>Feature sequence001 <1 585 gene locus_tag LOCUS_00010 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005493728.1:endopeptidase La 735 1010 gene locus_tag LOCUS_00020 gene hupB 735 1010 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_00020 1031 1106 gene locus_tag LOCUS_t00010 1031 1106 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1113 1189 gene locus_tag LOCUS_t00020 1113 1189 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1326 3245 gene locus_tag LOCUS_00030 1326 3245 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_00030 5283 3391 gene locus_tag LOCUS_00040 gene parE 5283 3391 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_00040 6305 5478 gene locus_tag LOCUS_00050 6305 5478 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_00050 6479 7294 gene locus_tag LOCUS_00060 6479 7294 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817938.1 protein_id gnl|my_center|LOCUS_00060 7297 8499 gene locus_tag LOCUS_00070 7297 8499 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_00070 8822 11245 gene locus_tag LOCUS_00080 8822 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12502 11300 gene locus_tag LOCUS_00090 12502 11300 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_00090 14185 12554 gene locus_tag LOCUS_00100 14185 12554 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_00100 14818 14252 gene locus_tag LOCUS_00110 gene yeiP 14818 14252 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_00110 15220 14852 gene locus_tag LOCUS_00120 15220 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16380 15220 gene locus_tag LOCUS_00130 16380 15220 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039574.1 protein_id gnl|my_center|LOCUS_00130 17498 16593 gene locus_tag LOCUS_00140 gene argF 17498 16593 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_00140 18683 17508 gene locus_tag LOCUS_00150 18683 17508 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_00150 20337 18823 gene locus_tag LOCUS_00160 20337 18823 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_00160 21314 20427 gene locus_tag LOCUS_00170 21314 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22067 21837 gene locus_tag LOCUS_00180 22067 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22419 22054 gene locus_tag LOCUS_00190 22419 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23057 22419 gene locus_tag LOCUS_00200 23057 22419 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_00200 23208 23711 gene locus_tag LOCUS_00210 23208 23711 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_00210 25083 23869 gene locus_tag LOCUS_00220 25083 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27051 25102 gene locus_tag LOCUS_00230 27051 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27980 27330 gene locus_tag LOCUS_00240 gene pdxH 27980 27330 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_00240 28422 28904 gene locus_tag LOCUS_00250 28422 28904 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772268.1 protein_id gnl|my_center|LOCUS_00250 29710 28952 gene locus_tag LOCUS_00260 29710 28952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770277.1 protein_id gnl|my_center|LOCUS_00260 30185 29778 gene locus_tag LOCUS_00270 30185 29778 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_00270 31357 30182 gene locus_tag LOCUS_00280 31357 30182 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_00280 32597 31413 gene locus_tag LOCUS_00290 32597 31413 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809196.1 protein_id gnl|my_center|LOCUS_00290 34439 33162 gene locus_tag LOCUS_00300 34439 33162 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_00300 34711 35139 gene locus_tag LOCUS_00310 gene dksA 34711 35139 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_00310 35279 36082 gene locus_tag LOCUS_00320 gene gluQRS 35279 36082 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_00320 36191 37093 gene locus_tag LOCUS_00330 36191 37093 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 protein_id gnl|my_center|LOCUS_00330 37173 39011 gene locus_tag LOCUS_00340 37173 39011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39425 39012 gene locus_tag LOCUS_00350 39425 39012 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268622.1 protein_id gnl|my_center|LOCUS_00350 39633 40127 gene locus_tag LOCUS_00360 39633 40127 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 protein_id gnl|my_center|LOCUS_00360 40153 40866 gene locus_tag LOCUS_00370 40153 40866 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_00370 40986 41180 gene locus_tag LOCUS_00380 40986 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41345 42232 gene locus_tag LOCUS_00390 41345 42232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085040.1 protein_id gnl|my_center|LOCUS_00390 42904 42371 gene locus_tag LOCUS_00400 42904 42371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45567 42904 gene locus_tag LOCUS_00410 45567 42904 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176758209.1 protein_id gnl|my_center|LOCUS_00410 45854 46372 gene locus_tag LOCUS_00420 45854 46372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 46369 46809 gene locus_tag LOCUS_00430 46369 46809 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_00430 46824 47630 gene locus_tag LOCUS_00440 46824 47630 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930317.1 protein_id gnl|my_center|LOCUS_00440 47691 48902 gene locus_tag LOCUS_00450 47691 48902 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_00450 48937 51087 gene locus_tag LOCUS_00460 48937 51087 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_00460 51237 53069 gene locus_tag LOCUS_00470 gene mutL 51237 53069 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_00470 53083 54024 gene locus_tag LOCUS_00480 gene miaA 53083 54024 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704169.1 protein_id gnl|my_center|LOCUS_00480 54076 54152 gene locus_tag LOCUS_t00030 54076 54152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 55043 54348 gene locus_tag LOCUS_00490 55043 54348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943846.1 protein_id gnl|my_center|LOCUS_00490 56834 55050 gene locus_tag LOCUS_00500 gene ladS 56834 55050 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_00500 57246 56965 gene locus_tag LOCUS_00510 57246 56965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57506 63217 gene locus_tag LOCUS_00520 57506 63217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63490 63897 gene locus_tag LOCUS_00530 63490 63897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00530 64208 64603 gene locus_tag LOCUS_00540 64208 64603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66662 64671 gene locus_tag LOCUS_00550 66662 64671 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_00550 68288 66681 gene locus_tag LOCUS_00560 68288 66681 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_00560 69672 68485 gene locus_tag LOCUS_00570 69672 68485 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_00570 69931 72804 gene locus_tag LOCUS_00580 69931 72804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 72912 74321 gene locus_tag LOCUS_00590 72912 74321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 74377 75564 gene locus_tag LOCUS_00600 74377 75564 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_00600 75561 76802 gene locus_tag LOCUS_00610 75561 76802 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_00610 77292 78095 gene locus_tag LOCUS_00620 gene rpsB 77292 78095 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 protein_id gnl|my_center|LOCUS_00620 78311 79186 gene locus_tag LOCUS_00630 gene tsf 78311 79186 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_00630 79231 79959 gene locus_tag LOCUS_00640 gene pyrH 79231 79959 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_00640 79961 80518 gene locus_tag LOCUS_00650 gene frr 79961 80518 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262432.1 protein_id gnl|my_center|LOCUS_00650 80557 81315 gene locus_tag LOCUS_00660 gene uppS 80557 81315 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_00660 81308 82123 gene locus_tag LOCUS_00670 81308 82123 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266974.1 protein_id gnl|my_center|LOCUS_00670 82155 83354 gene locus_tag LOCUS_00680 82155 83354 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193915.1 protein_id gnl|my_center|LOCUS_00680 83354 84721 gene locus_tag LOCUS_00690 gene rseP 83354 84721 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 protein_id gnl|my_center|LOCUS_00690 84832 87126 gene locus_tag LOCUS_00700 gene bamA 84832 87126 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_00700 87305 87847 gene locus_tag LOCUS_00710 87305 87847 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037416754.1 protein_id gnl|my_center|LOCUS_00710 87853 88863 gene locus_tag LOCUS_00720 gene lpxD 87853 88863 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_00720 88876 89325 gene locus_tag LOCUS_00730 gene fabZ 88876 89325 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_00730 89322 90092 gene locus_tag LOCUS_00740 gene lpxA 89322 90092 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103594.1 protein_id gnl|my_center|LOCUS_00740 91235 90096 gene locus_tag LOCUS_00750 gene lpxB 91235 90096 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_00750 92338 91244 gene locus_tag LOCUS_00760 92338 91244 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_00760 93722 92424 gene locus_tag LOCUS_00770 93722 92424 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 protein_id gnl|my_center|LOCUS_00770 95420 93870 gene locus_tag LOCUS_00780 95420 93870 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_00780 96691 95417 gene locus_tag LOCUS_00790 96691 95417 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 protein_id gnl|my_center|LOCUS_00790 98629 96707 gene locus_tag LOCUS_00800 98629 96707 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_00800 99224 99811 gene locus_tag LOCUS_00810 gene rnhB 99224 99811 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927570.1 protein_id gnl|my_center|LOCUS_00810 99808 103317 gene locus_tag LOCUS_00820 gene dnaE 99808 103317 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001909664.1 protein_id gnl|my_center|LOCUS_00820 103381 104343 gene locus_tag LOCUS_00830 gene accA 103381 104343 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377825.1 protein_id gnl|my_center|LOCUS_00830 104369 105682 gene locus_tag LOCUS_00840 gene tilS 104369 105682 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_00840 105804 107432 gene locus_tag LOCUS_00850 105804 107432 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_00850 107555 109798 gene locus_tag LOCUS_00860 107555 109798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 110371 109808 gene locus_tag LOCUS_00870 110371 109808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 112050 110455 gene locus_tag LOCUS_00880 112050 110455 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_00880 112154 113098 gene locus_tag LOCUS_00890 112154 113098 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_00890 113238 115406 gene locus_tag LOCUS_00900 113238 115406 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_00900 115879 116898 gene locus_tag LOCUS_00910 115879 116898 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_00910 116913 117365 gene locus_tag LOCUS_00920 116913 117365 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268272.1 protein_id gnl|my_center|LOCUS_00920 117408 118484 gene locus_tag LOCUS_00930 gene mnmA 117408 118484 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_00930 118484 119113 gene locus_tag LOCUS_00940 gene hflD 118484 119113 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072581.1 protein_id gnl|my_center|LOCUS_00940 119294 119710 gene locus_tag LOCUS_00950 119294 119710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 119917 122070 gene locus_tag LOCUS_00960 119917 122070 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_00960 122250 124301 gene locus_tag LOCUS_00970 122250 124301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 125329 124478 gene locus_tag LOCUS_00980 125329 124478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 127688 125706 gene locus_tag LOCUS_00990 127688 125706 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_00990 129642 127681 gene locus_tag LOCUS_01000 129642 127681 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_01000 130517 129681 gene locus_tag LOCUS_01010 130517 129681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_01010 132788 130674 gene locus_tag LOCUS_01020 132788 130674 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_01020 133330 132788 gene locus_tag LOCUS_01030 gene pilP 133330 132788 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_01030 133940 133332 gene locus_tag LOCUS_01040 133940 133332 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_01040 134507 133950 gene locus_tag LOCUS_01050 134507 133950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 135568 134507 gene locus_tag LOCUS_01060 135568 134507 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_01060 135772 138171 gene locus_tag LOCUS_01070 135772 138171 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_01070 138291 140861 gene locus_tag LOCUS_01080 gene gyrA 138291 140861 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_01080 140917 141996 gene locus_tag LOCUS_01090 gene serC 140917 141996 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211326.1 protein_id gnl|my_center|LOCUS_01090 142003 143166 gene locus_tag LOCUS_01100 142003 143166 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_01100 143211 144296 gene locus_tag LOCUS_01110 gene pheA 143211 144296 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_01110 144309 145442 gene locus_tag LOCUS_01120 gene hisC 144309 145442 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_01120 145435 146298 gene locus_tag LOCUS_01130 145435 146298 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066770.1 protein_id gnl|my_center|LOCUS_01130 146295 147617 gene locus_tag LOCUS_01140 146295 147617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01140 147607 148302 gene locus_tag LOCUS_01150 gene cmk 147607 148302 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042611231.1 protein_id gnl|my_center|LOCUS_01150 148432 150108 gene locus_tag LOCUS_01160 gene rpsA 148432 150108 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_01160 150165 150470 gene locus_tag LOCUS_01170 150165 150470 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_01170 150560 151285 gene locus_tag LOCUS_01180 gene pyrF 150560 151285 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210613.1 protein_id gnl|my_center|LOCUS_01180 151475 153346 gene locus_tag LOCUS_01190 151475 153346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 153351 154043 gene locus_tag LOCUS_01200 153351 154043 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_01200 154164 155951 gene locus_tag LOCUS_01210 154164 155951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 156894 156031 gene locus_tag LOCUS_01220 gene rsgA 156894 156031 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 protein_id gnl|my_center|LOCUS_01220 157052 157597 gene locus_tag LOCUS_01230 gene orn 157052 157597 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_01230 157658 158428 gene locus_tag LOCUS_01240 157658 158428 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_01240 158483 158692 gene locus_tag LOCUS_01250 158483 158692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 158770 159015 gene locus_tag LOCUS_01260 158770 159015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01260 159003 159158 gene locus_tag LOCUS_01270 159003 159158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01270 159240 159488 gene locus_tag LOCUS_01280 159240 159488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 159624 162104 gene locus_tag LOCUS_01290 159624 162104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 162222 162716 gene locus_tag LOCUS_01300 162222 162716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 162791 162866 gene locus_tag LOCUS_t00040 162791 162866 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 165251 162909 gene locus_tag LOCUS_01310 165251 162909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 166220 165327 gene locus_tag LOCUS_01320 166220 165327 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_01320 166665 168428 gene locus_tag LOCUS_01330 166665 168428 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_01330 169633 168422 gene locus_tag LOCUS_01340 169633 168422 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_01340 170461 169637 gene locus_tag LOCUS_01350 170461 169637 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 protein_id gnl|my_center|LOCUS_01350 170614 171801 gene locus_tag LOCUS_01360 170614 171801 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_01360 171804 172127 gene locus_tag LOCUS_01370 gene glpE 171804 172127 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957677.1 protein_id gnl|my_center|LOCUS_01370 172148 172369 gene locus_tag LOCUS_01380 172148 172369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 172764 172381 gene locus_tag LOCUS_01390 gene acpS 172764 172381 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211568.1 protein_id gnl|my_center|LOCUS_01390 173498 172761 gene locus_tag LOCUS_01400 gene pdxJ 173498 172761 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 protein_id gnl|my_center|LOCUS_01400 173643 174794 gene locus_tag LOCUS_01410 173643 174794 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_01410 174862 176010 gene locus_tag LOCUS_01420 174862 176010 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_01420 176758 176099 gene locus_tag LOCUS_01430 176758 176099 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_01430 176880 177680 gene locus_tag LOCUS_01440 176880 177680 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_01440 177849 178772 gene locus_tag LOCUS_01450 177849 178772 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086302.1 protein_id gnl|my_center|LOCUS_01450 179307 178933 gene locus_tag LOCUS_01460 179307 178933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175101.1 protein_id gnl|my_center|LOCUS_01460 179516 179893 gene locus_tag LOCUS_01470 179516 179893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105252.1 protein_id gnl|my_center|LOCUS_01470 179890 180081 gene locus_tag LOCUS_01480 179890 180081 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867752.1 protein_id gnl|my_center|LOCUS_01480 180105 180488 gene locus_tag LOCUS_01490 180105 180488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01490 180636 181931 gene locus_tag LOCUS_01500 180636 181931 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039185890.1 protein_id gnl|my_center|LOCUS_01500 181935 182666 gene locus_tag LOCUS_01510 181935 182666 CDS product (S)-benzoin forming benzil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244421.1 protein_id gnl|my_center|LOCUS_01510 183020 182688 gene locus_tag LOCUS_01520 183020 182688 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_01520 183141 184136 gene locus_tag LOCUS_01530 183141 184136 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554476.1 protein_id gnl|my_center|LOCUS_01530 184208 185107 gene locus_tag LOCUS_01540 184208 185107 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_01540 185130 185636 gene locus_tag LOCUS_01550 185130 185636 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021659.1 protein_id gnl|my_center|LOCUS_01550 185629 186609 gene locus_tag LOCUS_01560 185629 186609 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_01560 186606 187601 gene locus_tag LOCUS_01570 186606 187601 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021652.1 protein_id gnl|my_center|LOCUS_01570 187598 188428 gene locus_tag LOCUS_01580 187598 