>Feature sequence0001 3086 1665 gene locus_tag LOCUS_00010 3086 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4585 3374 gene locus_tag LOCUS_00020 4585 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 >Feature sequence0002 1255 1773 gene locus_tag LOCUS_00030 1255 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2043 2118 gene locus_tag LOCUS_t00010 2043 2118 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3336 4166 gene locus_tag LOCUS_00040 3336 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5106 4702 gene locus_tag LOCUS_00050 5106 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4993 6909 gene locus_tag LOCUS_00060 4993 6909 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_00060 >Feature sequence0003 <1 669 gene locus_tag LOCUS_00070 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005651824.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 691 2088 gene locus_tag LOCUS_00080 gene murD 691 2088 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_00080 2067 3158 gene locus_tag LOCUS_00090 gene ftsW 2067 3158 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_00090 3158 4279 gene locus_tag LOCUS_00100 gene murG 3158 4279 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 protein_id gnl|my_center|LOCUS_00100 5033 4302 gene locus_tag LOCUS_00110 5033 4302 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345837.1 protein_id gnl|my_center|LOCUS_00110 >Feature sequence0004 683 486 gene locus_tag LOCUS_00120 683 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 953 732 gene locus_tag LOCUS_00130 953 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 2040 913 gene locus_tag LOCUS_00140 2040 913 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_00140 2368 2045 gene locus_tag LOCUS_00150 2368 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 2741 2358 gene locus_tag LOCUS_00160 2741 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 3562 2765 gene locus_tag LOCUS_00170 3562 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 4715 3549 gene locus_tag LOCUS_00180 4715 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 4653 4895 gene locus_tag LOCUS_00190 4653 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 5819 5010 gene locus_tag LOCUS_00200 5819 5010 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 protein_id gnl|my_center|LOCUS_00200 6063 6248 gene locus_tag LOCUS_00210 6063 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence0005 115 588 gene locus_tag LOCUS_00220 115 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 667 2142 gene locus_tag LOCUS_00230 667 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 3502 2159 gene locus_tag LOCUS_00240 3502 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 4470 3499 gene locus_tag LOCUS_00250 4470 3499 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110609.1 protein_id gnl|my_center|LOCUS_00250 <6298 4467 gene locus_tag LOCUS_00260 <6298 4467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870273.1:type I restriction endonuclease subunit R >Feature sequence0006 951 622 gene locus_tag LOCUS_00270 951 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2801 1104 gene locus_tag LOCUS_00280 2801 1104 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_00280 3503 2874 gene locus_tag LOCUS_00290 3503 2874 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_00290 3683 4219 gene locus_tag LOCUS_00300 3683 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 <5836 4421 gene locus_tag LOCUS_00310 <5836 4421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003144052.1:aryl-sulfate sulfotransferase >Feature sequence0007 2259 643 gene locus_tag LOCUS_00320 2259 643 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_00320 4303 2273 gene locus_tag LOCUS_00330 4303 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 <5777 4466 gene locus_tag LOCUS_00340 <5777 4466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920215.1:cellulase family glycosylhydrolase >Feature sequence0008 684 352 gene locus_tag LOCUS_00350 684 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3393 2032 gene locus_tag LOCUS_00360 3393 2032 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0009 5587 4148 gene locus_tag LOCUS_00370 5587 4148 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084183.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence0010 821 1081 gene locus_tag LOCUS_00380 821 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1294 2988 gene locus_tag LOCUS_00390 1294 2988 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228668.1 protein_id gnl|my_center|LOCUS_00390 3403 3164 gene locus_tag LOCUS_00400 3403 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 3849 3400 gene locus_tag LOCUS_00410 3849 3400 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_00410 4143 3874 gene locus_tag LOCUS_00420 4143 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 <5391 4140 gene locus_tag LOCUS_00430 <5391 4140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530181.1:integrase arm-type DNA-binding domain-containing protein >Feature sequence0011 2440 443 gene locus_tag LOCUS_00440 gene tkt 2440 443 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_00440 4959 2521 gene locus_tag LOCUS_00450 4959 2521 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence0012 1 894 gene locus_tag LOCUS_00460 1 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 976 1968 gene locus_tag LOCUS_00470 976 1968 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00470 3537 2023 gene locus_tag LOCUS_00480 3537 2023 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_00480 5310 3556 gene locus_tag LOCUS_00490 5310 3556 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence0013 2914 1748 gene locus_tag LOCUS_00500 gene mnmA 2914 1748 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_00500 4071 2911 gene locus_tag LOCUS_00510 gene nifS 4071 2911 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_00510 <5260 4183 gene locus_tag LOCUS_00520 <5260 4183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403266.1:citrate synthase >Feature sequence0014 1607 1170 gene locus_tag LOCUS_00530 1607 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 2209 1553 gene locus_tag LOCUS_00540 2209 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2361 2179 gene locus_tag LOCUS_00550 2361 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 2554 3339 gene locus_tag LOCUS_00560 2554 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 3903 3607 gene locus_tag LOCUS_00570 3903 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4723 4205 gene locus_tag LOCUS_00580 4723 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4653 4868 gene locus_tag LOCUS_00590 4653 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 >Feature sequence0015 3243 499 gene locus_tag LOCUS_00600 3243 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 3884 3240 gene locus_tag LOCUS_00610 3884 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 >Feature sequence0016 352 549 gene locus_tag LOCUS_00620 352 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 886 1167 gene locus_tag LOCUS_00630 886 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 1174 1584 gene locus_tag LOCUS_00640 1174 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 2294 2136 gene locus_tag LOCUS_00650 2294 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 2945 2610 gene locus_tag LOCUS_00660 2945 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3022 4347 gene locus_tag LOCUS_00670 3022 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00670 4657 4412 gene locus_tag LOCUS_00680 4657 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4636 4791 gene locus_tag LOCUS_00690 4636 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 >Feature sequence0017 338 493 gene locus_tag LOCUS_00700 338 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 639 1370 gene locus_tag LOCUS_00710 639 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1343 1561 gene locus_tag LOCUS_00720 1343 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 1565 2092 gene locus_tag LOCUS_00730 1565 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 2092 3837 gene locus_tag LOCUS_00740 2092 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 3840 4031 gene locus_tag LOCUS_00750 3840 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4050 5018 gene locus_tag LOCUS_00760 4050 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence0018 3947 3195 gene locus_tag LOCUS_00770 3947 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4796 4215 gene locus_tag LOCUS_00780 4796 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence0019 453 241 gene locus_tag LOCUS_00790 453 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 377 1324 gene locus_tag LOCUS_00800 377 1324 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_00800 2302 2688 gene locus_tag LOCUS_00810 2302 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3115 2861 gene locus_tag LOCUS_00820 3115 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3344 4954 gene locus_tag LOCUS_00830 3344 4954 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence0020 466 275 gene locus_tag LOCUS_00840 466 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00840 1326 739 gene locus_tag LOCUS_00850 1326 739 CDS product DUF2478 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338851.1 protein_id gnl|my_center|LOCUS_00850 2252 1323 gene locus_tag LOCUS_00860 2252 1323 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133519.1 protein_id gnl|my_center|LOCUS_00860 3054 2230 gene locus_tag LOCUS_00870 3054 2230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408444.1 protein_id gnl|my_center|LOCUS_00870 3398 3051 gene locus_tag LOCUS_00880 3398 3051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112436.1 protein_id gnl|my_center|LOCUS_00880 4198 3401 gene locus_tag LOCUS_00890 4198 3401 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 protein_id gnl|my_center|LOCUS_00890 5011 4205 gene locus_tag LOCUS_00900 5011 4205 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408448.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence0021 298 2406 gene locus_tag LOCUS_00910 298 2406 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_00910 2662 3087 gene locus_tag LOCUS_00920 gene brxB 2662 3087 CDS product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 protein_id gnl|my_center|LOCUS_00920 3545 3225 gene locus_tag LOCUS_00930 3545 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3540 3668 gene locus_tag LOCUS_00940 3540 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 <5009 3815 gene locus_tag LOCUS_00950 <5009 3815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938761.1:DegQ family serine endoprotease >Feature sequence0022 1075 1458 gene locus_tag LOCUS_00960 1075 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1928 3430 gene locus_tag LOCUS_00970 gene ltrA 1928 3430 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_00970 3546 3764 gene locus_tag LOCUS_00980 3546 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3786 4427 gene locus_tag LOCUS_00990 3786 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00990 4743 4414 gene locus_tag LOCUS_01000 4743 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence0023 262 1677 gene locus_tag LOCUS_01010 262 1677 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_01010 1680 2945 gene locus_tag LOCUS_01020 1680 2945 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_01020 3019 4572 gene locus_tag LOCUS_01030 3019 4572 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_01030 >Feature sequence0024 791 297 gene locus_tag LOCUS_01040 gene rplP 791 297 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_01040 1508 837 gene locus_tag LOCUS_01050 gene rpsC 1508 837 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_01050 2054 1524 gene locus_tag LOCUS_01060 2054 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2363 2079 gene locus_tag LOCUS_01070 gene rpsS 2363 2079 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_01070 3316 2492 gene locus_tag LOCUS_01080 gene rplB 3316 2492 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_01080 3748 3455 gene locus_tag LOCUS_01090 3748 3455 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_01090 4416 3748 gene locus_tag LOCUS_01100 gene rplD 4416 3748 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence0025 <1 1232 gene locus_tag LOCUS_01110 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962188.1:helix-turn-helix domain-containing protein 1396 2019 gene locus_tag LOCUS_01120 1396 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01120 2023 4056 gene locus_tag LOCUS_01130 2023 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01130 <4896 4252 gene locus_tag LOCUS_01140 <4896 4252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070741.1:RhuM family protein note possible pseudo, internal stop codon >Feature sequence0026 <1 1710 gene locus_tag LOCUS_01150 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257081.1:threonine--tRNA ligase 2159 1779 gene locus_tag LOCUS_01160 gene crcB 2159 1779 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568601.1 protein_id gnl|my_center|LOCUS_01160 2698 2156 gene locus_tag LOCUS_01170 2698 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3149 2937 gene locus_tag LOCUS_01180 3149 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4127 3219 gene locus_tag LOCUS_01190 4127 3219 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228277.1 protein_id gnl|my_center|LOCUS_01190 4495 4232 gene locus_tag LOCUS_01200 4495 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence0027 487 774 gene locus_tag LOCUS_01210 487 774 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969543.1 protein_id gnl|my_center|LOCUS_01210 775 1014 gene locus_tag LOCUS_01220 775 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01220 1044 1334 gene locus_tag LOCUS_01230 1044 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 1678 1331 gene locus_tag LOCUS_01240 1678 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 2099 1950 gene locus_tag LOCUS_01250 2099 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 3293 2142 gene locus_tag LOCUS_01260 3293 2142 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_01260 3643 3296 gene locus_tag LOCUS_01270 gene ychN 3643 3296 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 protein_id gnl|my_center|LOCUS_01270 4325 3645 gene locus_tag LOCUS_01280 4325 3645 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence0028 352 1635 gene locus_tag LOCUS_01290 gene murA 352 1635 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_01290 1722 3461 gene locus_tag LOCUS_01300 1722 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 3481 3915 gene locus_tag LOCUS_01310 3481 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3952 4668 gene locus_tag LOCUS_01320 3952 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 >Feature sequence0029 >Feature sequence0030 99 314 gene locus_tag LOCUS_01330 99 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1575 514 gene locus_tag LOCUS_01340 gene dndB 1575 514 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_01340 2176 2658 gene locus_tag LOCUS_01350 2176 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 2952 2821 gene locus_tag LOCUS_01360 2952 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4553 2976 gene locus_tag LOCUS_01370 4553 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence0031 232 56 gene locus_tag LOCUS_01380 232 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 1982 726 gene locus_tag LOCUS_01390 1982 726 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 protein_id gnl|my_center|LOCUS_01390 2341 2505 gene locus_tag LOCUS_01400 2341 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3447 2575 gene locus_tag LOCUS_01410 gene sucD 3447 2575 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_01410 <4659 3648 gene locus_tag LOCUS_01420 <4659 3648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001020785.1:ADP-forming succinate--CoA ligase subunit beta >Feature sequence0032 68 1687 gene locus_tag LOCUS_01430 gene bshC 68 1687 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_01430 1723 2670 gene locus_tag LOCUS_01440 1723 2670 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_01440 3951 2704 gene locus_tag LOCUS_01450 3951 2704 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence0033 594 2006 gene locus_tag LOCUS_01460 gene hemG 594 2006 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_01460 2045 3175 gene locus_tag LOCUS_01470 2045 3175 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_01470 3401 3883 gene locus_tag LOCUS_01480 3401 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4079 4411 gene locus_tag LOCUS_01490 4079 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence0034 1709 1062 gene locus_tag LOCUS_01500 1709 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3784 1922 gene locus_tag LOCUS_01510 3784 1922 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence0035 >Feature sequence0036 >Feature sequence0037 147 1220 gene locus_tag LOCUS_01520 147 1220 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_01520 1317 1748 gene locus_tag LOCUS_01530 gene tadA 1317 1748 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_01530 3017 1776 gene locus_tag LOCUS_01540 gene coaBC 3017 1776 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 protein_id gnl|my_center|LOCUS_01540 3912 3010 gene locus_tag LOCUS_01550 gene panC 3912 3010 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_01550 4397 3915 gene locus_tag LOCUS_01560 4397 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence0038 754 1419 gene locus_tag LOCUS_01570 754 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1438 2886 gene locus_tag LOCUS_01580 1438 2886 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence0039 371 2776 gene locus_tag LOCUS_01590 371 2776 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_01590 2769 4373 gene locus_tag LOCUS_01600 2769 4373 CDS product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence0040 197 3010 gene locus_tag LOCUS_01610 gene bamA 197 3010 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_01610 3335 3976 gene locus_tag LOCUS_01620 3335 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence0041 1733 789 gene locus_tag LOCUS_01630 1733 789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_01630 3428 1797 gene locus_tag LOCUS_01640 3428 1797 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_01640 <4494 3508 gene locus_tag LOCUS_01650 <4494 3508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031093.1:6-phospho-beta-glucosidase >Feature sequence0042 732 1046 gene locus_tag LOCUS_01660 732 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 1046 3367 gene locus_tag LOCUS_01670 gene clpA 1046 3367 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_01670 3580 3711 gene locus_tag LOCUS_01680 3580 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence0043 <1 864 gene locus_tag LOCUS_01690 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870076.1:flagellar protein export ATPase FliI 864 1349 gene locus_tag LOCUS_01700 864 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1449 2444 gene locus_tag LOCUS_01710 1449 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2477 3607 gene locus_tag LOCUS_01720 2477 3607 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_01720 3906 4334 gene locus_tag LOCUS_01730 3906 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0044 525 1010 gene locus_tag LOCUS_01740 525 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1526 1095 gene locus_tag LOCUS_01750 1526 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3123 1513 gene locus_tag LOCUS_01760 3123 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3619 3107 gene locus_tag LOCUS_01770 3619 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3843 3619 gene locus_tag LOCUS_01780 3843 3619 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence0045 783 28 gene locus_tag LOCUS_01790 783 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4300 914 gene locus_tag LOCUS_01800 4300 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence0046 191 973 gene locus_tag LOCUS_01810 191 973 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_01810 977 2026 gene locus_tag LOCUS_01820 gene coxB 977 2026 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_01820 2031 3707 gene locus_tag LOCUS_01830 gene ctaD 2031 3707 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence0047 767 201 gene locus_tag LOCUS_01840 767 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 1013 1300 gene locus_tag LOCUS_01850 1013 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1942 1364 gene locus_tag LOCUS_01860 gene rfbC 1942 1364 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_01860 2397 2957 gene locus_tag LOCUS_01870 gene efp 2397 2957 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_01870 3096 4343 gene locus_tag LOCUS_01880 3096 4343 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_01880 >Feature sequence0048 3881 1605 gene locus_tag LOCUS_01890 3881 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence0049 4044 682 gene locus_tag LOCUS_01900 4044 682 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275461.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence0050 <1 1641 gene locus_tag LOCUS_01910 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 2825 1638 gene locus_tag LOCUS_01920 2825 1638 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228785.1 protein_id gnl|my_center|LOCUS_01920 3166 4281 gene locus_tag LOCUS_01930 3166 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence0051 <1 2253 gene locus_tag LOCUS_01940 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117787.1:efflux RND transporter permease subunit 2250 3566 gene locus_tag LOCUS_01950 2250 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4146 3685 gene locus_tag LOCUS_01960 4146 3685 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence0052 3 2960 gene locus_tag LOCUS_01970 3 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 3164 4003 gene locus_tag LOCUS_01980 3164 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0053 <1 537 gene locus_tag LOCUS_01990 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977779.1:DNA starvation/stationary phase protection protein 742 1743 gene locus_tag LOCUS_02000 742 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1799 2752 gene locus_tag LOCUS_02010 1799 2752 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_02010 2841 3875 gene locus_tag LOCUS_02020 gene pstC 2841 3875 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence0054 112 1764 gene locus_tag LOCUS_02030 112 1764 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_02030 1958 2467 gene locus_tag LOCUS_02040 1958 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2905 2477 gene locus_tag LOCUS_02050 2905 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 <4283 2907 gene locus_tag LOCUS_02060 <4283 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933467.1:excinuclease ABC subunit UvrC >Feature sequence0055 1645 185 gene locus_tag LOCUS_02070 gene argH 1645 185 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_02070 2697 1642 gene locus_tag LOCUS_02080 gene argF 2697 1642 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257452.1 protein_id gnl|my_center|LOCUS_02080 3937 2690 gene locus_tag LOCUS_02090 3937 2690 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence0056 <1 934 gene locus_tag LOCUS_02100 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765563.1:CusA/CzcA family heavy metal efflux RND transporter 1480 1124 gene locus_tag LOCUS_02110 1480 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 3733 1589 gene locus_tag LOCUS_02120 gene hyfB 3733 1589 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816729.1 protein_id gnl|my_center|LOCUS_02120 <4256 3737 gene locus_tag LOCUS_02130 <4256 3737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941404.1:hydrogenase >Feature sequence0057 334 930 gene locus_tag LOCUS_02140 334 930 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_02140 923 1159 gene locus_tag LOCUS_02150 923 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 1146 3344 gene locus_tag LOCUS_02160 1146 3344 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224006.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence0058 2699 1566 gene locus_tag LOCUS_02170 2699 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence0059 1816 2268 gene locus_tag LOCUS_02180 1816 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3802 2303 gene locus_tag LOCUS_02190 gene hslU 3802 2303 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence0060 62 1243 gene locus_tag LOCUS_02200 62 1243 CDS product IS4-like element ISGsu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_02200 2496 1450 gene locus_tag LOCUS_02210 2496 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3912 2629 gene locus_tag LOCUS_02220 3912 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence0061 1250 969 gene locus_tag LOCUS_02230 1250 969 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_02230 2390 1257 gene locus_tag LOCUS_02240 2390 1257 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_02240 <4223 2739 gene locus_tag LOCUS_02250 <4223 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337061.1:ATPase >Feature sequence0062 1300 1031 gene locus_tag LOCUS_02260 1300 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2887 2147 gene locus_tag LOCUS_02270 2887 2147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083605.1 protein_id gnl|my_center|LOCUS_02270 4222 2891 gene locus_tag LOCUS_02280 4222 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence0063 >Feature sequence0064 941 1360 gene locus_tag LOCUS_02290 941 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1418 2509 gene locus_tag LOCUS_02300 gene arsB 1418 2509 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_02300 3677 2559 gene locus_tag LOCUS_02310 3677 2559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_02310 <4218 3677 gene locus_tag LOCUS_02320 <4218 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937437.1:ATP-binding cassette domain-containing protein >Feature sequence0065 <1 584 gene locus_tag LOCUS_02330 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461441.1:topoisomerase DNA-binding C4 zinc finger domain-containing protein 660 1091 gene locus_tag LOCUS_02340 660 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1261 1587 gene locus_tag LOCUS_02350 1261 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1751 2035 gene locus_tag LOCUS_02360 1751 2035 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_02360 3519 2050 gene locus_tag LOCUS_02370 3519 2050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_02370 <4216 3672 gene locus_tag LOCUS_02380 <4216 3672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256075.1:ketol-acid reductoisomerase >Feature sequence0066 2438 1089 gene locus_tag LOCUS_02390 2438 1089 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228566.1 protein_id gnl|my_center|LOCUS_02390 3101 2481 gene locus_tag LOCUS_02400 3101 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence0067 498 2909 gene locus_tag LOCUS_02410 gene lon 498 2909 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_02410 2916 3623 gene locus_tag LOCUS_02420 2916 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence0068 653 21 gene locus_tag LOCUS_02430 653 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 1997 783 gene locus_tag LOCUS_02440 1997 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3591 2113 gene locus_tag LOCUS_02450 3591 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3970 3680 gene locus_tag LOCUS_02460 3970 3680 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence0069 1527 298 gene locus_tag LOCUS_02470 1527 298 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_02470 2013 1663 gene locus_tag LOCUS_02480 2013 1663 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_02480 3608 2313 gene locus_tag LOCUS_02490 3608 2313 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence0070 809 393 gene locus_tag LOCUS_02500 gene rpsK 809 393 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908645.1 protein_id gnl|my_center|LOCUS_02500 1192 809 gene locus_tag LOCUS_02510 gene rpsM 1192 809 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_02510 1766 1548 gene locus_tag LOCUS_02520 gene infA 1766 1548 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393913.1 protein_id gnl|my_center|LOCUS_02520 2559 1807 gene locus_tag LOCUS_02530 gene map 2559 1807 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_02530 3286 2564 gene locus_tag LOCUS_02540 3286 2564 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_02540 <4171 3280 gene locus_tag LOCUS_02550 <4171 3280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938618.1:preprotein translocase subunit SecY >Feature sequence0071 191 412 gene locus_tag LOCUS_02560 191 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02560 419 1120 gene locus_tag LOCUS_02570 419 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 1117 1323 gene locus_tag LOCUS_02580 1117 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 1360 2574 gene locus_tag LOCUS_02590 gene hcnB 1360 2574 CDS product cyanide-forming glycine dehydrogenase subunit HcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113685.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 2571 3692 gene locus_tag LOCUS_02600 2571 3692 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence0072 1453 302 gene locus_tag LOCUS_02610 gene mqnE 1453 302 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_02610 1609 2223 gene locus_tag LOCUS_02620 1609 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2655 2224 gene locus_tag LOCUS_02630 gene rimI 2655 2224 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762816.1 protein_id gnl|my_center|LOCUS_02630 3241 2756 gene locus_tag LOCUS_02640 3241 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence0073 1563 595 gene locus_tag LOCUS_02650 1563 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2563 1553 gene locus_tag LOCUS_02660 gene mltG 2563 1553 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880471.1 protein_id gnl|my_center|LOCUS_02660 2720 3184 gene locus_tag LOCUS_02670 gene ruvX 2720 3184 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_02670 3275 3748 gene locus_tag LOCUS_02680 gene greA 3275 3748 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence0074 36 467 gene locus_tag LOCUS_02690 gene merR 36 467 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_02690 1673 489 gene locus_tag LOCUS_02700 1673 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 <4123 1771 gene locus_tag LOCUS_02710 <4123 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase >Feature sequence0075 1312 2244 gene locus_tag LOCUS_02720 gene pycR 1312 2244 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_02720 3010 2270 gene locus_tag LOCUS_02730 3010 2270 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_02730 <4122 3047 gene locus_tag LOCUS_02740 <4122 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037978.1:L-serine ammonia-lyase >Feature sequence0076 1789 440 gene locus_tag LOCUS_02750 1789 440 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 protein_id gnl|my_center|LOCUS_02750 1976 3214 gene locus_tag LOCUS_02760 1976 3214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_02760 <4119 3272 gene locus_tag LOCUS_02770 <4119 3272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392356.1:stage V sporulation protein D >Feature sequence0077 1335 634 gene locus_tag LOCUS_02780 1335 634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_02780 2637 1348 gene locus_tag LOCUS_02790 2637 1348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_02790 3851 2634 gene locus_tag LOCUS_02800 3851 2634 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089757.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence0078 3852 253 gene locus_tag LOCUS_02810 3852 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence0079 <1 891 gene locus_tag LOCUS_02820 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257853.1:NADH-quinone oxidoreductase subunit D 925 1524 gene locus_tag LOCUS_02830 925 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 1521 2675 gene locus_tag LOCUS_02840 gene nuoH 1521 2675 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_02840 2775 3275 gene locus_tag LOCUS_02850 2775 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3272 3583 gene locus_tag LOCUS_02860 gene nuoK 3272 3583 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence0080 457 888 gene locus_tag LOCUS_02870 457 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence0081 1167 790 gene locus_tag LOCUS_02880 1167 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1555 2037 gene locus_tag LOCUS_02890 1555 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2125 2745 gene locus_tag LOCUS_02900 2125 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2841 3536 gene locus_tag LOCUS_02910 2841 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0082 3283 2084 gene locus_tag LOCUS_02920 3283 2084 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217540.1 protein_id gnl|my_center|LOCUS_02920 <4069 3285 gene locus_tag LOCUS_02930 <4069 3285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870274.1:restriction endonuclease subunit S >Feature sequence0083 1021 2 gene locus_tag LOCUS_02940 gene flgF 1021 2 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557363.1 protein_id gnl|my_center|LOCUS_02940 1132 1207 gene locus_tag LOCUS_t00020 1132 1207 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1912 1265 gene locus_tag LOCUS_02950 1912 1265 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667217.1 protein_id gnl|my_center|LOCUS_02950 2996 1914 gene locus_tag LOCUS_02960 2996 1914 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673627.1 protein_id gnl|my_center|LOCUS_02960 3218 4054 gene locus_tag LOCUS_02970 3218 4054 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence0084 1118 2302 gene locus_tag LOCUS_02980 1118 2302 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_02980 2709 2332 gene locus_tag LOCUS_02990 2709 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3568 2675 gene locus_tag LOCUS_03000 3568 2675 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_03000 3755 3889 gene locus_tag LOCUS_03010 3755 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0085 1940 858 gene locus_tag LOCUS_03020 gene purM 1940 858 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_03020 2853 2095 gene locus_tag LOCUS_03030 2853 2095 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_03030 <4056 3136 gene locus_tag LOCUS_03040 <4056 3136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880274.1:serine hydroxymethyltransferase >Feature sequence0086 3764 2337 gene locus_tag LOCUS_03050 3764 2337 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence0087 1107 883 gene locus_tag LOCUS_03060 1107 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1552 1298 gene locus_tag LOCUS_03070 1552 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1726 1962 gene locus_tag LOCUS_03080 1726 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 <4047 2149 gene locus_tag LOCUS_03090 <4047 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920963.1:TonB-dependent receptor >Feature sequence0088 1968 1045 gene locus_tag LOCUS_03100 1968 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2331 3707 gene locus_tag LOCUS_03110 2331 3707 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958488.