12200 1181 2041 gene locus_tag LOCUS_12210 1181 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2182 3096 gene locus_tag LOCUS_12220 gene dapF 2182 3096 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_12220 3135 3257 gene locus_tag LOCUS_12230 3135 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence176 1314 2090 gene locus_tag LOCUS_12240 1314 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2265 2846 gene locus_tag LOCUS_12250 2265 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2894 3064 gene locus_tag LOCUS_12260 2894 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3168 3031 gene locus_tag LOCUS_12270 3168 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence177 1121 243 gene locus_tag LOCUS_12280 1121 243 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522262.1 protein_id gnl|my_center|LOCUS_12280 1578 2063 gene locus_tag LOCUS_12290 1578 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2066 2302 gene locus_tag LOCUS_12300 2066 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2470 3318 gene locus_tag LOCUS_12310 2470 3318 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence178 1423 518 gene locus_tag LOCUS_12320 1423 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2942 1617 gene locus_tag LOCUS_12330 2942 1617 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence179 232 672 gene locus_tag LOCUS_12340 232 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2062 1235 gene locus_tag LOCUS_12350 2062 1235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192698.1 protein_id gnl|my_center|LOCUS_12350 3181 2405 gene locus_tag LOCUS_12360 3181 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence180 <1 1222 gene locus_tag LOCUS_12370 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase 1589 1909 gene locus_tag LOCUS_12380 1589 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1936 3279 gene locus_tag LOCUS_12390 1936 3279 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence181 97 1371 gene locus_tag LOCUS_12400 97 1371 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_12400 2146 2934 gene locus_tag LOCUS_12410 2146 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence182 <1 723 gene locus_tag LOCUS_12420 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250916.1:hydroxyacid dehydrogenase 823 1638 gene locus_tag LOCUS_12430 823 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1801 1729 gene locus_tag LOCUS_t00240 1801 1729 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1969 3336 gene locus_tag LOCUS_12440 1969 3336 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530014.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence183 <1 900 gene locus_tag LOCUS_12450 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123442.1:DNA translocase FtsK 943 2403 gene locus_tag LOCUS_12460 943 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 <3390 2674 gene locus_tag LOCUS_12470 <3390 2674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931839.1:phosphopyruvate hydratase >Feature sequence184 360 196 gene locus_tag LOCUS_12480 360 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 480 830 gene locus_tag LOCUS_12490 480 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 827 2251 gene locus_tag LOCUS_12500 gene cptA 827 2251 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_12500 2312 3346 gene locus_tag LOCUS_12510 gene tsaD 2312 3346 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence185 752 1393 gene locus_tag LOCUS_12520 752 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3196 2033 gene locus_tag LOCUS_12530 3196 2033 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040383028.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence186 1006 314 gene locus_tag LOCUS_12540 1006 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2369 1272 gene locus_tag LOCUS_12550 gene prfA 2369 1272 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_12550 2686 2459 gene locus_tag LOCUS_12560 gene rpmE 2686 2459 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_12560 2817 2745 gene locus_tag LOCUS_t00250 2817 2745 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 45 701 gene locus_tag LOCUS_12570 45 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 613 1122 gene locus_tag LOCUS_12580 613 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2011 1544 gene locus_tag LOCUS_12590 2011 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence188 <1 1011 gene locus_tag LOCUS_12600 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405041.1:magnesium chelatase 1794 1048 gene locus_tag LOCUS_12610 1794 1048 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061297.1 protein_id gnl|my_center|LOCUS_12610 3038 1902 gene locus_tag LOCUS_12620 gene dusB 3038 1902 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence189 <3195 2561 gene locus_tag LOCUS_12630 <3195 2561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392758.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence190 961 23 gene locus_tag LOCUS_12640 gene oppC 961 23 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651799.1 protein_id gnl|my_center|LOCUS_12640 2279 1053 gene locus_tag LOCUS_12650 2279 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2604 2822 gene locus_tag LOCUS_12660 2604 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence191 3 164 gene locus_tag LOCUS_12670 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 298 1635 gene locus_tag LOCUS_12680 298 1635 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence192 61 1095 gene locus_tag LOCUS_12690 61 1095 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_12690 1096 1860 gene locus_tag LOCUS_12700 gene truA 1096 1860 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence193 2404 2153 gene locus_tag LOCUS_12710 2404 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence194 2770 68 gene locus_tag LOCUS_12720 2770 68 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence195 2793 1438 gene locus_tag LOCUS_12730 2793 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence196 <1 501 gene locus_tag LOCUS_12740 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583596.1:ATP-binding protein 749 2467 gene locus_tag LOCUS_12750 749 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2790 2509 gene locus_tag LOCUS_12760 2790 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence197 178 945 gene locus_tag LOCUS_12770 178 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1188 940 gene locus_tag LOCUS_12780 1188 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence198 497 1150 gene locus_tag LOCUS_12790 497 1150 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_12790 2142 1153 gene locus_tag LOCUS_12800 2142 1153 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12800 2764 2207 gene locus_tag LOCUS_12810 2764 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence199 2361 412 gene locus_tag LOCUS_12820 2361 412 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_12820 2718 2377 gene locus_tag LOCUS_12830 2718 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence200 2184 58 gene locus_tag LOCUS_12840 2184 58 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165932.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence201 <1 998 gene locus_tag LOCUS_12850 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026984.1:alpha-L-fucosidase >Feature sequence202 <1 1001 gene locus_tag LOCUS_12860 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479332.1:efflux RND transporter permease subunit 1546 2409 gene locus_tag LOCUS_12870 1546 2409 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence203 831 1259 gene locus_tag LOCUS_12880 831 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2123 1260 gene locus_tag LOCUS_12890 gene panC 2123 1260 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_12890 2632 2102 gene locus_tag LOCUS_12900 gene folK 2632 2102 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_12900 2817 2632 gene locus_tag LOCUS_12910 2817 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence204 247 2328 gene locus_tag LOCUS_12920 gene kdpB 247 2328 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence205 788 1954 gene locus_tag LOCUS_12930 788 1954 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence206 972 376 gene locus_tag LOCUS_12940 972 376 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940563.1 protein_id gnl|my_center|LOCUS_12940 1317 988 gene locus_tag LOCUS_12950 1317 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1984 1310 gene locus_tag LOCUS_12960 gene ubiE 1984 1310 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence207 1821 1252 gene locus_tag LOCUS_12970 1821 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2127 1825 gene locus_tag LOCUS_12980 2127 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence208 451 795 gene locus_tag LOCUS_12990 451 795 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_12990 824 2077 gene locus_tag LOCUS_13000 824 2077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence209 211 801 gene locus_tag LOCUS_13010 211 801 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_13010 1471 863 gene locus_tag LOCUS_13020 gene hisB 1471 863 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_13020 <2545 1468 gene locus_tag LOCUS_13030 <2545 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121508.1:histidinol-phosphate transaminase