188428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 188422 190119 gene locus_tag LOCUS_01590 188422 190119 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_01590 192002 190311 gene locus_tag LOCUS_01600 192002 190311 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_01600 193123 192032 gene locus_tag LOCUS_01610 gene trpD 193123 192032 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_01610 195139 193148 gene locus_tag LOCUS_01620 195139 193148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 196360 195281 gene locus_tag LOCUS_01630 196360 195281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 196519 197811 gene locus_tag LOCUS_01640 gene hemL 196519 197811 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243834.1 protein_id gnl|my_center|LOCUS_01640 197814 198638 gene locus_tag LOCUS_01650 197814 198638 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_01650 199534 198671 gene locus_tag LOCUS_01660 199534 198671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 199700 200713 gene locus_tag LOCUS_01670 gene moaA 199700 200713 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_01670 200716 201240 gene locus_tag LOCUS_01680 gene moaB 200716 201240 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_01680 202062 201289 gene locus_tag LOCUS_01690 202062 201289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 202827 204437 gene locus_tag LOCUS_01700 202827 204437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_01700 204661 205617 gene locus_tag LOCUS_01710 204661 205617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_01710 205628 206689 gene locus_tag LOCUS_01720 205628 206689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307726.1 protein_id gnl|my_center|LOCUS_01720 206694 208364 gene locus_tag LOCUS_01730 206694 208364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_01730 209088 208528 gene locus_tag LOCUS_01740 209088 208528 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_01740 209204 210118 gene locus_tag LOCUS_01750 209204 210118 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705501.1 protein_id gnl|my_center|LOCUS_01750 210919 210101 gene locus_tag LOCUS_01760 210919 210101 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073859065.1 protein_id gnl|my_center|LOCUS_01760 213112 210959 gene locus_tag LOCUS_01770 gene fimX 213112 210959 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_01770 213302 213871 gene locus_tag LOCUS_01780 gene efp 213302 213871 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_01780 213883 214854 gene locus_tag LOCUS_01790 gene epmA 213883 214854 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 protein_id gnl|my_center|LOCUS_01790 214847 215359 gene locus_tag LOCUS_01800 214847 215359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_01800 216412 215426 gene locus_tag LOCUS_01810 gene asd 216412 215426 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_01810 216566 217477 gene locus_tag LOCUS_01820 gene prmB 216566 217477 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306448.1 protein_id gnl|my_center|LOCUS_01820 217983 217621 gene locus_tag LOCUS_01830 217983 217621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 218297 218085 gene locus_tag LOCUS_01840 218297 218085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01840 219995 218787 gene locus_tag LOCUS_01850 gene chrA 219995 218787 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 protein_id gnl|my_center|LOCUS_01850 220600 220397 gene locus_tag LOCUS_01860 220600 220397 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943568.1 protein_id gnl|my_center|LOCUS_01860 221105 220731 gene locus_tag LOCUS_01870 221105 220731 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920811.1 protein_id gnl|my_center|LOCUS_01870 221731 221102 gene locus_tag LOCUS_01880 221731 221102 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_01880 221913 222200 gene locus_tag LOCUS_01890 221913 222200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 222935 223531 gene locus_tag LOCUS_01900 222935 223531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 223572 224432 gene locus_tag LOCUS_01910 223572 224432 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460600.1 protein_id gnl|my_center|LOCUS_01910 225183 224416 gene locus_tag LOCUS_01920 225183 224416 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_01920 227546 225270 gene locus_tag LOCUS_01930 227546 225270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 228428 227655 gene locus_tag LOCUS_01940 228428 227655 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_01940 228501 229133 gene locus_tag LOCUS_01950 228501 229133 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_01950 229186 229815 gene locus_tag LOCUS_01960 229186 229815 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_01960 229820 230617 gene locus_tag LOCUS_01970 229820 230617 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_01970 230633 231403 gene locus_tag LOCUS_01980 230633 231403 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448626.1 protein_id gnl|my_center|LOCUS_01980 231696 231944 gene locus_tag LOCUS_01990 231696 231944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 232136 234298 gene locus_tag LOCUS_02000 232136 234298 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_02000 234325 235044 gene locus_tag LOCUS_02010 234325 235044 CDS product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 protein_id gnl|my_center|LOCUS_02010 235086 235325 gene locus_tag LOCUS_02020 235086 235325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 235463 236374 gene locus_tag LOCUS_02030 gene rdgC 235463 236374 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_02030 237815 236601 gene locus_tag LOCUS_02040 237815 236601 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089133.1 protein_id gnl|my_center|LOCUS_02040 237934 238536 gene locus_tag LOCUS_02050 237934 238536 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_02050 239749 238550 gene locus_tag LOCUS_02060 239749 238550 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099096086.1 protein_id gnl|my_center|LOCUS_02060 240286 239909 gene locus_tag LOCUS_02070 240286 239909 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815550.1 protein_id gnl|my_center|LOCUS_02070 240699 240298 gene locus_tag LOCUS_02080 240699 240298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815548.1 protein_id gnl|my_center|LOCUS_02080 241134 240709 gene locus_tag LOCUS_02090 241134 240709 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_02090 242291 241131 gene locus_tag LOCUS_02100 242291 241131 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_02100 243455 242334 gene locus_tag LOCUS_02110 243455 242334 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_02110 243601 244449 gene locus_tag LOCUS_02120 gene nadC 243601 244449 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017019488.1 protein_id gnl|my_center|LOCUS_02120 244470 245714 gene locus_tag LOCUS_02130 244470 245714 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_02130 245729 246301 gene locus_tag LOCUS_02140 245729 246301 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_02140 246294 246932 gene locus_tag LOCUS_02150 gene thiE 246294 246932 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_02150 247749 246973 gene locus_tag LOCUS_02160 247749 246973 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_02160 247929 248795 gene locus_tag LOCUS_02170 247929 248795 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261558.1 protein_id gnl|my_center|LOCUS_02170 249034 249858 gene locus_tag LOCUS_02180 gene xthA 249034 249858 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942186.1 protein_id gnl|my_center|LOCUS_02180 250220 249906 gene locus_tag LOCUS_02190 250220 249906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 250729 250220 gene locus_tag LOCUS_02200 gene sodN 250729 250220 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_02200 251519 252796 gene locus_tag LOCUS_02210 251519 252796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 254259 252844 gene locus_tag LOCUS_02220 254259 252844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 259394 254559 gene locus_tag LOCUS_02230 259394 254559 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_02230 259622 260167 gene locus_tag LOCUS_02240 259622 260167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 260867 260130 gene locus_tag LOCUS_02250 260867 260130 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103822.1 protein_id gnl|my_center|LOCUS_02250 262063 260864 gene locus_tag LOCUS_02260 262063 260864 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_02260 262175 263104 gene locus_tag LOCUS_02270 262175 263104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 263169 263723 gene locus_tag LOCUS_02280 263169 263723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 263723 264169 gene locus_tag LOCUS_02290 263723 264169 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_02290 265060 264323 gene locus_tag LOCUS_02300 265060 264323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 266204 265134 gene locus_tag LOCUS_02310 gene rsgA 266204 265134 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 protein_id gnl|my_center|LOCUS_02310 268521 266608 gene locus_tag LOCUS_02320 268521 266608 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_02320 269726 268578 gene locus_tag LOCUS_02330 269726 268578 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_02330 271123 269741 gene locus_tag LOCUS_02340 271123 269741 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_02340 273102 271120 gene locus_tag LOCUS_02350 273102 271120 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence002 103 852 gene locus_tag LOCUS_02360 103 852 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862533.1 protein_id gnl|my_center|LOCUS_02360 892 1416 gene locus_tag LOCUS_02370 892 1416 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633782.1 protein_id gnl|my_center|LOCUS_02370 1546 1980 gene locus_tag LOCUS_02380 1546 1980 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_02380 2189 2113 gene locus_tag LOCUS_t00050 2189 2113 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2412 4175 gene locus_tag LOCUS_02390 gene acsA 2412 4175 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 protein_id gnl|my_center|LOCUS_02390 4172 5161 gene locus_tag LOCUS_02400 gene pdhA 4172 5161 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_02400 5154 6164 gene locus_tag LOCUS_02410 5154 6164 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_02410 6157 7302 gene locus_tag LOCUS_02420 6157 7302 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229325.1 protein_id gnl|my_center|LOCUS_02420 7299 7550 gene locus_tag LOCUS_02430 7299 7550 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_02430 9955 7520 gene locus_tag LOCUS_02440 gene ppsA 9955 7520 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087424.1 protein_id gnl|my_center|LOCUS_02440 10318 10037 gene locus_tag LOCUS_02450 10318 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11169 10369 gene locus_tag LOCUS_02460 11169 10369 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814689.1 protein_id gnl|my_center|LOCUS_02460 11260 12798 gene locus_tag LOCUS_02470 11260 12798 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_02470 12862 14094 gene locus_tag LOCUS_02480 12862 14094 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089076.1 protein_id gnl|my_center|LOCUS_02480 14105 14626 gene locus_tag LOCUS_02490 14105 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15905 14757 gene locus_tag LOCUS_02500 15905 14757 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815551.1 protein_id gnl|my_center|LOCUS_02500 16831 15902 gene locus_tag LOCUS_02510 16831 15902 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_02510 17140 17931 gene locus_tag LOCUS_02520 17140 17931 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_02520 18239 19273 gene locus_tag LOCUS_02530 18239 19273 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_02530 19280 20224 gene locus_tag LOCUS_02540 19280 20224 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_02540 20221 20901 gene locus_tag LOCUS_02550 gene pgl 20221 20901 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 protein_id gnl|my_center|LOCUS_02550 20966 21757 gene locus_tag LOCUS_02560 20966 21757 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_02560 21768 22388 gene locus_tag LOCUS_02570 21768 22388 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_02570 23416 22460 gene locus_tag LOCUS_02580 23416 22460 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704945.1 protein_id gnl|my_center|LOCUS_02580 24148 23480 gene locus_tag LOCUS_02590 gene coxH3 24148 23480 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_02590 24987 24190 gene locus_tag LOCUS_02600 24987 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 25630 25100 gene locus_tag LOCUS_02610 25630 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 26049 25630 gene locus_tag LOCUS_02620 26049 25630 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_02620 26923 26081 gene locus_tag LOCUS_02630 26923 26081 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_02630 27552 26935 gene locus_tag LOCUS_02640 27552 26935 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_02640 27963 27577 gene locus_tag LOCUS_02650 gene apaG 27963 27577 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 protein_id gnl|my_center|LOCUS_02650 28837 28043 gene locus_tag LOCUS_02660 gene rsmA 28837 28043 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_02660 29423 29797 gene locus_tag LOCUS_02670 29423 29797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 29923 30522 gene locus_tag LOCUS_02680 29923 30522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 31500 30688 gene locus_tag LOCUS_02690 31500 30688 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262760.1 protein_id gnl|my_center|LOCUS_02690 32222 31500 gene locus_tag LOCUS_02700 32222 31500 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262759.1 protein_id gnl|my_center|LOCUS_02700 32386 33792 gene locus_tag LOCUS_02710 32386 33792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 34948 33962 gene locus_tag LOCUS_02720 34948 33962 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081833.1 protein_id gnl|my_center|LOCUS_02720 35641 34970 gene locus_tag LOCUS_02730 35641 34970 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703175.1 protein_id gnl|my_center|LOCUS_02730 36184 35669 gene locus_tag LOCUS_02740 gene zur 36184 35669 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_02740 37562 36906 gene locus_tag LOCUS_02750 37562 36906 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228201.1 protein_id gnl|my_center|LOCUS_02750 37657 38922 gene locus_tag LOCUS_02760 gene fabF 37657 38922 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973649.1 protein_id gnl|my_center|LOCUS_02760 39356 40360 gene locus_tag LOCUS_02770 gene glk 39356 40360 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815870.1 protein_id gnl|my_center|LOCUS_02770 41030 40674 gene locus_tag LOCUS_02780 41030 40674 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243177.1 protein_id gnl|my_center|LOCUS_02780 41694 41023 gene locus_tag LOCUS_02790 41694 41023 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243178.1 protein_id gnl|my_center|LOCUS_02790 43232 41691 gene locus_tag LOCUS_02800 43232 41691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243179.1 protein_id gnl|my_center|LOCUS_02800 43917 43240 gene locus_tag LOCUS_02810 43917 43240 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606634.1 protein_id gnl|my_center|LOCUS_02810 44850 43927 gene locus_tag LOCUS_02820 44850 43927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243444.1 protein_id gnl|my_center|LOCUS_02820 45947 44847 gene locus_tag LOCUS_02830 45947 44847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243181.1 protein_id gnl|my_center|LOCUS_02830 47090 45966 gene locus_tag LOCUS_02840 47090 45966 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243182.1 protein_id gnl|my_center|LOCUS_02840 48753 47749 gene locus_tag LOCUS_02850 gene pdxA 48753 47749 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_02850 50146 48764 gene locus_tag LOCUS_02860 50146 48764 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_02860 52241 50118 gene locus_tag LOCUS_02870 gene lptD 52241 50118 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_02870 52384 53091 gene locus_tag LOCUS_02880 gene ung 52384 53091 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_02880 53140 54333 gene locus_tag LOCUS_02890 53140 54333 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931022.1 protein_id gnl|my_center|LOCUS_02890 54614 55867 gene locus_tag LOCUS_02900 54614 55867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 56092 57837 gene locus_tag LOCUS_02910 gene aceK 56092 57837 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_02910 57921 58349 gene locus_tag LOCUS_02920 gene rplM 57921 58349 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847599.1 protein_id gnl|my_center|LOCUS_02920 58385 58777 gene locus_tag LOCUS_02930 gene rpsI 58385 58777 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_02930 59520 58855 gene locus_tag LOCUS_02940 gene rpiA 59520 58855 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770348.1 protein_id gnl|my_center|LOCUS_02940 60029 59520 gene locus_tag LOCUS_02950 gene rutF 60029 59520 CDS product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312118.1 protein_id gnl|my_center|LOCUS_02950 60786 60070 gene locus_tag LOCUS_02960 60786 60070 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728466.1 protein_id gnl|my_center|LOCUS_02960 61033 62166 gene locus_tag LOCUS_02970 61033 62166 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_02970 62226 63353 gene locus_tag LOCUS_02980 62226 63353 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931674.1 protein_id gnl|my_center|LOCUS_02980 63375 64166 gene locus_tag LOCUS_02990 63375 64166 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088784.1 protein_id gnl|my_center|LOCUS_02990 64795 64163 gene locus_tag LOCUS_03000 64795 64163 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_03000 66536 65172 gene locus_tag LOCUS_03010 66536 65172 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 protein_id gnl|my_center|LOCUS_03010 67000 66572 gene locus_tag LOCUS_03020 67000 66572 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087727.1 protein_id gnl|my_center|LOCUS_03020 67120 67902 gene locus_tag LOCUS_03030 67120 67902 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_03030 67909 68691 gene locus_tag LOCUS_03040 gene cmoM 67909 68691 CDS product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154025.1 protein_id gnl|my_center|LOCUS_03040 68786 70117 gene locus_tag LOCUS_03050 68786 70117 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081268.1 protein_id gnl|my_center|LOCUS_03050 70117 71133 gene locus_tag LOCUS_03060 70117 71133 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_03060 72070 71171 gene locus_tag LOCUS_03070 72070 71171 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_03070 72583 72128 gene locus_tag LOCUS_03080 72583 72128 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 protein_id gnl|my_center|LOCUS_03080 72637 73179 gene locus_tag LOCUS_03090 gene hutZ 72637 73179 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073462.1 protein_id gnl|my_center|LOCUS_03090 73980 73210 gene locus_tag LOCUS_03100 73980 73210 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_03100 75110 73968 gene locus_tag LOCUS_03110 75110 73968 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_03110 76335 75166 gene locus_tag LOCUS_03120 76335 75166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 77217 76507 gene locus_tag LOCUS_03130 77217 76507 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_03130 78154 77339 gene