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence0089 <1 518 gene locus_tag LOCUS_03120 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin oxidoreductase family protein 976 3813 gene locus_tag LOCUS_03130 gene bamA 976 3813 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence0090 1829 1443 gene locus_tag LOCUS_03140 1829 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2141 1929 gene locus_tag LOCUS_03150 2141 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3029 2310 gene locus_tag LOCUS_03160 3029 2310 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057504658.1 protein_id gnl|my_center|LOCUS_03160 <4016 3053 gene locus_tag LOCUS_03170 <4016 3053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941325.1:redox-regulated ATPase YchF >Feature sequence0091 254 1462 gene locus_tag LOCUS_03180 254 1462 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_03180 1649 1957 gene locus_tag LOCUS_03190 1649 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence0092 3376 1871 gene locus_tag LOCUS_03200 3376 1871 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_03200 3658 3410 gene locus_tag LOCUS_03210 3658 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence0093 1156 2289 gene locus_tag LOCUS_03220 1156 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2537 3598 gene locus_tag LOCUS_03230 2537 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence0094 2311 428 gene locus_tag LOCUS_03240 2311 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence0095 1895 1215 gene locus_tag LOCUS_03250 gene hscB 1895 1215 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 protein_id gnl|my_center|LOCUS_03250 2401 1991 gene locus_tag LOCUS_03260 2401 1991 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_03260 2903 2490 gene locus_tag LOCUS_03270 gene iscU 2903 2490 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_03270 <3992 2993 gene locus_tag LOCUS_03280 <3992 2993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144367.1:IscS subfamily cysteine desulfurase >Feature sequence0096 2203 791 gene locus_tag LOCUS_03290 gene secY 2203 791 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_03290 2924 2442 gene locus_tag LOCUS_03300 gene rplO 2924 2442 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_03300 3172 2987 gene locus_tag LOCUS_03310 gene rpmD 3172 2987 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_03310 3767 3261 gene locus_tag LOCUS_03320 gene rpsE 3767 3261 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence0097 420 1286 gene locus_tag LOCUS_03330 gene cutB 420 1286 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_03330 1312 1833 gene locus_tag LOCUS_03340 gene cutC 1312 1833 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence0098 <1 725 gene locus_tag LOCUS_03350 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257665.1:L-glutamate gamma-semialdehyde dehydrogenase 1436 1038 gene locus_tag LOCUS_03360 1436 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2238 1726 gene locus_tag LOCUS_03370 2238 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2592 2308 gene locus_tag LOCUS_03380 2592 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3962 2631 gene locus_tag LOCUS_03390 3962 2631 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence0099 285 515 gene locus_tag LOCUS_03400 285 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 512 1132 gene locus_tag LOCUS_03410 512 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2236 1208 gene locus_tag LOCUS_03420 gene antC 2236 1208 CDS product anthranilate 1,2-dioxygenase electron transfer component AntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113312.1 protein_id gnl|my_center|LOCUS_03420 <3978 2295 gene locus_tag LOCUS_03430 <3978 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705038.1:hydroxylamine reductase >Feature sequence0100 313 1938 gene locus_tag LOCUS_03440 313 1938 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence0101 478 2451 gene locus_tag LOCUS_03450 gene hyfB 478 2451 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_03450 2448 3386 gene locus_tag LOCUS_03460 2448 3386 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence0102 2437 1733 gene locus_tag LOCUS_03470 2437 1733 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385770.1 protein_id gnl|my_center|LOCUS_03470 3896 3024 gene locus_tag LOCUS_03480 3896 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence0103 890 753 gene locus_tag LOCUS_03490 890 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1674 931 gene locus_tag LOCUS_03500 1674 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1942 1664 gene locus_tag LOCUS_03510 1942 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2579 1857 gene locus_tag LOCUS_03520 2579 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2887 2579 gene locus_tag LOCUS_03530 2887 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2948 3331 gene locus_tag LOCUS_03540 2948 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3328 3588 gene locus_tag LOCUS_03550 3328 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3588 3800 gene locus_tag LOCUS_03560 3588 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence0104 1132 263 gene locus_tag LOCUS_03570 1132 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2256 1138 gene locus_tag LOCUS_03580 2256 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3038 2253 gene locus_tag LOCUS_03590 3038 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0105 3735 181 gene locus_tag LOCUS_03600 3735 181 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence0106 1753 116 gene locus_tag LOCUS_03610 gene nifA 1753 116 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_03610 2906 1815 gene locus_tag LOCUS_03620 gene draG 2906 1815 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_03620 3743 2916 gene locus_tag LOCUS_03630 3743 2916 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence0107 359 177 gene locus_tag LOCUS_03640 359 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 661 356 gene locus_tag LOCUS_03650 661 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 855 658 gene locus_tag LOCUS_03660 855 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1130 852 gene locus_tag LOCUS_03670 1130 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3303 1327 gene locus_tag LOCUS_03680 3303 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3710 3303 gene locus_tag LOCUS_03690 3710 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence0108 674 2365 gene locus_tag LOCUS_03700 674 2365 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_03700 2548 2868 gene locus_tag LOCUS_03710 2548 2868 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_03710 3119 3592 gene locus_tag LOCUS_03720 3119 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence0109 <1 1080 gene locus_tag LOCUS_03730 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140498.1:efflux RND transporter periplasmic adaptor subunit 1095 2066 gene locus_tag LOCUS_03740 1095 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2081 3412 gene locus_tag LOCUS_03750 2081 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence0110 187 2049 gene locus_tag LOCUS_03760 187 2049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence0111 <1 934 gene locus_tag LOCUS_03770 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198768.1:CoA transferase 1319 1627 gene locus_tag LOCUS_03780 1319 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2115 3236 gene locus_tag LOCUS_03790 2115 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence0112 201 914 gene locus_tag LOCUS_03800 201 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1183 2049 gene locus_tag LOCUS_03810 1183 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0113 401 1558 gene locus_tag LOCUS_03820 401 1558 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_03820 2751 1651 gene locus_tag LOCUS_03830 2751 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3236 3069 gene locus_tag LOCUS_03840 3236 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence0114 1555 557 gene locus_tag LOCUS_03850 1555 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1727 2941 gene locus_tag LOCUS_03860 1727 2941 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_03860 3741 3031 gene locus_tag LOCUS_03870 3741 3031 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030520.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence0115 <1 3207 gene locus_tag LOCUS_03880 <1 3207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase 3210 3632 gene locus_tag LOCUS_03890 3210 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence0116 1024 1914 gene locus_tag LOCUS_03900 1024 1914 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_03900 2788 1955 gene locus_tag LOCUS_03910 2788 1955 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_03910 3602 2823 gene locus_tag LOCUS_03920 3602 2823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence0117 3691 2399 gene locus_tag LOCUS_03930 3691 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0118 395 138 gene locus_tag LOCUS_03940 395 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 1230 397 gene locus_tag LOCUS_03950 1230 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1363 1223 gene locus_tag LOCUS_03960 1363 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2795 1374 gene locus_tag LOCUS_03970 2795 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3286 2795 gene locus_tag LOCUS_03980 3286 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence0119 <1 960 gene locus_tag LOCUS_03990 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113717.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 981 2126 gene locus_tag LOCUS_04000 981 2126 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_04000 2116 3240 gene locus_tag LOCUS_04010 2116 3240 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence0120 2162 123 gene locus_tag LOCUS_04020 2162 123 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070840.1 protein_id gnl|my_center|LOCUS_04020 3891 2575 gene locus_tag LOCUS_04030 3891 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence0121 2 241 gene locus_tag LOCUS_04040 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 564 2132 gene locus_tag LOCUS_04050 564 2132 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_04050 3030 2854 gene locus_tag LOCUS_04060 3030 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence0122 334 549 gene locus_tag LOCUS_04070 334 549 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113932710.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence0123 <1 1446 gene locus_tag LOCUS_04080 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388585.1:type I-C CRISPR-associated protein Cas8c/Csd1 1443 2336 gene locus_tag LOCUS_04090 gene cas7c 1443 2336 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_04090 2357 3004 gene locus_tag LOCUS_04100 gene cas4 2357 3004 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence0124 <1 920 gene locus_tag LOCUS_04110 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_179487022.1:ImmA/IrrE family metallo-endopeptidase 935 1399 gene locus_tag LOCUS_04120 935 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence0125 1434 49 gene locus_tag LOCUS_04130 1434 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1977 1672 gene locus_tag LOCUS_04140 1977 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2193 3425 gene locus_tag LOCUS_04150 2193 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence0126 1159 308 gene locus_tag LOCUS_04160 1159 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2120 1404 gene locus_tag LOCUS_04170 2120 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2304 2131 gene locus_tag LOCUS_04180 2304 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3514 3675 gene locus_tag LOCUS_04190 3514 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence0127 135 2270 gene locus_tag LOCUS_04200 135 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2320 3003 gene locus_tag LOCUS_04210 2320 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence0128 <1 1023 gene locus_tag LOCUS_04220 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942882.1:lipopolysaccharide heptosyltransferase I 1020 1586 gene locus_tag LOCUS_04230 1020 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1612 2409 gene locus_tag LOCUS_04240 1612 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3875 2418 gene locus_tag LOCUS_04250 3875 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence0129 2860 701 gene locus_tag LOCUS_04260 2860 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 <3890 2860 gene locus_tag LOCUS_04270 <3890 2860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940731.1:type I-U CRISPR-associated RAMP protein Csb1/Cas7u >Feature sequence0130 630 2036 gene locus_tag LOCUS_04280 630 2036 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054746.1 protein_id gnl|my_center|LOCUS_04280 2383 2928 gene locus_tag LOCUS_04290 2383 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3608 3072 gene locus_tag LOCUS_04300 3608 3072 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0131 <1 1501 gene locus_tag LOCUS_04310 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941980.1:ATP-dependent DNA helicase RecG 1574 2155 gene locus_tag LOCUS_04320 1574 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2362 2919 gene locus_tag LOCUS_04330 2362 2919 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence0132 950 3415 gene locus_tag LOCUS_04340 950 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence0133 >Feature sequence0134 1489 20 gene locus_tag LOCUS_04350 1489 20 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_04350 1962 1642 gene locus_tag LOCUS_04360 1962 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2616 2290 gene locus_tag LOCUS_04370 2616 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence0135 1929 1582 gene locus_tag LOCUS_04380 1929 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04380 2554 2108 gene locus_tag LOCUS_04390 2554 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04390 2800 2636 gene locus_tag LOCUS_04400 2800 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence0136 906 94 gene locus_tag LOCUS_04410 906 94 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence0137 <1 595 gene locus_tag LOCUS_04420 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704266.1:peptide deformylase 1016 1951 gene locus_tag LOCUS_04430 gene fmt 1016 1951 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_04430 2204 3571 gene locus_tag LOCUS_04440 gene rsmB 2204 3571 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence0138 605 1597 gene locus_tag LOCUS_04450 605 1597 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_04450 1882 1733 gene locus_tag LOCUS_04460 1882 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2624 2196 gene locus_tag LOCUS_04470 2624 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3577 2885 gene locus_tag LOCUS_04480 3577 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence0139 513 869 gene locus_tag LOCUS_04490 513 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2715 1945 gene locus_tag LOCUS_04500 2715 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04500 3306 2920 gene locus_tag LOCUS_04510 3306 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 >Feature sequence0140 135 1460 gene locus_tag LOCUS_04520 135 1460 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_04520 1478 3079 gene locus_tag LOCUS_04530 1478 3079 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930845.1 protein_id gnl|my_center|LOCUS_04530 3787 3098 gene locus_tag LOCUS_04540 3787 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0141 357 1709 gene locus_tag LOCUS_04550 357 1709 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193978.1 protein_id gnl|my_center|LOCUS_04550 1799 2854 gene locus_tag LOCUS_04560 1799 2854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_04560 3830 2937 gene locus_tag LOCUS_04570 3830 2937 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence0142 <1 806 gene locus_tag LOCUS_04580 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799131.1:EAL domain-containing protein 1397 1906 gene locus_tag LOCUS_04590 1397 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2981 2004 gene locus_tag LOCUS_04600 2981 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 <3862 3025 gene locus_tag LOCUS_04610 <3862 3025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879242.1:ammonium transporter >Feature sequence0143 2048 804 gene locus_tag LOCUS_04620 2048 804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_04620 3220 2279 gene locus_tag LOCUS_04630 3220 2279 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523980.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence0144 1312 665 gene locus_tag LOCUS_04640 1312 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 1438 2775 gene locus_tag LOCUS_04650 1438 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2827 3798 gene locus_tag LOCUS_04660 2827 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence0145 3184 1871 gene locus_tag LOCUS_04670 gene glcF 3184 1871 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401223.1 protein_id gnl|my_center|LOCUS_04670 <3842 3190 gene locus_tag LOCUS_04680 <3842 3190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338663.1:FAD-binding protein >Feature sequence0146 <1 1531 gene locus_tag LOCUS_04690 <1 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094682.1:ATP-dependent chaperone ClpB 2720 1539 gene locus_tag LOCUS_04700 2720 1539 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_04700 <3841 2842 gene locus_tag LOCUS_04710 <3841 2842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140163.1:acetate--CoA ligase >Feature sequence0147 2517 463 gene locus_tag LOCUS_04720 2517 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3600 2611 gene locus_tag LOCUS_04730 gene ispB 3600 2611 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence0148 <1 2466 gene locus_tag LOCUS_04740 <1 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259010.1:phosphoenolpyruvate carboxylase 2651 3787 gene locus_tag LOCUS_04750 2651 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence0149 2256 1975 gene locus_tag LOCUS_04760 2256 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2966 2316 gene locus_tag LOCUS_04770 2966 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3273 3755 gene locus_tag LOCUS_04780 3273 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence0150 201 779 gene locus_tag LOCUS_04790 201 779 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_04790 1232 888 gene locus_tag LOCUS_04800 1232 888 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_04800 1718 1275 gene locus_tag LOCUS_04810 1718 1275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_04810 1842 3119 gene locus_tag LOCUS_04820 1842 3119 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_04820 <3828 3141 gene locus_tag LOCUS_04830 <3828 3141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence0151 449 2308 gene locus_tag LOCUS_04840 449 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 2441 2890 gene locus_tag LOCUS_04850 2441 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence0152 263 33 gene locus_tag LOCUS_04860 gene rpmE 263 33 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946387.1 protein_id gnl|my_center|LOCUS_04860 1659 412 gene locus_tag LOCUS_04870 gene hemW 1659 412 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811160.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0153 1422 118 gene locus_tag LOCUS_04880 gene iolF 1422 118 CDS product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 protein_id gnl|my_center|LOCUS_04880 3634 2213 gene locus_tag LOCUS_04890 3634 2213 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973088.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence0154 1 195 gene locus_tag LOCUS_04900 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 269 922 gene locus_tag LOCUS_04910 269 922 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_04910 996 1466 gene locus_tag LOCUS_04920 996 1466 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_04920 1551 2087 gene locus_tag LOCUS_04930 1551 2087 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_04930 2208 2759 gene locus_tag LOCUS_04940 2208 2759 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_04940 2881 3264 gene locus_tag LOCUS_04950 2881 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3505 3335 gene locus_tag LOCUS_04960 3505 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3733 3572 gene locus_tag LOCUS_04970 3733 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence0155 413 120 gene locus_tag LOCUS_04980 413 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 982 512 gene locus_tag LOCUS_04990 982 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1359 979 gene locus_tag LOCUS_05000 1359 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1709 1356 gene locus_tag LOCUS_05010 1709 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2362 1706 gene locus_tag LOCUS_05020 2362 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3159 2359 gene locus_tag LOCUS_05030 3159 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3320 3156 gene locus_tag LOCUS_05040 3320 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3530 3384 gene locus_tag LOCUS_05050 3530 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3775 3527 gene locus_tag LOCUS_05060 3775 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence0156 2205 688 gene locus_tag LOCUS_05070 gene guaB 2205 688 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_05070 2454 3257 gene locus_tag LOCUS_05080 2454 3257 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022097.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence0157 1259 309 gene locus_tag LOCUS_05090 gene cysD 1259 309 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_05090 1896 1501 gene locus_tag LOCUS_05100 gene msrB 1896 1501 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070109.1 protein_id gnl|my_center|LOCUS_05100 2451 1948 gene locus_tag LOCUS_05110 2451 1948 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_05110 2631 3524 gene locus_tag LOCUS_05120 2631 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence0158 2448 1879 gene locus_tag LOCUS_05130 2448 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence0159 321 127 gene locus_tag LOCUS_05140 321 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1618 245 gene locus_tag LOCUS_05150 1618 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3354 2257 gene locus_tag LOCUS_05160 3354 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3806 3351 gene locus_tag LOCUS_05170 3806 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence0160 459 3737 gene locus_tag LOCUS_05180 459 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence0161 3699 1933 gene locus_tag LOCUS_05190 3699 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence0162 2203 1292 gene locus_tag LOCUS_05200 2203 1292 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_05200 2664 2894 gene locus_tag LOCUS_05210 2664 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2891 3295 gene locus_tag LOCUS_05220 2891 3295 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911329.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence0163 1133 2440 gene locus_tag LOCUS_05230 gene glgC 1133 2440 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence0164 732 1910 gene locus_tag LOCUS_05240 gene dnaN 732 1910 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_05240 2252 1992 gene locus_tag LOCUS_05250 2252 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2193 3401 gene locus_tag LOCUS_05260 2193 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence0165 608 1798 gene locus_tag LOCUS_05270 608 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1795 2334 gene locus_tag LOCUS_05280 1795 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence0166 1929 847 gene locus_tag LOCUS_05290 1929 847 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_05290 3364 1961 gene locus_tag LOCUS_05300 gene tolC 3364 1961 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073650.1 protein_id gnl|my_center|LOCUS_05300 3553 3416 gene locus_tag LOCUS_05310 3553 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0167 36 1235 gene locus_tag LOCUS_05320 36 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1235 2290 gene locus_tag LOCUS_05330 1235 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence0168 >Feature sequence0169 292 2739 gene locus_tag LOCUS_05340 292 2739 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_05340 2781 3392 gene locus_tag LOCUS_05350 2781 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence0170 135 881 gene locus_tag LOCUS_05360 gene tolQ 135 881 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_05360 1061 1501 gene locus_tag LOCUS_05370 gene tolR 1061 1501 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_05370 1602 2033 gene locus_tag LOCUS_05380 gene tolR 1602 2033 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_05380 2220 2390 gene locus_tag LOCUS_05390 2220 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3466 2660 gene locus_tag LOCUS_05400 3466 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence0171 <1 1059 gene locus_tag LOCUS_05410 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037596.1:phenylalanine--tRNA ligase subunit beta 1326 1655 gene locus_tag LOCUS_05420 1326 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1823 2200 gene locus_tag LOCUS_05430 1823 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2479 3603 gene locus_tag LOCUS_05440 2479 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0172 528 328 gene locus_tag LOCUS_05450 528 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 927 625 gene locus_tag LOCUS_05460 927 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1042 1785 gene locus_tag LOCUS_05470 1042 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3585 1969 gene locus_tag LOCUS_05480 3585 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence0173 1540 2646 gene locus_tag LOCUS_05490 1540 2646 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202471.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0174 418 3327 gene locus_tag LOCUS_05500 gene uvrA 418 3327 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662676.1 protein_id gnl|my_center|LOCUS_05500 3427 3352 gene locus_tag LOCUS_t00030 3427 3352 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0175 1082 423 gene locus_tag LOCUS_05510 1082 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1158 1604 gene locus_tag LOCUS_05520 1158 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2191 2424 gene locus_tag LOCUS_05530 2191 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 <3761 2513 gene locus_tag LOCUS_05540 <3761 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639983.1:type II toxin-antitoxin system HipA family toxin >Feature sequence0176 1210 374 gene locus_tag LOCUS_05550 1210 374 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_05550 1993 1214 gene locus_tag LOCUS_05560 1993 1214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_05560 2142 3365 gene locus_tag LOCUS_05570 2142 3365 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920792.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence0177 2 655 gene locus_tag LOCUS_05580 2 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 892 1989 gene locus_tag LOCUS_05590 892 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2060 3625 gene locus_tag LOCUS_05600 2060 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0178 115 537 gene locus_tag LOCUS_05610 115 537 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_05610 1624 701 gene locus_tag LOCUS_05620 gene dapA 1624 701 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_05620 1738 2553 gene locus_tag LOCUS_05630 1738 2553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_05630 3249 2566 gene locus_tag LOCUS_05640 gene dapB 3249 2566 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence0179 2192 1176 gene locus_tag LOCUS_05650 2192 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2326 2198 gene locus_tag LOCUS_05660 2326 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence0180 2336 408 gene locus_tag LOCUS_05670 gene ftsH 2336 408 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_05670 <3747 2650 gene locus_tag LOCUS_05680 <3747 2650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942455.1:tRNA lysidine(34) synthetase TilS >Feature sequence0181 1025 402 gene locus_tag LOCUS_05690 1025 402 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_05690 1816 1052 gene locus_tag LOCUS_05700 1816 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3413 1899 gene locus_tag LOCUS_05710 gene gatA 3413 1899 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence0182 1965 1552 gene locus_tag LOCUS_05720 1965 1552 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545148.1 protein_id gnl|my_center|LOCUS_05720 2253 1975 gene locus_tag LOCUS_05730 2253 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2409 2759 gene locus_tag LOCUS_05740 2409 2759 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_05740 2825 3058 gene locus_tag LOCUS_05750 2825 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 >Feature sequence0183 2930 3475 gene locus_tag LOCUS_05760 2930 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence0184 3696 1381 gene locus_tag LOCUS_05770 3696 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108528.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence0185 358 3504 gene locus_tag LOCUS_05780 358 3504 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922218.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence0186 <1 821 gene locus_tag LOCUS_05790 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 929 1771 gene locus_tag LOCUS_05800 gene proC 929 1771 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_05800 1837 2952 gene locus_tag LOCUS_05810 1837 2952 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_05810 3507 3160 gene locus_tag LOCUS_05820 3507 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence0187 122 1510 gene locus_tag LOCUS_05830 gene pmbA 122 1510 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_05830 1510 2841 gene locus_tag LOCUS_05840 1510 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3707 2838 gene locus_tag LOCUS_05850 3707 2838 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence0188 <1 708 gene locus_tag LOCUS_05860 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108492.1:GRP family sugar transporter 722 1663 gene locus_tag LOCUS_05870 gene rbsK 722 1663 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532180.1 protein_id gnl|my_center|LOCUS_05870 2041 1892 gene locus_tag LOCUS_05880 2041 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2490 2191 gene locus_tag LOCUS_05890 2490 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3057 2530 gene locus_tag LOCUS_05900 3057 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence0189 715 2733 gene locus_tag LOCUS_05910 715 2733 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_05910 2767 2949 gene locus_tag LOCUS_05920 2767 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2912 3661 gene locus_tag LOCUS_05930 2912 3661 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence0190 1582 2574 gene locus_tag LOCUS_05940 1582 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2875 3129 gene locus_tag LOCUS_05950 2875 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence0191 <1 851 gene locus_tag LOCUS_05960 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056806.1:ABC transporter ATP-binding protein 3177 1048 gene locus_tag LOCUS_05970 3177 1048 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence0192 2228 339 gene locus_tag LOCUS_05980 gene nuoL 2228 339 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246027.1 protein_id gnl|my_center|LOCUS_05980 2536 2228 gene locus_tag LOCUS_05990 gene nuoK 2536 2228 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_05990 3038 2451 gene locus_tag LOCUS_06000 gene nuoJ 3038 2451 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_06000 3567 3052 gene locus_tag LOCUS_06010 gene nuoI 3567 3052 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172752.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence0193 885 256 gene locus_tag LOCUS_06020 885 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1388 882 gene locus_tag LOCUS_06030 gene mog 1388 882 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_06030 1526 2659 gene locus_tag LOCUS_06040 1526 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence0194 1102 3003 gene locus_tag LOCUS_06050 1102 3003 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_06050 3088 3495 gene locus_tag LOCUS_06060 3088 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence0195 <1 2052 gene locus_tag LOCUS_06070 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase 3448 2156 gene locus_tag LOCUS_06080 3448 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence0196 <1 2220 gene locus_tag LOCUS_06090 <1 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886493.1:transglycosylase SLT domain-containing protein 2433 2633 gene locus_tag LOCUS_06100 2433 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0197 819 1460 gene locus_tag LOCUS_06110 819 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267739.1 protein_id gnl|my_center|LOCUS_06110 1502 1660 gene locus_tag LOCUS_06120 1502 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1707 1925 gene locus_tag LOCUS_06130 1707 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2697 3710 gene locus_tag LOCUS_06140 2697 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence0198 2817 1165 gene locus_tag LOCUS_06150 2817 1165 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 protein_id gnl|my_center|LOCUS_06150 <3703 2968 gene locus_tag LOCUS_06160 <3703 2968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541542.1:IMP dehydrogenase >Feature sequence0199 127 567 gene locus_tag LOCUS_06170 gene argR 127 567 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_06170 564 1628 gene locus_tag LOCUS_06180 gene argC 564 1628 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_06180 1625 2407 gene locus_tag LOCUS_06190 gene argB 1625 2407 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_06190 2404 3651 gene locus_tag LOCUS_06200 2404 3651 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence0200 1513 512 gene locus_tag LOCUS_06210 1513 512 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180600.1 protein_id gnl|my_center|LOCUS_06210 3490 1517 gene locus_tag LOCUS_06220 3490 1517 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774194.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence0201 646 278 gene locus_tag LOCUS_06230 646 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2094 706 gene locus_tag LOCUS_06240 2094 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3587 2097 gene locus_tag LOCUS_06250 3587 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence0202 1619 402 gene locus_tag LOCUS_06260 1619 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3460 1616 gene locus_tag LOCUS_06270 3460 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence0203 2465 1983 gene locus_tag LOCUS_06280 2465 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3013 2465 gene locus_tag LOCUS_06290 3013 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence0204 1935 874 gene locus_tag LOCUS_06300 1935 874 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_06300 2657 2538 gene locus_tag LOCUS_06310 2657 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3584 2769 gene locus_tag LOCUS_06320 gene ppk2 3584 2769 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086264.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence0205 33 296 gene locus_tag LOCUS_06330 33 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 481 299 gene locus_tag LOCUS_06340 481 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 835 563 gene locus_tag LOCUS_06350 835 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2646 1015 gene locus_tag LOCUS_06360 gene sucB 2646 1015 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110455.1 protein_id gnl|my_center|LOCUS_06360 3530 2769 gene locus_tag LOCUS_06370 gene lipB 3530 2769 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0206 2101 2355 gene locus_tag LOCUS_06380 2101 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2346 2798 gene locus_tag LOCUS_06390 2346 2798 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_06390 3016 2888 gene locus_tag LOCUS_06400 3016 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3110 3499 gene locus_tag LOCUS_06410 3110 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence0207 >Feature sequence0208 1225 470 gene locus_tag LOCUS_06420 1225 470 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_06420 <3666 1222 gene locus_tag LOCUS_06430 <3666 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932586.1:helicase-related protein >Feature sequence0209 3606 1771 gene locus_tag LOCUS_06440 gene atzF 3606 1771 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206338.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence0210 1092 37 gene locus_tag LOCUS_06450 1092 37 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_06450 3579 1285 gene locus_tag LOCUS_06460 3579 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence0211 946 1074 gene locus_tag LOCUS_06470 946 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1102 1254 gene locus_tag LOCUS_06480 1102 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2671 1643 gene locus_tag LOCUS_06490 2671 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 <3659 2723 gene locus_tag LOCUS_06500 <3659 2723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877899.1:class I adenylate-forming enzyme family protein >Feature sequence0212 13 1929 gene locus_tag LOCUS_06510 13 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2988 2913 gene locus_tag LOCUS_t00040 2988 2913 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3355 3510 gene locus_tag LOCUS_06520 3355 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0213 3363 406 gene locus_tag LOCUS_06530 3363 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence0214 1234 719 gene locus_tag LOCUS_06540 1234 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2449 1562 gene locus_tag LOCUS_06550 2449 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3406 3023 gene locus_tag LOCUS_06560 3406 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence0215 1665 3062 gene locus_tag LOCUS_06570 1665 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence0216 1378 803 gene locus_tag LOCUS_06580 gene satP 1378 803 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_06580 2316 1423 gene locus_tag LOCUS_06590 2316 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2585 2797 gene locus_tag LOCUS_06600 2585 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence0217 794 363 gene locus_tag LOCUS_06610 794 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1300 797 gene locus_tag LOCUS_06620 1300 797 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_06620 2390 1305 gene locus_tag LOCUS_06630 2390 1305 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_06630 3006 2380 gene locus_tag LOCUS_06640 3006 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0218 2854 2480 gene locus_tag LOCUS_06650 gene rplL 2854 2480 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_06650 3622 3011 gene locus_tag LOCUS_06660 3622 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence0219 1534 1818 gene locus_tag LOCUS_06670 1534 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1842 2600 gene locus_tag LOCUS_06680 1842 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3070 2870 gene locus_tag LOCUS_06690 3070 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0220 3208 56 gene locus_tag LOCUS_06700 3208 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0221 1459 980 gene locus_tag LOCUS_06710 1459 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1660 1490 gene locus_tag LOCUS_06720 1660 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence0222 743 1594 gene locus_tag LOCUS_06730 743 1594 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_06730 3562 1907 gene locus_tag LOCUS_06740 3562 1907 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence0223 1040 21 gene locus_tag LOCUS_06750 1040 21 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_06750 1857 1087 gene locus_tag LOCUS_06760 1857 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 <3626 2099 gene locus_tag LOCUS_06770 <3626 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814586.1:ATP-binding cassette domain-containing protein >Feature sequence0224 2118 1150 gene locus_tag LOCUS_06780 2118 1150 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965824.1 protein_id gnl|my_center|LOCUS_06780 2341 3000 gene locus_tag LOCUS_06790 gene queC 2341 3000 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence0225 <3617 1428 gene locus_tag LOCUS_06800 <3617 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928775.1:ABC transporter permease >Feature sequence0226 >Feature sequence0227 3597 1390 gene locus_tag LOCUS_06810 3597 1390 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence0228 786 85 gene locus_tag LOCUS_06820 786 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1315 800 gene locus_tag LOCUS_06830 1315 800 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021980.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence0229 2140 650 gene locus_tag LOCUS_06840 2140 650 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090275.1 protein_id gnl|my_center|LOCUS_06840 2448 3563 gene locus_tag LOCUS_06850 2448 3563 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence0230 713 237 gene locus_tag LOCUS_06860 713 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1499 3088 gene locus_tag LOCUS_06870 1499 3088 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931017.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence0231 504 830 gene locus_tag LOCUS_06880 504 830 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_06880 909 3590 gene locus_tag LOCUS_06890 909 3590 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence0232 2 619 gene locus_tag LOCUS_06900 2 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1181 2440 gene locus_tag LOCUS_06910 1181 2440 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence0233 22 1884 gene locus_tag LOCUS_06920 22 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1887 2651 gene locus_tag LOCUS_06930 1887 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2788 3111 gene locus_tag LOCUS_06940 2788 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence0234 637 452 gene locus_tag LOCUS_06950 gene rpmD 637 452 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 protein_id gnl|my_center|LOCUS_06950 1151 642 gene locus_tag LOCUS_06960 gene rpsE 1151 642 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_06960 1581 1225 gene locus_tag LOCUS_06970 gene rplR 1581 1225 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_06970 2210 1671 gene locus_tag LOCUS_06980 gene rplF 2210 1671 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_06980 2707 2309 gene locus_tag LOCUS_06990 gene rpsH 2707 2309 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_06990 3004 2819 gene locus_tag LOCUS_07000 3004 2819 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_07000 <3593 3034 gene locus_tag LOCUS_07010 <3593 3034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943474.1:50S ribosomal protein L5 >Feature sequence0235 854 330 gene locus_tag LOCUS_07020 gene ruvX 854 330 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_07020 931 1971 gene locus_tag LOCUS_07030 gene mltG 931 1971 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880471.1 protein_id gnl|my_center|LOCUS_07030 1968 2858 gene locus_tag LOCUS_07040 1968 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3522 2947 gene locus_tag LOCUS_07050 3522 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0236 <3592 1645 gene locus_tag LOCUS_07060 <3592 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000868463.1:S9 family peptidase >Feature sequence0237 2961 1870 gene locus_tag LOCUS_07070 2961 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <3590 2958 gene locus_tag LOCUS_07080 <3590 2958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103620.1:pyoverdine signaling pathway sigma factor FpvI >Feature sequence0238 476 252 gene locus_tag LOCUS_07090 476 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 636 460 gene locus_tag LOCUS_07100 636 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1348 629 gene locus_tag LOCUS_07110 1348 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2275 1349 gene locus_tag LOCUS_07120 2275 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2465 2268 gene locus_tag LOCUS_07130 2465 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2773 2462 gene locus_tag LOCUS_07140 2773 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2966 2775 gene locus_tag LOCUS_07150 2966 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3196 2978 gene locus_tag LOCUS_07160 3196 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3408 3217 gene locus_tag LOCUS_07170 3408 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence0239 304 380 gene locus_tag LOCUS_t00050 304 380 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 972 730 gene locus_tag LOCUS_07180 972 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1595 2539 gene locus_tag LOCUS_07190 gene folD 1595 2539 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_07190 2551 3225 gene locus_tag LOCUS_07200 gene coaE 2551 3225 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393338.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence0240 1336 266 gene locus_tag LOCUS_07210 1336 266 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112642.1 protein_id gnl|my_center|LOCUS_07210 2437 1355 gene locus_tag LOCUS_07220 2437 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3231 2434 gene locus_tag LOCUS_07230 3231 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence0241 >Feature sequence0242 2280 2462 gene locus_tag LOCUS_07240 2280 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2474 2890 gene locus_tag LOCUS_07250 gene hicB 2474 2890 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_07250 <3573 3035 gene locus_tag LOCUS_07260 <3573 3035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002223072.1:glutamine-hydrolyzing GMP synthase >Feature sequence0243 997 1656 gene locus_tag LOCUS_07270 gene tmk 997 1656 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_07270 1682 3190 gene locus_tag LOCUS_07280 1682 3190 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence0244 <1 884 gene locus_tag LOCUS_07290 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209648948.1:IS701 family transposase 1427 2692 gene locus_tag LOCUS_07300 1427 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2864 3265 gene locus_tag LOCUS_07310 2864 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3255 3443 gene locus_tag LOCUS_07320 3255 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0245 <3563 2651 gene locus_tag LOCUS_07330 <3563 2651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973258.1:FecR family protein >Feature sequence0246 1380 199 gene locus_tag LOCUS_07340 1380 199 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_07340 2576 1377 gene locus_tag LOCUS_07350 gene hmeB 2576 1377 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_07350 3419 2580 gene locus_tag LOCUS_07360 3419 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence0247 3339 313 gene locus_tag LOCUS_07370 3339 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0248 1202 162 gene locus_tag LOCUS_07380 1202 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2379 1327 gene locus_tag LOCUS_07390 2379 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0249 187 627 gene locus_tag LOCUS_07400 187 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 627 1637 gene locus_tag LOCUS_07410 627 1637 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179487022.1 protein_id gnl|my_center|LOCUS_07410 1651 2115 gene locus_tag LOCUS_07420 1651 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence0250 1014 298 gene locus_tag LOCUS_07430 1014 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2443 2057 gene locus_tag LOCUS_07440 2443 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence0251 633 25 gene locus_tag LOCUS_07450 633 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1760 1050 gene locus_tag LOCUS_07460 1760 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1755 1922 gene locus_tag LOCUS_07470 1755 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence0252 1458 142 gene locus_tag LOCUS_07480 1458 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3202 1529 gene locus_tag LOCUS_07490 3202 1529 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence0253 124 1488 gene locus_tag LOCUS_07500 124 1488 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120884.1 protein_id gnl|my_center|LOCUS_07500 <3544 1601 gene locus_tag LOCUS_07510 <3544 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392876.1:CCA tRNA nucleotidyltransferase >Feature sequence0254 592 1176 gene locus_tag LOCUS_07520 592 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1173 2705 gene locus_tag LOCUS_07530 1173 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3476 2835 gene locus_tag LOCUS_07540 3476 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence0255 2662 1313 gene locus_tag LOCUS_07550 2662 1313 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_07550 <3539 2659 gene locus_tag LOCUS_07560 <3539 2659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:efflux RND transporter permease subunit >Feature sequence0256 22 318 gene locus_tag LOCUS_07570 22 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 425 2191 gene locus_tag LOCUS_07580 425 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence0257 203 589 gene locus_tag LOCUS_07590 203 589 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_07590 793 1569 gene locus_tag LOCUS_07600 793 1569 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_07600 1614 2129 gene locus_tag LOCUS_07610 1614 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 <3531 2184 gene locus_tag LOCUS_07620 <3531 2184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113976.1:ATP-binding cassette domain-containing protein >Feature sequence0258 295 732 gene locus_tag LOCUS_07630 295 732 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083224.1 protein_id gnl|my_center|LOCUS_07630 732 1769 gene locus_tag LOCUS_07640 732 1769 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084984.1 protein_id gnl|my_center|LOCUS_07640 1778 2593 gene locus_tag LOCUS_07650 1778 2593 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462295.1 protein_id gnl|my_center|LOCUS_07650 2707 3462 gene locus_tag LOCUS_07660 2707 3462 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence0259 1747 2076 gene locus_tag LOCUS_07670 1747 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0260 <1 1040 gene locus_tag LOCUS_07680 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329623.1:glucose-1-phosphate adenylyltransferase 1213 1953 gene locus_tag LOCUS_07690 1213 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1956 2741 gene locus_tag LOCUS_07700 1956 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence0261 <3525 1016 gene locus_tag LOCUS_07710 <3525 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036950.1:EAL domain-containing protein >Feature sequence0262 749 21 gene locus_tag LOCUS_07720 gene lptB 749 21 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_07720 3274 749 gene locus_tag LOCUS_07730 3274 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0263 594 106 gene locus_tag LOCUS_07740 594 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2362 713 gene locus_tag LOCUS_07750 2362 713 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_07750 <3523 2359 gene locus_tag LOCUS_07760 <3523 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258557.1:helicase-related protein >Feature sequence0264 <1 1783 gene locus_tag LOCUS_07770 <1 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994129.1:family 20 glycosylhydrolase 1845 3398 gene locus_tag LOCUS_07780 1845 3398 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0265 877 68 gene locus_tag LOCUS_07790 877 68 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_07790 2562 874 gene locus_tag LOCUS_07800 gene lysS 2562 874 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 protein_id gnl|my_center|LOCUS_07800 2725 2543 gene locus_tag LOCUS_07810 2725 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2788 2970 gene locus_tag LOCUS_07820 2788 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2967 3431 gene locus_tag LOCUS_07830 2967 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence0266 2 2767 gene locus_tag LOCUS_07840 2 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence0267 >Feature sequence0268 <1 2865 gene locus_tag LOCUS_07850 <1 2865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:TonB-dependent receptor >Feature sequence0269 >Feature sequence0270 640 831 gene locus_tag LOCUS_07860 640 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1106 933 gene locus_tag LOCUS_07870 1106 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1815 1363 gene locus_tag LOCUS_07880 1815 1363 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013556.1 protein_id gnl|my_center|LOCUS_07880 2684 2031 gene locus_tag LOCUS_07890 2684 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence0271 882 2357 gene locus_tag LOCUS_07900 gene xylB 882 2357 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_07900 3142 2390 gene locus_tag LOCUS_07910 3142 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0272 <1 1730 gene locus_tag LOCUS_07920 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880827.1:ATP-dependent Clp protease ATP-binding subunit 2262 1954 gene locus_tag LOCUS_07930 2262 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3221 2412 gene locus_tag LOCUS_07940 3221 2412 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence0273 77 1003 gene locus_tag LOCUS_07950 77 1003 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210901.1 protein_id gnl|my_center|LOCUS_07950 1651 1037 gene locus_tag LOCUS_07960 1651 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2556 1648 gene locus_tag LOCUS_07970 2556 1648 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence0274 687 217 gene locus_tag LOCUS_07980 gene rpsG 687 217 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_07980 1189 803 gene locus_tag LOCUS_07990 gene rpsL 1189 803 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_07990 2091 1789 gene locus_tag LOCUS_08000 2091 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2740 2324 gene locus_tag LOCUS_08010 gene ndk 2740 2324 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707487.1 protein_id gnl|my_center|LOCUS_08010 3118 3009 gene locus_tag LOCUS_r00010 3118 3009 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence0275 <3492 2415 gene locus_tag LOCUS_08020 <3492 2415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338340.1:choline-sulfatase >Feature sequence0276 <1 1156 gene locus_tag LOCUS_08030 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086777.1:carboxylesterase family protein 1244 2320 gene locus_tag LOCUS_08040 1244 2320 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920175.1 protein_id gnl|my_center|LOCUS_08040 2483 2407 gene locus_tag LOCUS_t00060 2483 2407 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <3491 2537 gene locus_tag LOCUS_08050 <3491 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230185.1:serine hydrolase domain-containing protein >Feature sequence0277 2314 218 gene locus_tag LOCUS_08060 2314 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2688 2311 gene locus_tag LOCUS_08070 2688 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3213 2887 gene locus_tag LOCUS_08080 3213 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0278 267 1265 gene locus_tag LOCUS_08090 gene lpxD 267 1265 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 protein_id gnl|my_center|LOCUS_08090 1327 1977 gene locus_tag LOCUS_08100 1327 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 <3490 1972 gene locus_tag LOCUS_08110 <3490 1972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108981.1:alpha-L-fucosidase >Feature sequence0279 362 1507 gene locus_tag LOCUS_08120 362 1507 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921397.1 protein_id gnl|my_center|LOCUS_08120 1973 3475 gene locus_tag LOCUS_08130 1973 3475 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence0280 691 2325 gene locus_tag LOCUS_08140 691 2325 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_08140 <3486 2461 gene locus_tag LOCUS_08150 <3486 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974206.1:glucose-6-phosphate dehydrogenase >Feature sequence0281 >Feature sequence0282 668 832 gene locus_tag LOCUS_08160 668 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1162 1833 gene locus_tag LOCUS_08170 1162 1833 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_08170 <3481 2171 gene locus_tag LOCUS_08180 <3481 2171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091283.1:exopolysaccharide Pel transporter PelG >Feature sequence0283 729 1142 gene locus_tag LOCUS_08190 729 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1487 1996 gene locus_tag LOCUS_08200 1487 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2012 2770 gene locus_tag LOCUS_08210 gene pyrF 2012 2770 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968510.1 protein_id gnl|my_center|LOCUS_08210 <3481 2793 gene locus_tag LOCUS_08220 <3481 2793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922147.1:primosomal protein N' >Feature sequence0284 2911 2483 gene locus_tag LOCUS_08230 2911 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <3480 2908 gene locus_tag LOCUS_08240 <3480 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222251.1:SDR family oxidoreductase >Feature sequence0285 464 285 gene locus_tag LOCUS_08250 464 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 786 637 gene locus_tag LOCUS_08260 786 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1177 917 gene locus_tag LOCUS_08270 1177 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1462 1617 gene locus_tag LOCUS_08280 1462 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1706 2185 gene locus_tag LOCUS_08290 1706 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 2160 2828 gene locus_tag LOCUS_08300 2160 2828 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 3146 2841 gene locus_tag LOCUS_08310 3146 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0286 535 1668 gene locus_tag LOCUS_08320 gene cas7e 535 1668 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_08320 1674 2387 gene locus_tag LOCUS_08330 gene cas5e 1674 2387 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_08330 2384 3082 gene locus_tag LOCUS_08340 2384 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence0287 2730 97 gene locus_tag LOCUS_08350 2730 97 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 protein_id gnl|my_center|LOCUS_08350 <3477 2727 gene locus_tag LOCUS_08360 <3477 2727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406584.1:exonuclease SbcCD subunit D >Feature sequence0288 996 1382 gene locus_tag LOCUS_08370 996 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1360 2577 gene locus_tag LOCUS_08380 1360 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence0289 <1 1073 gene locus_tag LOCUS_08390 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816110.1:M24 family metallopeptidase 1179 2150 gene locus_tag LOCUS_08400 1179 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2261 3376 gene locus_tag LOCUS_08410 2261 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0290 1660 86 gene locus_tag LOCUS_08420 1660 86 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_08420 1908 2594 gene locus_tag LOCUS_08430 1908 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2579 3043 gene locus_tag LOCUS_08440 2579 3043 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531529.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0291 >Feature sequence0292 573 1577 gene locus_tag LOCUS_08450 573 1577 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056558.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0293 1096 239 gene locus_tag LOCUS_08460 1096 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2539 1100 gene locus_tag LOCUS_08470 2539 1100 CDS product IS4-like element ISLpn5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947782.1 protein_id gnl|my_center|LOCUS_08470 2995 2780 gene locus_tag LOCUS_08480 2995 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence0294 434 1114 gene locus_tag LOCUS_08490 434 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1558 1139 gene locus_tag LOCUS_08500 1558 1139 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085221.1 protein_id gnl|my_center|LOCUS_08500 1812 1555 gene locus_tag LOCUS_08510 1812 1555 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085222.1 protein_id gnl|my_center|LOCUS_08510 <3458 2012 gene locus_tag LOCUS_08520 <3458 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584150.1:alpha-glucan family phosphorylase >Feature sequence0295 223 1479 gene locus_tag LOCUS_08530 223 1479 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_08530 2220 1591 gene locus_tag LOCUS_08540 2220 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 3218 2607 gene locus_tag LOCUS_08550 3218 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 3456 3298 gene locus_tag LOCUS_08560 3456 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0296 >Feature sequence0297 1895 228 gene locus_tag LOCUS_08570 gene groL 1895 228 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_08570 2327 2013 gene locus_tag LOCUS_08580 gene groES 2327 2013 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706990.1 protein_id gnl|my_center|LOCUS_08580 2790 2987 gene locus_tag LOCUS_08590 2790 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence0298 814 1863 gene locus_tag LOCUS_08600 814 1863 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339538.1 protein_id gnl|my_center|LOCUS_08600 1966 2667 gene locus_tag LOCUS_08610 1966 2667 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_08610 3446 2688 gene locus_tag LOCUS_08620 3446 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0299 1548 52 gene locus_tag LOCUS_08630 1548 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2501 1563 gene locus_tag LOCUS_08640 2501 1563 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_08640 <3444 2611 gene locus_tag LOCUS_08650 <3444 2611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066403458.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence0300 <1 1300 gene locus_tag LOCUS_08660 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence0301 47 289 gene locus_tag LOCUS_08670 gene thiS 47 289 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_08670 1077 319 gene locus_tag LOCUS_08680 1077 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2759 1104 gene locus_tag LOCUS_08690 2759 1104 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_08690 <3443 2759 gene locus_tag LOCUS_08700 <3443 2759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136496851.1:cytochrome c oxidase subunit II >Feature sequence0302 <1 652 gene locus_tag LOCUS_08710 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921495.1:carbohydrate-binding family 9-like protein 798 3260 gene locus_tag LOCUS_08720 798 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence0303 2028 1003 gene locus_tag LOCUS_08730 gene ilvC 2028 1003 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_08730 2747 2127 gene locus_tag LOCUS_08740 gene ilvN 2747 2127 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_08740 <3437 2858 gene locus_tag LOCUS_08750 <3437 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256073.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence0304 483 298 gene locus_tag LOCUS_08760 483 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 645 1073 gene locus_tag LOCUS_08770 645 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1187 1522 gene locus_tag LOCUS_08780 1187 1522 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_08780 1519 2799 gene locus_tag LOCUS_08790 1519 2799 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533330.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence0305 657 1211 gene locus_tag LOCUS_08800 657 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1581 2588 gene locus_tag LOCUS_08810 1581 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence0306 325 206 gene locus_tag LOCUS_08820 325 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 297 3011 gene locus_tag LOCUS_08830 297 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence0307 1686 91 gene locus_tag LOCUS_08840 1686 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2047 1772 gene locus_tag LOCUS_08850 2047 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2416 3378 gene locus_tag LOCUS_08860 2416 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0308 1431 1045 gene locus_tag LOCUS_08870 1431 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2921 1428 gene locus_tag LOCUS_08880 2921 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence0309 1018 305 gene locus_tag LOCUS_08890 1018 305 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087336.1 protein_id gnl|my_center|LOCUS_08890 1857 1072 gene locus_tag LOCUS_08900 1857 1072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0310 2730 1627 gene locus_tag LOCUS_08910 2730 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2927 2718 gene locus_tag LOCUS_08920 2927 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3041 3304 gene locus_tag LOCUS_08930 3041 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence0311 >Feature sequence0312 >Feature sequence0313 <1 541 gene locus_tag LOCUS_08940 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013584.1:polysaccharide biosynthesis tyrosine autokinase 948 2585 gene locus_tag LOCUS_08950 948 2585 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence0314 2258 525 gene locus_tag LOCUS_08960 2258 525 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463461.1 protein_id gnl|my_center|LOCUS_08960 2415 3263 gene locus_tag LOCUS_08970 gene lgt 2415 3263 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0315 544 1821 gene locus_tag LOCUS_08980 544 1821 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_08980 3150 1882 gene locus_tag LOCUS_08990 3150 1882 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence0316 903 1988 gene locus_tag LOCUS_09000 903 1988 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0317 474 1883 gene locus_tag LOCUS_09010 474 1883 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_09010 2062 1986 gene locus_tag LOCUS_t00070 2062 1986 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2802 2053 gene locus_tag LOCUS_09020 2802 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 <3405 2836 gene locus_tag LOCUS_09030 <3405 2836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939508.1:alpha/beta fold hydrolase >Feature sequence0318 1776 175 gene locus_tag LOCUS_09040 1776 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 <3404 1934 gene locus_tag LOCUS_09050 <3404 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807791.1:choline-sulfatase >Feature sequence0319 194 433 gene locus_tag LOCUS_09060 194 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 516 1190 gene locus_tag LOCUS_09070 516 1190 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_09070 1187 2068 gene locus_tag LOCUS_09080 gene pssA 1187 2068 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_09080 2081 3127 gene locus_tag LOCUS_09090 2081 3127 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115016.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence0320 274 885 gene locus_tag LOCUS_09100 274 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2352 1291 gene locus_tag LOCUS_09110 2352 1291 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_09110 2778 2506 gene locus_tag LOCUS_09120 2778 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence0321 2501 1533 gene locus_tag LOCUS_09130 2501 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 <3395 2605 gene locus_tag LOCUS_09140 <3395 2605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090361384.1:copper resistance protein B >Feature sequence0322 <1 697 gene locus_tag LOCUS_09150 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974206.1:glucose-6-phosphate dehydrogenase 958 722 gene locus_tag LOCUS_09160 958 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1715 1461 gene locus_tag LOCUS_09170 1715 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence0323 529 936 gene locus_tag LOCUS_09180 529 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09180 1339 1710 gene locus_tag LOCUS_09190 1339 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1775 2710 gene locus_tag LOCUS_09200 1775 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence0324 16 89 gene locus_tag LOCUS_t00080 16 89 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <3389 484 gene locus_tag LOCUS_09210 <3389 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228376.1:DUF499 domain-containing protein >Feature sequence0325 <1 904 gene locus_tag LOCUS_09220 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125901.1:NADP-dependent isocitrate dehydrogenase 941 1867 gene locus_tag LOCUS_09230 gene mdh 941 1867 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence0326 69 1220 gene locus_tag LOCUS_09240 69 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1407 1619 gene locus_tag LOCUS_09250 1407 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence0327 322 1383 gene locus_tag LOCUS_09260 322 1383 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920792.1 protein_id gnl|my_center|LOCUS_09260 1399 2346 gene locus_tag LOCUS_09270 gene hpnC 1399 2346 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_09270 2343 3272 gene locus_tag LOCUS_09280 2343 3272 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0328 1417 1124 gene locus_tag LOCUS_09290 1417 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1949 1419 gene locus_tag LOCUS_09300 1949 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3358 1949 gene locus_tag LOCUS_09310 3358 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence0329 645 7 gene locus_tag LOCUS_09320 645 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3104 711 gene locus_tag LOCUS_09330 3104 711 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence0330 <1 1655 gene locus_tag LOCUS_09340 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839612.1:TonB-dependent receptor 2801 1662 gene locus_tag LOCUS_09350 2801 1662 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_09350 2949 3257 gene locus_tag LOCUS_09360 2949 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence0331 <1 880 gene locus_tag LOCUS_09370 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231837.1:glycine C-acetyltransferase 1736 906 gene locus_tag LOCUS_09380 1736 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3193 1862 gene locus_tag LOCUS_09390 3193 1862 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0332 2904 1333 gene locus_tag LOCUS_09400 2904 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0333 >Feature sequence0334 1260 463 gene locus_tag LOCUS_09410 1260 463 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_09410 1749 2573 gene locus_tag LOCUS_09420 1749 2573 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence0335 721 518 gene locus_tag LOCUS_09430 721 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1429 3057 gene locus_tag LOCUS_09440 1429 3057 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0336 263 442 gene locus_tag LOCUS_09450 263 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 443 592 gene locus_tag LOCUS_09460 443 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 592 918 gene locus_tag LOCUS_09470 592 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 922 1230 gene locus_tag LOCUS_09480 922 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1239 2102 gene locus_tag LOCUS_09490 1239 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2102 2911 gene locus_tag LOCUS_09500 2102 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2911 3234 gene locus_tag LOCUS_09510 2911 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0337 3294 1066 gene locus_tag LOCUS_09520 gene ppk1 3294 1066 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0338 393 73 gene locus_tag LOCUS_09530 393 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1415 432 gene locus_tag LOCUS_09540 1415 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2531 1797 gene locus_tag LOCUS_09550 2531 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2856 2638 gene locus_tag LOCUS_09560 2856 2638 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_09560 3182 2964 gene locus_tag LOCUS_09570 3182 2964 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724507.