locus_tag LOCUS_03140 78154 77339 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_03140 78316 79275 gene locus_tag LOCUS_03150 78316 79275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 79272 81398 gene locus_tag LOCUS_03160 79272 81398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 81401 82213 gene locus_tag LOCUS_03170 gene mutM 81401 82213 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369156.1 protein_id gnl|my_center|LOCUS_03170 82881 82189 gene locus_tag LOCUS_03180 82881 82189 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070665.1 protein_id gnl|my_center|LOCUS_03180 83543 82881 gene locus_tag LOCUS_03190 gene rpe 83543 82881 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739815.1 protein_id gnl|my_center|LOCUS_03190 85822 83741 gene locus_tag LOCUS_03200 gene fusA 85822 83741 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_03200 86535 86062 gene locus_tag LOCUS_03210 86535 86062 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_03210 86622 87431 gene locus_tag LOCUS_03220 86622 87431 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_03220 87488 89170 gene locus_tag LOCUS_03230 gene ggt 87488 89170 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_03230 90787 89414 gene locus_tag LOCUS_03240 90787 89414 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743136.1 protein_id gnl|my_center|LOCUS_03240 91233 90781 gene locus_tag LOCUS_03250 91233 90781 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534145.1 protein_id gnl|my_center|LOCUS_03250 91485 92411 gene locus_tag LOCUS_03260 91485 92411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 92521 94950 gene locus_tag LOCUS_03270 gene gspD 92521 94950 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086028586.1 protein_id gnl|my_center|LOCUS_03270 94952 96478 gene locus_tag LOCUS_03280 gene xcpR 94952 96478 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_03280 96484 97704 gene locus_tag LOCUS_03290 gene xcpS 96484 97704 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_03290 99074 97701 gene locus_tag LOCUS_03300 99074 97701 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802062.1 protein_id gnl|my_center|LOCUS_03300 99332 100201 gene locus_tag LOCUS_03310 99332 100201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 100350 101492 gene locus_tag LOCUS_03320 100350 101492 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 protein_id gnl|my_center|LOCUS_03320 101532 102590 gene locus_tag LOCUS_03330 101532 102590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_03330 104035 102617 gene locus_tag LOCUS_03340 104035 102617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_03340 104272 104601 gene locus_tag LOCUS_03350 104272 104601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 104634 104873 gene locus_tag LOCUS_03360 104634 104873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 106313 104886 gene locus_tag LOCUS_03370 106313 104886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 107032 106310 gene locus_tag LOCUS_03380 107032 106310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_03380 107222 107731 gene locus_tag LOCUS_03390 107222 107731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 108652 107822 gene locus_tag LOCUS_03400 108652 107822 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_03400 109158 108691 gene locus_tag LOCUS_03410 109158 108691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 109303 110169 gene locus_tag LOCUS_03420 109303 110169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 110177 110713 gene locus_tag LOCUS_03430 110177 110713 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_03430 110798 112018 gene locus_tag LOCUS_03440 gene aspB 110798 112018 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_03440 112565 112095 gene locus_tag LOCUS_03450 112565 112095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 113147 112656 gene locus_tag LOCUS_03460 113147 112656 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_03460 113935 113258 gene locus_tag LOCUS_03470 113935 113258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 114717 113956 gene locus_tag LOCUS_03480 114717 113956 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_03480 115489 114725 gene locus_tag LOCUS_03490 gene motD 115489 114725 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_03490 116240 115476 gene locus_tag LOCUS_03500 116240 115476 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_03500 118295 116388 gene locus_tag LOCUS_03510 118295 116388 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_03510 119484 118306 gene locus_tag LOCUS_03520 119484 118306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_03520 119658 120353 gene locus_tag LOCUS_03530 119658 120353 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_03530 120343 121605 gene locus_tag LOCUS_03540 120343 121605 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 protein_id gnl|my_center|LOCUS_03540 121756 122289 gene locus_tag LOCUS_03550 121756 122289 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 protein_id gnl|my_center|LOCUS_03550 122323 122898 gene locus_tag LOCUS_03560 122323 122898 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_03560 122895 123683 gene locus_tag LOCUS_03570 122895 123683 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266741.1 protein_id gnl|my_center|LOCUS_03570 123680 124921 gene locus_tag LOCUS_03580 123680 124921 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768840.1 protein_id gnl|my_center|LOCUS_03580 124918 125688 gene locus_tag LOCUS_03590 124918 125688 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_03590 125688 126941 gene locus_tag LOCUS_03600 125688 126941 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_03600 126977 127525 gene locus_tag LOCUS_03610 126977 127525 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_03610 127553 128947 gene locus_tag LOCUS_03620 gene phrB 127553 128947 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768836.1 protein_id gnl|my_center|LOCUS_03620 129404 128952 gene locus_tag LOCUS_03630 129404 128952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 130723 129401 gene locus_tag LOCUS_03640 130723 129401 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_03640 131507 130716 gene locus_tag LOCUS_03650 131507 130716 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_03650 133458 131509 gene locus_tag LOCUS_03660 133458 131509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 133942 133475 gene locus_tag LOCUS_03670 133942 133475 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971831.1 protein_id gnl|my_center|LOCUS_03670 135622 134096 gene locus_tag LOCUS_03680 135622 134096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 135909 136277 gene locus_tag LOCUS_03690 135909 136277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 136295 137161 gene locus_tag LOCUS_03700 gene atpB 136295 137161 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_03700 137195 137434 gene locus_tag LOCUS_03710 137195 137434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 137511 137981 gene locus_tag LOCUS_03720 137511 137981 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_03720 138002 138535 gene locus_tag LOCUS_03730 gene atpH 138002 138535 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175171.1 protein_id gnl|my_center|LOCUS_03730 138589 140130 gene locus_tag LOCUS_03740 gene atpA 138589 140130 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_03740 140157 141020 gene locus_tag LOCUS_03750 gene atpG 140157 141020 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_03750 141058 142434 gene locus_tag LOCUS_03760 gene atpD 141058 142434 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_03760 142451 142870 gene locus_tag LOCUS_03770 142451 142870 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_03770 142947 143105 gene locus_tag LOCUS_03780 142947 143105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 143657 143478 gene locus_tag LOCUS_03790 143657 143478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 144679 144374 gene locus_tag LOCUS_03800 144679 144374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03800 144992 146389 gene locus_tag LOCUS_03810 gene fumC 144992 146389 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057374.1 protein_id gnl|my_center|LOCUS_03810 147550 146474 gene locus_tag LOCUS_03820 gene corA 147550 146474 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_03820 151149 147640 gene locus_tag LOCUS_03830 151149 147640 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615508.1 protein_id gnl|my_center|LOCUS_03830 151380 151679 gene locus_tag LOCUS_03840 151380 151679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 151609 151803 gene locus_tag LOCUS_03850 151609 151803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 152155 151865 gene locus_tag LOCUS_03860 152155 151865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 152376 152131 gene locus_tag LOCUS_03870 152376 152131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03870 152825 152421 gene locus_tag LOCUS_03880 152825 152421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 153040 152801 gene locus_tag LOCUS_03890 153040 152801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 153173 153934 gene locus_tag LOCUS_03900 153173 153934 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957845.1 protein_id gnl|my_center|LOCUS_03900 153934 154569 gene locus_tag LOCUS_03910 153934 154569 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_03910 155698 154646 gene locus_tag LOCUS_03920 155698 154646 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_03920 156608 155703 gene locus_tag LOCUS_03930 gene rimK 156608 155703 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_03930 157296 156754 gene locus_tag LOCUS_03940 157296 156754 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_03940 158183 157323 gene locus_tag LOCUS_03950 158183 157323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_03950 158663 158259 gene locus_tag LOCUS_03960 gene hslR 158663 158259 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703665.1 protein_id gnl|my_center|LOCUS_03960 158717 159370 gene locus_tag LOCUS_03970 158717 159370 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_03970 159677 160081 gene locus_tag LOCUS_03980 159677 160081 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931351.1 protein_id gnl|my_center|LOCUS_03980 160078 161229 gene locus_tag LOCUS_03990 160078 161229 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_03990 161289 162422 gene locus_tag LOCUS_04000 161289 162422 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_04000 162840 162553 gene locus_tag LOCUS_04010 162840 162553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 164382 163135 gene locus_tag LOCUS_04020 164382 163135 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_04020 165508 164639 gene locus_tag LOCUS_04030 165508 164639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 167384 165843 gene locus_tag LOCUS_04040 gene gpmI 167384 165843 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_04040 167519 168379 gene locus_tag LOCUS_04050 gene ttcA 167519 168379 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_04050 168387 169109 gene locus_tag LOCUS_04060 168387 169109 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_04060 169650 169096 gene locus_tag LOCUS_04070 gene kdsC 169650 169096 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_04070 170483 169650 gene locus_tag LOCUS_04080 gene kdsA 170483 169650 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_04080 170668 171759 gene locus_tag LOCUS_04090 170668 171759 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_04090 171756 172766 gene locus_tag LOCUS_04100 171756 172766 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_04100 172799 174034 gene locus_tag LOCUS_04110 172799 174034 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_04110 174058 175293 gene locus_tag LOCUS_04120 174058 175293 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929806.1 protein_id gnl|my_center|LOCUS_04120 175329 175718 gene locus_tag LOCUS_04130 175329 175718 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025575720.1 protein_id gnl|my_center|LOCUS_04130 177767 175764 gene locus_tag LOCUS_04140 177767 175764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 178622 177771 gene locus_tag LOCUS_04150 178622 177771 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_04150 178948 178619 gene locus_tag LOCUS_04160 178948 178619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943213.1 protein_id gnl|my_center|LOCUS_04160 180345 179119 gene locus_tag LOCUS_04170 180345 179119 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_04170 181475 180393 gene locus_tag LOCUS_04180 181475 180393 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 protein_id gnl|my_center|LOCUS_04180 181490 182734 gene locus_tag LOCUS_04190 gene cca 181490 182734 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_04190 183908 182697 gene locus_tag LOCUS_04200 gene ispG 183908 182697 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_04200 184457 183912 gene locus_tag LOCUS_04210 gene mug 184457 183912 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228931.1 protein_id gnl|my_center|LOCUS_04210 184495 184680 gene locus_tag LOCUS_04220 184495 184680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 185296 184685 gene locus_tag LOCUS_04230 185296 184685 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456632.1 protein_id gnl|my_center|LOCUS_04230 186091 185315 gene locus_tag LOCUS_04240 gene yaaA 186091 185315 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_04240 186927 186184 gene locus_tag LOCUS_04250 186927 186184 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387878.1 protein_id gnl|my_center|LOCUS_04250 187646 186996 gene locus_tag LOCUS_04260 187646 186996 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_04260 188497 187766 gene locus_tag LOCUS_04270 188497 187766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387872.1 protein_id gnl|my_center|LOCUS_04270 189276 188497 gene locus_tag LOCUS_04280 189276 188497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 189557 191023 gene locus_tag LOCUS_04290 189557 191023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 191862 191029 gene locus_tag LOCUS_04300 191862 191029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 193280 191847 gene locus_tag LOCUS_04310 193280 191847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 193766 193293 gene locus_tag LOCUS_04320 193766 193293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 194388 193747 gene locus_tag LOCUS_04330 194388 193747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 195950 194385 gene locus_tag LOCUS_04340 195950 194385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 197158 195950 gene locus_tag LOCUS_04350 197158 195950 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_04350 198858 197161 gene locus_tag LOCUS_04360 198858 197161 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_04360 200239 198878 gene locus_tag LOCUS_04370 200239 198878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 201921 200236 gene locus_tag LOCUS_04380 201921 200236 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_04380 203365 201911 gene locus_tag LOCUS_04390 203365 201911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 204762 203371 gene locus_tag LOCUS_04400 204762 203371 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_04400 205021 205494 gene locus_tag LOCUS_04410 205021 205494 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035465.1 protein_id gnl|my_center|LOCUS_04410 206518 205514 gene locus_tag LOCUS_04420 206518 205514 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035460.1 protein_id gnl|my_center|LOCUS_04420 207001 206525 gene locus_tag LOCUS_04430 gene secB 207001 206525 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948014.1 protein_id gnl|my_center|LOCUS_04430 207977 207060 gene locus_tag LOCUS_04440 gene hemF 207977 207060 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946321.1 protein_id gnl|my_center|LOCUS_04440 208639 207989 gene locus_tag LOCUS_04450 208639 207989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 208760 210280 gene locus_tag LOCUS_04460 208760 210280 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_04460 210642 212459 gene locus_tag LOCUS_04470 210642 212459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 212704 215130 gene locus_tag LOCUS_04480 212704 215130 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389298.1 protein_id gnl|my_center|LOCUS_04480 216237 215188 gene locus_tag LOCUS_04490 gene fbaB 216237 215188 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 protein_id gnl|my_center|LOCUS_04490 217784 216321 gene locus_tag LOCUS_04500 gene pyk 217784 216321 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044417.1 protein_id gnl|my_center|LOCUS_04500 218418 217975 gene locus_tag LOCUS_04510 218418 217975 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199454.1 protein_id gnl|my_center|LOCUS_04510 219384 218476 gene locus_tag LOCUS_04520 219384 218476 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_04520 220661 219504 gene locus_tag LOCUS_04530 220661 219504 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_04530 221940 221050 gene locus_tag LOCUS_04540 gene cyoE 221940 221050 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_04540 222728 222120 gene locus_tag LOCUS_04550 222728 222120 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 protein_id gnl|my_center|LOCUS_04550 223466 222741 gene locus_tag LOCUS_04560 223466 222741 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_04560 224722 223847 gene locus_tag LOCUS_04570 224722 223847 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_04570 225327 224752 gene locus_tag LOCUS_04580 225327 224752 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_04580 227184 225586 gene locus_tag LOCUS_04590 gene ctaD 227184 225586 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_04590 228378 227239 gene locus_tag LOCUS_04600 gene coxB 228378 227239 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 protein_id gnl|my_center|LOCUS_04600 230523 228691 gene locus_tag LOCUS_04610 gene glmS 230523 228691 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215552.1 protein_id gnl|my_center|LOCUS_04610 231902 230523 gene locus_tag LOCUS_04620 gene glmU 231902 230523 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence003 1661 2740 gene locus_tag LOCUS_04630 1661 2740 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 protein_id gnl|my_center|LOCUS_04630 2745 4106 gene locus_tag LOCUS_04640 2745 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880043.1 protein_id gnl|my_center|LOCUS_04640 4276 5688 gene locus_tag LOCUS_04650 4276 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5708 6484 gene locus_tag LOCUS_04660 5708 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6481 7587 gene locus_tag LOCUS_04670 6481 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7650 7874 gene locus_tag LOCUS_04680 7650 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 7865 9007 gene locus_tag LOCUS_04690 7865 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9004 9468 gene locus_tag LOCUS_04700 9004 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9395 10483 gene locus_tag LOCUS_04710 9395 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10920 10513 gene locus_tag LOCUS_04720 10920 10513 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_04720 11267 10917 gene locus_tag LOCUS_04730 11267 10917 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_04730 12100 11288 gene locus_tag LOCUS_04740 12100 11288 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_04740 12798 12100 gene locus_tag LOCUS_04750 12798 12100 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_04750 13791 13003 gene locus_tag LOCUS_04760 13791 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 14746 13889 gene locus_tag LOCUS_04770 gene cyoE 14746 13889 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886271.1 protein_id gnl|my_center|LOCUS_04770 16522 14825 gene locus_tag LOCUS_04780 16522 14825 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_04780 17077 16535 gene locus_tag LOCUS_04790 17077 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 17281 17126 gene locus_tag LOCUS_04800 17281 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 17981 17442 gene locus_tag LOCUS_04810 17981 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 18150 19877 gene locus_tag LOCUS_04820 gene nirS 18150 19877 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_04820 19953 20744 gene locus_tag LOCUS_04830 gene cobA 19953 20744 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073514.1 protein_id gnl|my_center|LOCUS_04830 20728 21096 gene locus_tag LOCUS_04840 gene nirC 20728 21096 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_04840 21093 22271 gene locus_tag LOCUS_04850 gene nirF 21093 22271 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_04850 22271 23254 gene locus_tag LOCUS_04860 22271 23254 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_04860 23247 23690 gene locus_tag LOCUS_04870 23247 23690 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_04870 23687 24190 gene locus_tag LOCUS_04880 23687 24190 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_04880 24190 25413 gene locus_tag LOCUS_04890 gene nirJ 24190 25413 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_04890 25401 26990 gene locus_tag LOCUS_04900 25401 26990 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_04900 27081 27437 gene locus_tag LOCUS_04910 gene hinT 27081 27437 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_04910 28128 27529 gene locus_tag LOCUS_04920 28128 27529 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_04920 28993 28166 gene locus_tag LOCUS_04930 gene proC 28993 28166 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_04930 30121 29003 gene locus_tag LOCUS_04940 30121 29003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 30910 30206 gene locus_tag LOCUS_04950 30910 30206 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_04950 31005 32039 gene locus_tag LOCUS_04960 31005 32039 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_04960 32050 33222 gene locus_tag LOCUS_04970 32050 33222 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_04970 33235 34368 gene locus_tag LOCUS_04980 33235 34368 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_04980 34944 34378 gene locus_tag LOCUS_04990 gene dcd 34944 34378 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_04990 36044 34953 gene locus_tag LOCUS_05000 gene apbC 36044 34953 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_05000 36823 36143 gene locus_tag LOCUS_05010 gene bioD 36823 36143 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_05010 38054 36837 gene locus_tag LOCUS_05020 gene bioF 38054 36837 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_05020 39324 38032 gene locus_tag LOCUS_05030 gene bioA 39324 38032 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_05030 40457 39363 gene locus_tag LOCUS_05040 gene bioB 40457 39363 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_05040 42040 40541 gene locus_tag LOCUS_05050 42040 40541 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_05050 43139 42063 gene locus_tag LOCUS_05060 gene sohB 43139 42063 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762574.1 protein_id gnl|my_center|LOCUS_05060 44141 43176 gene locus_tag LOCUS_05070 gene lipA 44141 43176 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958112.1 protein_id gnl|my_center|LOCUS_05070 44806 44138 gene locus_tag LOCUS_05080 gene lipB 44806 44138 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431344.1 protein_id gnl|my_center|LOCUS_05080 45066 44803 gene locus_tag LOCUS_05090 45066 44803 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_05090 45931 45071 gene locus_tag LOCUS_05100 45931 45071 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_05100 47070 45928 gene locus_tag LOCUS_05110 47070 45928 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_05110 47819 47187 gene locus_tag LOCUS_05120 gene folK 47819 47187 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_05120 49059 47716 gene locus_tag LOCUS_05130 gene pcnB 49059 47716 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222090.1 protein_id gnl|my_center|LOCUS_05130 50172 49081 gene locus_tag LOCUS_05140 gene ychF 50172 49081 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_05140 50786 50178 gene locus_tag LOCUS_05150 gene pth 50786 50178 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_05150 51441 50803 gene locus_tag LOCUS_05160 51441 50803 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_05160 52484 51531 gene locus_tag LOCUS_05170 52484 51531 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120445.1 protein_id gnl|my_center|LOCUS_05170 52644 52570 gene locus_tag LOCUS_t00060 52644 52570 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 53562 52675 gene locus_tag LOCUS_05180 gene ispE 53562 52675 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_05180 54194 53559 gene locus_tag LOCUS_05190 54194 53559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 55912 54191 gene locus_tag LOCUS_05200 55912 54191 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_05200 56057 57322 gene locus_tag LOCUS_05210 gene hemA 56057 57322 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_05210 57319 58401 gene locus_tag LOCUS_05220 gene prfA 57319 58401 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_05220 58405 59244 gene locus_tag LOCUS_05230 gene prmC 58405 59244 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114694.1 protein_id gnl|my_center|LOCUS_05230 59241 59996 gene locus_tag LOCUS_05240 59241 59996 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_05240 60594 59959 gene locus_tag LOCUS_05250 60594 59959 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_05250 61988 60648 gene locus_tag LOCUS_05260 gene cptA 61988 60648 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_05260 63246 62083 gene locus_tag LOCUS_05270 63246 62083 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_05270 63365 65236 gene locus_tag LOCUS_05280 63365 65236 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_05280 65337 66125 gene locus_tag LOCUS_05290 65337 66125 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_05290 67180 66296 gene locus_tag LOCUS_05300 gene rarD 67180 66296 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791842.1 protein_id gnl|my_center|LOCUS_05300 69032 67182 gene locus_tag LOCUS_05310 gene ilvD 69032 67182 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127399.1 protein_id gnl|my_center|LOCUS_05310 69141 69422 gene locus_tag LOCUS_05320 69141 69422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 69442 69732 gene locus_tag LOCUS_05330 69442 69732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 69894 70976 gene locus_tag LOCUS_05340 69894 70976 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_05340 71032 71700 gene locus_tag LOCUS_05350 71032 71700 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549393.1 protein_id gnl|my_center|LOCUS_05350 71733 73328 gene locus_tag LOCUS_05360 71733 73328 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_05360 73698 73354 gene locus_tag LOCUS_05370 73698 73354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 74627 73740 gene locus_tag LOCUS_05380 gene htpX 74627 73740 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_05380 74829 77501 gene locus_tag LOCUS_05390 gene acnA 74829 77501 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_05390 77778 80552 gene locus_tag LOCUS_05400 77778 80552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 80695 81648 gene locus_tag LOCUS_05410 gene cofD 80695 81648 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_05410 83063 81651 gene locus_tag LOCUS_05420 gene sthA 83063 81651 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537057.1 protein_id gnl|my_center|LOCUS_05420 83181 84140 gene locus_tag LOCUS_05430 83181 84140 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_05430 84681 84130 gene locus_tag LOCUS_05440 84681 84130 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 protein_id gnl|my_center|LOCUS_05440 87086 84681 gene locus_tag LOCUS_05450 87086 84681 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_05450 88354 87242 gene locus_tag LOCUS_05460 gene dprA 88354 87242 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_05460 89596 88361 gene locus_tag LOCUS_05470 89596 88361 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_05470 89656 90162 gene locus_tag LOCUS_05480 gene def 89656 90162 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401459.1 protein_id gnl|my_center|LOCUS_05480 90164 91111 gene locus_tag LOCUS_05490 gene fmt 90164 91111 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_05490 91104 92435 gene locus_tag LOCUS_05500 gene rsmB 91104 92435 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_05500 92436 93017 gene locus_tag LOCUS_05510 92436 93017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 93047 95218 gene locus_tag LOCUS_05520 93047 95218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_05520 95215 96603 gene locus_tag LOCUS_05530 95215 96603 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_05530 96623 97993 gene locus_tag LOCUS_05540 gene trkA 96623 97993 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_05540 97997 99445 gene locus_tag LOCUS_05550 97997 99445 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_05550 99445 100023 gene locus_tag LOCUS_05560 99445 100023 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941339.1 protein_id gnl|my_center|LOCUS_05560 100020 100964 gene locus_tag LOCUS_05570 gene lpxM 100020 100964 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694093.1 protein_id gnl|my_center|LOCUS_05570 101057 102004 gene locus_tag LOCUS_05580 101057 102004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_05580 101997 103139 gene locus_tag LOCUS_05590 101997 103139 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_05590 103234 103542 gene locus_tag LOCUS_05600 103234 103542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 103535 104554 gene locus_tag LOCUS_05610 103535 104554 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_05610 104798 105949 gene locus_tag LOCUS_05620 104798 105949 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_05620 105970 107955 gene locus_tag LOCUS_05630 105970 107955 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086713.1 protein_id gnl|my_center|LOCUS_05630 108036 108569 gene locus_tag LOCUS_05640 108036 108569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 109041 108643 gene locus_tag LOCUS_05650 109041 108643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 109901 109089 gene locus_tag LOCUS_05660 109901 109089 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_05660 110432 110797 gene locus_tag LOCUS_05670 110432 110797 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_05670 110997 111722 gene locus_tag LOCUS_05680 110997 111722 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330817.1 protein_id gnl|my_center|LOCUS_05680 111795 112352 gene locus_tag LOCUS_05690 111795 112352 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070683.1 protein_id gnl|my_center|LOCUS_05690 112706 112879 gene locus_tag LOCUS_05700 112706 112879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 113479 113964 gene locus_tag LOCUS_05710 113479 113964 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704762.1 protein_id gnl|my_center|LOCUS_05710 114064 114708 gene locus_tag LOCUS_05720 114064 114708 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 protein_id gnl|my_center|LOCUS_05720 114831 115325 gene locus_tag LOCUS_05730 114831 115325 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_05730 115388 115642 gene locus_tag LOCUS_05740 115388 115642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 115955 117196 gene locus_tag LOCUS_05750 115955 117196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 117244 117930 gene locus_tag LOCUS_05760 117244 117930 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_05760 118180 118377 gene locus_tag LOCUS_05770 118180 118377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 118963 119145 gene locus_tag LOCUS_05780 118963 119145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 119213 119656 gene locus_tag LOCUS_05790 119213 119656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 119976 120296 gene locus_tag LOCUS_05800 119976 120296 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088398.1 protein_id gnl|my_center|LOCUS_05800 120283 120774 gene locus_tag LOCUS_05810 120283 120774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 120954 121463 gene locus_tag LOCUS_05820 120954 121463 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483274.1 protein_id gnl|my_center|LOCUS_05820 122657 121551 gene locus_tag LOCUS_05830 122657 121551 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931373.1 protein_id gnl|my_center|LOCUS_05830 123828 122692 gene locus_tag LOCUS_05840 123828 122692 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_05840 125385 123829 gene locus_tag LOCUS_05850 125385 123829 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965432.1 protein_id gnl|my_center|LOCUS_05850 126080 126784 gene locus_tag LOCUS_05860 126080 126784 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769371.1 protein_id gnl|my_center|LOCUS_05860 128500 126809 gene locus_tag LOCUS_05870 128500 126809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 129012 129764 gene locus_tag LOCUS_05880 129012 129764 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967020.1 protein_id gnl|my_center|LOCUS_05880 129874 131040 gene locus_tag LOCUS_05890 129874 131040 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_05890 131055 132029 gene locus_tag LOCUS_05900 131055 132029 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523004.1 protein_id gnl|my_center|LOCUS_05900 132848 132312 gene locus_tag LOCUS_05910 132848 132312 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_05910 133115 134911 gene locus_tag LOCUS_05920 133115 134911 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_05920 134957 135973 gene locus_tag LOCUS_05930 134957 135973 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_05930 137309 136059 gene locus_tag LOCUS_05940 137309 136059 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_05940 137686 137348 gene locus_tag LOCUS_05950 gene glnK 137686 137348 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05950 138773 137904 gene locus_tag LOCUS_05960 138773 137904 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_05960 139528 138812 gene locus_tag LOCUS_05970 gene trmB 139528 138812 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 protein_id gnl|my_center|LOCUS_05970 140336 139542 gene locus_tag LOCUS_05980 140336 139542 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_05980 140557 140357 gene locus_tag LOCUS_05990 140557 140357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 140719 141159 gene locus_tag LOCUS_06000 140719 141159 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208362.1 protein_id gnl|my_center|LOCUS_06000 141404 141664 gene locus_tag LOCUS_06010 141404 141664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 141751 143883 gene locus_tag LOCUS_06020 gene spoT 141751 143883 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 protein_id gnl|my_center|LOCUS_06020 143864 144307 gene locus_tag LOCUS_06030 143864 144307 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957491.1 protein_id gnl|my_center|LOCUS_06030 144311 146407 gene locus_tag LOCUS_06040 gene recG 144311 146407 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_06040 146991 146404 gene locus_tag LOCUS_06050 gene rrtA 146991 146404 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482515.1 protein_id gnl|my_center|LOCUS_06050 147194 147649 gene locus_tag LOCUS_06060 147194 147649 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_06060 148122 147688 gene locus_tag LOCUS_06070 148122 147688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 149304 148147 gene locus_tag LOCUS_06080 149304 148147 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_06080 149707 149315 gene locus_tag LOCUS_06090 149707 149315 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 protein_id gnl|my_center|LOCUS_06090 150868 149735 gene locus_tag LOCUS_06100 150868 149735 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_06100 152034 150895 gene locus_tag LOCUS_06110 152034 150895 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_06110 152409 152669 gene locus_tag LOCUS_06120 gene rpsT 152409 152669 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 protein_id gnl|my_center|LOCUS_06120 152822 153157 gene locus_tag LOCUS_06130 152822 153157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06130 153380 153595 gene locus_tag LOCUS_06140 153380 153595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 155054 153636 gene locus_tag LOCUS_06150 155054 153636 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_06150 155756 155076 gene locus_tag LOCUS_06160 155756 155076 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence004 280 1062 gene locus_tag LOCUS_06170 gene menB 280 1062 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_06170 2542 1097 gene locus_tag LOCUS_06180 gene der 2542 1097 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 protein_id gnl|my_center|LOCUS_06180 3677 2535 gene locus_tag LOCUS_06190 gene bamB 3677 2535 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_06190 4321 3686 gene locus_tag LOCUS_06200 4321 3686 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_06200 5649 4357 gene locus_tag LOCUS_06210 gene hisS 5649 4357 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159557.1 protein_id gnl|my_center|LOCUS_06210 6865 5696 gene locus_tag LOCUS_06220 6865 5696 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 protein_id gnl|my_center|LOCUS_06220 7636 6872 gene locus_tag LOCUS_06230 gene pilW 7636 6872 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947275.1 protein_id gnl|my_center|LOCUS_06230 8739 7633 gene locus_tag LOCUS_06240 gene rlmN 8739 7633 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_06240 9208 8777 gene locus_tag LOCUS_06250 gene ndk 9208 8777 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_06250 9471 9671 gene locus_tag LOCUS_06260 gene rpmB 9471 9671 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014822.1 protein_id gnl|my_center|LOCUS_06260 9684 9839 gene locus_tag LOCUS_06270 gene rpmG 9684 9839 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_06270 10434 9955 gene locus_tag LOCUS_06280 10434 9955 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808064.1 protein_id gnl|my_center|LOCUS_06280 10903 10424 gene locus_tag LOCUS_06290 10903 10424 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161781423.1 protein_id gnl|my_center|LOCUS_06290 12151 10946 gene locus_tag LOCUS_06300 12151 10946 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174520.1 protein_id gnl|my_center|LOCUS_06300 12247 13410 gene locus_tag LOCUS_06310 12247 13410 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064857.1 protein_id gnl|my_center|LOCUS_06310 13437 14132 gene locus_tag LOCUS_06320 13437 14132 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 protein_id gnl|my_center|LOCUS_06320 14448 14762 gene locus_tag LOCUS_06330 14448 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 15767 14859 gene locus_tag LOCUS_06340 gene puuE 15767 14859 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387502.1 protein_id gnl|my_center|LOCUS_06340 16954 15767 gene locus_tag LOCUS_06350 16954 15767 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_06350 17482 16955 gene locus_tag LOCUS_06360 