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0339 2310 904 gene locus_tag LOCUS_09580 gene lpdA 2310 904 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051289.1 protein_id gnl|my_center|LOCUS_09580 3281 2538 gene locus_tag LOCUS_09590 3281 2538 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0340 >Feature sequence0341 587 1024 gene locus_tag LOCUS_09600 587 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1346 1870 gene locus_tag LOCUS_09610 1346 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1867 2316 gene locus_tag LOCUS_09620 1867 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2303 3013 gene locus_tag LOCUS_09630 2303 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence0342 9 1649 gene locus_tag LOCUS_09640 9 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2220 1717 gene locus_tag LOCUS_09650 2220 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0343 1910 81 gene locus_tag LOCUS_09660 1910 81 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_09660 3228 2149 gene locus_tag LOCUS_09670 3228 2149 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence0344 1193 261 gene locus_tag LOCUS_09680 1193 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2928 1183 gene locus_tag LOCUS_09690 2928 1183 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 protein_id gnl|my_center|LOCUS_09690 3160 2939 gene locus_tag LOCUS_09700 3160 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence0345 1 447 gene locus_tag LOCUS_09710 1 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1443 649 gene locus_tag LOCUS_09720 1443 649 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09720 2085 1594 gene locus_tag LOCUS_09730 2085 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 2286 2546 gene locus_tag LOCUS_09740 2286 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2874 2539 gene locus_tag LOCUS_09750 2874 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 >Feature sequence0346 2664 2446 gene locus_tag LOCUS_09760 2664 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3148 2861 gene locus_tag LOCUS_09770 3148 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence0347 364 438 gene locus_tag LOCUS_t00090 364 438 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 952 473 gene locus_tag LOCUS_09780 952 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2289 1018 gene locus_tag LOCUS_09790 2289 1018 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_09790 2669 2406 gene locus_tag LOCUS_09800 gene rpmA 2669 2406 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964571.1 protein_id gnl|my_center|LOCUS_09800 3134 2802 gene locus_tag LOCUS_09810 gene rplU 3134 2802 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence0348 639 1292 gene locus_tag LOCUS_09820 639 1292 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_09820 1442 1963 gene locus_tag LOCUS_09830 1442 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2373 2095 gene locus_tag LOCUS_09840 2373 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2260 3063 gene locus_tag LOCUS_09850 2260 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence0349 1 870 gene locus_tag LOCUS_09860 1 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 897 1772 gene locus_tag LOCUS_09870 897 1772 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_09870 1765 2682 gene locus_tag LOCUS_09880 1765 2682 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0350 1291 2490 gene locus_tag LOCUS_09890 1291 2490 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_09890 2550 3071 gene locus_tag LOCUS_09900 2550 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence0351 44 1015 gene locus_tag LOCUS_09910 gene fabD 44 1015 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_09910 1031 1732 gene locus_tag LOCUS_09920 1031 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2226 1753 gene locus_tag LOCUS_09930 2226 1753 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_09930 2646 2338 gene locus_tag LOCUS_09940 2646 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0352 1321 917 gene locus_tag LOCUS_09950 1321 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2542 1598 gene locus_tag LOCUS_09960 2542 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence0353 732 3002 gene locus_tag LOCUS_09970 732 3002 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence0354 3 761 gene locus_tag LOCUS_09980 3 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 921 1454 gene locus_tag LOCUS_09990 921 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2239 1451 gene locus_tag LOCUS_10000 2239 1451 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_10000 2318 3172 gene locus_tag LOCUS_10010 gene mazG 2318 3172 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence0355 455 736 gene locus_tag LOCUS_10020 455 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 753 1187 gene locus_tag LOCUS_10030 753 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1248 1988 gene locus_tag LOCUS_10040 gene atpB 1248 1988 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_10040 2146 2448 gene locus_tag LOCUS_10050 gene atpE 2146 2448 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_10050 2976 2551 gene locus_tag LOCUS_10060 2976 2551 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_10060 3221 2973 gene locus_tag LOCUS_10070 3221 2973 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence0356 1296 13 gene locus_tag LOCUS_10080 1296 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2456 1293 gene locus_tag LOCUS_10090 2456 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2841 2593 gene locus_tag LOCUS_10100 2841 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2815 3024 gene locus_tag LOCUS_10110 2815 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence0357 >Feature sequence0358 <1 706 gene locus_tag LOCUS_10120 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001216246.1:LysR family transcriptional regulator 2055 838 gene locus_tag LOCUS_10130 2055 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3197 2058 gene locus_tag LOCUS_10140 3197 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0359 <1 2666 gene locus_tag LOCUS_10150 <1 2666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036268.1:site-specific DNA-methyltransferase >Feature sequence0360 932 2212 gene locus_tag LOCUS_10160 932 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2434 2580 gene locus_tag LOCUS_10170 2434 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2684 2556 gene locus_tag LOCUS_10180 2684 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 <3325 2688 gene locus_tag LOCUS_10190 <3325 2688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210328108.1:IS110 family transposase note possible pseudo, internal stop codon >Feature sequence0361 <1 1370 gene locus_tag LOCUS_10200 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350815.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence0362 944 1723 gene locus_tag LOCUS_10210 gene tolQ 944 1723 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_10210 1707 2141 gene locus_tag LOCUS_10220 gene tolR 1707 2141 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_10220 2184 2966 gene locus_tag LOCUS_10230 2184 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence0363 1444 284 gene locus_tag LOCUS_10240 gene ribD 1444 284 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_10240 2430 1456 gene locus_tag LOCUS_10250 gene ftsY 2430 1456 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_10250 <3322 2483 gene locus_tag LOCUS_10260 <3322 2483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940684.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence0364 1263 2303 gene locus_tag LOCUS_10270 1263 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2461 2832 gene locus_tag LOCUS_10280 2461 2832 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251099.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence0365 <1 1061 gene locus_tag LOCUS_10290 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940506.1:multidrug efflux RND transporter permease subunit 1064 2509 gene locus_tag LOCUS_10300 1064 2509 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810342.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence0366 745 1818 gene locus_tag LOCUS_10310 745 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0367 1035 742 gene locus_tag LOCUS_10320 1035 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1229 2101 gene locus_tag LOCUS_10330 1229 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3309 2281 gene locus_tag LOCUS_10340 3309 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence0368 2028 1894 gene locus_tag LOCUS_10350 2028 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2642 2567 gene locus_tag LOCUS_t00100 2642 2567 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0369 1157 1855 gene locus_tag LOCUS_10360 gene cmk 1157 1855 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_10360 2037 2333 gene locus_tag LOCUS_10370 2037 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0370 240 7 gene locus_tag LOCUS_10380 240 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence0371 2343 178 gene locus_tag LOCUS_10390 2343 178 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_10390 2825 2409 gene locus_tag LOCUS_10400 2825 2409 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence0372 212 772 gene locus_tag LOCUS_10410 212 772 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 protein_id gnl|my_center|LOCUS_10410 876 2420 gene locus_tag LOCUS_10420 876 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0373 278 826 gene locus_tag LOCUS_10430 278 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1952 1605 gene locus_tag LOCUS_10440 1952 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2518 2060 gene locus_tag LOCUS_10450 2518 2060 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence0374 <1 549 gene locus_tag LOCUS_10460 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120708963.1:type IV toxin-antitoxin system AbiEi family antitoxin 546 1364 gene locus_tag LOCUS_10470 546 1364 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_10470 1419 2255 gene locus_tag LOCUS_10480 1419 2255 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140126.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0375 43 672 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggattgctcacgggccggggtcagttacact 3216 649 gene locus_tag LOCUS_10490 3216 649 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926995.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0376 629 138 gene locus_tag LOCUS_10500 629 138 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_10500 800 1636 gene locus_tag LOCUS_10510 800 1636 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_10510 1884 2072 gene locus_tag LOCUS_10520 1884 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2131 2955 gene locus_tag LOCUS_10530 gene proC 2131 2955 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0377 872 351 gene locus_tag LOCUS_10540 872 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2188 875 gene locus_tag LOCUS_10550 2188 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 <3286 2365 gene locus_tag LOCUS_10560 <3286 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942731.1:rod shape-determining protein >Feature sequence0378 762 529 gene locus_tag LOCUS_10570 762 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1607 762 gene locus_tag LOCUS_10580 1607 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3063 2722 gene locus_tag LOCUS_10590 3063 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0379 418 1119 gene locus_tag LOCUS_10600 418 1119 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_10600 1232 2452 gene locus_tag LOCUS_10610 gene trpB 1232 2452 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_10610 2456 3244 gene locus_tag LOCUS_10620 gene trpA 2456 3244 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0380 >Feature sequence0381 1521 4 gene locus_tag LOCUS_10630 1521 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2149 1637 gene locus_tag LOCUS_10640 2149 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2575 2351 gene locus_tag LOCUS_10650 2575 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3120 2659 gene locus_tag LOCUS_10660 3120 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence0382 2878 812 gene locus_tag LOCUS_10670 2878 812 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0383 27 953 gene locus_tag LOCUS_10680 27 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0384 2034 64 gene locus_tag LOCUS_10690 gene nuoL 2034 64 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_10690 2333 2031 gene locus_tag LOCUS_10700 gene nuoK 2333 2031 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015281.1 protein_id gnl|my_center|LOCUS_10700 2832 2338 gene locus_tag LOCUS_10710 2832 2338 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0385 791 633 gene locus_tag LOCUS_10720 791 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2068 1004 gene locus_tag LOCUS_10730 2068 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence0386 308 574 gene locus_tag LOCUS_10740 308 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1158 616 gene locus_tag LOCUS_10750 1158 616 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_10750 1492 1211 gene locus_tag LOCUS_10760 1492 1211 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938488.1 protein_id gnl|my_center|LOCUS_10760 2223 1663 gene locus_tag LOCUS_10770 gene efp 2223 1663 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_10770 3265 2456 gene locus_tag LOCUS_10780 3265 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence0387 1143 373 gene locus_tag LOCUS_10790 gene rfbF 1143 373 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545825.1 protein_id gnl|my_center|LOCUS_10790 1221 2630 gene locus_tag LOCUS_10800 gene rfbH 1221 2630 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_10800 <3265 2650 gene locus_tag LOCUS_10810 <3265 2650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_160648704.1:NAD(P)-dependent oxidoreductase >Feature sequence0388 5 1264 gene locus_tag LOCUS_10820 5 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1261 3066 gene locus_tag LOCUS_10830 1261 3066 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence0389 142 2043 gene locus_tag LOCUS_10840 gene ggt 142 2043 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965496.1 protein_id gnl|my_center|LOCUS_10840 <3261 2626 gene locus_tag LOCUS_10850 <3261 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880274.1:serine hydroxymethyltransferase >Feature sequence0390 1820 438 gene locus_tag LOCUS_10860 1820 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2139 3236 gene locus_tag LOCUS_10870 2139 3236 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence0391 <3256 1530 gene locus_tag LOCUS_10880 <3256 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD >Feature sequence0392 1158 739 gene locus_tag LOCUS_10890 1158 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2294 1155 gene locus_tag LOCUS_10900 gene hpnH 2294 1155 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_10900 <3256 2382 gene locus_tag LOCUS_10910 <3256 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941348.1:squalene--hopene cyclase >Feature sequence0393 2488 65 gene locus_tag LOCUS_10920 gene lon 2488 65 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 protein_id gnl|my_center|LOCUS_10920 3029 2628 gene locus_tag LOCUS_10930 gene mscL 3029 2628 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence0394 >Feature sequence0395 1478 783 gene locus_tag LOCUS_10940 1478 783 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_10940 2216 1602 gene locus_tag LOCUS_10950 2216 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 <3246 2366 gene locus_tag LOCUS_10960 <3246 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025774851.1:anthranilate phosphoribosyltransferase >Feature sequence0396 1675 1193 gene locus_tag LOCUS_10970 gene nrdR 1675 1193 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_10970 2813 1725 gene locus_tag LOCUS_10980 2813 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0397 <1 1262 gene locus_tag LOCUS_10990 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210781.1:D-lactate dehydrogenase 1522 2892 gene locus_tag LOCUS_11000 gene araE 1522 2892 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0398 765 1529 gene locus_tag LOCUS_11010 765 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3131 1746 gene locus_tag LOCUS_11020 3131 1746 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0399 588 70 gene locus_tag LOCUS_11030 588 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1310 684 gene locus_tag LOCUS_11040 1310 684 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_11040 <3238 1324 gene locus_tag LOCUS_11050 <3238 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037325.1:sensor histidine kinase >Feature sequence0400 1181 1819 gene locus_tag LOCUS_11060 1181 1819 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_11060 <3237 1920 gene locus_tag LOCUS_11070 <3237 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338417.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence0401 1151 129 gene locus_tag LOCUS_11080 1151 129 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_11080 1745 1287 gene locus_tag LOCUS_11090 1745 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3121 1961 gene locus_tag LOCUS_11100 gene hpnH 3121 1961 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0402 1552 473 gene locus_tag LOCUS_11110 1552 473 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_11110 2004 3035 gene locus_tag LOCUS_11120 2004 3035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0403 99 446 gene locus_tag LOCUS_11130 99 446 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_11130 1611 820 gene locus_tag LOCUS_11140 1611 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2514 3035 gene locus_tag LOCUS_11150 2514 3035 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0404 671 829 gene locus_tag LOCUS_11160 671 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 902 2257 gene locus_tag LOCUS_11170 902 2257 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170457.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0405 <1 665 gene locus_tag LOCUS_11180 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207967.1:phosphoserine phosphatase SerB 1666 653 gene locus_tag LOCUS_11190 gene galE 1666 653 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_11190 1851 2897 gene locus_tag LOCUS_11200 1851 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence0406 1904 327 gene locus_tag LOCUS_11210 1904 327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385601.1 protein_id gnl|my_center|LOCUS_11210 <3232 2407 gene locus_tag LOCUS_11220 <3232 2407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087313.1:ATP-binding cassette domain-containing protein >Feature sequence0407 1684 242 gene locus_tag LOCUS_11230 1684 242 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_11230 3157 2054 gene locus_tag LOCUS_11240 3157 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0408 140 1615 gene locus_tag LOCUS_11250 gene gatB 140 1615 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_11250 2231 1854 gene locus_tag LOCUS_11260 2231 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2433 2236 gene locus_tag LOCUS_11270 2433 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0409 1912 2466 gene locus_tag LOCUS_11280 1912 2466 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 protein_id gnl|my_center|LOCUS_11280 2761 3096 gene locus_tag LOCUS_11290 2761 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence0410 924 127 gene locus_tag LOCUS_11300 924 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1385 960 gene locus_tag LOCUS_11310 gene tolR 1385 960 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_11310 2160 1468 gene locus_tag LOCUS_11320 gene tolQ 2160 1468 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0411 743 141 gene locus_tag LOCUS_11330 743 141 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_11330 2496 985 gene locus_tag LOCUS_11340 gene ppx 2496 985 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_11340 3212 2499 gene locus_tag LOCUS_11350 gene phoU 3212 2499 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence0412 2983 131 gene locus_tag LOCUS_11360 2983 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0413 2 706 gene locus_tag LOCUS_11370 2 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 755 2575 gene locus_tag LOCUS_11380 755 2575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0414 448 2949 gene locus_tag LOCUS_11390 448 2949 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence0415 <1 1055 gene locus_tag LOCUS_11400 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861147.1:recombinase family protein 1776 1180 gene locus_tag LOCUS_11410 1776 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence0416 974 1213 gene locus_tag LOCUS_11420 974 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1216 1602 gene locus_tag LOCUS_11430 gene tnpB 1216 1602 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612591.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence0417 1899 937 gene locus_tag LOCUS_11440 1899 937 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225817.1 protein_id gnl|my_center|LOCUS_11440 2888 1896 gene locus_tag LOCUS_11450 gene plsX 2888 1896 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_11450 3128 2949 gene locus_tag LOCUS_11460 gene rpmF 3128 2949 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence0418 3000 1891 gene locus_tag LOCUS_11470 3000 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0419 145 1377 gene locus_tag LOCUS_11480 145 1377 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_11480 2978 1437 gene locus_tag LOCUS_11490 gene hutH 2978 1437 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243255.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence0420 1501 1064 gene locus_tag LOCUS_11500 1501 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2368 1802 gene locus_tag LOCUS_11510 2368 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2395 2538 gene locus_tag LOCUS_11520 2395 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2578 2796 gene locus_tag LOCUS_11530 2578 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0421 2213 39 gene locus_tag LOCUS_11540 gene ppk1 2213 39 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_11540 <3194 2540 gene locus_tag LOCUS_11550 <3194 2540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080611.1:L-fucose/L-arabinose isomerase family protein >Feature sequence0422 1152 910 gene locus_tag LOCUS_11560 1152 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2905 1193 gene locus_tag LOCUS_11570 2905 1193 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence0423 665 1450 gene locus_tag LOCUS_11580 665 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1450 1950 gene locus_tag LOCUS_11590 1450 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence0424 >Feature sequence0425 764 1510 gene locus_tag LOCUS_11600 764 1510 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491603.1 protein_id gnl|my_center|LOCUS_11600 2362 1514 gene locus_tag LOCUS_11610 gene lgt 2362 1514 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_11610 2449 3006 gene locus_tag LOCUS_11620 gene hpt 2449 3006 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence0426 <1 990 gene locus_tag LOCUS_11630 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006313911.1:UDP-glucose/GDP-mannose dehydrogenase family protein 1024 1956 gene locus_tag LOCUS_11640 1024 1956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_11640 1959 3038 gene locus_tag LOCUS_11650 1959 3038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence0427 1139 393 gene locus_tag LOCUS_11660 1139 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1481 1164 gene locus_tag LOCUS_11670 1481 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2157 1738 gene locus_tag LOCUS_11680 2157 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <3189 2284 gene locus_tag LOCUS_11690 <3189 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942409.1:polyprenyl synthetase family protein >Feature sequence0428 1060 593 gene locus_tag LOCUS_11700 1060 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2706 1057 gene locus_tag LOCUS_11710 2706 1057 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012560534.1 protein_id gnl|my_center|LOCUS_11710 2920 2696 gene locus_tag LOCUS_11720 2920 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence0429 3153 2497 gene locus_tag LOCUS_11730 gene tsf 3153 2497 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0430 876 1 gene locus_tag LOCUS_11740 876 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11740 2017 869 gene locus_tag LOCUS_11750 2017 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11750 2667 2344 gene locus_tag LOCUS_11760 2667 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0431 1408 896 gene locus_tag LOCUS_11770 1408 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence0432 214 1206 gene locus_tag LOCUS_11780 214 1206 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence0433 545 120 gene locus_tag LOCUS_11790 545 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 964 542 gene locus_tag LOCUS_11800 964 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1578 1141 gene locus_tag LOCUS_11810 1578 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1952 2395 gene locus_tag LOCUS_11820 1952 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2395 2523 gene locus_tag LOCUS_11830 2395 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2675 2499 gene locus_tag LOCUS_11840 2675 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3177 2827 gene locus_tag LOCUS_11850 3177 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence0434 406 206 gene locus_tag LOCUS_11860 406 206 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_11860 909 2687 gene locus_tag LOCUS_11870 gene glgP 909 2687 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0435 1681 1229 gene locus_tag LOCUS_11880 1681 1229 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975946.1 protein_id gnl|my_center|LOCUS_11880 1916 1824 gene locus_tag LOCUS_t00110 1916 1824 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0436 <3173 1 gene locus_tag LOCUS_11890 <3173 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258561.1:Swt1 family HEPN domain-containing protein >Feature sequence0437 520 335 gene locus_tag LOCUS_11900 520 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1590 517 gene locus_tag LOCUS_11910 gene pyrC 1590 517 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_11910 2003 1587 gene locus_tag LOCUS_11920 2003 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3084 2221 gene locus_tag LOCUS_11930 3084 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence0438 >Feature sequence0439 505 1425 gene locus_tag LOCUS_11940 505 1425 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_11940 1555 1992 gene locus_tag LOCUS_11950 1555 1992 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642254.1 protein_id gnl|my_center|LOCUS_11950 2061 2930 gene locus_tag LOCUS_11960 2061 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence0440 404 1033 gene locus_tag LOCUS_11970 404 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1797 1069 gene locus_tag LOCUS_11980 1797 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2263 1910 gene locus_tag LOCUS_11990 2263 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <3168 2396 gene locus_tag LOCUS_12000 <3168 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545988.1:MFS transporter >Feature sequence0441 396 2681 gene locus_tag LOCUS_12010 396 2681 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence0442 236 1789 gene locus_tag LOCUS_12020 gene lnt 236 1789 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_12020 3071 1725 gene locus_tag LOCUS_12030 gene pmbA 3071 1725 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687847.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0443 724 1725 gene locus_tag LOCUS_12040 gene purM 724 1725 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_12040 2197 2835 gene locus_tag LOCUS_12050 gene purN 2197 2835 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_12050 2832 3161 gene locus_tag LOCUS_12060 2832 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence0444 1942 1295 gene locus_tag LOCUS_12070 gene hisG 1942 1295 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_12070 3162 1939 gene locus_tag LOCUS_12080 gene murA 3162 1939 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0445 1693 845 gene locus_tag LOCUS_12090 gene proC 1693 845 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_12090 2440 1808 gene locus_tag LOCUS_12100 2440 1808 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_12100 2937 2443 gene locus_tag LOCUS_12110 gene greA 2937 2443 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941932.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0446 20 1099 gene locus_tag LOCUS_12120 20 1099 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245431.1 protein_id gnl|my_center|LOCUS_12120 1112 1447 gene locus_tag LOCUS_12130 1112 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1432 2310 gene locus_tag LOCUS_12140 1432 2310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_12140 2298 3137 gene locus_tag LOCUS_12150 2298 3137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067355.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0447 1041 10 gene locus_tag LOCUS_12160 gene obgE 1041 10 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence0448 <3158 1201 gene locus_tag LOCUS_12170 <3158 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase >Feature sequence0449 1825 674 gene locus_tag LOCUS_12180 gene pheS 1825 674 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_12180 1915 2307 gene locus_tag LOCUS_12190 1915 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2714 2346 gene locus_tag LOCUS_12200 gene rplT 2714 2346 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_12200 3078 2881 gene locus_tag LOCUS_12210 gene rpmI 3078 2881 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence0450 682 1689 gene locus_tag LOCUS_12220 682 1689 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_12220 <3154 1699 gene locus_tag LOCUS_12230 <3154 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036929.1:glycoside hydrolase family 31 protein >Feature sequence0451 >Feature sequence0452 <3153 1582 gene locus_tag LOCUS_12240 <3153 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence0453 605 147 gene locus_tag LOCUS_12250 605 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 971 606 gene locus_tag LOCUS_12260 971 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1962 985 gene locus_tag LOCUS_12270 1962 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2334 2029 gene locus_tag LOCUS_12280 2334 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence0454 148 1164 gene locus_tag LOCUS_12290 148 1164 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_12290 2156 1584 gene locus_tag LOCUS_12300 2156 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence0455 <1 734 gene locus_tag LOCUS_12310 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391806.1:type I glyceraldehyde-3-phosphate dehydrogenase 1013 1384 gene locus_tag LOCUS_12320 1013 1384 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_12320 1788 2999 gene locus_tag LOCUS_12330 1788 2999 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence0456 <1 958 gene locus_tag LOCUS_12340 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013062574.1:heme o synthase 963 1958 gene locus_tag LOCUS_12350 963 1958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_12350 1970 2791 gene locus_tag LOCUS_12360 1970 2791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0457 73 1497 gene locus_tag LOCUS_12370 73 1497 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_12370 2643 1693 gene locus_tag LOCUS_12380 2643 1693 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence0458 537 1034 gene locus_tag LOCUS_12390 537 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence0459 645 2978 gene locus_tag LOCUS_12400 645 2978 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0460 471 1124 gene locus_tag LOCUS_12410 gene upp 471 1124 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_12410 1325 1537 gene locus_tag LOCUS_12420 1325 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1541 1951 gene locus_tag LOCUS_12430 1541 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1941 2603 gene locus_tag LOCUS_12440 gene atpB 1941 2603 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_12440 2616 2855 gene locus_tag LOCUS_12450 2616 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence0461 1712 798 gene locus_tag LOCUS_12460 1712 798 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence0462 1546 809 gene locus_tag LOCUS_12470 gene purQ 1546 809 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_12470 1765 2187 gene locus_tag LOCUS_12480 1765 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2318 3067 gene locus_tag LOCUS_12490 2318 3067 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence0463 2143 746 gene locus_tag LOCUS_12500 2143 746 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0464 337 486 gene locus_tag LOCUS_12510 337 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1022 663 gene locus_tag LOCUS_12520 1022 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2702 1362 gene locus_tag LOCUS_12530 2702 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0465 1608 901 gene locus_tag LOCUS_12540 1608 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1712 3094 gene locus_tag LOCUS_12550 1712 3094 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence0466 2212 1067 gene locus_tag LOCUS_12560 2212 1067 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_12560 3126 2200 gene locus_tag LOCUS_12570 3126 2200 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence0467 2386 2240 gene locus_tag LOCUS_12580 2386 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0468 274 1374 gene locus_tag LOCUS_12590 gene nagZ 274 1374 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_12590 1371 2591 gene locus_tag LOCUS_12600 gene anmK 1371 2591 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274964.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0469 <1 580 gene locus_tag LOCUS_12610 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038017.1:glycoside hydrolase family 3 C-terminal domain-containing protein 593 3118 gene locus_tag LOCUS_12620 593 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0470 >Feature sequence0471 935 1369 gene locus_tag LOCUS_12630 935 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3112 1439 gene locus_tag LOCUS_12640 gene ilvD 3112 1439 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0472 164 1618 gene locus_tag LOCUS_12650 164 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2807 1626 gene locus_tag LOCUS_12660 2807 1626 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0473 563 2317 gene locus_tag LOCUS_12670 563 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3043 2885 gene locus_tag LOCUS_12680 3043 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence0474 270 656 gene locus_tag LOCUS_12690 270 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 664 1992 gene locus_tag LOCUS_12700 664 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0475 692 1294 gene locus_tag LOCUS_12710 692 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1884 1462 gene locus_tag LOCUS_12720 1884 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2472 2266 gene locus_tag LOCUS_12730 2472 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence0476 >Feature sequence0477 93 752 gene locus_tag LOCUS_12740 93 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 951 1730 gene locus_tag LOCUS_12750 951 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3034 1754 gene locus_tag LOCUS_12760 3034 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence0478 1187 975 gene locus_tag LOCUS_12770 1187 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1436 1245 gene locus_tag LOCUS_12780 1436 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1982 1743 gene locus_tag LOCUS_12790 1982 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0479 <1 851 gene locus_tag LOCUS_12800 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031646.1:SDR family oxidoreductase 873 1364 gene locus_tag LOCUS_12810 873 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0480 >Feature sequence0481 >Feature sequence0482 >Feature sequence0483 >Feature sequence0484 3101 234 gene locus_tag LOCUS_12820 3101 234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039200.