17482 16955 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 protein_id gnl|my_center|LOCUS_06360 18475 17486 gene locus_tag LOCUS_06370 gene alc 18475 17486 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114681.1 protein_id gnl|my_center|LOCUS_06370 19012 18479 gene locus_tag LOCUS_06380 gene uraD 19012 18479 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_06380 19733 19002 gene locus_tag LOCUS_06390 19733 19002 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 protein_id gnl|my_center|LOCUS_06390 19859 21241 gene locus_tag LOCUS_06400 19859 21241 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459007.1 protein_id gnl|my_center|LOCUS_06400 21272 21625 gene locus_tag LOCUS_06410 gene uraH 21272 21625 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_06410 21628 23112 gene locus_tag LOCUS_06420 gene xdhA 21628 23112 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061551.1 protein_id gnl|my_center|LOCUS_06420 23109 25442 gene locus_tag LOCUS_06430 gene xdhB 23109 25442 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920472.1 protein_id gnl|my_center|LOCUS_06430 25439 26515 gene locus_tag LOCUS_06440 gene xdhC 25439 26515 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920471.1 protein_id gnl|my_center|LOCUS_06440 26512 26991 gene locus_tag LOCUS_06450 26512 26991 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_06450 26999 28576 gene locus_tag LOCUS_06460 26999 28576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_06460 28566 29651 gene locus_tag LOCUS_06470 28566 29651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_06470 29654 30583 gene locus_tag LOCUS_06480 29654 30583 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_06480 30613 31701 gene locus_tag LOCUS_06490 30613 31701 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_06490 31759 32781 gene locus_tag LOCUS_06500 31759 32781 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_06500 32837 34198 gene locus_tag LOCUS_06510 32837 34198 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_06510 34720 34226 gene locus_tag LOCUS_06520 34720 34226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 35441 35076 gene locus_tag LOCUS_06530 35441 35076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 35661 38858 gene locus_tag LOCUS_06540 gene recC 35661 38858 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_06540 38855 42373 gene locus_tag LOCUS_06550 gene recB 38855 42373 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942181.1 protein_id gnl|my_center|LOCUS_06550 42370 44202 gene locus_tag LOCUS_06560 gene recD 42370 44202 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215834.1 protein_id gnl|my_center|LOCUS_06560 44975 44199 gene locus_tag LOCUS_06570 44975 44199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966750.1 protein_id gnl|my_center|LOCUS_06570 45729 44968 gene locus_tag LOCUS_06580 45729 44968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 46895 45726 gene locus_tag LOCUS_06590 46895 45726 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391055.1 protein_id gnl|my_center|LOCUS_06590 47905 46907 gene locus_tag LOCUS_06600 47905 46907 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_06600 49324 47984 gene locus_tag LOCUS_06610 49324 47984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_06610 49733 49933 gene locus_tag LOCUS_06620 49733 49933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 49923 52901 gene locus_tag LOCUS_06630 gene cbrA 49923 52901 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_06630 52879 54210 gene locus_tag LOCUS_06640 gene cbrB 52879 54210 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_06640 54382 55758 gene locus_tag LOCUS_06650 54382 55758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 55855 56739 gene locus_tag LOCUS_06660 55855 56739 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_06660 57041 57958 gene locus_tag LOCUS_06670 gene xerD 57041 57958 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_06670 58283 59365 gene locus_tag LOCUS_06680 58283 59365 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 protein_id gnl|my_center|LOCUS_06680 59488 60009 gene locus_tag LOCUS_06690 59488 60009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 60100 61410 gene locus_tag LOCUS_06700 60100 61410 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_06700 61422 62564 gene locus_tag LOCUS_06710 61422 62564 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_06710 62638 63792 gene locus_tag LOCUS_06720 62638 63792 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_06720 63895 64734 gene locus_tag LOCUS_06730 63895 64734 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_06730 64731 65636 gene locus_tag LOCUS_06740 64731 65636 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_06740 66561 65650 gene locus_tag LOCUS_06750 66561 65650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 67018 66653 gene locus_tag LOCUS_06760 67018 66653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 67642 67139 gene locus_tag LOCUS_06770 67642 67139 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261477.1 protein_id gnl|my_center|LOCUS_06770 68554 69003 gene locus_tag LOCUS_06780 68554 69003 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461766.1 protein_id gnl|my_center|LOCUS_06780 69095 70309 gene locus_tag LOCUS_06790 69095 70309 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206376.1 protein_id gnl|my_center|LOCUS_06790 71070 70306 gene locus_tag LOCUS_06800 71070 70306 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_06800 71464 71658 gene locus_tag LOCUS_06810 71464 71658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 72245 71949 gene locus_tag LOCUS_06820 72245 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 72897 72469 gene locus_tag LOCUS_06830 72897 72469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 73284 72931 gene locus_tag LOCUS_06840 73284 72931 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722157.1 protein_id gnl|my_center|LOCUS_06840 73855 73361 gene locus_tag LOCUS_06850 73855 73361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_06850 74289 73939 gene locus_tag LOCUS_06860 74289 73939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 74932 74375 gene locus_tag LOCUS_06870 74932 74375 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_06870 75924 75037 gene locus_tag LOCUS_06880 75924 75037 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_06880 77051 77275 gene locus_tag LOCUS_06890 77051 77275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 77630 77247 gene locus_tag LOCUS_06900 77630 77247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 78684 77908 gene locus_tag LOCUS_06910 78684 77908 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_06910 80504 78840 gene locus_tag LOCUS_06920 80504 78840 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_06920 81417 80641 gene locus_tag LOCUS_06930 81417 80641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 82614 81418 gene locus_tag LOCUS_06940 82614 81418 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_06940 83048 82653 gene locus_tag LOCUS_06950 83048 82653 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888664.1 protein_id gnl|my_center|LOCUS_06950 84074 83064 gene locus_tag LOCUS_06960 gene meaB 84074 83064 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_06960 85812 84148 gene locus_tag LOCUS_06970 85812 84148 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_06970 86148 86930 gene locus_tag LOCUS_06980 86148 86930 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038922.1 protein_id gnl|my_center|LOCUS_06980 88338 86977 gene locus_tag LOCUS_06990 gene mgtE 88338 86977 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_06990 90164 88413 gene locus_tag LOCUS_07000 gene ptsP 90164 88413 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225691.1 protein_id gnl|my_center|LOCUS_07000 90440 90171 gene locus_tag LOCUS_07010 90440 90171 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_07010 91302 90451 gene locus_tag LOCUS_07020 gene rapZ 91302 90451 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_07020 92362 91463 gene locus_tag LOCUS_07030 gene pstB 92362 91463 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_07030 93790 92498 gene locus_tag LOCUS_07040 gene pstA 93790 92498 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_07040 95165 93783 gene locus_tag LOCUS_07050 gene pstC 95165 93783 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_07050 96290 95247 gene locus_tag LOCUS_07060 96290 95247 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_07060 96743 97468 gene locus_tag LOCUS_07070 96743 97468 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_07070 97470 98225 gene locus_tag LOCUS_07080 97470 98225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383595.1 protein_id gnl|my_center|LOCUS_07080 98249 99457 gene locus_tag LOCUS_07090 gene ubiF 98249 99457 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816831.1 protein_id gnl|my_center|LOCUS_07090 99642 100439 gene locus_tag LOCUS_07100 99642 100439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 100466 102646 gene locus_tag LOCUS_07110 100466 102646 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942572.1 protein_id gnl|my_center|LOCUS_07110 103437 102598 gene locus_tag LOCUS_07120 103437 102598 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_07120 104314 103508 gene locus_tag LOCUS_07130 gene thiD 104314 103508 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_07130 104629 105147 gene locus_tag LOCUS_07140 104629 105147 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728997.1 protein_id gnl|my_center|LOCUS_07140 105235 106545 gene locus_tag LOCUS_07150 105235 106545 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_07150 106603 107721 gene locus_tag LOCUS_07160 106603 107721 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 protein_id gnl|my_center|LOCUS_07160 107820 108941 gene locus_tag LOCUS_07170 107820 108941 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 protein_id gnl|my_center|LOCUS_07170 109008 110120 gene locus_tag LOCUS_07180 109008 110120 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 protein_id gnl|my_center|LOCUS_07180 110335 111156 gene locus_tag LOCUS_07190 gene panB 110335 111156 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_07190 111186 112079 gene locus_tag LOCUS_07200 gene panC 111186 112079 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_07200 112459 114090 gene locus_tag LOCUS_07210 gene pgi 112459 114090 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 protein_id gnl|my_center|LOCUS_07210 114281 115444 gene locus_tag LOCUS_07220 114281 115444 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089980.1 protein_id gnl|my_center|LOCUS_07220 116113 115457 gene locus_tag LOCUS_07230 gene aat 116113 115457 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241684.1 protein_id gnl|my_center|LOCUS_07230 117093 116137 gene locus_tag LOCUS_07240 gene trxB 117093 116137 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence005 1286 105 gene locus_tag LOCUS_07250 1286 105 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_07250 2344 1337 gene locus_tag LOCUS_07260 gene gap 2344 1337 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_07260 4358 2367 gene locus_tag LOCUS_07270 gene tkt 4358 2367 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098601.1 protein_id gnl|my_center|LOCUS_07270 4735 4472 gene locus_tag LOCUS_07280 4735 4472 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_07280 5802 4732 gene locus_tag LOCUS_07290 gene mutY 5802 4732 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 protein_id gnl|my_center|LOCUS_07290 7977 5809 gene locus_tag LOCUS_07300 7977 5809 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704719.1 protein_id gnl|my_center|LOCUS_07300 8036 9064 gene locus_tag LOCUS_07310 8036 9064 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_07310 9122 9661 gene locus_tag LOCUS_07320 9122 9661 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_07320 10152 9673 gene locus_tag LOCUS_07330 gene moaC 10152 9673 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_07330 10179 10433 gene locus_tag LOCUS_07340 10179 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 10433 10870 gene locus_tag LOCUS_07350 gene moaE 10433 10870 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_07350 11889 10879 gene locus_tag LOCUS_07360 gene rfbB 11889 10879 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_07360 12350 11886 gene locus_tag LOCUS_07370 12350 11886 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337389.1 protein_id gnl|my_center|LOCUS_07370 12850 12527 gene locus_tag LOCUS_07380 12850 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 15103 13217 gene locus_tag LOCUS_07390 15103 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15310 17061 gene locus_tag LOCUS_07400 15310 17061 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_07400 17061 20810 gene locus_tag LOCUS_07410 17061 20810 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595689.1 protein_id gnl|my_center|LOCUS_07410 20810 22180 gene locus_tag LOCUS_07420 20810 22180 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440399.1 protein_id gnl|my_center|LOCUS_07420 22315 23601 gene locus_tag LOCUS_07430 gene purD 22315 23601 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_07430 24871 23615 gene locus_tag LOCUS_07440 gene rho 24871 23615 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260932.1 protein_id gnl|my_center|LOCUS_07440 25138 25515 gene locus_tag LOCUS_07450 25138 25515 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546612.1 protein_id gnl|my_center|LOCUS_07450 25532 26032 gene locus_tag LOCUS_07460 25532 26032 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_07460 26007 26897 gene locus_tag LOCUS_07470 26007 26897 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958357.1 protein_id gnl|my_center|LOCUS_07470 27044 29611 gene locus_tag LOCUS_07480 27044 29611 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_07480 31102 29639 gene locus_tag LOCUS_07490 gene malQ 31102 29639 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_07490 32816 31134 gene locus_tag LOCUS_07500 32816 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 34083 32809 gene locus_tag LOCUS_07510 gene glgC 34083 32809 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_07510 34296 36542 gene locus_tag LOCUS_07520 gene glgB 34296 36542 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_07520 36571 38040 gene locus_tag LOCUS_07530 gene glgA 36571 38040 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_07530 38086 38694 gene locus_tag LOCUS_07540 38086 38694 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_07540 38772 39224 gene locus_tag LOCUS_07550 38772 39224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 39307 39594 gene locus_tag LOCUS_07560 39307 39594 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_07560 39657 40064 gene locus_tag LOCUS_07570 39657 40064 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 protein_id gnl|my_center|LOCUS_07570 40441 40752 gene locus_tag LOCUS_07580 40441 40752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 40822 41421 gene locus_tag LOCUS_07590 40822 41421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 41418 41885 gene locus_tag LOCUS_07600 gene aac(6') 41418 41885 CDS product cryptic aminoglycoside N-acetyltransferase AAC(6')-Iy/Iaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354865.1 protein_id gnl|my_center|LOCUS_07600 41989 42369 gene locus_tag LOCUS_07610 41989 42369 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_07610 42445 43083 gene locus_tag LOCUS_07620 42445 43083 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_07620 43309 44181 gene locus_tag LOCUS_07630 43309 44181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895546.1 protein_id gnl|my_center|LOCUS_07630 45301 44300 gene locus_tag LOCUS_07640 45301 44300 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023154.1 protein_id gnl|my_center|LOCUS_07640 45904 45419 gene locus_tag LOCUS_07650 45904 45419 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_07650 47209 45962 gene locus_tag LOCUS_07660 47209 45962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 48999 47392 gene locus_tag LOCUS_07670 48999 47392 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957930.1 protein_id gnl|my_center|LOCUS_07670 50644 49049 gene locus_tag LOCUS_07680 50644 49049 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957930.1 protein_id gnl|my_center|LOCUS_07680 51151 50648 gene locus_tag LOCUS_07690 51151 50648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 52628 51153 gene locus_tag LOCUS_07700 52628 51153 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623974.1 protein_id gnl|my_center|LOCUS_07700 53947 52739 gene locus_tag LOCUS_07710 53947 52739 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_07710 55209 53998 gene locus_tag LOCUS_07720 55209 53998 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_07720 56329 55286 gene locus_tag LOCUS_07730 56329 55286 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_07730 57204 56332 gene locus_tag LOCUS_07740 57204 56332 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088705.1 protein_id gnl|my_center|LOCUS_07740 59060 57222 gene locus_tag LOCUS_07750 59060 57222 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930188.1 protein_id gnl|my_center|LOCUS_07750 59833 59060 gene locus_tag LOCUS_07760 59833 59060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_07760 60621 59830 gene locus_tag LOCUS_07770 60621 59830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_07770 62454 60649 gene locus_tag LOCUS_07780 62454 60649 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207710.1 protein_id gnl|my_center|LOCUS_07780 63127 64311 gene locus_tag LOCUS_07790 63127 64311 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 protein_id gnl|my_center|LOCUS_07790 64341 65531 gene locus_tag LOCUS_07800 64341 65531 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973073.1 protein_id gnl|my_center|LOCUS_07800 65652 66980 gene locus_tag LOCUS_07810 65652 66980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 67129 68103 gene locus_tag LOCUS_07820 67129 68103 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_07820 70009 68159 gene locus_tag LOCUS_07830 70009 68159 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 protein_id gnl|my_center|LOCUS_07830 70302 70592 gene locus_tag LOCUS_07840 70302 70592 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_07840 70589 71170 gene locus_tag LOCUS_07850 70589 71170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 71175 71489 gene locus_tag LOCUS_07860 71175 71489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 71676 72140 gene locus_tag LOCUS_07870 71676 72140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 74399 72501 gene locus_tag LOCUS_07880 gene htpG 74399 72501 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_07880 76217 74517 gene locus_tag LOCUS_07890 76217 74517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 76733 76389 gene locus_tag LOCUS_07900 gene rplS 76733 76389 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 protein_id gnl|my_center|LOCUS_07900 77492 76764 gene locus_tag LOCUS_07910 gene trmD 77492 76764 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 protein_id gnl|my_center|LOCUS_07910 78009 77494 gene locus_tag LOCUS_07920 gene rimM 78009 77494 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_07920 78295 78035 gene locus_tag LOCUS_07930 gene rpsP 78295 78035 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023081.1 protein_id gnl|my_center|LOCUS_07930 78708 78502 gene locus_tag LOCUS_07940 78708 78502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 79894 78887 gene locus_tag LOCUS_07950 gene rpoA 79894 78887 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_07950 80533 79910 gene locus_tag LOCUS_07960 gene