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence0485 150 1028 gene locus_tag LOCUS_12830 150 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_12830 1084 1641 gene locus_tag LOCUS_12840 1084 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1709 2746 gene locus_tag LOCUS_12850 gene pyrC 1709 2746 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0486 49 1308 gene locus_tag LOCUS_12860 49 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence0487 1822 2334 gene locus_tag LOCUS_12870 1822 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12870 2316 2954 gene locus_tag LOCUS_12880 2316 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0488 186 653 gene locus_tag LOCUS_12890 186 653 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_12890 684 2855 gene locus_tag LOCUS_12900 684 2855 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence0489 1333 536 gene locus_tag LOCUS_12910 1333 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2136 1330 gene locus_tag LOCUS_12920 2136 1330 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_12920 3057 2227 gene locus_tag LOCUS_12930 3057 2227 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0490 <1 515 gene locus_tag LOCUS_12940 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552205.1:cysteine desulfurase family protein 625 1389 gene locus_tag LOCUS_12950 625 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2387 1386 gene locus_tag LOCUS_12960 2387 1386 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_12960 <3093 2384 gene locus_tag LOCUS_12970 <3093 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence0491 290 1573 gene locus_tag LOCUS_12980 gene serS 290 1573 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393416.1 protein_id gnl|my_center|LOCUS_12980 1799 2032 gene locus_tag LOCUS_12990 1799 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2800 3090 gene locus_tag LOCUS_13000 2800 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence0492 <1 1215 gene locus_tag LOCUS_13010 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000846383.1:DUF2779 domain-containing protein 1212 2474 gene locus_tag LOCUS_13020 1212 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence0493 337 777 gene locus_tag LOCUS_13030 337 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 985 1329 gene locus_tag LOCUS_13040 985 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2381 1962 gene locus_tag LOCUS_13050 2381 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2648 2881 gene locus_tag LOCUS_13060 2648 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence0494 808 1854 gene locus_tag LOCUS_13070 808 1854 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969998.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence0495 212 1276 gene locus_tag LOCUS_13080 gene rfbB 212 1276 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_13080 1261 2163 gene locus_tag LOCUS_13090 gene rfbD 1261 2163 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_13090 2114 2737 gene locus_tag LOCUS_13100 2114 2737 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence0496 1328 1050 gene locus_tag LOCUS_13110 1328 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0497 2105 2713 gene locus_tag LOCUS_13120 2105 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence0498 >Feature sequence0499 346 1218 gene locus_tag LOCUS_13130 346 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1821 1273 gene locus_tag LOCUS_13140 1821 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2552 1920 gene locus_tag LOCUS_13150 2552 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0500 <1 2466 gene locus_tag LOCUS_13160 <1 2466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970349.1:formate dehydrogenase subunit alpha 2484 2675 gene locus_tag LOCUS_13170 2484 2675 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970348.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence0501 >Feature sequence0502 570 1568 gene locus_tag LOCUS_13180 570 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13180 <3072 2091 gene locus_tag LOCUS_13190 <3072 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141391.1:RNA-binding protein >Feature sequence0503 299 84 gene locus_tag LOCUS_13200 299 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2014 500 gene locus_tag LOCUS_13210 2014 500 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_13210 2971 2210 gene locus_tag LOCUS_13220 2971 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence0504 2989 1820 gene locus_tag LOCUS_13230 2989 1820 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0505 1213 995 gene locus_tag LOCUS_13240 1213 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1424 1681 gene locus_tag LOCUS_13250 1424 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1881 1660 gene locus_tag LOCUS_13260 1881 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2213 2407 gene locus_tag LOCUS_13270 2213 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence0506 783 82 gene locus_tag LOCUS_13280 783 82 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_13280 1517 765 gene locus_tag LOCUS_13290 gene surE 1517 765 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_13290 2128 1616 gene locus_tag LOCUS_13300 2128 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 <3066 2331 gene locus_tag LOCUS_13310 <3066 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074057.1:glutamate--ammonia ligase >Feature sequence0507 864 244 gene locus_tag LOCUS_13320 gene nthA 864 244 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_13320 1969 1199 gene locus_tag LOCUS_13330 1969 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2077 2286 gene locus_tag LOCUS_13340 2077 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence0508 1756 266 gene locus_tag LOCUS_13350 1756 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0509 296 2254 gene locus_tag LOCUS_13360 296 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2285 2785 gene locus_tag LOCUS_13370 2285 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0510 1317 214 gene locus_tag LOCUS_13380 1317 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2579 1719 gene locus_tag LOCUS_13390 2579 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0511 54 1040 gene locus_tag LOCUS_13400 gene bfmBAB 54 1040 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_13400 1314 1967 gene locus_tag LOCUS_13410 1314 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence0512 440 1336 gene locus_tag LOCUS_13420 gene galU 440 1336 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_13420 1404 1736 gene locus_tag LOCUS_13430 1404 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1736 2242 gene locus_tag LOCUS_13440 1736 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0513 1921 458 gene locus_tag LOCUS_13450 1921 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence0514 2088 151 gene locus_tag LOCUS_13460 2088 151 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_13460 <3056 2085 gene locus_tag LOCUS_13470 <3056 2085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538232.1:DUF3363 domain-containing protein >Feature sequence0515 477 2708 gene locus_tag LOCUS_13480 477 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2695 2955 gene locus_tag LOCUS_13490 2695 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0516 587 1282 gene locus_tag LOCUS_13500 587 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1677 1408 gene locus_tag LOCUS_13510 1677 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2866 1823 gene locus_tag LOCUS_13520 2866 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0517 549 1307 gene locus_tag LOCUS_13530 549 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1526 1314 gene locus_tag LOCUS_13540 1526 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1904 1557 gene locus_tag LOCUS_13550 1904 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2241 2648 gene locus_tag LOCUS_13560 2241 2648 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0518 <1 966 gene locus_tag LOCUS_13570 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257848.1:NADH-quinone oxidoreductase subunit L 963 2531 gene locus_tag LOCUS_13580 963 2531 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0519 <1 682 gene locus_tag LOCUS_13590 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229622.1:aldo/keto reductase 795 2312 gene locus_tag LOCUS_13600 795 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0520 511 840 gene locus_tag LOCUS_13610 511 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 892 2424 gene locus_tag LOCUS_13620 gene gltX 892 2424 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence0521 1879 1091 gene locus_tag LOCUS_13630 1879 1091 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_13630 <3048 1880 gene locus_tag LOCUS_13640 <3048 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257750.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence0522 <1 953 gene locus_tag LOCUS_13650 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036452.1:TonB-dependent receptor 1530 2678 gene locus_tag LOCUS_13660 1530 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence0523 851 1483 gene locus_tag LOCUS_13670 851 1483 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_13670 2948 1509 gene locus_tag LOCUS_13680 gene gatA 2948 1509 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0524 855 130 gene locus_tag LOCUS_13690 855 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1111 836 gene locus_tag LOCUS_13700 1111 836 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_13700 2156 1314 gene locus_tag LOCUS_13710 gene trmD 2156 1314 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_13710 2794 2165 gene locus_tag LOCUS_13720 gene rimM 2794 2165 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056908.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence0525 2410 1544 gene locus_tag LOCUS_13730 2410 1544 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_13730 2506 2835 gene locus_tag LOCUS_13740 2506 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0526 766 446 gene locus_tag LOCUS_13750 766 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1638 763 gene locus_tag LOCUS_13760 1638 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence0527 71 952 gene locus_tag LOCUS_13770 71 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 952 1311 gene locus_tag LOCUS_13780 952 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2131 1322 gene locus_tag LOCUS_13790 2131 1322 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586552.1 protein_id gnl|my_center|LOCUS_13790 3025 2135 gene locus_tag LOCUS_13800 3025 2135 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0528 2080 854 gene locus_tag LOCUS_13810 2080 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2463 2077 gene locus_tag LOCUS_13820 2463 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2671 2483 gene locus_tag LOCUS_13830 2671 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3000 2668 gene locus_tag LOCUS_13840 3000 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence0529 1453 137 gene locus_tag LOCUS_13850 1453 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1963 1685 gene locus_tag LOCUS_13860 1963 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2679 2026 gene locus_tag LOCUS_13870 2679 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2978 2805 gene locus_tag LOCUS_13880 2978 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence0530 425 1039 gene locus_tag LOCUS_13890 425 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1036 1548 gene locus_tag LOCUS_13900 1036 1548 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401913.1 protein_id gnl|my_center|LOCUS_13900 1846 1652 gene locus_tag LOCUS_13910 1846 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1937 2317 gene locus_tag LOCUS_13920 1937 2317 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525071.1 protein_id gnl|my_center|LOCUS_13920 2470 2763 gene locus_tag LOCUS_13930 2470 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0531 881 228 gene locus_tag LOCUS_13940 881 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2570 900 gene locus_tag LOCUS_13950 gene merA 2570 900 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_13950 2816 2989 gene locus_tag LOCUS_13960 2816 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0532 2854 2027 gene locus_tag LOCUS_13970 2854 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0533 1032 301 gene locus_tag LOCUS_13980 1032 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1395 1249 gene locus_tag LOCUS_13990 1395 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2388 1414 gene locus_tag LOCUS_14000 gene secF 2388 1414 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence0534 <1 1175 gene locus_tag LOCUS_14010 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000925616.1:glycoside hydrolase family 9 protein >Feature sequence0535 >Feature sequence0536 <1 1095 gene locus_tag LOCUS_14020 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776163.1:FtsK/SpoIIIE domain-containing protein 1632 2954 gene locus_tag LOCUS_14030 1632 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0537 >Feature sequence0538 1761 424 gene locus_tag LOCUS_14040 1761 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2819 1968 gene locus_tag LOCUS_14050 gene cpaB 2819 1968 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence0539 4 180 gene locus_tag LOCUS_14060 4 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 192 1829 gene locus_tag LOCUS_14070 192 1829 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_14070 1838 2743 gene locus_tag LOCUS_14080 1838 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0540 284 922 gene locus_tag LOCUS_14090 284 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1634 924 gene locus_tag LOCUS_14100 1634 924 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_14100 <3029 1642 gene locus_tag LOCUS_14110 <3029 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933145.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase >Feature sequence0541 1789 845 gene locus_tag LOCUS_14120 1789 845 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088748.1 protein_id gnl|my_center|LOCUS_14120 2637 1792 gene locus_tag LOCUS_14130 2637 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2948 2634 gene locus_tag LOCUS_14140 2948 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0542 <1 940 gene locus_tag LOCUS_14150 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414924.1:permease 1061 1993 gene locus_tag LOCUS_14160 1061 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2071 2709 gene locus_tag LOCUS_14170 2071 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence0543 <1 724 gene locus_tag LOCUS_14180 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291837.1:NADP-dependent isocitrate dehydrogenase 1185 2507 gene locus_tag LOCUS_14190 gene bioA 1185 2507 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210761.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence0544 2005 893 gene locus_tag LOCUS_14200 2005 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 2076 2333 gene locus_tag LOCUS_14210 2076 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence0545 >Feature sequence0546 <1 1086 gene locus_tag LOCUS_14220 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202820.1:FAD-dependent oxidoreductase 1077 1274 gene locus_tag LOCUS_14230 1077 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1281 2099 gene locus_tag LOCUS_14240 1281 2099 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221723.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence0547 >Feature sequence0548 100 1194 gene locus_tag LOCUS_14250 100 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1318 1106 gene locus_tag LOCUS_14260 1318 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1396 1575 gene locus_tag LOCUS_14270 1396 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1986 2909 gene locus_tag LOCUS_14280 1986 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence0549 <1 807 gene locus_tag LOCUS_14290 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251054.1:deoxyribose-phosphate aldolase 887 2845 gene locus_tag LOCUS_14300 887 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0550 1034 354 gene locus_tag LOCUS_14310 1034 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1452 1171 gene locus_tag LOCUS_14320 1452 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2816 1605 gene locus_tag LOCUS_14330 2816 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence0551 >Feature sequence0552 122 1009 gene locus_tag LOCUS_14340 122 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 <3020 1087 gene locus_tag LOCUS_14350 <3020 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:PAS domain S-box protein >Feature sequence0553 2 2026 gene locus_tag LOCUS_14360 2 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 2026 2349 gene locus_tag LOCUS_14370 2026 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2699 2292 gene locus_tag LOCUS_14380 2699 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence0554 1783 536 gene locus_tag LOCUS_14390 1783 536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_14390 <3018 1967 gene locus_tag LOCUS_14400 <3018 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545399.1:ABC transporter permease >Feature sequence0555 >Feature sequence0556 649 828 gene locus_tag LOCUS_14410 649 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 821 2176 gene locus_tag LOCUS_14420 gene dnaA 821 2176 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0557 107 349 gene locus_tag LOCUS_14430 107 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1794 328 gene locus_tag LOCUS_14440 1794 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3014 1794 gene locus_tag LOCUS_14450 3014 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence0558 2143 1016 gene locus_tag LOCUS_14460 2143 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2488 2147 gene locus_tag LOCUS_14470 2488 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 <3013 2485 gene locus_tag LOCUS_14480 <3013 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393900.1:thioether cross-link-forming SCIFF peptide maturase >Feature sequence0559 111 347 gene locus_tag LOCUS_14490 111 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence0560 366 103 gene locus_tag LOCUS_14500 366 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 636 794 gene locus_tag LOCUS_14510 636 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1145 1531 gene locus_tag LOCUS_14520 1145 1531 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080932.1 protein_id gnl|my_center|LOCUS_14520 1528 2481 gene locus_tag LOCUS_14530 1528 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence0561 <1 557 gene locus_tag LOCUS_14540 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102358.1:xanthine dehydrogenase family protein subunit M 548 1411 gene locus_tag LOCUS_14550 548 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1401 1841 gene locus_tag LOCUS_14560 1401 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1868 2233 gene locus_tag LOCUS_14570 gene nifU 1868 2233 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022677.1 protein_id gnl|my_center|LOCUS_14570 2910 2230 gene locus_tag LOCUS_14580 2910 2230 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence0562 1423 1187 gene locus_tag LOCUS_14590 1423 1187 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_14590 1834 1445 gene locus_tag LOCUS_14600 1834 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence0563 <1 613 gene locus_tag LOCUS_14610 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256521.1:cytochrome c 717 2057 gene locus_tag LOCUS_14620 717 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_14620 2047 2778 gene locus_tag LOCUS_14630 2047 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0564 1624 749 gene locus_tag LOCUS_14640 1624 749 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_14640 2695 1625 gene locus_tag LOCUS_14650 gene trpS 2695 1625 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence0565 <1 887 gene locus_tag LOCUS_14660 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112411.1:sulfotransferase family protein 1409 987 gene locus_tag LOCUS_14670 1409 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2039 1443 gene locus_tag LOCUS_14680 gene wcaF 2039 1443 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153560.1 protein_id gnl|my_center|LOCUS_14680 2973 2029 gene locus_tag LOCUS_14690 2973 2029 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence0566 2595 1231 gene locus_tag LOCUS_14700 2595 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence0567 >Feature sequence0568 226 1050 gene locus_tag LOCUS_14710 226 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1054 1596 gene locus_tag LOCUS_14720 1054 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1599 2105 gene locus_tag LOCUS_14730 1599 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2234 2443 gene locus_tag LOCUS_14740 2234 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence0569 <1 855 gene locus_tag LOCUS_14750 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244177.1:MFS transporter 1692 1114 gene locus_tag LOCUS_14760 1692 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2559 1795 gene locus_tag LOCUS_14770 2559 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2512 2727 gene locus_tag LOCUS_14780 2512 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence0570 195 647 gene locus_tag LOCUS_14790 195 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2554 1133 gene locus_tag LOCUS_14800 2554 1133 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence0571 339 1046 gene locus_tag LOCUS_14810 gene rplA 339 1046 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870242.1 protein_id gnl|my_center|LOCUS_14810 1174 1713 gene locus_tag LOCUS_14820 gene rplJ 1174 1713 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_14820 1825 2202 gene locus_tag LOCUS_14830 gene rplL 1825 2202 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536194.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence0572 626 1273 gene locus_tag LOCUS_14840 626 1273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_14840 1385 2779 gene locus_tag LOCUS_14850 1385 2779 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393971.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0573 442 1458 gene locus_tag LOCUS_14860 442 1458 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_14860 2356 2003 gene locus_tag LOCUS_14870 2356 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2486 2262 gene locus_tag LOCUS_14880 2486 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence0574 1516 449 gene locus_tag LOCUS_14890 gene waaC 1516 449 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_14890 2160 1513 gene locus_tag LOCUS_14900 2160 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14900 2629 2201 gene locus_tag LOCUS_14910 2629 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14910 >Feature sequence0575 1012 1965 gene locus_tag LOCUS_14920 1012 1965 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0576 2867 1245 gene locus_tag LOCUS_14930 2867 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0577 403 1326 gene locus_tag LOCUS_14940 403 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1868 1464 gene locus_tag LOCUS_14950 1868 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2809 2015 gene locus_tag LOCUS_14960 gene fabG 2809 2015 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0578 383 769 gene locus_tag LOCUS_14970 gene cueR 383 769 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_14970 827 1456 gene locus_tag LOCUS_14980 827 1456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_14980 2285 1989 gene locus_tag LOCUS_14990 2285 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2700 2311 gene locus_tag LOCUS_15000 2700 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence0579 <1 1724 gene locus_tag LOCUS_15010 <1 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932832.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence0580 <1 738 gene locus_tag LOCUS_15020 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103411.1:glycosyltransferase >Feature sequence0581 1187 468 gene locus_tag LOCUS_15030 1187 468 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_15030 1429 1833 gene locus_tag LOCUS_15040 gene mscL 1429 1833 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence0582 >Feature sequence0583 1833 1633 gene locus_tag LOCUS_15050 1833 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2276 2073 gene locus_tag LOCUS_15060 2276 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2662 2273 gene locus_tag LOCUS_15070 2662 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15070 >Feature sequence0584 >Feature sequence0585 1335 2528 gene locus_tag LOCUS_15080 1335 2528 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0586 329 1027 gene locus_tag LOCUS_15090 329 1027 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971974.1 protein_id gnl|my_center|LOCUS_15090 1155 2408 gene locus_tag LOCUS_15100 1155 2408 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803724.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence0587 2753 1230 gene locus_tag LOCUS_15110 2753 1230 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0588 119 44 gene locus_tag LOCUS_t00120 119 44 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 643 251 gene locus_tag LOCUS_15120 643 251 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_15120 1853 648 gene locus_tag LOCUS_15130 1853 648 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence0589 <2981 771 gene locus_tag LOCUS_15140 <2981 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence0590 578 177 gene locus_tag LOCUS_15150 578 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1283 741 gene locus_tag LOCUS_15160 1283 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence0591 2850 1258 gene locus_tag LOCUS_15170 gene der 2850 1258 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence0592 98 355 gene locus_tag LOCUS_15180 98 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 359 2128 gene locus_tag LOCUS_15190 359 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2169 2888 gene locus_tag LOCUS_15200 2169 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0593 2626 479 gene locus_tag LOCUS_15210 2626 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2817 2662 gene locus_tag LOCUS_15220 2817 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence0594 420 1439 gene locus_tag LOCUS_15230 420 1439 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146738.1 protein_id gnl|my_center|LOCUS_15230 2315 2239 gene locus_tag LOCUS_t00130 2315 2239 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2434 2359 gene locus_tag LOCUS_t00140 2434 2359 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2630 2557 gene locus_tag LOCUS_t00150 2630 2557 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2801 2724 gene locus_tag LOCUS_t00160 2801 2724 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0595 191 6 gene locus_tag LOCUS_15240 191 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 739 188 gene locus_tag LOCUS_15250 739 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 <2971 1072 gene locus_tag LOCUS_15260 <2971 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884100.1:KAP family P-loop domain protein >Feature sequence0596 224 910 gene locus_tag LOCUS_15270 224 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15270 1640 948 gene locus_tag LOCUS_15280 1640 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2083 1628 gene locus_tag LOCUS_15290 2083 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence0597 1661 513 gene locus_tag LOCUS_15300 1661 513 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_15300 2350 1673 gene locus_tag LOCUS_15310 gene flgH 2350 1673 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037111.1 protein_id gnl|my_center|LOCUS_15310 <2970 2362 gene locus_tag LOCUS_15320 <2970 2362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082164.1:flagellar basal-body rod protein FlgG >Feature sequence0598 <1 2536 gene locus_tag LOCUS_15330 <1 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120599.1:FG-GAP-like repeat-containing protein 2533 2970 gene locus_tag LOCUS_15340 2533 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0599 338 580 gene locus_tag LOCUS_15350 338 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 580 2136 gene locus_tag LOCUS_15360 580 2136 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_15360 2434 2610 gene locus_tag LOCUS_15370 2434 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0600 392 2092 gene locus_tag LOCUS_15380 392 2092 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence0601 569 2782 gene locus_tag LOCUS_15390 569 2782 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence0602 573 382 gene locus_tag LOCUS_15400 573 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 837 1094 gene locus_tag LOCUS_15410 837 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15410 1261 2151 gene locus_tag LOCUS_15420 1261 2151 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_15420 <2958 2260 gene locus_tag LOCUS_15430 <2958 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205295.1:acid phosphatase >Feature sequence0603 <1 1220 gene locus_tag LOCUS_15440 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257638.1:aldehyde dehydrogenase family protein 1840 1265 gene locus_tag LOCUS_15450 1840 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 <2958 1858 gene locus_tag LOCUS_15460 <2958 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922252.1:sialate O-acetylesterase >Feature sequence0604 1248 1730 gene locus_tag LOCUS_15470 1248 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0605 117 635 gene locus_tag LOCUS_15480 117 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1071 2096 gene locus_tag LOCUS_15490 1071 2096 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_15490 2108 2692 gene locus_tag LOCUS_15500 2108 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0606 525 707 gene locus_tag LOCUS_15510 525 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 697 2781 gene locus_tag LOCUS_15520 697 2781 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173640842.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence0607 <1 934 gene locus_tag LOCUS_15530 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294683.1:CpaF family protein 946 1917 gene locus_tag LOCUS_15540 946 1917 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939400.1 protein_id gnl|my_center|LOCUS_15540 1938 2852 gene locus_tag LOCUS_15550 1938 2852 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335393.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence0608 1089 838 gene locus_tag LOCUS_15560 1089 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1324 2127 gene locus_tag LOCUS_15570 1324 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15570 >Feature sequence0609 1470 1234 gene locus_tag LOCUS_15580 1470 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2116 1709 gene locus_tag LOCUS_15590 2116 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 2379 2113 gene locus_tag LOCUS_15600 2379 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence0610 2399 1662 gene locus_tag LOCUS_15610 2399 1662 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_15610 2394 2699 gene locus_tag LOCUS_15620 2394 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence0611 <1 1068 gene locus_tag LOCUS_15630 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114106.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 1939 1139 gene locus_tag LOCUS_15640 1939 1139 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_15640 <2944 1926 gene locus_tag LOCUS_15650 <2944 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730921.1:NAD(P)-dependent oxidoreductase >Feature sequence0612 1068 2147 gene locus_tag LOCUS_15660 1068 2147 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence0613 846 1709 gene locus_tag LOCUS_15670 846 1709 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_15670 1706 2446 gene locus_tag LOCUS_15680 gene udk 1706 2446 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0614 879 1073 gene locus_tag LOCUS_15690 879 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1089 1481 gene locus_tag LOCUS_15700 1089 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2941 1571 gene locus_tag LOCUS_15710 2941 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence0615 2084 654 gene locus_tag LOCUS_15720 2084 654 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_15720 2083 2349 gene locus_tag LOCUS_15730 2083 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0616 <1 1237 gene locus_tag LOCUS_15740 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339081.1:FAD-binding protein 1234 1743 gene locus_tag LOCUS_15750 1234 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1768 2217 gene locus_tag LOCUS_15760 1768 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence0617 2269 128 gene locus_tag LOCUS_15770 2269 128 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence0618 625 1233 gene locus_tag LOCUS_15780 625 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1264 2412 gene locus_tag LOCUS_15790 1264 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0619 810 1397 gene locus_tag LOCUS_15800 810 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1394 1888 gene locus_tag LOCUS_15810 1394 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0620 963 25 gene locus_tag LOCUS_15820 gene czcD 963 25 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 protein_id gnl|my_center|LOCUS_15820 2259 1018 gene locus_tag LOCUS_15830 2259 1018 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0621 2852 1629 gene locus_tag LOCUS_15840 2852 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence0622 1190 1345 gene locus_tag LOCUS_15850 1190 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2320 1550 gene locus_tag LOCUS_15860 2320 1550 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941251.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence0623 1194 97 gene locus_tag LOCUS_15870 1194 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1521 2507 gene locus_tag LOCUS_15880 1521 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0624 <1 1027 gene locus_tag LOCUS_15890 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256733.1:glutamine synthetase family protein 1077 1229 gene locus_tag LOCUS_15900 1077 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0625 853 365 gene locus_tag LOCUS_15910 gene ybeY 853 365 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965162.1 protein_id gnl|my_center|LOCUS_15910 1998 937 gene locus_tag LOCUS_15920 1998 937 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence0626 2517 1525 gene locus_tag LOCUS_15930 2517 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence0627 884 279 gene locus_tag LOCUS_15940 gene metW 884 279 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_15940 2032 881 gene locus_tag LOCUS_15950 2032 881 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114709.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence0628 2168 2028 gene locus_tag LOCUS_15960 2168 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0629 1642 1821 gene locus_tag LOCUS_15970 1642 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence0630 278 865 gene locus_tag LOCUS_15980 gene ruvA 278 865 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_15980 <2934 919 gene locus_tag LOCUS_15990 <2934 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112799.1:cyclic di-GMP receptor MorA >Feature sequence0631 659 1084 gene locus_tag LOCUS_16000 659 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1085 1480 gene locus_tag LOCUS_16010 1085 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1650 2285 gene locus_tag LOCUS_16020 1650 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 <2934 2348 gene locus_tag LOCUS_16030 <2934 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387760.1:dTDP-4-dehydrorhamnose reductase >Feature sequence0632 <1 750 gene locus_tag LOCUS_16040 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114406.1:class I SAM-dependent DNA methyltransferase 747 2573 gene locus_tag LOCUS_16050 747 2573 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209314.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence0633 1549 161 gene locus_tag LOCUS_16060 1549 161 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_16060 <2933 1602 gene locus_tag LOCUS_16070 <2933 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389900.1:glycogen synthase GlgA >Feature sequence0634 805 1608 gene locus_tag LOCUS_16080 gene otsB 805 1608 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869049.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence0635 535 1308 gene locus_tag LOCUS_16090 gene fabG 535 1308 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_16090 1332 2105 gene locus_tag LOCUS_16100 1332 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2233 2721 gene locus_tag LOCUS_16110 gene fabZ 2233 2721 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence0636 >Feature sequence0637 1397 108 gene locus_tag LOCUS_16120 1397 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <2930 1421 gene locus_tag LOCUS_16130 <2930 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073369.1:M28 family metallopeptidase >Feature sequence0638 328 1233 gene locus_tag LOCUS_16140 328 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0639 893 24 gene locus_tag LOCUS_16150 893 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1178 897 gene locus_tag LOCUS_16160 1178 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1294 1446 gene locus_tag LOCUS_16170 1294 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2262 1597 gene locus_tag LOCUS_16180 2262 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2893 2345 gene locus_tag LOCUS_16190 2893 2345 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977628.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0640 1020 382 gene locus_tag LOCUS_16200 1020 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1418 1053 gene locus_tag LOCUS_16210 gene ndhC 1418 1053 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence0641 422 1540 gene locus_tag LOCUS_16220 gene asd 422 1540 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092012.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0642 331 74 gene locus_tag LOCUS_16230 331 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1687 596 gene locus_tag LOCUS_16240 1687 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2254 2117 gene locus_tag LOCUS_16250 2254 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0643 847 2343 gene locus_tag LOCUS_16260 847 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_16260 2451 2615 gene locus_tag LOCUS_16270 2451 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0644 945 1994 gene locus_tag LOCUS_16280 945 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence0645 <1 1409 gene locus_tag LOCUS_16290 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150670707.1:DUF4011 domain-containing protein >Feature sequence0646 533 829 gene locus_tag LOCUS_16300 533 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 826 1533 gene locus_tag LOCUS_16310 gene fliP 826 1533 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_16310 1601 1870 gene locus_tag LOCUS_16320 1601 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1883 2779 gene locus_tag LOCUS_16330 1883 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence0647 720 205 gene locus_tag LOCUS_16340 720 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2786 723 gene locus_tag LOCUS_16350 2786 723 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence0648 <1 671 gene locus_tag LOCUS_16360 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258390.1:S41 family peptidase 1232 1369 gene locus_tag LOCUS_16370 1232 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1522 2514 gene locus_tag LOCUS_16380 1522 2514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence0649 2778 925 gene locus_tag LOCUS_16390 2778 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence0650 429 617 gene locus_tag LOCUS_16400 429 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 614 1384 gene locus_tag LOCUS_16410 gene soj 614 1384 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_16410 1371 1721 gene locus_tag LOCUS_16420 1371 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0651 <1 1032 gene locus_tag LOCUS_16430 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065752.1:chloride channel protein 1097 1897 gene locus_tag LOCUS_16440 1097 1897 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0652 20 184 gene locus_tag LOCUS_16450 20 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 280 669 gene locus_tag LOCUS_16460 280 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 951 817 gene locus_tag LOCUS_16470 951 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2743 1097 gene locus_tag LOCUS_16480 2743 1097 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence0653 2410 752 gene locus_tag LOCUS_16490 gene nusA 2410 752 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0654 >Feature sequence0655 2650 2408 gene locus_tag LOCUS_16500 2650 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence0656 355 576 gene locus_tag LOCUS_16510 355 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 670 2856 gene locus_tag LOCUS_16520 670 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0657 1337 864 gene locus_tag LOCUS_16530 1337 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2293 1586 gene locus_tag LOCUS_16540 2293 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 <2910 2286 gene locus_tag LOCUS_16550 <2910 2286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903162.1:ABC transporter permease >Feature sequence0658 804 310 gene locus_tag LOCUS_16560 804 310 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170040.1 protein_id gnl|my_center|LOCUS_16560 <2910 2091 gene locus_tag LOCUS_16570 <2910 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016558605.1:GntR family transcriptional regulator >Feature sequence0659 1216 89 gene locus_tag LOCUS_16580 1216 89 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640615.1 protein_id gnl|my_center|LOCUS_16580 1451 1942 gene locus_tag LOCUS_16590 1451 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence0660 >Feature sequence0661 799 1923 gene locus_tag LOCUS_16600 799 1923 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223900.1 protein_id gnl|my_center|LOCUS_16600 1946 2212 gene locus_tag LOCUS_16610 1946 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence0662 324 236 gene locus_tag LOCUS_t00170 324 236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1353 403 gene locus_tag LOCUS_16620 gene secF 1353 403 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_16620 <2903 1361 gene locus_tag LOCUS_16630 <2903 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482962.1:protein translocase subunit SecD >Feature sequence0663 1192 113 gene locus_tag LOCUS_16640 gene rfbB 1192 113 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186461.1 protein_id gnl|my_center|LOCUS_16640 2250 1408 gene locus_tag LOCUS_16650 2250 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence0664 1398 1550 gene locus_tag LOCUS_16660 1398 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0665 70 831 gene locus_tag LOCUS_16670 70 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1019 2083 gene locus_tag LOCUS_16680 gene asd 1019 2083 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496420.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0666 759 1169 gene locus_tag LOCUS_16690 759 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1233 2387 gene locus_tag LOCUS_16700 gene tgt 1233 2387 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence0667 1766 1251 gene locus_tag LOCUS_16710 1766 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2092 1844 gene locus_tag LOCUS_16720 2092 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0668 732 1718 gene locus_tag LOCUS_16730 732 1718 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403152.1 protein_id gnl|my_center|LOCUS_16730 2837 1722 gene locus_tag LOCUS_16740 2837 1722 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence0669 835 641 gene locus_tag LOCUS_16750 835 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2512 893 gene locus_tag LOCUS_16760 2512 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence0670 1282 278 gene locus_tag LOCUS_16770 1282 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 <2898 1772 gene locus_tag LOCUS_16780 <2898 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000193219.1:mercury(II) reductase >Feature sequence0671 1835 2677 gene locus_tag LOCUS_16790 1835 2677 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence0672 505 1656 gene locus_tag LOCUS_16800 505 1656 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856704.1 protein_id gnl|my_center|LOCUS_16800 1653 2465 gene locus_tag LOCUS_16810 1653 2465 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228703.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence0673 723 977 gene locus_tag LOCUS_16820 723 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1598 2275 gene locus_tag LOCUS_16830 1598 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0674 75 401 gene locus_tag LOCUS_16840 75 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 701 874 gene locus_tag LOCUS_16850 701 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 888 1295 gene locus_tag LOCUS_16860 888 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1402 2664 gene locus_tag LOCUS_16870 1402 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence0675 <1 702 gene locus_tag LOCUS_16880 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022106.1:restriction endonuclease subunit S 699 2489 gene locus_tag LOCUS_16890 699 2489 CDS product restriction system-associated AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123252.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence0676 1594 2307 gene locus_tag LOCUS_16900 1594 2307 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_16900 2475 2367 gene locus_tag LOCUS_r00020 2475 2367 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence0677 1360 215 gene locus_tag LOCUS_16910 1360 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <2883 1547 gene locus_tag LOCUS_16920 <2883 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057023.1:M3 family metallopeptidase >Feature sequence0678 <1 552 gene locus_tag LOCUS_16930 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640051.1:aromatic ring-hydroxylating dioxygenase subunit alpha <2883 565 gene locus_tag LOCUS_16940 <2883 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257049.1:DUF3536 domain-containing protein >Feature sequence0679 1441 494 gene locus_tag LOCUS_16950 gene cyoE 1441 494 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence0680 1333 932 gene locus_tag LOCUS_16960 1333 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1218 2408 gene locus_tag LOCUS_16970 1218 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2716 2495 gene locus_tag LOCUS_16980 2716 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence0681 2641 1085 gene locus_tag LOCUS_16990 2641 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence0682 1642 626 gene locus_tag LOCUS_17000 1642 626 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_17000 <2881 1639 gene locus_tag LOCUS_17010 <2881 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0683 1816 2829 gene locus_tag LOCUS_17020 1816 2829 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939915.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0684 1246 707 gene locus_tag LOCUS_17030 1246 707 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391876.1 protein_id gnl|my_center|LOCUS_17030 1645 1460 gene locus_tag LOCUS_17040 1645 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0685 352 1767 gene locus_tag LOCUS_17050 352 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1780 2205 gene locus_tag LOCUS_17060 gene queD 1780 2205 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_17060 2497 2769 gene locus_tag LOCUS_17070 2497 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0686 193 1023 gene locus_tag LOCUS_17080 193 1023 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_17080 1032 1730 gene locus_tag LOCUS_17090 1032 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence0687 2311 1199 gene locus_tag LOCUS_17100 2311 1199 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_17100 <2877 2329 gene locus_tag LOCUS_17110 <2877 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791295.1:glucoamylase family protein >Feature sequence0688 1476 970 gene locus_tag LOCUS_17120 1476 970 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089471.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence0689 <1 1318 gene locus_tag LOCUS_17130 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036209.1:DUF3488 and transglutaminase-like domain-containing protein <2874 1332 gene locus_tag LOCUS_17140 <2874 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938960.1:ABC transporter transmembrane domain-containing protein >Feature sequence0690 2368 1370 gene locus_tag LOCUS_17150 2368 1370 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0691 435 1358 gene locus_tag LOCUS_17160 435 1358 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222376.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence0692 239 2167 gene locus_tag LOCUS_17170 239 2167 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021808.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence0693 2066 597 gene locus_tag LOCUS_17180 2066 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2455 2063 gene locus_tag LOCUS_17190 2455 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence0694 <1 708 gene locus_tag LOCUS_17200 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000521262.1:uroporphyrinogen-III C-methyltransferase 705 968 gene locus_tag LOCUS_17210 705 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545371.1 protein_id gnl|my_center|LOCUS_17210 996 2393 gene locus_tag LOCUS_17220 gene cobB 996 2393 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence0695 <1 1155 gene locus_tag LOCUS_17230 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477586.1:tetratricopeptide repeat protein note possible pseudo, internal stop codon 2787 1366 gene locus_tag LOCUS_17240 2787 1366 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence0696 507 121 gene locus_tag LOCUS_17250 507 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1851 805 gene locus_tag LOCUS_17260 1851 805 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence0697 732 1715 gene locus_tag LOCUS_17270 732 1715 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_17270 1712 2539 gene locus_tag LOCUS_17280 1712 2539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0698 <1 941 gene locus_tag LOCUS_17290 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025269720.1:CocE/NonD family hydrolase 1537 1812 gene locus_tag LOCUS_17300 1537 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2105 2713 gene locus_tag LOCUS_17310 2105 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence0699 443 1081 gene locus_tag LOCUS_17320 443 1081 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_17320 1324 2130 gene locus_tag LOCUS_17330 1324 2130 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_17330 <2861 2158 gene locus_tag LOCUS_17340 <2861 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038530.1:pteridine reductase >Feature sequence0700 231 306 gene locus_tag LOCUS_t00180 231 306 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1380 397 gene locus_tag LOCUS_17350 gene rocF 1380 397 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_17350 2025 1504 gene locus_tag LOCUS_17360 2025 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0701 88 2451 gene locus_tag LOCUS_17370 gene bglX 88 2451 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence0702 1334 351 gene locus_tag LOCUS_17380 1334 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1587 2237 gene locus_tag LOCUS_17390 1587 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2429 2259 gene locus_tag LOCUS_17400 2429 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0703 274 44 gene locus_tag LOCUS_17410 274 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 439 299 gene locus_tag LOCUS_17420 439 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1529 417 gene locus_tag LOCUS_17430 1529 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0704 265 2175 gene locus_tag LOCUS_17440 gene dsbD 265 2175 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_17440 2471 2800 gene locus_tag LOCUS_17450 2471 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence0705 704 1540 gene locus_tag LOCUS_17460 704 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1605 2669 gene locus_tag LOCUS_17470 1605 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0706 >Feature sequence0707 175 1914 gene locus_tag LOCUS_17480 175 1914 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_17480 1911 2633 gene locus_tag LOCUS_17490 1911 2633 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence0708 204 1649 gene locus_tag LOCUS_17500 gene tldD 204 1649 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence0709 2712 646 gene locus_tag LOCUS_17510 gene kdpB 2712 646 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970239.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence0710 1562 525 gene locus_tag LOCUS_17520 gene mtaA 1562 525 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_17520 2164 1583 gene locus_tag LOCUS_17530 2164 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2550 2756 gene locus_tag LOCUS_17540 2550 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence0711 1711 2265 gene locus_tag LOCUS_17550 gene cobU 1711 2265 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215857.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0712 2358 484 gene locus_tag LOCUS_17560 2358 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence0713 610 2055 gene locus_tag LOCUS_17570 610 2055 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence0714 1785 343 gene locus_tag LOCUS_17580 gene nrfD 1785 343 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_17580 <2838 1782 gene locus_tag LOCUS_17590 <2838 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence0715 794 384 gene locus_tag LOCUS_17600 794 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 <2838 894 gene locus_tag LOCUS_17610 <2838 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence0716 471 193 gene locus_tag LOCUS_17620 471 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 547 903 gene locus_tag LOCUS_17630 547 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1343 1020 gene locus_tag LOCUS_17640 1343 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2250 1336 gene locus_tag LOCUS_17650 2250 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2613 2377 gene locus_tag LOCUS_17660 2613 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0717 44 1183 gene locus_tag LOCUS_17670 44 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1553 1338 gene locus_tag LOCUS_17680 1553 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1745 1990 gene locus_tag LOCUS_17690 1745 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1994 2377 gene locus_tag LOCUS_17700 1994 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2382 2690 gene locus_tag LOCUS_17710 2382 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0718 1407 859 gene locus_tag LOCUS_17720 1407 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0719 1511 228 gene locus_tag LOCUS_17730 1511 228 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_17730 1712 1536 gene locus_tag LOCUS_17740 1712 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1780 2718 gene locus_tag LOCUS_17750 1780 2718 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0720 348 1355 gene locus_tag LOCUS_17760 348 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1339 2652 gene locus_tag LOCUS_17770 1339 2652 CDS product IS701-like element ISBj9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence0721 <2832 859 gene locus_tag LOCUS_17780 <2832 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA >Feature sequence0722 1394 633 gene locus_tag LOCUS_17790 1394 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2223 1852 gene locus_tag LOCUS_17800 2223 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2104 2442 gene locus_tag LOCUS_17810 2104 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence0723 2046 724 gene locus_tag LOCUS_17820 2046 724 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence0724 1 933 gene locus_tag LOCUS_17830 1 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence0725 786 34 gene locus_tag LOCUS_17840 786 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1278 2252 gene locus_tag LOCUS_17850 1278 2252 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence0726 407 970 gene locus_tag LOCUS_17860 407 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533245.1 protein_id gnl|my_center|LOCUS_17860 1289 936 gene locus_tag LOCUS_17870 1289 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2708 1650 gene locus_tag LOCUS_17880 2708 1650 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence0727 299 970 gene locus_tag LOCUS_17890 299 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0728 <1 638 gene locus_tag LOCUS_17900 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932219.1:7-cyano-7-deazaguanine synthase QueC 910 1998 gene locus_tag LOCUS_17910 910 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0729 1275 124 gene locus_tag LOCUS_17920 1275 124 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174156303.1 protein_id gnl|my_center|LOCUS_17920 1502 1651 gene locus_tag LOCUS_17930 1502 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence0730 1247 648 gene locus_tag LOCUS_17940 1247 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2375 1284 gene locus_tag LOCUS_17950 2375 1284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_17950 2468 2638 gene locus_tag LOCUS_17960 2468 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0731 <1 1541 gene locus_tag LOCUS_17970 <1 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388610.1:asparagine synthetase B >Feature sequence0732 184 930 gene locus_tag LOCUS_17980 184 930 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_17980 1139 1351 gene locus_tag LOCUS_17990 1139 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17990 2605 1418 gene locus_tag LOCUS_18000 2605 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence0733 <1 1565 gene locus_tag LOCUS_18010 <1 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269442.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 2203 1697 gene locus_tag LOCUS_18020 2203 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence0734 <1 551 gene locus_tag LOCUS_18030 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090949.1:ABC transporter ATP-binding protein >Feature sequence0735 <1 1036 gene locus_tag LOCUS_18040 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057204.1:molybdopterin molybdotransferase MoeA 1048 2094 gene locus_tag LOCUS_18050 gene moaA 1048 2094 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence0736 271 2145 gene locus_tag LOCUS_18060 271 2145 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0737 <1 844 gene locus_tag LOCUS_18070 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228551.1:DNA primase 841 1869 gene locus_tag LOCUS_18080 gene xerD 841 1869 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806640.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence0738 2022 382 gene locus_tag LOCUS_18090 2022 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2315 2106 gene locus_tag LOCUS_18100 2315 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence0739 677 297 gene locus_tag LOCUS_18110 677 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 917 2476 gene locus_tag LOCUS_18120 917 2476 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528841.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence0740 <1 936 gene locus_tag LOCUS_18130 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421524.1:amidase 1249 1812 gene locus_tag LOCUS_18140 1249 1812 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618765.1 protein_id gnl|my_center|LOCUS_18140 2049 1822 gene locus_tag LOCUS_18150 2049 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2398 2219 gene locus_tag LOCUS_18160 2398 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0741 460 741 gene locus_tag LOCUS_18170 460 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1395 742 gene locus_tag LOCUS_18180 1395 742 CDS product Eco29kI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689649.1 protein_id gnl|my_center|LOCUS_18180 2612 1392 gene locus_tag LOCUS_18190 gene dcm 2612 1392 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence0742 2002 122 gene locus_tag LOCUS_18200 2002 122 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_18200 2105 2308 gene locus_tag LOCUS_18210 2105 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0743 <1 2576 gene locus_tag LOCUS_18220 <1 2576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000414323.1:glycosyltransferase >Feature sequence0744 1344 37 gene locus_tag LOCUS_18230 1344 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1579 1400 gene locus_tag LOCUS_18240 1579 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence0745 <1 837 gene locus_tag LOCUS_18250 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257202.1:glycosyltransferase family 2 protein 1053 2561 gene locus_tag LOCUS_18260 1053 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2713 2807 gene locus_tag LOCUS_t00190 2713 2807 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0746 224 57 gene locus_tag LOCUS_18270 224 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1451 549 gene locus_tag LOCUS_18280 1451 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18280 1989 1522 gene locus_tag LOCUS_18290 1989 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 protein_id gnl|my_center|LOCUS_18290 2092 2568 gene locus_tag LOCUS_18300 2092 2568 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence0747 146 874 gene locus_tag LOCUS_18310 146 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 937 1323 gene locus_tag LOCUS_18320 937 1323 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_18320 1435 2139 gene locus_tag LOCUS_18330 1435 2139 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0748 133 336 gene locus_tag LOCUS_18340 133 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 592 1920 gene locus_tag LOCUS_18350 592 1920 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_18350 2020 2490 gene locus_tag LOCUS_18360 2020 2490 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_18360 2520 2744 gene locus_tag LOCUS_18370 2520 2744 CDS product DUF4266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072165.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0749 <1 1056 gene locus_tag LOCUS_18380 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089082.1:hydrogenase 4 subunit F 1058 2683 gene locus_tag LOCUS_18390 1058 2683 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393673.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence0750 <2801 2227 gene locus_tag LOCUS_18400 <2801 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877553.1:glycosyltransferase >Feature sequence0751 643 254 gene locus_tag LOCUS_18410 643 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 860 1774 gene locus_tag LOCUS_18420 860 1774 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_18420 <2799 1925 gene locus_tag LOCUS_18430 <2799 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974439.1:glucose 1-dehydrogenase >Feature sequence0752 97 1443 gene locus_tag LOCUS_18440 97 1443 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_18440 1524 2312 gene locus_tag LOCUS_18450 1524 2312 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence0753 1910 441 gene locus_tag LOCUS_18460 gene terL 1910 441 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_18460 2370 1831 gene locus_tag LOCUS_18470 2370 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689093.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence0754 660 415 gene locus_tag LOCUS_18480 660 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 655 1581 gene locus_tag LOCUS_18490 655 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1981 1829 gene locus_tag LOCUS_18500 1981 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2596 2174 gene locus_tag LOCUS_18510 2596 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence0755 104 1459 gene locus_tag LOCUS_18520 104 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1526 2236 gene locus_tag LOCUS_18530 1526 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0756 1749 1045 gene locus_tag LOCUS_18540 1749 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1868 2107 gene locus_tag LOCUS_18550 1868 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 <2795 2091 gene locus_tag LOCUS_18560 <2795 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533028.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence0757 53 1636 gene locus_tag LOCUS_18570 53 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0758 731 1519 gene locus_tag LOCUS_18580 731 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1550 2110 gene locus_tag LOCUS_18590 1550 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18590 2290 2490 gene locus_tag LOCUS_18600 2290 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence0759 2658 1138 gene locus_tag LOCUS_18610 gene pyk 2658 1138 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence0760 <1 1022 gene locus_tag LOCUS_18620 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331373.1:glycosyltransferase 1035 1652 gene locus_tag LOCUS_18630 1035 1652 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_18630 1701 2030 gene locus_tag LOCUS_18640 1701 2030 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809460.1 protein_id gnl|my_center|LOCUS_18640 2791 2129 gene locus_tag LOCUS_18650 2791 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence0761 <1 756 gene locus_tag LOCUS_18660 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049592323.1:IS110 family transposase 794 1912 gene locus_tag LOCUS_18670 gene hypD 794 1912 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence0762 1494 391 gene locus_tag LOCUS_18680 1494 391 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_18680 <2791 1523 gene locus_tag LOCUS_18690 <2791 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082990.1:alpha-N-arabinofuranosidase >Feature sequence0763 35 907 gene locus_tag LOCUS_18700 35 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 904 1935 gene locus_tag LOCUS_18710 904 1935 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_18710 2499 1951 gene locus_tag LOCUS_18720 2499 1951 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0764 344 66 gene locus_tag LOCUS_18730 344 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 699 2111 gene locus_tag LOCUS_18740 gene zwf 699 2111 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_18740 2751 2137 gene locus_tag LOCUS_18750 2751 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence0765 370 1008 gene locus_tag LOCUS_18760 370 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 995 1951 gene locus_tag LOCUS_18770 995 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1948 2139 gene locus_tag LOCUS_18780 1948 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2646 2188 gene locus_tag LOCUS_18790 2646 2188 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence0766 460 215 gene locus_tag LOCUS_18800 gene purS 460 215 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_18800 572 1132 gene locus_tag LOCUS_18810 572 1132 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259161.1 protein_id gnl|my_center|LOCUS_18810 2495 1185 gene locus_tag LOCUS_18820 gene eat 2495 1185 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112038.1 protein_id gnl|my_center|LOCUS_18820 2695 2787 gene locus_tag LOCUS_t00200 2695 2787 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0767 1061 18 gene locus_tag LOCUS_18830 1061 18 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_18830 2272 1058 gene locus_tag LOCUS_18840 gene galK 2272 1058 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence0768 555 794 gene locus_tag LOCUS_18850 555 794 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_18850 820 2082 gene locus_tag LOCUS_18860 gene fabF 820 2082 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388177.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence0769 1201 443 gene locus_tag LOCUS_18870 1201 443 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900356.1 protein_id gnl|my_center|LOCUS_18870 1591 1866 gene locus_tag LOCUS_18880 1591 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence0770 <1 1119 gene locus_tag LOCUS_18890 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014327307.1:bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase 1129 2421 gene locus_tag LOCUS_18900 gene rhaI 1129 2421 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0771 2030 1017 gene locus_tag LOCUS_18910 2030 1017 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970422.1 protein_id gnl|my_center|LOCUS_18910 2710 2027 gene locus_tag LOCUS_18920 2710 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence0772 302 1588 gene locus_tag LOCUS_18930 302 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1591 2718 gene locus_tag LOCUS_18940 1591 2718 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0773 2737 2096 gene locus_tag LOCUS_18950 2737 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence0774 1886 1182 gene locus_tag LOCUS_18960 gene dnr 1886 1182 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence0775 <1 1521 gene locus_tag LOCUS_18970 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase >Feature sequence0776 1 1200 gene locus_tag LOCUS_18980 1 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1239 1943 gene locus_tag LOCUS_18990 1239 1943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0777 101 1204 gene locus_tag LOCUS_19000 101 1204 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531070.1 protein_id gnl|my_center|LOCUS_19000 1401 2765 gene locus_tag LOCUS_19010 gene trmFO 1401 2765 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence0778 >Feature sequence0779 1948 899 gene locus_tag LOCUS_19020 1948 899 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900173.1 protein_id gnl|my_center|LOCUS_19020 <2778 1951 gene locus_tag LOCUS_19030 <2778 1951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941871.1:methyltransferase >Feature sequence0780 77 478 gene locus_tag LOCUS_19040 77 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 2058 574 gene locus_tag LOCUS_19050 2058 574 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_19050 <2777 2058 gene locus_tag LOCUS_19060 <2777 2058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117787.1:efflux RND transporter permease subunit >Feature sequence0781 793 425 gene locus_tag LOCUS_19070 793 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1713 1075 gene locus_tag LOCUS_19080 1713 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2504 1710 gene locus_tag LOCUS_19090 2504 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0782 1688 1362 gene locus_tag LOCUS_19100 1688 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1581 2174 gene locus_tag LOCUS_19110 1581 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence0783 735 343 gene locus_tag LOCUS_19120 735 343 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024360564.1 protein_id gnl|my_center|LOCUS_19120 1448 882 gene locus_tag LOCUS_19130 1448 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2409 1471 gene locus_tag LOCUS_19140 2409 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence0784 <1 1359 gene locus_tag LOCUS_19150 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941495.1:TolC family protein 1425 2630 gene locus_tag LOCUS_19160 1425 2630 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471043.