rpsD 80533 79910 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693170.1 protein_id gnl|my_center|LOCUS_07960 80946 80560 gene locus_tag LOCUS_07970 gene rpsK 80946 80560 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_07970 81328 80972 gene locus_tag LOCUS_07980 gene rpsM 81328 80972 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_07980 82925 81564 gene locus_tag LOCUS_07990 gene secY 82925 81564 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_07990 83353 82922 gene locus_tag LOCUS_08000 gene rplO 83353 82922 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946097.1 protein_id gnl|my_center|LOCUS_08000 83546 83358 gene locus_tag LOCUS_08010 gene rpmD 83546 83358 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_08010 84057 83551 gene locus_tag LOCUS_08020 gene rpsE 84057 83551 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417255.1 protein_id gnl|my_center|LOCUS_08020 84465 84067 gene locus_tag LOCUS_08030 gene rplR 84465 84067 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070627.1 protein_id gnl|my_center|LOCUS_08030 84982 84449 gene locus_tag LOCUS_08040 gene rplF 84982 84449 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951357.1 protein_id gnl|my_center|LOCUS_08040 85415 85017 gene locus_tag LOCUS_08050 gene rpsH 85415 85017 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062614.1 protein_id gnl|my_center|LOCUS_08050 85743 85438 gene locus_tag LOCUS_08060 gene rpsN 85743 85438 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_08060 86293 85751 gene locus_tag LOCUS_08070 gene rplE 86293 85751 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555477.1 protein_id gnl|my_center|LOCUS_08070 86612 86295 gene locus_tag LOCUS_08080 gene rplX 86612 86295 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215435.1 protein_id gnl|my_center|LOCUS_08080 86998 86630 gene locus_tag LOCUS_08090 gene rplN 86998 86630 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_08090 87292 87032 gene locus_tag LOCUS_08100 gene rpsQ 87292 87032 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_08100 87497 87306 gene locus_tag LOCUS_08110 gene rpmC 87497 87306 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_08110 87910 87497 gene locus_tag LOCUS_08120 gene rplP 87910 87497 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555482.1 protein_id gnl|my_center|LOCUS_08120 88605 87916 gene locus_tag LOCUS_08130 gene rpsC 88605 87916 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_08130 88959 88624 gene locus_tag LOCUS_08140 gene rplV 88959 88624 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957457.1 protein_id gnl|my_center|LOCUS_08140 89241 88969 gene locus_tag LOCUS_08150 gene rpsS 89241 88969 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004883670.1 protein_id gnl|my_center|LOCUS_08150 90078 89251 gene locus_tag LOCUS_08160 gene rplB 90078 89251 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 protein_id gnl|my_center|LOCUS_08160 90382 90080 gene locus_tag LOCUS_08170 gene rplW 90382 90080 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555488.1 protein_id gnl|my_center|LOCUS_08170 90843 90379 gene locus_tag LOCUS_08180 90843 90379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 91646 91011 gene locus_tag LOCUS_08190 gene rplC 91646 91011 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_08190 92050 91733 gene locus_tag LOCUS_08200 gene rpsJ 92050 91733 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_08200 93242 92052 gene locus_tag LOCUS_08210 gene tuf 93242 92052 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036112.1 protein_id gnl|my_center|LOCUS_08210 95367 93286 gene locus_tag LOCUS_08220 gene fusA 95367 93286 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_08220 95875 95405 gene locus_tag LOCUS_08230 gene rpsG 95875 95405 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_08230 96137 95916 gene locus_tag LOCUS_08240 96137 95916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 100613 96438 gene locus_tag LOCUS_08250 gene rpoC 100613 96438 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_08250 104753 100671 gene locus_tag LOCUS_08260 gene rpoB 104753 100671 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_08260 105284 104907 gene locus_tag LOCUS_08270 gene rplL 105284 104907 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_08270 105884 105360 gene locus_tag LOCUS_08280 gene rplJ 105884 105360 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_08280 106755 106066 gene locus_tag LOCUS_08290 gene rplA 106755 106066 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_08290 107187 106756 gene locus_tag LOCUS_08300 gene rplK 107187 106756 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946069.1 protein_id gnl|my_center|LOCUS_08300 107820 107275 gene locus_tag LOCUS_08310 gene nusG 107820 107275 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_08310 108309 108234 gene locus_tag LOCUS_t00070 108309 108234 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 948 145 gene locus_tag LOCUS_08320 948 145 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_08320 2156 960 gene locus_tag LOCUS_08330 2156 960 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_08330 2407 3168 gene locus_tag LOCUS_08340 2407 3168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_08340 3161 3865 gene locus_tag LOCUS_08350 3161 3865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086814.1 protein_id gnl|my_center|LOCUS_08350 3912 5123 gene locus_tag LOCUS_08360 3912 5123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973580.1 protein_id gnl|my_center|LOCUS_08360 5211 6098 gene locus_tag LOCUS_08370 5211 6098 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528527.1 protein_id gnl|my_center|LOCUS_08370 6099 7049 gene locus_tag LOCUS_08380 6099 7049 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397979.1 protein_id gnl|my_center|LOCUS_08380 8539 7025 gene locus_tag LOCUS_08390 8539 7025 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_08390 10558 8588 gene locus_tag LOCUS_08400 10558 8588 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_08400 11104 10703 gene locus_tag LOCUS_08410 11104 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 12511 11381 gene locus_tag LOCUS_08420 12511 11381 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_08420 13386 12754 gene locus_tag LOCUS_08430 13386 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14408 13383 gene locus_tag LOCUS_08440 14408 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 14917 14408 gene locus_tag LOCUS_08450 14917 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 15415 14933 gene locus_tag LOCUS_08460 15415 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 16065 15415 gene locus_tag LOCUS_08470 16065 15415 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_08470 16397 16095 gene locus_tag LOCUS_08480 16397 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 16969 16397 gene locus_tag LOCUS_08490 16969 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 19877 16950 gene locus_tag LOCUS_08500 19877 16950 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_08500 21810 19879 gene locus_tag LOCUS_08510 21810 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 22323 21835 gene locus_tag LOCUS_08520 22323 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 23524 22418 gene locus_tag LOCUS_08530 23524 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 23753 23511 gene locus_tag LOCUS_08540 23753 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 24250 23753 gene locus_tag LOCUS_08550 24250 23753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 24897 24259 gene locus_tag LOCUS_08560 24897 24259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 25652 24909 gene locus_tag LOCUS_08570 25652 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 26173 25658 gene locus_tag LOCUS_08580 26173 25658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 28961 26202 gene locus_tag LOCUS_08590 28961 26202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 30237 29251 gene locus_tag LOCUS_08600 30237 29251 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_08600 31566 30367 gene locus_tag LOCUS_08610 31566 30367 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083559.1 protein_id gnl|my_center|LOCUS_08610 31669 32370 gene locus_tag LOCUS_08620 gene cofC 31669 32370 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_08620 32361 34877 gene locus_tag LOCUS_08630 32361 34877 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092974.1 protein_id gnl|my_center|LOCUS_08630 36022 34874 gene locus_tag LOCUS_08640 36022 34874 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_08640 37160 36303 gene locus_tag LOCUS_08650 37160 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 37698 37153 gene locus_tag LOCUS_08660 37698 37153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 38431 37826 gene locus_tag LOCUS_08670 38431 37826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 39021 38428 gene locus_tag LOCUS_08680 39021 38428 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528397.1 protein_id gnl|my_center|LOCUS_08680 40855 39506 gene locus_tag LOCUS_08690 40855 39506 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_08690 41874 42173 gene locus_tag LOCUS_08700 41874 42173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 43318 42923 gene locus_tag LOCUS_08710 43318 42923 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068930417.1 protein_id gnl|my_center|LOCUS_08710 43894 43478 gene locus_tag LOCUS_08720 43894 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 44850 43984 gene locus_tag LOCUS_08730 44850 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 45551 44973 gene locus_tag LOCUS_08740 45551 44973 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_08740 46074 45667 gene locus_tag LOCUS_08750 46074 45667 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063587.1 protein_id gnl|my_center|LOCUS_08750 46559 46167 gene locus_tag LOCUS_08760 46559 46167 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640257.1 protein_id gnl|my_center|LOCUS_08760 47998 47249 gene locus_tag LOCUS_08770 47998 47249 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258311.1 protein_id gnl|my_center|LOCUS_08770 48615 48160 gene locus_tag LOCUS_08780 48615 48160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 49324 48863 gene locus_tag LOCUS_08790 49324 48863 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 protein_id gnl|my_center|LOCUS_08790 50025 49423 gene locus_tag LOCUS_08800 50025 49423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 50502 52349 gene locus_tag LOCUS_08810 50502 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 52391 52915 gene locus_tag LOCUS_08820 52391 52915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 53364 52912 gene locus_tag LOCUS_08830 53364 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 55177 53573 gene locus_tag LOCUS_08840 55177 53573 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966127.1 protein_id gnl|my_center|LOCUS_08840 57161 55539 gene locus_tag LOCUS_08850 57161 55539 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705057.1 protein_id gnl|my_center|LOCUS_08850 58919 57291 gene locus_tag LOCUS_08860 58919 57291 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550980.1 protein_id gnl|my_center|LOCUS_08860 60398 58953 gene locus_tag LOCUS_08870 60398 58953 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_08870 60877 60395 gene locus_tag LOCUS_08880 60877 60395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 62274 61048 gene locus_tag LOCUS_08890 62274 61048 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_08890 62506 65121 gene locus_tag LOCUS_08900 62506 65121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 65152 66333 gene locus_tag LOCUS_08910 65152 66333 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085615.1 protein_id gnl|my_center|LOCUS_08910 66437 67243 gene locus_tag LOCUS_08920 66437 67243 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_08920 67329 68237 gene locus_tag LOCUS_08930 67329 68237 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390819.1 protein_id gnl|my_center|LOCUS_08930 68299 69537 gene locus_tag LOCUS_08940 68299 69537 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_08940 69692 70507 gene locus_tag LOCUS_08950 69692 70507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 70678 72222 gene locus_tag LOCUS_08960 70678 72222 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173812.1 protein_id gnl|my_center|LOCUS_08960 72273 73061 gene locus_tag LOCUS_08970 72273 73061 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_08970 73180 74148 gene locus_tag LOCUS_08980 gene ispB 73180 74148 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_08980 77637 74164 gene locus_tag LOCUS_08990 77637 74164 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_08990 78110 78790 gene locus_tag LOCUS_09000 78110 78790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 78747 79709 gene locus_tag LOCUS_09010 gene pip 78747 79709 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_09010 79706 80155 gene locus_tag LOCUS_09020 gene dtd 79706 80155 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_09020 81191 80196 gene locus_tag LOCUS_09030 81191 80196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 82156 81191 gene locus_tag LOCUS_09040 82156 81191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 82325 82918 gene locus_tag LOCUS_09050 gene hisB 82325 82918 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_09050 82982 83632 gene locus_tag LOCUS_09060 gene hisH 82982 83632 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767120.1 protein_id gnl|my_center|LOCUS_09060 84120 83719 gene locus_tag LOCUS_09070 84120 83719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 84832 84104 gene locus_tag LOCUS_09080 84832 84104 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_09080 85608 84832 gene locus_tag LOCUS_09090 85608 84832 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939504.1 protein_id gnl|my_center|LOCUS_09090 86995 85718 gene locus_tag LOCUS_09100 86995 85718 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247057.1 protein_id gnl|my_center|LOCUS_09100 87984 86992 gene locus_tag LOCUS_09110 87984 86992 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_09110 88505 87981 gene locus_tag LOCUS_09120 gene pyrR 88505 87981 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_09120 88926 88495 gene locus_tag LOCUS_09130 gene ruvX 88926 88495 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377205.1 protein_id gnl|my_center|LOCUS_09130 89481 88927 gene locus_tag LOCUS_09140 89481 88927 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 protein_id gnl|my_center|LOCUS_09140 90380 89520 gene locus_tag LOCUS_09150 90380 89520 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_09150 91497 90535 gene locus_tag LOCUS_09160 gene gshB 91497 90535 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377199.1 protein_id gnl|my_center|LOCUS_09160 91829 92209 gene locus_tag LOCUS_09170 gene pilG 91829 92209 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_09170 92232 92600 gene locus_tag LOCUS_09180 gene pilH 92232 92600 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_09180 92635 93174 gene locus_tag LOCUS_09190 92635 93174 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_09190 93281 95428 gene locus_tag LOCUS_09200 gene pilJ 93281 95428 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_09200 95467 101046 gene locus_tag LOCUS_09210 95467 101046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 101048 101521 gene locus_tag LOCUS_09220 101048 101521 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_09220 102839 101508 gene locus_tag LOCUS_09230 102839 101508 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_09230 103004 103690 gene locus_tag LOCUS_09240 103004 103690 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_09240 104626 103763 gene locus_tag LOCUS_09250 gene fadH 104626 103763 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_09250 <105471 104623 gene locus_tag LOCUS_09260 <105471 104623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207709.1:SDR family oxidoreductase >Feature sequence007 1349 1780 gene locus_tag LOCUS_09270 1349 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09270 1983 3365 gene locus_tag LOCUS_09280 gene dnaA 1983 3365 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_09280 3548 4651 gene locus_tag LOCUS_09290 gene dnaN 3548 4651 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_09290 4664 5749 gene locus_tag LOCUS_09300 gene recF 4664 5749 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 protein_id gnl|my_center|LOCUS_09300 5768 8188 gene locus_tag LOCUS_09310 gene gyrB 5768 8188 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_09310 10506 8818 gene locus_tag LOCUS_09320 gene glnS 10506 8818 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 protein_id gnl|my_center|LOCUS_09320 11327 10665 gene locus_tag LOCUS_09330 11327 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12310 11324 gene locus_tag LOCUS_09340 12310 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 13095 12313 gene locus_tag LOCUS_09350 13095 12313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_09350 14229 13099 gene locus_tag LOCUS_09360 14229 13099 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_09360 15065 14232 gene locus_tag LOCUS_09370 gene aroE 15065 14232 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103018.1 protein_id gnl|my_center|LOCUS_09370 15184 16194 gene locus_tag LOCUS_09380 gene hemB 15184 16194 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_09380 16846 16196 gene locus_tag LOCUS_09390 16846 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 18723 16843 gene locus_tag LOCUS_09400 18723 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 18998 19651 gene locus_tag LOCUS_09410 gene adk 18998 19651 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687832.1 protein_id gnl|my_center|LOCUS_09410 19703 20179 gene locus_tag LOCUS_09420 19703 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 20183 20521 gene locus_tag LOCUS_09430 20183 20521 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_09430 21324 20518 gene locus_tag LOCUS_09440 gene cysQ 21324 20518 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 protein_id gnl|my_center|LOCUS_09440 21431 22135 gene locus_tag LOCUS_09450 gene yrfG 21431 22135 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343604.1 protein_id gnl|my_center|LOCUS_09450 23396 22473 gene locus_tag LOCUS_09460 23396 22473 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522122.1 protein_id gnl|my_center|LOCUS_09460 23849 23625 gene locus_tag LOCUS_09470 23849 23625 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_09470 25343 24255 gene locus_tag LOCUS_09480 25343 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09480 25535 26254 gene locus_tag LOCUS_09490 25535 26254 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_09490 27035 26259 gene locus_tag LOCUS_09500 gene hisN 27035 26259 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 protein_id gnl|my_center|LOCUS_09500 27216 27491 gene locus_tag LOCUS_09510 27216 27491 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_09510 27496 29007 gene locus_tag LOCUS_09520 27496 29007 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_09520 29048 29455 gene locus_tag LOCUS_09530 29048 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 30294 29479 gene locus_tag LOCUS_09540 30294 29479 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947237.1 protein_id gnl|my_center|LOCUS_09540 31284 30301 gene locus_tag LOCUS_09550 gene mltB 31284 30301 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_09550 32473 31352 gene locus_tag LOCUS_09560 gene rodA 32473 31352 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_09560 34348 32498 gene locus_tag LOCUS_09570 gene mrdA 34348 32498 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_09570 34433 35026 gene locus_tag LOCUS_09580 34433 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 36531 35080 gene locus_tag LOCUS_09590 gene glcD 36531 35080 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_09590 36645 37817 gene locus_tag LOCUS_09600 36645 37817 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_09600 37821 38222 gene locus_tag LOCUS_09610 37821 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 39675 38212 gene locus_tag LOCUS_09620 39675 38212 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766682.1 protein_id gnl|my_center|LOCUS_09620 40658 39681 gene locus_tag LOCUS_09630 gene cobD 40658 39681 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_09630 41574 40651 gene locus_tag LOCUS_09640 gene cbiB 41574 40651 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_09640 42260 41589 gene locus_tag LOCUS_09650 42260 41589 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245851.1 protein_id gnl|my_center|LOCUS_09650 43276 42254 gene locus_tag LOCUS_09660 43276 42254 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114001.1 protein_id gnl|my_center|LOCUS_09660 47048 43269 gene locus_tag LOCUS_09670 gene cobN 47048 43269 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268156.1 protein_id gnl|my_center|LOCUS_09670 47167 48777 gene locus_tag LOCUS_09680 47167 48777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 48801 49850 gene locus_tag LOCUS_09690 48801 49850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 49867 50304 gene locus_tag LOCUS_09700 49867 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 51267 50356 gene locus_tag LOCUS_09710 51267 50356 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731422.1 protein_id gnl|my_center|LOCUS_09710 52528 51284 gene locus_tag LOCUS_09720 52528 51284 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_09720 53004 52525 gene locus_tag LOCUS_09730 gene ripB 53004 52525 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212069.1 protein_id gnl|my_center|LOCUS_09730 54190 53024 gene locus_tag LOCUS_09740 54190 53024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 54681 54187 gene locus_tag LOCUS_09750 54681 54187 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_09750 56048 54693 gene locus_tag LOCUS_09760 56048 54693 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931342.1 protein_id gnl|my_center|LOCUS_09760 56859 56134 gene locus_tag LOCUS_09770 56859 56134 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_09770 56944 57375 gene locus_tag LOCUS_09780 56944 57375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 58593 57409 gene locus_tag LOCUS_09790 gene tyrS 58593 57409 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_09790 59165 60253 gene locus_tag LOCUS_09800 59165 60253 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_09800 60257 61372 gene locus_tag LOCUS_09810 60257 61372 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_09810 61984 61472 gene locus_tag LOCUS_09820 61984 61472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 63454 62195 gene locus_tag LOCUS_09830 63454 62195 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_09830 64647 63451 gene locus_tag LOCUS_09840 64647 63451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 65435 64659 gene locus_tag LOCUS_09850 gene hemD 65435 64659 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 protein_id gnl|my_center|LOCUS_09850 66393 65455 gene locus_tag LOCUS_09860 gene hemC 66393 65455 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141022.1 protein_id gnl|my_center|LOCUS_09860 67232 66486 gene locus_tag LOCUS_09870 67232 66486 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_09870 68286 67237 gene locus_tag LOCUS_09880 68286 67237 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_09880 69518 68550 gene locus_tag LOCUS_09890 gene msrP 69518 68550 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 protein_id gnl|my_center|LOCUS_09890 69675 70136 gene locus_tag LOCUS_09900 69675 70136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 70668 70865 gene locus_tag LOCUS_09910 70668 70865 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942197.1 protein_id gnl|my_center|LOCUS_09910 70876 71319 gene locus_tag LOCUS_09920 70876 71319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 71763 71335 gene locus_tag LOCUS_09930 gene hemJ 71763 71335 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_09930 71875 72903 gene locus_tag LOCUS_09940 gene argC 71875 72903 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_09940 72911 73630 gene locus_tag LOCUS_09950 72911 73630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 73633 74073 gene locus_tag LOCUS_09960 73633 74073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 74135 74494 gene locus_tag LOCUS_09970 gene erpA 74135 74494 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_09970 75438 75755 gene locus_tag LOCUS_09980 75438 75755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 75902 77164 gene locus_tag LOCUS_09990 75902 77164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 77931 77167 gene locus_tag LOCUS_10000 gene cofE 77931 77167 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_10000 78598 77939 gene locus_tag LOCUS_10010 gene npdG 78598 77939 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_10010 79675 78647 gene locus_tag LOCUS_10020 79675 78647 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_10020 79803 80261 gene locus_tag LOCUS_10030 79803 80261 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908387.1 protein_id gnl|my_center|LOCUS_10030 80332 80583 gene locus_tag LOCUS_10040 80332 80583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 80580 81290 gene locus_tag LOCUS_10050 gene cobB 80580 81290 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952746.1 protein_id gnl|my_center|LOCUS_10050 81346 82506 gene locus_tag LOCUS_10060 81346 82506 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_10060 82503 83567 gene locus_tag LOCUS_10070 82503 83567 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_10070 83631 84110 gene locus_tag LOCUS_10080 83631 84110 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_10080 84278 84754 gene locus_tag LOCUS_10090 84278 84754 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_10090 85117 84842 gene locus_tag LOCUS_10100 85117 84842 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_10100 85796 85263 gene locus_tag LOCUS_10110 gene fldA 85796 85263 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 protein_id gnl|my_center|LOCUS_10110 86048 87139 gene locus_tag LOCUS_10120 86048 87139 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_10120 87458 88039 gene locus_tag LOCUS_10130 87458 88039 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_10130 88041 89672 gene locus_tag LOCUS_10140 88041 89672 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_10140 92204 89688 gene locus_tag LOCUS_10150 92204 89688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 92454 93548 gene locus_tag LOCUS_10160 gene thiO 92454 93548 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_10160 93630 96458 gene locus_tag LOCUS_10170 gene ileS 93630 96458 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_10170 96473 96952 gene locus_tag LOCUS_10180 gene lspA 96473 96952 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_10180 98126 96960 gene locus_tag LOCUS_10190 gene pdxB 98126 96960 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706175.1 protein_id gnl|my_center|LOCUS_10190 98669 98175 gene locus_tag LOCUS_10200 98669 98175 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_10200 99003 98662 gene locus_tag LOCUS_10210 99003 98662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 99138 99437 gene locus_tag LOCUS_10220 99138 99437 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_10220 99437 100036 gene locus_tag LOCUS_10230 99437 100036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 100146 100071 gene locus_tag LOCUS_t00080 100146 100071 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 2256 223 gene locus_tag LOCUS_10240 gene metG 2256 223 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_10240 2482 3996 gene locus_tag LOCUS_10250 2482 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4809 4012 gene locus_tag LOCUS_10260 gene trpC 4809 4012 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_10260 5830 4793 gene locus_tag LOCUS_10270 gene trpD 5830 4793 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_10270 6438 5851 gene locus_tag LOCUS_10280 6438 5851 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_10280 7237 6422 gene locus_tag LOCUS_10290 7237 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8749 7262 gene locus_tag LOCUS_10300 gene trpE 8749 7262 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_10300 8996 10147 gene locus_tag LOCUS_10310 8996 10147 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_10310 10199 11368 gene locus_tag LOCUS_10320 10199 11368 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_10320 11382 12518 gene locus_tag LOCUS_10330 gene pimD 11382 12518 CDS product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 protein_id gnl|my_center|LOCUS_10330 12542 13588 gene locus_tag LOCUS_10340 gene ruvB 12542 13588 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 protein_id gnl|my_center|LOCUS_10340 13598 14551 gene locus_tag LOCUS_10350 13598 14551 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929888.1 protein_id gnl|my_center|LOCUS_10350 14616 15056 gene locus_tag LOCUS_10360 gene ybgC 14616 15056 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_10360 15046 15744 gene locus_tag LOCUS_10370 gene tolQ 15046 15744 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_10370 15741 16166 gene locus_tag LOCUS_10380 gene tolR 15741 16166 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_10380 16171 17097 gene locus_tag LOCUS_10390 16171 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 17101 18411 gene locus_tag LOCUS_10400 gene tolB 17101 18411 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_10400 18503 19045 gene locus_tag LOCUS_10410 gene pal 18503 19045 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_10410 19065 19880 gene locus_tag LOCUS_10420 19065 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 19994 20069 gene locus_tag LOCUS_t00090 19994 20069 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20255 21856 gene locus_tag LOCUS_10430 gene pckA 20255 21856 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265689.1 protein_id gnl|my_center|LOCUS_10430 23327 21870 gene locus_tag LOCUS_10440 23327 21870 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767670.1 protein_id gnl|my_center|LOCUS_10440 23467 23697 gene locus_tag LOCUS_10450 23467 23697 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063946.1 protein_id gnl|my_center|LOCUS_10450 23824 25551 gene locus_tag LOCUS_10460 23824 25551 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_10460 25548 26042 gene locus_tag LOCUS_10470 gene ilvN 25548 26042 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_10470 26080 27096 gene locus_tag LOCUS_10480 gene ilvC 26080 27096 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_10480 27123 27914 gene locus_tag LOCUS_10490 gene pssA 27123 27914 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_10490 28117 29667 gene locus_tag LOCUS_10500 28117 29667 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_10500 29685 30218 gene locus_tag LOCUS_10510 29685 30218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 30211 30693 gene locus_tag LOCUS_10520 gene rimI 30211 30693 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191864.1 protein_id gnl|my_center|LOCUS_10520 30861 32258 gene locus_tag LOCUS_10530 30861 32258 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_10530 32415 33923 gene locus_tag LOCUS_10540 32415 33923 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_10540 33966 34736 gene locus_tag LOCUS_10550 33966 34736 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_10550 35596 36690 gene locus_tag LOCUS_10560 35596 36690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 36906 37463 gene locus_tag LOCUS_10570 36906 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 37785 38618 gene locus_tag LOCUS_10580 37785 38618 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_10580 38718 38912 gene locus_tag LOCUS_10590 38718 38912 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700404.1 protein_id gnl|my_center|LOCUS_10590 39759 38971 gene locus_tag LOCUS_10600 39759 38971 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_10600 40594 39785 gene locus_tag LOCUS_10610 40594 39785 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_10610 41803 40637 gene locus_tag LOCUS_10620 41803 40637 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_10620 43123 41810 gene locus_tag LOCUS_10630 43123 41810 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_10630 44163 43138 gene locus_tag LOCUS_10640 44163 43138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 45309 44197 gene locus_tag LOCUS_10650 45309 44197 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_10650 45768 45334 gene locus_tag LOCUS_10660 45768 45334 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075834.1 protein_id gnl|my_center|LOCUS_10660 46931 45783 gene locus_tag LOCUS_10670 46931 45783 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_10670 48134 46983 gene locus_tag LOCUS_10680 48134 46983 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064691.1 protein_id gnl|my_center|LOCUS_10680 49486 48542 gene locus_tag LOCUS_10690 49486 48542 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965341.1 protein_id gnl|my_center|LOCUS_10690 51428 49515 gene locus_tag LOCUS_10700 51428 49515 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_10700 52160 51450 gene locus_tag LOCUS_10710 52160 51450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_10710 52302 52793 gene locus_tag LOCUS_10720 gene aroK 52302 52793 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946667.1 protein_id gnl|my_center|LOCUS_10720 52787 53890 gene locus_tag LOCUS_10730 gene aroB 52787 53890 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_10730 53925 55637 gene locus_tag LOCUS_10740 53925 55637 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070660.1 protein_id gnl|my_center|LOCUS_10740 55771 56646 gene locus_tag LOCUS_10750 55771 56646 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_10750 56669 57856 gene locus_tag LOCUS_10760 56669 57856 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_10760 61473 57886 gene locus_tag LOCUS_10770 61473 57886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 63318 61513 gene locus_tag LOCUS_10780 63318 61513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 64642 63635 gene locus_tag LOCUS_10790 64642 63635 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_10790 65956 64679 gene locus_tag LOCUS_10800 gene tviB 65956 64679 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_10800 67045 66167 gene locus_tag LOCUS_10810 67045 66167 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103885.1 protein_id gnl|my_center|LOCUS_10810 67242 68651 gene locus_tag LOCUS_10820 gene leuC 67242 68651 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_10820 68662 69300 gene locus_tag LOCUS_10830 gene leuD 68662 69300 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_10830 69322 70392 gene locus_tag LOCUS_10840 gene leuB 69322 70392 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267364.1 protein_id gnl|my_center|LOCUS_10840 70458 71480 gene locus_tag LOCUS_10850 70458 71480 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_10850 71625 74597 gene locus_tag LOCUS_10860 71625 74597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 74745 75455 gene locus_tag LOCUS_10870 gene truA 74745 75455 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 protein_id gnl|my_center|LOCUS_10870 75528 76169 gene locus_tag LOCUS_10880 75528 76169 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_10880 76138 77376 gene locus_tag LOCUS_10890 gene trpB 76138 77376 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_10890 77373 78191 gene locus_tag LOCUS_10900 gene trpA 77373 78191 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980825.1 protein_id gnl|my_center|LOCUS_10900 78196 79071 gene locus_tag LOCUS_10910 gene accD 78196 79071 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_10910 79127 80410 gene locus_tag LOCUS_10920 gene folC 79127 80410 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_10920 80452 81024 gene locus_tag LOCUS_10930 80452 81024 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_10930 81101 81637 gene locus_tag LOCUS_10940 gene cvpA 81101 81637 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_10940 81669 83204 gene locus_tag LOCUS_10950 gene purF 81669 83204 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_10950 83218 83778 gene locus_tag LOCUS_10960 gene elsL 83218 83778 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_10960 83969 84670 gene locus_tag LOCUS_10970 83969 84670 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_10970 84963 85550 gene locus_tag LOCUS_10980 84963 85550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 85580 86779 gene locus_tag LOCUS_10990 85580 86779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 86780 87367 gene locus_tag LOCUS_11000 gene msrQ 86780 87367 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_11000 87707 87393 gene locus_tag LOCUS_11010 87707 87393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 88233 87754 gene locus_tag LOCUS_11020 gene rraA 88233 87754 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_11020 89294 88254 gene locus_tag LOCUS_11030 89294 88254 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_11030 89432 89617 gene locus_tag LOCUS_11040 89432 89617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 89712 90101 gene locus_tag LOCUS_11050 gene sdhC 89712 90101 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_11050 90108 90491 gene locus_tag LOCUS_11060 gene sdhD 90108 90491 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_11060 90495 92285 gene locus_tag LOCUS_11070 gene sdhA 90495 92285 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_11070 92344 93126 gene locus_tag LOCUS_11080 92344 93126 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_11080 93221 93412 gene locus_tag LOCUS_11090 93221 93412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 93823 94704 gene locus_tag LOCUS_11100 93823 94704 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_11100 95838 94708 gene locus_tag LOCUS_11110 95838 94708 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_11110 96005 96349 gene locus_tag LOCUS_11120 96005 96349 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943583.1 protein_id gnl|my_center|LOCUS_11120 96382 97428 gene locus_tag LOCUS_11130 96382 97428 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 protein_id gnl|my_center|LOCUS_11130 97433 98644 gene locus_tag LOCUS_11140 gene arsJ 97433 98644 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence009 3 647 gene locus_tag LOCUS_11150 3 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1598 732 gene locus_tag LOCUS_11160 1598 732 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369148.1 protein_id gnl|my_center|LOCUS_11160 1819 2535 gene locus_tag LOCUS_11170 gene rph 1819 2535 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_11170 2535 3134 gene locus_tag LOCUS_11180 2535 3134 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_11180 3139 4290 gene locus_tag LOCUS_11190 3139 4290 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_11190 5204 4449 gene locus_tag LOCUS_11200 5204 4449 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_11200 5657 6196 gene locus_tag LOCUS_11210 gene gntX 5657 6196 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817358.1 protein_id gnl|my_center|LOCUS_11210 7119 6193 gene locus_tag LOCUS_11220 gene