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence0785 <1 967 gene locus_tag LOCUS_19170 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118265.1:sugar phosphate isomerase/epimerase 982 2253 gene locus_tag LOCUS_19180 982 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence0786 973 1173 gene locus_tag LOCUS_19190 973 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 1546 1343 gene locus_tag LOCUS_19200 1546 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2645 1665 gene locus_tag LOCUS_19210 2645 1665 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence0787 2117 126 gene locus_tag LOCUS_19220 2117 126 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_19220 <2768 2114 gene locus_tag LOCUS_19230 <2768 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218083104.1:CRTAC1 family protein >Feature sequence0788 >Feature sequence0789 2766 523 gene locus_tag LOCUS_19240 gene katG 2766 523 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence0790 1920 370 gene locus_tag LOCUS_19250 1920 370 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_19250 <2766 1913 gene locus_tag LOCUS_19260 <2766 1913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405142.1:anhydro-N-acetylmuramic acid kinase >Feature sequence0791 141 1037 gene locus_tag LOCUS_19270 141 1037 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_19270 1034 2365 gene locus_tag LOCUS_19280 1034 2365 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence0792 <1 1092 gene locus_tag LOCUS_19290 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084368.1:cytochrome c peroxidase 1103 2170 gene locus_tag LOCUS_19300 1103 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence0793 174 1628 gene locus_tag LOCUS_19310 174 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence0794 1748 174 gene locus_tag LOCUS_19320 1748 174 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_19320 <2760 1750 gene locus_tag LOCUS_19330 <2760 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389441.1:NADH-quinone oxidoreductase subunit L >Feature sequence0795 295 1251 gene locus_tag LOCUS_19340 gene pdhA 295 1251 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence0796 1970 891 gene locus_tag LOCUS_19350 1970 891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_19350 2432 2061 gene locus_tag LOCUS_19360 2432 2061 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence0797 1810 1460 gene locus_tag LOCUS_19370 1810 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence0798 634 104 gene locus_tag LOCUS_19380 634 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2232 631 gene locus_tag LOCUS_19390 2232 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 <2755 2232 gene locus_tag LOCUS_19400 <2755 2232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533405.1:ThiF family adenylyltransferase >Feature sequence0799 <1 1018 gene locus_tag LOCUS_19410 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195190.1:MFS transporter 1034 1519 gene locus_tag LOCUS_19420 1034 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 1911 2072 gene locus_tag LOCUS_19430 1911 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2133 2357 gene locus_tag LOCUS_19440 2133 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2408 2590 gene locus_tag LOCUS_19450 2408 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence0800 596 742 gene locus_tag LOCUS_19460 596 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2309 777 gene locus_tag LOCUS_19470 2309 777 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931675.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence0801 564 1472 gene locus_tag LOCUS_19480 564 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2454 1600 gene locus_tag LOCUS_19490 2454 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence0802 1434 2417 gene locus_tag LOCUS_19500 gene msrP 1434 2417 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence0803 247 753 gene locus_tag LOCUS_19510 247 753 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_19510 740 1987 gene locus_tag LOCUS_19520 740 1987 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0804 633 304 gene locus_tag LOCUS_19530 633 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 617 850 gene locus_tag LOCUS_19540 617 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 847 1029 gene locus_tag LOCUS_19550 847 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1154 1906 gene locus_tag LOCUS_19560 1154 1906 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010257677.1 protein_id gnl|my_center|LOCUS_19560 1899 2141 gene locus_tag LOCUS_19570 1899 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0805 255 524 gene locus_tag LOCUS_19580 255 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2731 560 gene locus_tag LOCUS_19590 2731 560 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence0806 <1 2353 gene locus_tag LOCUS_19600 <1 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303084.1:discoidin domain-containing protein >Feature sequence0807 908 1588 gene locus_tag LOCUS_19610 908 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence0808 2714 66 gene locus_tag LOCUS_19620 2714 66 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence0809 3 527 gene locus_tag LOCUS_19630 3 527 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082774477.1 protein_id gnl|my_center|LOCUS_19630 508 1284 gene locus_tag LOCUS_19640 508 1284 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_19640 1984 1433 gene locus_tag LOCUS_19650 1984 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19650 2249 2076 gene locus_tag LOCUS_19660 2249 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence0810 576 1904 gene locus_tag LOCUS_19670 576 1904 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_19670 1917 2387 gene locus_tag LOCUS_19680 1917 2387 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0811 <1 921 gene locus_tag LOCUS_19690 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085719.1:efflux RND transporter periplasmic adaptor subunit 921 2405 gene locus_tag LOCUS_19700 921 2405 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence0812 690 1553 gene locus_tag LOCUS_19710 690 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1550 2527 gene locus_tag LOCUS_19720 1550 2527 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0813 72 599 gene locus_tag LOCUS_19730 72 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 702 998 gene locus_tag LOCUS_19740 702 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1227 2744 gene locus_tag LOCUS_19750 1227 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence0814 2436 1273 gene locus_tag LOCUS_19760 2436 1273 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence0815 >Feature sequence0816 1148 2368 gene locus_tag LOCUS_19770 1148 2368 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence0817 92 1960 gene locus_tag LOCUS_19780 92 1960 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_19780 2689 2015 gene locus_tag LOCUS_19790 2689 2015 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence0818 1168 269 gene locus_tag LOCUS_19800 1168 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2159 1248 gene locus_tag LOCUS_19810 2159 1248 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887015.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence0819 353 709 gene locus_tag LOCUS_19820 353 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1331 1855 gene locus_tag LOCUS_19830 1331 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence0820 >Feature sequence0821 2701 1355 gene locus_tag LOCUS_19840 gene iolF 2701 1355 CDS product myo-inositol transporter IolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244597.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence0822 825 631 gene locus_tag LOCUS_19850 825 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 <2735 1097 gene locus_tag LOCUS_19860 <2735 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010874377.1:DEAD/DEAH box helicase >Feature sequence0823 <1 2555 gene locus_tag LOCUS_19870 <1 2555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081335.1:DEAD/DEAH box helicase family protein >Feature sequence0824 <1 596 gene locus_tag LOCUS_19880 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083040.1:beta-galactosidase >Feature sequence0825 >Feature sequence0826 283 636 gene locus_tag LOCUS_19890 283 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2412 805 gene locus_tag LOCUS_19900 2412 805 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence0827 1298 1663 gene locus_tag LOCUS_19910 1298 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1751 2077 gene locus_tag LOCUS_19920 1751 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2058 2306 gene locus_tag LOCUS_19930 2058 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0828 1351 374 gene locus_tag LOCUS_19940 gene murQ 1351 374 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369100.1 protein_id gnl|my_center|LOCUS_19940 2473 1424 gene locus_tag LOCUS_19950 2473 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0829 2 154 gene locus_tag LOCUS_19960 2 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 970 218 gene locus_tag LOCUS_19970 gene istB 970 218 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967409.1 protein_id gnl|my_center|LOCUS_19970 2533 992 gene locus_tag LOCUS_19980 gene istA 2533 992 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087149263.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence0830 513 118 gene locus_tag LOCUS_19990 513 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1138 530 gene locus_tag LOCUS_20000 1138 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2238 1153 gene locus_tag LOCUS_20010 2238 1153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence0831 565 317 gene locus_tag LOCUS_20020 565 317 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_20020 1099 1878 gene locus_tag LOCUS_20030 1099 1878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266208.1 protein_id gnl|my_center|LOCUS_20030 2330 2647 gene locus_tag LOCUS_20040 2330 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence0832 340 735 gene locus_tag LOCUS_20050 340 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2040 814 gene locus_tag LOCUS_20060 gene ispG 2040 814 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence0833 656 240 gene locus_tag LOCUS_20070 656 240 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_20070 724 1674 gene locus_tag LOCUS_20080 724 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 <2727 1730 gene locus_tag LOCUS_20090 <2727 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence0834 <1 1007 gene locus_tag LOCUS_20100 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418888.1:acyl-CoA dehydrogenase 1074 2138 gene locus_tag LOCUS_20110 1074 2138 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence0835 1084 1311 gene locus_tag LOCUS_20120 1084 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1515 2015 gene locus_tag LOCUS_20130 1515 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2284 2499 gene locus_tag LOCUS_20140 2284 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence0836 1226 558 gene locus_tag LOCUS_20150 1226 558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_20150 2377 1274 gene locus_tag LOCUS_20160 gene hpnH 2377 1274 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence0837 192 1565 gene locus_tag LOCUS_20170 192 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1588 1806 gene locus_tag LOCUS_20180 1588 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1819 2019 gene locus_tag LOCUS_20190 1819 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2023 2655 gene locus_tag LOCUS_20200 2023 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence0838 125 1090 gene locus_tag LOCUS_20210 gene pssA 125 1090 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770492.1 protein_id gnl|my_center|LOCUS_20210 1087 2118 gene locus_tag LOCUS_20220 1087 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence0839 3 2462 gene locus_tag LOCUS_20230 3 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence0840 219 2255 gene locus_tag LOCUS_20240 219 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence0841 >Feature sequence0842 <1 654 gene locus_tag LOCUS_20250 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256280.1:thiamine phosphate synthase 770 2299 gene locus_tag LOCUS_20260 770 2299 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080476.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence0843 <1 2332 gene locus_tag LOCUS_20270 <1 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173615039.1:aldehyde dehydrogenase family protein >Feature sequence0844 249 121 gene locus_tag LOCUS_20280 249 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 581 883 gene locus_tag LOCUS_20290 581 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0845 >Feature sequence0846 1275 181 gene locus_tag LOCUS_20300 1275 181 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_20300 2313 1363 gene locus_tag LOCUS_20310 2313 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2528 2352 gene locus_tag LOCUS_20320 2528 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence0847 >Feature sequence0848 <1 1477 gene locus_tag LOCUS_20330 <1 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein assembly factor 1486 2274 gene locus_tag LOCUS_20340 1486 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence0849 905 27 gene locus_tag LOCUS_20350 905 27 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 protein_id gnl|my_center|LOCUS_20350 1922 906 gene locus_tag LOCUS_20360 gene aroF 1922 906 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_20360 2260 1919 gene locus_tag LOCUS_20370 2260 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence0850 766 197 gene locus_tag LOCUS_20380 766 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1051 821 gene locus_tag LOCUS_20390 1051 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2340 1156 gene locus_tag LOCUS_20400 2340 1156 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence0851 284 526 gene locus_tag LOCUS_20410 gene csrA 284 526 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_20410 563 802 gene locus_tag LOCUS_20420 563 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1252 827 gene locus_tag LOCUS_20430 1252 827 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 protein_id gnl|my_center|LOCUS_20430 1548 1255 gene locus_tag LOCUS_20440 1548 1255 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence0852 112 1038 gene locus_tag LOCUS_20450 112 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1035 2483 gene locus_tag LOCUS_20460 1035 2483 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence0853 169 786 gene locus_tag LOCUS_20470 gene pyrE 169 786 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940203.1 protein_id gnl|my_center|LOCUS_20470 2563 971 gene locus_tag LOCUS_20480 2563 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0854 1638 1195 gene locus_tag LOCUS_20490 1638 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0855 >Feature sequence0856 >Feature sequence0857 <1 997 gene locus_tag LOCUS_20500 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272540.1:O-antigen ligase family protein >Feature sequence0858 1363 614 gene locus_tag LOCUS_20510 gene sdhB 1363 614 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_20510 <2706 1381 gene locus_tag LOCUS_20520 <2706 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808703.1:succinate dehydrogenase flavoprotein subunit >Feature sequence0859 2564 660 gene locus_tag LOCUS_20530 2564 660 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932588.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence0860 <1 1022 gene locus_tag LOCUS_20540 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403001.1:phosphoribosyltransferase family protein 1484 1053 gene locus_tag LOCUS_20550 1484 1053 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_20550 2327 1518 gene locus_tag LOCUS_20560 2327 1518 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence0861 <1 676 gene locus_tag LOCUS_20570 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123898.1:vitamin B12-dependent ribonucleotide reductase 2397 787 gene locus_tag LOCUS_20580 2397 787 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence0862 <1 2437 gene locus_tag LOCUS_20590 <1 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861114.1:ATP-binding protein >Feature sequence0863 1892 720 gene locus_tag LOCUS_20600 1892 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1945 2472 gene locus_tag LOCUS_20610 1945 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2551 2691 gene locus_tag LOCUS_20620 2551 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0864 <1 786 gene locus_tag LOCUS_20630 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014507955.1:TRZ/ATZ family hydrolase 783 1490 gene locus_tag LOCUS_20640 gene ubiG 783 1490 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_20640 1483 2157 gene locus_tag LOCUS_20650 1483 2157 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 protein_id gnl|my_center|LOCUS_20650 2583 2119 gene locus_tag LOCUS_20660 2583 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence0865 376 1905 gene locus_tag LOCUS_20670 376 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence0866 348 139 gene locus_tag LOCUS_20680 348 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 473 348 gene locus_tag LOCUS_20690 473 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1009 707 gene locus_tag LOCUS_20700 1009 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2503 1163 gene locus_tag LOCUS_20710 2503 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence0867 >Feature sequence0868 164 240 gene locus_tag LOCUS_t00210 164 240 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1782 520 gene locus_tag LOCUS_20720 1782 520 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 protein_id gnl|my_center|LOCUS_20720 2131 2682 gene locus_tag LOCUS_20730 2131 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence0869 >Feature sequence0870 1669 386 gene locus_tag LOCUS_20740 gene egtB 1669 386 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_20740 2291 1860 gene locus_tag LOCUS_20750 2291 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence0871 1731 1138 gene locus_tag LOCUS_20760 1731 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 <2699 2029 gene locus_tag LOCUS_20770 <2699 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405515.1:glycoside hydrolase family 18 protein >Feature sequence0872 1121 78 gene locus_tag LOCUS_20780 1121 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1595 2626 gene locus_tag LOCUS_20790 1595 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0873 1 480 gene locus_tag LOCUS_20800 1 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 569 1624 gene locus_tag LOCUS_20810 569 1624 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039520.1 protein_id gnl|my_center|LOCUS_20810 2561 1689 gene locus_tag LOCUS_20820 2561 1689 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0874 <2697 2185 gene locus_tag LOCUS_20830 <2697 2185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141273.1:ABC transporter ATP-binding protein >Feature sequence0875 >Feature sequence0876 1132 215 gene locus_tag LOCUS_20840 gene lipA 1132 215 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence0877 1089 1013 gene locus_tag LOCUS_t00220 1089 1013 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1447 1175 gene locus_tag LOCUS_20850 1447 1175 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_20850 1521 2555 gene locus_tag LOCUS_20860 1521 2555 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_20860 2605 2678 gene locus_tag LOCUS_t00230 2605 2678 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0878 >Feature sequence0879 1902 2210 gene locus_tag LOCUS_20870 1902 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2207 2593 gene locus_tag LOCUS_20880 2207 2593 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence0880 315 1190 gene locus_tag LOCUS_20890 gene hisG 315 1190 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_20890 1209 2492 gene locus_tag LOCUS_20900 gene hisD 1209 2492 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence0881 160 1485 gene locus_tag LOCUS_20910 gene rlmD 160 1485 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942393.1 protein_id gnl|my_center|LOCUS_20910 1486 2691 gene locus_tag LOCUS_20920 1486 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0882 501 1799 gene locus_tag LOCUS_20930 501 1799 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_20930 2568 1867 gene locus_tag LOCUS_20940 2568 1867 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390935.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0883 1004 246 gene locus_tag LOCUS_20950 1004 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1760 1218 gene locus_tag LOCUS_20960 1760 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2591 1812 gene locus_tag LOCUS_20970 2591 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0884 1662 889 gene locus_tag LOCUS_20980 1662 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 <2689 1960 gene locus_tag LOCUS_20990 <2689 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385431.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ >Feature sequence0885 2594 1785 gene locus_tag LOCUS_21000 gene map 2594 1785 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence0886 1257 352 gene locus_tag LOCUS_21010 1257 352 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814552.1 protein_id gnl|my_center|LOCUS_21010 1368 2582 gene locus_tag LOCUS_21020 1368 2582 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268353.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence0887 1450 104 gene locus_tag LOCUS_21030 1450 104 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_21030 1729 2400 gene locus_tag LOCUS_21040 1729 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence0888 1206 394 gene locus_tag LOCUS_21050 1206 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1391 1203 gene locus_tag LOCUS_21060 1391 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1812 1498 gene locus_tag LOCUS_21070 1812 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2114 1809 gene locus_tag LOCUS_21080 2114 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2341 2126 gene locus_tag LOCUS_21090 2341 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence0889 >Feature sequence0890 1224 49 gene locus_tag LOCUS_21100 1224 49 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_21100 1727 1281 gene locus_tag LOCUS_21110 1727 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence0891 508 1494 gene locus_tag LOCUS_21120 508 1494 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462489.1 protein_id gnl|my_center|LOCUS_21120 1513 2496 gene locus_tag LOCUS_21130 1513 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence0892 713 913 gene locus_tag LOCUS_21140 713 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 910 1284 gene locus_tag LOCUS_21150 910 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2492 1686 gene locus_tag LOCUS_21160 gene fadH 2492 1686 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0893 2597 654 gene locus_tag LOCUS_21170 2597 654 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence0894 65 847 gene locus_tag LOCUS_21180 65 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1246 857 gene locus_tag LOCUS_21190 1246 857 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817071.1 protein_id gnl|my_center|LOCUS_21190 1333 2208 gene locus_tag LOCUS_21200 1333 2208 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence0895 <1 1181 gene locus_tag LOCUS_21210 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930844.1:HlyD family efflux transporter periplasmic adaptor subunit 1619 1191 gene locus_tag LOCUS_21220 gene tadA 1619 1191 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073170.1 protein_id gnl|my_center|LOCUS_21220 <2679 1714 gene locus_tag LOCUS_21230 <2679 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029301722.1:EAL domain-containing response regulator >Feature sequence0896 2016 1087 gene locus_tag LOCUS_21240 2016 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2221 2508 gene locus_tag LOCUS_21250 2221 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0897 1347 715 gene locus_tag LOCUS_21260 1347 715 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_21260 2550 1933 gene locus_tag LOCUS_21270 2550 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0898 1568 1029 gene locus_tag LOCUS_21280 1568 1029 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_21280 2356 1568 gene locus_tag LOCUS_21290 2356 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence0899 1057 284 gene locus_tag LOCUS_21300 1057 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2172 1054 gene locus_tag LOCUS_21310 2172 1054 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552205.1 protein_id gnl|my_center|LOCUS_21310 2530 2177 gene locus_tag LOCUS_21320 2530 2177 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence0900 916 428 gene locus_tag LOCUS_21330 916 428 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392135.1 protein_id gnl|my_center|LOCUS_21330 1669 1022 gene locus_tag LOCUS_21340 gene nox 1669 1022 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_21340 2219 2608 gene locus_tag LOCUS_21350 2219 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence0901 1336 473 gene locus_tag LOCUS_21360 1336 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2058 1333 gene locus_tag LOCUS_21370 2058 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085279.1 protein_id gnl|my_center|LOCUS_21370 2435 2055 gene locus_tag LOCUS_21380 2435 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0902 738 475 gene locus_tag LOCUS_21390 738 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1041 742 gene locus_tag LOCUS_21400 1041 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21400 1892 1644 gene locus_tag LOCUS_21410 1892 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2415 1813 gene locus_tag LOCUS_21420 2415 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2664 2419 gene locus_tag LOCUS_21430 2664 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0903 917 300 gene locus_tag LOCUS_21440 917 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21440 2452 914 gene locus_tag LOCUS_21450 gene narH 2452 914 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence0904 2336 516 gene locus_tag LOCUS_21460 2336 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence0905 >Feature sequence0906 1553 357 gene locus_tag LOCUS_21470 1553 357 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494103.1 protein_id gnl|my_center|LOCUS_21470 1657 2121 gene locus_tag LOCUS_21480 1657 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2179 2658 gene locus_tag LOCUS_21490 2179 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0907 442 1500 gene locus_tag LOCUS_21500 442 1500 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence0908 1269 355 gene locus_tag LOCUS_21510 1269 355 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_21510 1524 2525 gene locus_tag LOCUS_21520 1524 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence0909 591 166 gene locus_tag LOCUS_21530 591 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1712 588 gene locus_tag LOCUS_21540 gene hpnH 1712 588 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_21540 <2658 1791 gene locus_tag LOCUS_21550 <2658 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941348.1:squalene--hopene cyclase >Feature sequence0910 >Feature sequence0911 1922 210 gene locus_tag LOCUS_21560 1922 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2044 2313 gene locus_tag LOCUS_21570 2044 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence0912 >Feature sequence0913 <1 1720 gene locus_tag LOCUS_21580 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405269.1:DNA polymerase III subunit gamma/tau 1737 2075 gene locus_tag LOCUS_21590 1737 2075 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948445.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence0914 1665 1339 gene locus_tag LOCUS_21600 1665 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1800 1716 gene locus_tag LOCUS_t00240 1800 1716 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0915 <1 1039 gene locus_tag LOCUS_21610 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972789.1:D-galactarolactone cycloisomerase 1104 1391 gene locus_tag LOCUS_21620 1104 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2284 1466 gene locus_tag LOCUS_21630 2284 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 >Feature sequence0916 486 1097 gene locus_tag LOCUS_21640 486 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1304 2062 gene locus_tag LOCUS_21650 1304 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2347 2571 gene locus_tag LOCUS_21660 gene cspC 2347 2571 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence0917 1467 592 gene locus_tag LOCUS_21670 1467 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1880 1521 gene locus_tag LOCUS_21680 gene tnpB 1880 1521 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975539.1 protein_id gnl|my_center|LOCUS_21680 2284 1877 gene locus_tag LOCUS_21690 2284 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence0918 <1 2503 gene locus_tag LOCUS_21700 <1 2503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001301738.1:two-component system sensor histidine kinase KdpD >Feature sequence0919 2576 927 gene locus_tag LOCUS_21710 gene mdcA 2576 927 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112666.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence0920 567 289 gene locus_tag LOCUS_21720 567 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 824 564 gene locus_tag LOCUS_21730 824 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2646 811 gene locus_tag LOCUS_21740 2646 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0921 >Feature sequence0922 >Feature sequence0923 607 1614 gene locus_tag LOCUS_21750 607 1614 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence0924 469 1227 gene locus_tag LOCUS_21760 gene pstB 469 1227 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965015.1 protein_id gnl|my_center|LOCUS_21760 1224 1916 gene locus_tag LOCUS_21770 gene phoU 1224 1916 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence0925 >Feature sequence0926 >Feature sequence0927 639 439 gene locus_tag LOCUS_21780 639 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1210 623 gene locus_tag LOCUS_21790 1210 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0928 94 315 gene locus_tag LOCUS_21800 94 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2636 1122 gene locus_tag LOCUS_21810 2636 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0929 >Feature sequence0930 152 21 gene locus_tag LOCUS_21820 152 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1605 313 gene locus_tag LOCUS_21830 1605 313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088779.1 protein_id gnl|my_center|LOCUS_21830 2073 1837 gene locus_tag LOCUS_21840 2073 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2309 2070 gene locus_tag LOCUS_21850 2309 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2296 2421 gene locus_tag LOCUS_21860 2296 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence0931 1803 628 gene locus_tag LOCUS_21870 1803 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2324 2013 gene locus_tag LOCUS_21880 2324 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence0932 540 283 gene locus_tag LOCUS_21890 540 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1942 770 gene locus_tag LOCUS_21900 1942 770 CDS product IS4-like element ISGsu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence0933 <1 515 gene locus_tag LOCUS_21910 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073221.1:type IV pilus twitching motility protein PilT 525 1655 gene locus_tag LOCUS_21920 gene pilU 525 1655 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0934 662 540 gene locus_tag LOCUS_21930 662 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0935 <1 733 gene locus_tag LOCUS_21940 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000401225.1:F0F1 ATP synthase subunit A 896 1195 gene locus_tag LOCUS_21950 gene atpE 896 1195 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_21950 1559 2221 gene locus_tag LOCUS_21960 gene wlbG 1559 2221 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0936 170 406 gene locus_tag LOCUS_21970 170 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 623 874 gene locus_tag LOCUS_21980 623 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1937 1170 gene locus_tag LOCUS_21990 1937 1170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_21990 <2639 2018 gene locus_tag LOCUS_22000 <2639 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393509.1:NAD-dependent DNA ligase LigA >Feature sequence0937 969 1463 gene locus_tag LOCUS_22010 969 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1417 1683 gene locus_tag LOCUS_22020 1417 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1866 2420 gene locus_tag LOCUS_22030 1866 2420 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence0938 <2637 1441 gene locus_tag LOCUS_22040 <2637 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769641.1:OmpA family protein >Feature sequence0939 712 1572 gene locus_tag LOCUS_22050 712 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0940 944 546 gene locus_tag LOCUS_22060 944 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 852 1838 gene locus_tag LOCUS_22070 852 1838 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527988.1 protein_id gnl|my_center|LOCUS_22070 <2634 1854 gene locus_tag LOCUS_22080 <2634 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387903.1:cyclase family protein >Feature sequence0941 205 1497 gene locus_tag LOCUS_22090 205 1497 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_22090 2455 1517 gene locus_tag LOCUS_22100 2455 1517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence0942 1531 416 gene locus_tag LOCUS_22110 gene ald 1531 416 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_22110 <2633 1563 gene locus_tag LOCUS_22120 <2633 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257638.1:aldehyde dehydrogenase family protein >Feature sequence0943 489 148 gene locus_tag LOCUS_22130 489 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1205 486 gene locus_tag LOCUS_22140 1205 486 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_22140 2235 1216 gene locus_tag LOCUS_22150 gene trxB 2235 1216 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence0944 >Feature sequence0945 >Feature sequence0946 693 409 gene locus_tag LOCUS_22160 693 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 1259 792 gene locus_tag LOCUS_22170 1259 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1422 1249 gene locus_tag LOCUS_22180 1422 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2492 1428 gene locus_tag LOCUS_22190 2492 1428 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693270.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence0947 2565 673 gene locus_tag LOCUS_22200 2565 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0948 393 1325 gene locus_tag LOCUS_22210 393 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2352 1423 gene locus_tag LOCUS_22220 gene mdh 2352 1423 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence0949 42 221 gene locus_tag LOCUS_22230 42 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 849 1511 gene locus_tag LOCUS_22240 849 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1671 1892 gene locus_tag LOCUS_22250 1671 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence0950 790 1089 gene locus_tag LOCUS_22260 790 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1220 1348 gene locus_tag LOCUS_22270 1220 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1483 1638 gene locus_tag LOCUS_22280 1483 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence0951 171 305 gene locus_tag LOCUS_22290 171 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 332 1411 gene locus_tag LOCUS_22300 332 1411 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0952 1323 202 gene locus_tag LOCUS_22310 1323 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence0953 756 1553 gene locus_tag LOCUS_22320 756 1553 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence0954 345 1367 gene locus_tag LOCUS_22330 gene ilvC 345 1367 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256075.1 protein_id gnl|my_center|LOCUS_22330 1763 2557 gene locus_tag LOCUS_22340 1763 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence0955 1432 305 gene locus_tag LOCUS_22350 1432 305 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976071.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence0956 37 1026 gene locus_tag LOCUS_22360 gene gnd 37 1026 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_22360 1026 2423 gene locus_tag LOCUS_22370 gene zwf 1026 2423 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence0957 <1 1348 gene locus_tag LOCUS_22380 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797467.1:sugar porter family MFS transporter 1453 1896 gene locus_tag LOCUS_22390 1453 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 1862 2149 gene locus_tag LOCUS_22400 1862 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 2146 2469 gene locus_tag LOCUS_22410 2146 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22410 >Feature sequence0958 971 1201 gene locus_tag LOCUS_22420 971 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1483 1226 gene locus_tag LOCUS_22430 1483 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1656 1483 gene locus_tag LOCUS_22440 1656 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1872 1663 gene locus_tag LOCUS_22450 1872 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2413 1880 gene locus_tag LOCUS_22460 2413 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence0959 956 102 gene locus_tag LOCUS_22470 956 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1784 975 gene locus_tag LOCUS_22480 1784 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2048 1800 gene locus_tag LOCUS_22490 2048 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2407 2060 gene locus_tag LOCUS_22500 2407 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence0960 824 2311 gene locus_tag LOCUS_22510 824 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0961 1142 1909 gene locus_tag LOCUS_22520 1142 1909 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence0962 119 1291 gene locus_tag LOCUS_22530 119 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence0963 859 542 gene locus_tag LOCUS_22540 859 542 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_22540 2335 869 gene locus_tag LOCUS_22550 gene aldA 2335 869 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence0964 786 1010 gene locus_tag LOCUS_22560 786 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1064 2434 gene locus_tag LOCUS_22570 gene xseA 1064 2434 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence0965 1692 697 gene locus_tag LOCUS_22580 1692 697 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_22580 2051 2497 gene locus_tag LOCUS_22590 2051 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence0966 <1 1448 gene locus_tag LOCUS_22600 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1460 2479 gene locus_tag LOCUS_22610 1460 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence0967 571 1812 gene locus_tag LOCUS_22620 571 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 <2615 2075 gene locus_tag LOCUS_22630 <2615 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812405.1:transcription elongation factor GreB >Feature sequence0968 514 438 gene locus_tag LOCUS_t00250 514 438 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1590 532 gene locus_tag LOCUS_22640 1590 532 CDS product ISAs1-like element ISRm21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969728.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0969 887 1087 gene locus_tag LOCUS_22650 887 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0970 791 237 gene locus_tag LOCUS_22660 791 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1791 802 gene locus_tag LOCUS_22670 1791 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2299 1802 gene locus_tag LOCUS_22680 2299 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence0971 <2612 2024 gene locus_tag LOCUS_22690 <2612 2024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545499.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence0972 1389 697 gene locus_tag LOCUS_22700 1389 697 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039869.1 protein_id gnl|my_center|LOCUS_22700 1578 1961 gene locus_tag LOCUS_22710 1578 1961 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_22710 1992 2390 gene locus_tag LOCUS_22720 1992 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence0973 >Feature sequence0974 <2611 415 gene locus_tag LOCUS_22730 <2611 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0975 1664 1293 gene locus_tag LOCUS_22740 gene erpA 1664 1293 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_22740 1935 2204 gene locus_tag LOCUS_22750 1935 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence0976 1589 450 gene locus_tag LOCUS_22760 1589 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0977 417 1577 gene locus_tag LOCUS_22770 417 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0978 1704 2156 gene locus_tag LOCUS_22780 1704 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence0979 320 496 gene locus_tag LOCUS_22790 320 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 737 1009 gene locus_tag LOCUS_22800 737 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 996 1403 gene locus_tag LOCUS_22810 996 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1400 1837 gene locus_tag LOCUS_22820 1400 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1845 2561 gene locus_tag LOCUS_22830 1845 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence0980 <1 2468 gene locus_tag LOCUS_22840 <1 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein >Feature sequence0981 529 1533 gene locus_tag LOCUS_22850 529 1533 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence0982 <1 1153 gene locus_tag LOCUS_22860 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107494.1:sigma-54 dependent transcriptional regulator 1143 2495 gene locus_tag LOCUS_22870 1143 2495 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence0983 <2603 1703 gene locus_tag LOCUS_22880 <2603 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein assembly factor >Feature sequence0984 472 1086 gene locus_tag LOCUS_22890 472 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 <2601 1172 gene locus_tag LOCUS_22900 <2601 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036607.1:fumarate hydratase >Feature sequence0985 <1 550 gene locus_tag LOCUS_22910 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482529.1:ATP-dependent Clp endopeptidase proteolytic subunit ClpP 569 1840 gene locus_tag LOCUS_22920 gene clpX 569 1840 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence0986 332 877 gene locus_tag LOCUS_22930 332 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence0987 408 1397 gene locus_tag LOCUS_22940 408 1397 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0988 409 714 gene locus_tag LOCUS_22950 409 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 895 1344 gene locus_tag LOCUS_22960 895 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2040 1468 gene locus_tag LOCUS_22970 gene frr 2040 1468 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence0989 <2598 896 gene locus_tag LOCUS_22980 <2598 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120599.1:FG-GAP-like repeat-containing protein >Feature sequence0990 962 546 gene locus_tag LOCUS_22990 962 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1531 1103 gene locus_tag LOCUS_23000 1531 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2118 1747 gene locus_tag LOCUS_23010 2118 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence0991 51 476 gene locus_tag LOCUS_23020 51 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence0992 324 127 gene locus_tag LOCUS_23030 324 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 730 656 gene locus_tag LOCUS_t00260 730 656 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 937 2469 gene locus_tag LOCUS_23040 937 2469 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250519.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence0993 2069 162 gene locus_tag LOCUS_23050 gene traD 2069 162 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104272554.1 protein_id gnl|my_center|LOCUS_23050 2456 2073 gene locus_tag LOCUS_23060 2456 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence0994 1245 2240 gene locus_tag LOCUS_23070 1245 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence0995 1157 708 gene locus_tag LOCUS_23080 gene secB 1157 708 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_23080 1306 1381 gene locus_tag LOCUS_t00270 1306 1381 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0996 157 555 gene locus_tag LOCUS_23090 157 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 770 567 gene locus_tag LOCUS_23100 770 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 838 1752 gene locus_tag LOCUS_23110 838 1752 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103459.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence0997 1388 291 gene locus_tag LOCUS_23120 1388 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence0998 <2592 1503 gene locus_tag LOCUS_23130 <2592 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919625.1:glucosylceramidase >Feature sequence0999 >Feature sequence1000 <1 1868 gene locus_tag LOCUS_23140 <1 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000726144.1:ABC transporter substrate-binding protein 1946 2272 gene locus_tag LOCUS_23150 1946 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence1001 427 690 gene locus_tag LOCUS_23160 427 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 944 1288 gene locus_tag LOCUS_23170 944 1288 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_23170 2543 1479 gene locus_tag LOCUS_23180 2543 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence1002 461 108 gene locus_tag LOCUS_23190 461 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 705 511 gene locus_tag LOCUS_23200 705 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 968 729 gene locus_tag LOCUS_23210 968 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1588 1268 gene locus_tag LOCUS_23220 1588 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1856 1668 gene locus_tag LOCUS_23230 1856 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence1003 302 1378 gene locus_tag LOCUS_23240 302 1378 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_23240 1652 1401 gene locus_tag LOCUS_23250 1652 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence1004 643 1368 gene locus_tag LOCUS_23260 643 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1584 1339 gene locus_tag LOCUS_23270 1584 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1887 2441 gene locus_tag LOCUS_23280 1887 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence1005 931 1563 gene locus_tag LOCUS_23290 931 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2563 1538 gene locus_tag LOCUS_23300 2563 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence1006 5 1036 gene locus_tag LOCUS_23310 5 1036 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_23310 1097 1534 gene locus_tag LOCUS_23320 gene gspG 1097 1534 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_23320 1581 1973 gene locus_tag LOCUS_23330 1581 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1983 2366 gene locus_tag LOCUS_23340 1983 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence1007 168 1766 gene locus_tag LOCUS_23350 168 1766 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence1008 347 913 gene locus_tag LOCUS_23360 347 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 864 1043 gene locus_tag LOCUS_23370 864 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence1009 1170 910 gene locus_tag LOCUS_23380 1170 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1230 1640 gene locus_tag LOCUS_23390 1230 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 1722 1904 gene locus_tag LOCUS_23400 1722 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1907 2332 gene locus_tag LOCUS_23410 gene hicB 1907 2332 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence1010 536 330 gene locus_tag LOCUS_23420 536 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1564 533 gene locus_tag LOCUS_23430 1564 533 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068712904.1 protein_id gnl|my_center|LOCUS_23430 1813 2541 gene locus_tag LOCUS_23440 1813 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence1011 55 489 gene locus_tag LOCUS_23450 55 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 486 962 gene locus_tag LOCUS_23460 486 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1270 1452 gene locus_tag LOCUS_23470 1270 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1497 2171 gene locus_tag LOCUS_23480 1497 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence1012 442 366 gene locus_tag LOCUS_t00280 442 366 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1230 649 gene locus_tag LOCUS_23490 1230 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2165 1197 gene locus_tag LOCUS_23500 2165 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence1013 901 2265 gene locus_tag LOCUS_23510 gene araE 901 2265 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence1014 2375 1926 gene locus_tag LOCUS_23520 2375 1926 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973727.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence1015 534 1859 gene locus_tag LOCUS_23530 534 1859 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence1016 >Feature sequence1017 631 407 gene locus_tag LOCUS_23540 631 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 885 1814 gene locus_tag LOCUS_23550 885 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2061 2369 gene locus_tag LOCUS_23560 2061 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23560 >Feature sequence1018 496 1434 gene locus_tag LOCUS_23570 496 1434 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence1019 <2580 1705 gene locus_tag LOCUS_23580 <2580 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973946.1:4-hydroxybenzoate 3-monooxygenase >Feature sequence1020 159 320 gene locus_tag LOCUS_23590 159 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 320 592 gene locus_tag LOCUS_23600 320 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 683 1360 gene locus_tag LOCUS_23610 683 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1360 1953 gene locus_tag LOCUS_23620 1360 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence1021 1724 1044 gene locus_tag LOCUS_23630 1724 1044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence1022 913 98 gene locus_tag LOCUS_23640 913 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776583.1 protein_id gnl|my_center|LOCUS_23640 2229 922 gene locus_tag LOCUS_23650 2229 922 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence1023 891 664 gene locus_tag LOCUS_23660 891 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2162 963 gene locus_tag LOCUS_23670 2162 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence1024 314 1210 gene locus_tag LOCUS_23680 314 1210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_23680 1605 1438 gene locus_tag LOCUS_23690 1605 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2102 2299 gene locus_tag LOCUS_23700 2102 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence1025 <2574 2022 gene locus_tag LOCUS_23710 <2574 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225849.1:MFS transporter >Feature sequence1026 336 1208 gene locus_tag LOCUS_23720 336 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1348 1854 gene locus_tag LOCUS_23730 gene lirB 1348 1854 CDS product type IV secretion system effector LirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947678.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence1027 139 846 gene locus_tag LOCUS_23740 139 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 848 1648 gene locus_tag LOCUS_23750 848 1648 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_23750 1682 2218 gene locus_tag LOCUS_23760 1682 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence1028 115 252 gene locus_tag LOCUS_23770 115 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 653 450 gene locus_tag LOCUS_23780 653 450 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257713.1 protein_id gnl|my_center|LOCUS_23780 1678 752 gene locus_tag LOCUS_23790 1678 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 2018 1815 gene locus_tag LOCUS_23800 2018 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2093 2374 gene locus_tag LOCUS_23810 2093 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence1029 1183 950 gene locus_tag LOCUS_23820 1183 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence1030 379 2508 gene locus_tag LOCUS_23830 379 2508 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence1031 280 104 gene locus_tag LOCUS_23840 280 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1761 559 gene locus_tag LOCUS_23850 1761 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence1032 <1 627 gene locus_tag LOCUS_23860 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761873.1:TIGR04053 family radical SAM/SPASM domain-containing protein 808 2160 gene locus_tag LOCUS_23870 gene gltA 808 2160 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence1033 664 17 gene locus_tag LOCUS_23880 664 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1901 675 gene locus_tag LOCUS_23890 1901 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 2123 2332 gene locus_tag LOCUS_23900 2123 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence1034 294 1349 gene locus_tag LOCUS_23910 294 1349 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_23910 2499 1381 gene locus_tag LOCUS_23920 2499 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence1035 <2568 2044 gene locus_tag LOCUS_23930 <2568 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245496.1:ABC transporter ATP-binding protein >Feature sequence1036 1395 2306 gene locus_tag LOCUS_23940 1395 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence1037 1082 1876 gene locus_tag LOCUS_23950 1082 1876 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence1038 45 120 gene locus_tag LOCUS_t00290 45 120 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1783 71 gene locus_tag LOCUS_23960 1783 71 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158841022.1 protein_id gnl|my_center|LOCUS_23960 2175 1798 gene locus_tag LOCUS_23970 2175 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2563 2312 gene locus_tag LOCUS_23980 2563 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence1039 266 1204 gene locus_tag LOCUS_23990 266 1204 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence1040 <2564 438 gene locus_tag LOCUS_24000 <2564 438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223614.1:glycoside hydrolase family 3 C-terminal domain-containing protein >Feature sequence1041 125 1141 gene locus_tag LOCUS_24010 125 1141 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_24010 1640 1197 gene locus_tag LOCUS_24020 1640 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence1042 >Feature sequence1043 2489 1065 gene locus_tag LOCUS_24030 2489 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence1044 1471 44 gene locus_tag LOCUS_24040 1471 44 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_24040 1801 1484 gene locus_tag LOCUS_24050 1801 1484 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence1045 1703 195 gene locus_tag LOCUS_24060 gene pelF 1703 195 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_24060 2559 1696 gene locus_tag LOCUS_24070 2559 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence1046 2153 909 gene locus_tag LOCUS_24080 gene ltrA 2153 909 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022749.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence1047 280 582 gene locus_tag LOCUS_24090 280 582 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_24090 <2558 833 gene locus_tag LOCUS_24100 <2558 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545243.1:threonine--tRNA ligase >Feature sequence1048 1003 500 gene locus_tag LOCUS_24110 1003 500 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 protein_id gnl|my_center|LOCUS_24110 2007 1003 gene locus_tag LOCUS_24120 gene alc 2007 1003 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531999.1 protein_id gnl|my_center|LOCUS_24120 2512 2000 gene locus_tag LOCUS_24130 2512 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence1049 1367 153 gene locus_tag LOCUS_24140 1367 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1623 2417 gene locus_tag LOCUS_24150 1623 2417 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence1050 43 708 gene locus_tag LOCUS_24160 43 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 708 923 gene locus_tag LOCUS_24170 708 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 926 1291 gene locus_tag LOCUS_24180 926 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1291 2520 gene locus_tag LOCUS_24190 1291 2520 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098032.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence1051 234 1700 gene locus_tag LOCUS_24200 234 1700 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_24200 2212 2415 gene locus_tag LOCUS_24210 2212 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence1052 151 936 gene locus_tag LOCUS_24220 151 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1171 2085 gene locus_tag LOCUS_24230 1171 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence1053 2161 698 gene locus_tag LOCUS_24240 2161 698 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence1054 46 1233 gene locus_tag LOCUS_24250 46 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence1055 153 1127 gene locus_tag LOCUS_24260 153 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1259 1882 gene locus_tag LOCUS_24270 1259 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1886 2326 gene locus_tag LOCUS_24280 1886 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence1056 >Feature sequence1057 <2552 1686 gene locus_tag LOCUS_24290 <2552 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015546.1:glycosyltransferase family 87 protein >Feature sequence1058 2450 1371 gene locus_tag LOCUS_24300 gene coxB 2450 1371 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence1059 1019 237 gene locus_tag LOCUS_24310 1019 237 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_24310 1114 2292 gene locus_tag LOCUS_24320 gene dgoD 1114 2292 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence1060 2412 619 gene locus_tag LOCUS_24330 2412 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence1061 >Feature sequence1062 70 1698 gene locus_tag LOCUS_24340 70 1698 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328020.1 protein_id gnl|my_center|LOCUS_24340 1920 2447 gene locus_tag LOCUS_24350 1920 2447 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence1063 398 676 gene locus_tag LOCUS_24360 398 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 975 2330 gene locus_tag LOCUS_24370 975 2330 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence1064 672 878 gene locus_tag LOCUS_24380 672 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1913 2371 gene locus_tag LOCUS_24390 1913 2371 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence1065 1573 683 gene locus_tag LOCUS_24400 1573 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <2545 1966 gene locus_tag LOCUS_24410 <2545 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681381.1:type I restriction-modification system subunit M >Feature sequence1066 2339 1977 gene locus_tag LOCUS_24420 2339 1977 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349611.1 protein_id gnl|my_center|LOCUS_24420 2374 2520 gene locus_tag LOCUS_24430 2374 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence1067 40 1575 gene locus_tag LOCUS_24440 40 1575 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_24440 2277 1636 gene locus_tag LOCUS_24450 2277 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence1068 253 681 gene locus_tag LOCUS_24460 253 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 653 1285 gene locus_tag LOCUS_24470 653 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence1069 1533 433 gene locus_tag LOCUS_24480 1533 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence1070 1106 576 gene locus_tag LOCUS_24490 1106 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1606 1454 gene locus_tag LOCUS_24500 1606 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence1071 77 322 gene locus_tag LOCUS_24510 77 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24510 1661 504 gene locus_tag LOCUS_24520 1661 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence1072 1024 1932 gene locus_tag LOCUS_24530 1024 1932 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216246.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence1073 347 263 gene locus_tag LOCUS_t00300 347 263 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2218 407 gene locus_tag LOCUS_24540 2218 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2540 2229 gene locus_tag LOCUS_24550 2540 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence1074 >Feature sequence1075 >Feature sequence1076 457 233 gene locus_tag LOCUS_24560 457 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1315 464 gene locus_tag LOCUS_24570 1315 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence1077 1805 459 gene locus_tag LOCUS_24580 1805 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence1078 2020 1769 gene locus_tag LOCUS_24590 2020 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence1079 1337 1140 gene locus_tag LOCUS_24600 1337 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2188 1334 gene locus_tag LOCUS_24610 2188 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2406 2185 gene locus_tag LOCUS_24620 2406 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence1080 >Feature sequence1081 100 822 gene locus_tag LOCUS_24630 100 822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence1082 1 1527 gene locus_tag LOCUS_24640 1 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence1083 >Feature sequence1084 1210 599 gene locus_tag LOCUS_24650 1210 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2532 1207 gene locus_tag LOCUS_24660 2532 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence1085 >Feature sequence1086 249 16 gene locus_tag LOCUS_24670 249 16 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_24670 1417 449 gene locus_tag LOCUS_24680 1417 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1970 2245 gene locus_tag LOCUS_24690 gene rpsT 1970 2245 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence1087 <1 916 gene locus_tag LOCUS_24700 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529643.1:potassium-transporting ATPase subunit KdpA >Feature sequence1088 <1 875 gene locus_tag LOCUS_24710 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920837.1:mechanosensitive ion channel 2359 794 gene locus_tag LOCUS_24720 gene emrB 2359 794 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence1089 1400 2014 gene locus_tag LOCUS_24730 1400 2014 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence1090 <2528 1634 gene locus_tag LOCUS_24740 <2528 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545576.1:alanine--glyoxylate aminotransferase family protein >Feature sequence1091 478 801 gene locus_tag LOCUS_24750 478 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence1092 435 1046 gene locus_tag LOCUS_24760 435 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1237 1440 gene locus_tag LOCUS_24770 1237 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence1093 1260 421 gene locus_tag LOCUS_24780 1260 421 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_24780 1610 1269 gene locus_tag LOCUS_24790 1610 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 <2527 1815 gene locus_tag LOCUS_24800 <2527 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816645.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase >Feature sequence1094 <2525 1821 gene locus_tag LOCUS_24810 <2525 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927114.1:LPS export ABC transporter ATP-binding protein >Feature sequence1095 424 176 gene locus_tag LOCUS_24820 424 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 935 672 gene locus_tag LOCUS_24830 935 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence1096 >Feature sequence1097 549 1589 gene locus_tag LOCUS_24840 549 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence1098 588 1451 gene locus_tag LOCUS_24850 588 1451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085650.1 protein_id gnl|my_center|LOCUS_24850 1451 1921 gene locus_tag LOCUS_24860 1451 1921 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_24860 <2521 1925 gene locus_tag LOCUS_24870 <2521 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813715.1:glutathione ABC transporter permease GsiC >Feature sequence1099 1745 2521 gene locus_tag LOCUS_24880 1745 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence1100 <1 1614 gene locus_tag LOCUS_24890 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957611.1:DNA polymerase/3'-5' exonuclease PolX 1659 2258 gene locus_tag LOCUS_24900 1659 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 >Feature sequence1101 <2520 255 gene locus_tag LOCUS_24910 <2520 255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389244.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence1102 43 567 gene locus_tag LOCUS_24920 43 567 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_24920 521 1285 gene locus_tag LOCUS_24930 521 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1354 1884 gene locus_tag LOCUS_24940 gene sufT 1354 1884 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_24940 <2520 1891 gene locus_tag LOCUS_24950 <2520 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338417.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence1103 <1 1239 gene locus_tag LOCUS_24960 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005093999.1:geranylgeranyl reductase family protein 1499 1272 gene locus_tag LOCUS_24970 1499 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2136 1714 gene locus_tag LOCUS_24980 2136 1714 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_24980 2417 2133 gene locus_tag LOCUS_24990 2417 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence1104 936 1088 gene locus_tag LOCUS_25000 936 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence1105 1172 126 gene locus_tag LOCUS_25010 1172 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence1106 <2516 1296 gene locus_tag LOCUS_25020 <2516 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:NADP-dependent malic enzyme >Feature sequence1107 1444 269 gene locus_tag LOCUS_25030 1444 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1593 2375 gene locus_tag LOCUS_25040 1593 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence1108 163 549 gene locus_tag LOCUS_25050 163 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1832 762 gene locus_tag LOCUS_25060 1832 762 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929006.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence1109 >Feature sequence1110 <1 1990 gene locus_tag LOCUS_25070 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943700.1:penicillin-binding protein >Feature sequence1111 <1 587 gene locus_tag LOCUS_25080 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104442.1:IS66 family transposase 1010 2341 gene locus_tag LOCUS_25090 1010 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence1112 1826 243 gene locus_tag LOCUS_25100 1826 243 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930845.1 protein_id gnl|my_center|LOCUS_25100 <2512 1841 gene locus_tag LOCUS_25110 <2512 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205096.1:EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit >Feature sequence1113 1306 287 gene locus_tag LOCUS_25120 gene pstS 1306 287 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 protein_id gnl|my_center|LOCUS_25120 2488 1376 gene locus_tag LOCUS_25130 gene phoR 2488 1376 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245011.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence1114 86 1219 gene locus_tag LOCUS_25140 gene mraY 86 1219 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_25140 <2509 1361 gene locus_tag LOCUS_25150 <2509 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence1115 <2509 776 gene locus_tag LOCUS_25160 <2509 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence1116 547 1440 gene locus_tag LOCUS_25170 547 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 <2508 1479 gene locus_tag LOCUS_25180 <2508 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583661.1:trypsin-like peptidase domain-containing protein >Feature sequence1117 552 148 gene locus_tag LOCUS_25190 gene mscL 552 148 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_25190 979 686 gene locus_tag LOCUS_25200 979 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2293 1007 gene locus_tag LOCUS_25210 gene mtnA 2293 1007 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence1118 <1 893 gene locus_tag LOCUS_25220 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000631769.1:glycine cleavage system aminomethyltransferase GcvT 1158 1544 gene locus_tag LOCUS_25230 gene gcvH 1158 1544 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence1119 156 686 gene locus_tag LOCUS_25240 gene cobU 156 686 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938306.1 protein_id gnl|my_center|LOCUS_25240 683 1045 gene locus_tag LOCUS_25250 683 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2096 1644 gene locus_tag LOCUS_25260 2096 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence1120 797 2320 gene locus_tag LOCUS_25270 797 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence1121 403 1584 gene locus_tag LOCUS_25280 403 1584 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence1122 >Feature sequence1123 1898 789 gene locus_tag LOCUS_25290 1898 789 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_25290 <2503 1895 gene locus_tag LOCUS_25300 <2503 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765009.1:TolC family protein >Feature sequence1124 698 78 gene locus_tag LOCUS_25310 698 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence1125 158 349 gene locus_tag LOCUS_25320 158 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 737 1747 gene locus_tag LOCUS_25330 737 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence1126 >Feature sequence1127 487 1089 gene locus_tag LOCUS_25340 487 1089 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_25340 2383 1073 gene locus_tag LOCUS_25350 2383 1073 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918075.1 protein_id gnl|my_center|LOCUS_25350