ubiA 7119 6193 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772835.1 protein_id gnl|my_center|LOCUS_11220 7195 8538 gene locus_tag LOCUS_11230 gene gorA 7195 8538 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704063.1 protein_id gnl|my_center|LOCUS_11230 8564 9619 gene locus_tag LOCUS_11240 gene hrcA 8564 9619 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_11240 9692 10300 gene locus_tag LOCUS_11250 gene grpE 9692 10300 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064038.1 protein_id gnl|my_center|LOCUS_11250 10385 12307 gene locus_tag LOCUS_11260 gene dnaK 10385 12307 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_11260 12391 13524 gene locus_tag LOCUS_11270 gene dnaJ 12391 13524 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157034.1 protein_id gnl|my_center|LOCUS_11270 13761 13612 gene locus_tag LOCUS_11280 13761 13612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 14826 13927 gene locus_tag LOCUS_11290 14826 13927 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764752.1 protein_id gnl|my_center|LOCUS_11290 16076 14841 gene locus_tag LOCUS_11300 16076 14841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 17123 16173 gene locus_tag LOCUS_11310 gene ispH 17123 16173 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116992.1 protein_id gnl|my_center|LOCUS_11310 17857 17123 gene locus_tag LOCUS_11320 17857 17123 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_11320 17978 18490 gene locus_tag LOCUS_11330 17978 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 18622 19272 gene locus_tag LOCUS_11340 18622 19272 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_11340 19294 20343 gene locus_tag LOCUS_11350 19294 20343 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_11350 20487 21683 gene locus_tag LOCUS_11360 gene nhaA 20487 21683 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 protein_id gnl|my_center|LOCUS_11360 21891 22646 gene locus_tag LOCUS_11370 21891 22646 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266402.1 protein_id gnl|my_center|LOCUS_11370 22643 23416 gene locus_tag LOCUS_11380 22643 23416 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402969.1 protein_id gnl|my_center|LOCUS_11380 23425 23673 gene locus_tag LOCUS_11390 23425 23673 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081091609.1 protein_id gnl|my_center|LOCUS_11390 23676 23933 gene locus_tag LOCUS_11400 23676 23933 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418340.1 protein_id gnl|my_center|LOCUS_11400 23908 24096 gene locus_tag LOCUS_11410 23908 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 24080 24490 gene locus_tag LOCUS_11420 24080 24490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11420 24487 26205 gene locus_tag LOCUS_11430 24487 26205 CDS product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 protein_id gnl|my_center|LOCUS_11430 26198 26941 gene locus_tag LOCUS_11440 26198 26941 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 protein_id gnl|my_center|LOCUS_11440 26934 27911 gene locus_tag LOCUS_11450 26934 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11450 27930 29477 gene locus_tag LOCUS_11460 27930 29477 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 protein_id gnl|my_center|LOCUS_11460 29474 29890 gene locus_tag LOCUS_11470 29474 29890 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 protein_id gnl|my_center|LOCUS_11470 29890 30492 gene locus_tag LOCUS_11480 29890 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 30473 32863 gene locus_tag LOCUS_11490 30473 32863 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_11490 32860 34107 gene locus_tag LOCUS_11500 32860 34107 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074032.1 protein_id gnl|my_center|LOCUS_11500 34116 34643 gene locus_tag LOCUS_11510 34116 34643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 34640 35833 gene locus_tag LOCUS_11520 34640 35833 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765463.1 protein_id gnl|my_center|LOCUS_11520 35830 36282 gene locus_tag LOCUS_11530 35830 36282 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 protein_id gnl|my_center|LOCUS_11530 36279 37010 gene locus_tag LOCUS_11540 gene fabG 36279 37010 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765466.1 protein_id gnl|my_center|LOCUS_11540 37007 38239 gene locus_tag LOCUS_11550 37007 38239 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_11550 38263 39192 gene locus_tag LOCUS_11560 38263 39192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943612.1 protein_id gnl|my_center|LOCUS_11560 39189 40400 gene locus_tag LOCUS_11570 39189 40400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143462.1 protein_id gnl|my_center|LOCUS_11570 40407 40682 gene locus_tag LOCUS_11580 40407 40682 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_11580 40660 41817 gene locus_tag LOCUS_11590 40660 41817 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_11590 41817 42671 gene locus_tag LOCUS_11600 41817 42671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 43068 43337 gene locus_tag LOCUS_11610 43068 43337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 43437 45101 gene locus_tag LOCUS_11620 gene yidC 43437 45101 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_11620 45111 46472 gene locus_tag LOCUS_11630 gene mnmE 45111 46472 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 protein_id gnl|my_center|LOCUS_11630 48448 46484 gene locus_tag LOCUS_11640 48448 46484 CDS product 7TM diverse intracellular signaling domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993691.1 protein_id gnl|my_center|LOCUS_11640 48630 49253 gene locus_tag LOCUS_11650 48630 49253 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_11650 49425 52565 gene locus_tag LOCUS_11660 49425 52565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 52739 53620 gene locus_tag LOCUS_11670 52739 53620 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_11670 54025 53633 gene locus_tag LOCUS_11680 54025 53633 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073500.1 protein_id gnl|my_center|LOCUS_11680 54489 54202 gene locus_tag LOCUS_11690 54489 54202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 55459 54749 gene locus_tag LOCUS_11700 55459 54749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 55904 55692 gene locus_tag LOCUS_11710 55904 55692 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_11710 60671 56283 gene locus_tag LOCUS_11720 60671 56283 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_11720 60882 62360 gene locus_tag LOCUS_11730 60882 62360 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_11730 62385 63458 gene locus_tag LOCUS_11740 62385 63458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 64011 63694 gene locus_tag LOCUS_11750 64011 63694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 64233 64147 gene locus_tag LOCUS_t00100 64233 64147 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 64371 65783 gene locus_tag LOCUS_11760 gene argH 64371 65783 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_11760 66132 65791 gene locus_tag LOCUS_11770 gene panD 66132 65791 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_11770 66841 66224 gene locus_tag LOCUS_11780 gene gmk 66841 66224 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 protein_id gnl|my_center|LOCUS_11780 67392 66844 gene locus_tag LOCUS_11790 67392 66844 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763288.1 protein_id gnl|my_center|LOCUS_11790 68656 67412 gene locus_tag LOCUS_11800 68656 67412 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_11800 70289 68808 gene locus_tag LOCUS_11810 70289 68808 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_11810 70715 70479 gene locus_tag LOCUS_11820 70715 70479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 73213 71222 gene locus_tag LOCUS_11830 gene slt 73213 71222 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_11830 73331 74146 gene locus_tag LOCUS_11840 73331 74146 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_11840 74731 74129 gene locus_tag LOCUS_11850 74731 74129 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930903.1 protein_id gnl|my_center|LOCUS_11850 74949 75554 gene locus_tag LOCUS_11860 74949 75554 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_11860 76051 75620 gene locus_tag LOCUS_11870 76051 75620 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_11870 76169 76786 gene locus_tag LOCUS_11880 76169 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 77372 76764 gene locus_tag LOCUS_11890 77372 76764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 77626 79407 gene locus_tag LOCUS_11900 77626 79407 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_11900 79404 81242 gene locus_tag LOCUS_11910 79404 81242 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_11910 81239 82294 gene locus_tag LOCUS_11920 81239 82294 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_11920 82551 83051 gene locus_tag LOCUS_11930 82551 83051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 83041 83907 gene locus_tag LOCUS_11940 gene speE 83041 83907 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114619.1 protein_id gnl|my_center|LOCUS_11940 83904 85055 gene locus_tag LOCUS_11950 83904 85055 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705184.1 protein_id gnl|my_center|LOCUS_11950 86023 85103 gene locus_tag LOCUS_11960 86023 85103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 88949 86025 gene locus_tag LOCUS_11970 88949 86025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 89889 88939 gene locus_tag LOCUS_11980 89889 88939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_11980 90237 91181 gene locus_tag LOCUS_11990 90237 91181 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_11990 91185 91499 gene locus_tag LOCUS_12000 91185 91499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence010 10239 3637 gene locus_tag LOCUS_12010 10239 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11801 10653 gene locus_tag LOCUS_12020 11801 10653 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_12020 12224 11814 gene locus_tag LOCUS_12030 12224 11814 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_12030 13176 12256 gene locus_tag LOCUS_12040 13176 12256 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_12040 14399 13236 gene locus_tag LOCUS_12050 gene acdA 14399 13236 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_12050 14985 16436 gene locus_tag LOCUS_12060 14985 16436 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_12060 16460 18055 gene locus_tag LOCUS_12070 16460 18055 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550980.1 protein_id gnl|my_center|LOCUS_12070 18470 18937 gene locus_tag LOCUS_12080 gene rimP 18470 18937 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351719.1 protein_id gnl|my_center|LOCUS_12080 18995 20494 gene locus_tag LOCUS_12090 gene nusA 18995 20494 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_12090 20516 23143 gene locus_tag LOCUS_12100 gene infB 20516 23143 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707074.1 protein_id gnl|my_center|LOCUS_12100 23144 23512 gene locus_tag LOCUS_12110 gene rbfA 23144 23512 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_12110 23521 24474 gene locus_tag LOCUS_12120 gene truB 23521 24474 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_12120 24594 24866 gene locus_tag LOCUS_12130 gene rpsO 24594 24866 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_12130 24893 26995 gene locus_tag LOCUS_12140 gene pnp 24893 26995 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_12140 27110 27586 gene locus_tag LOCUS_12150 gene tadA 27110 27586 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191221.1 protein_id gnl|my_center|LOCUS_12150 28069 27611 gene locus_tag LOCUS_12160 28069 27611 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_12160 29122 28097 gene locus_tag LOCUS_12170 29122 28097 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_12170 29225 29638 gene locus_tag LOCUS_12180 29225 29638 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_12180 30543 29653 gene locus_tag LOCUS_12190 gene cysM 30543 29653 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_12190 30852 31871 gene locus_tag LOCUS_12200 30852 31871 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_12200 31955 33151 gene locus_tag LOCUS_12210 31955 33151 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103488.1 protein_id gnl|my_center|LOCUS_12210 33162 34277 gene locus_tag LOCUS_12220 33162 34277 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_12220 34304 35071 gene locus_tag LOCUS_12230 34304 35071 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385286.1 protein_id gnl|my_center|LOCUS_12230 35338 35838 gene locus_tag LOCUS_12240 35338 35838 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_12240 35928 36359 gene locus_tag LOCUS_12250 35928 36359 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_12250 36579 37841 gene locus_tag LOCUS_12260 36579 37841 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_12260 37838 38293 gene locus_tag LOCUS_12270 37838 38293 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_12270 39563 38361 gene locus_tag LOCUS_12280 39563 38361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966119.1 protein_id gnl|my_center|LOCUS_12280 40682 39636 gene locus_tag LOCUS_12290 40682 39636 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_12290 41618 40728 gene locus_tag LOCUS_12300 41618 40728 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_12300 43426 41618 gene locus_tag LOCUS_12310 43426 41618 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_12310 44214 43426 gene locus_tag LOCUS_12320 44214 43426 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391257.1 protein_id gnl|my_center|LOCUS_12320 45023 44229 gene locus_tag LOCUS_12330 45023 44229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_12330 45374 46243 gene locus_tag LOCUS_12340 45374 46243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 46288 47088 gene locus_tag LOCUS_12350 gene phnC 46288 47088 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682233.1 protein_id gnl|my_center|LOCUS_12350 47081 47896 gene locus_tag LOCUS_12360 gene phnE 47081 47896 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127689.1 protein_id gnl|my_center|LOCUS_12360 47903 48583 gene locus_tag LOCUS_12370 47903 48583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 48684 49088 gene locus_tag LOCUS_12380 48684 49088 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387476.1 protein_id gnl|my_center|LOCUS_12380 49539 49174 gene locus_tag LOCUS_12390 49539 49174 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 protein_id gnl|my_center|LOCUS_12390 50636 49665 gene locus_tag LOCUS_12400 50636 49665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 51234 50725 gene locus_tag LOCUS_12410 gene yjgA 51234 50725 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651852.1 protein_id gnl|my_center|LOCUS_12410 51874 51245 gene locus_tag LOCUS_12420 51874 51245 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330118.1 protein_id gnl|my_center|LOCUS_12420 53015 52074 gene locus_tag LOCUS_12430 53015 52074 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385586.1 protein_id gnl|my_center|LOCUS_12430 53755 53090 gene locus_tag LOCUS_12440 53755 53090 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217456.1 protein_id gnl|my_center|LOCUS_12440 54798 53806 gene locus_tag LOCUS_12450 54798 53806 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_12450 55638 54805 gene locus_tag LOCUS_12460 55638 54805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 56483 55638 gene locus_tag LOCUS_12470 56483 55638 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_12470 57287 56493 gene locus_tag LOCUS_12480 57287 56493 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087742.1 protein_id gnl|my_center|LOCUS_12480 58331 57351 gene locus_tag LOCUS_12490 gene rssA 58331 57351 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169303.1 protein_id gnl|my_center|LOCUS_12490 59416 58328 gene locus_tag LOCUS_12500 59416 58328 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_12500 60100 59543 gene locus_tag LOCUS_12510 gene folE 60100 59543 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_12510 61426 60161 gene locus_tag LOCUS_12520 61426 60161 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880067.1 protein_id gnl|my_center|LOCUS_12520 61901 61395 gene locus_tag LOCUS_12530 61901 61395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 62402 63550 gene locus_tag LOCUS_12540 gene carA 62402 63550 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_12540 63543 66770 gene locus_tag LOCUS_12550 gene carB 63543 66770 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_12550 66767 67243 gene locus_tag LOCUS_12560 gene greA 66767 67243 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128178593.1 protein_id gnl|my_center|LOCUS_12560 67788 67309 gene locus_tag LOCUS_12570 gene smpB 67788 67309 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_12570 67838 68269 gene locus_tag LOCUS_12580 67838 68269 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400153.1 protein_id gnl|my_center|LOCUS_12580 68277 68561 gene locus_tag LOCUS_12590 68277 68561 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_12590 69667 69365 gene locus_tag LOCUS_12600 69667 69365 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616835.1 protein_id gnl|my_center|LOCUS_12600 70897 69686 gene locus_tag LOCUS_12610 70897 69686 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_12610 71773 71042 gene locus_tag LOCUS_12620 gene dnaQ 71773 71042 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996329.1 protein_id gnl|my_center|LOCUS_12620 72225 71773 gene locus_tag LOCUS_12630 gene rnhA 72225 71773 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 protein_id gnl|my_center|LOCUS_12630 73003 72212 gene locus_tag LOCUS_12640 73003 72212 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 protein_id gnl|my_center|LOCUS_12640 73105 74829 gene locus_tag LOCUS_12650 73105 74829 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_12650 74832 75569 gene locus_tag LOCUS_12660 74832 75569 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_12660 76883 75555 gene locus_tag LOCUS_12670 76883 75555 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 protein_id gnl|my_center|LOCUS_12670 77015 77581 gene locus_tag LOCUS_12680 gene msrA 77015 77581 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_12680 77592 79325 gene locus_tag LOCUS_12690 gene recJ 77592 79325 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947190.1 protein_id gnl|my_center|LOCUS_12690 79417 80472 gene locus_tag LOCUS_12700 gene prfB 79417 80472 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 protein_id gnl|my_center|LOCUS_12700 80507 82006 gene locus_tag LOCUS_12710 gene lysS 80507 82006 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_12710 82063 82281 gene locus_tag LOCUS_12720 gene infA 82063 82281 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 protein_id gnl|my_center|LOCUS_12720 84623 82347 gene locus_tag LOCUS_12730 gene clpA 84623 82347 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_12730 84960 84658 gene locus_tag LOCUS_12740 gene clpS 84960 84658 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_12740 86062 85199 gene locus_tag LOCUS_12750 86062 85199 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_12750 86754 86059 gene locus_tag LOCUS_12760 gene urtE 86754 86059 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969815.1 protein_id gnl|my_center|LOCUS_12760 87569 86778 gene locus_tag LOCUS_12770 gene urtD 87569 86778 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976302.1 protein_id gnl|my_center|LOCUS_12770 88699 87566 gene locus_tag LOCUS_12780 gene urtC 88699 87566 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_12780 90316 88703 gene locus_tag LOCUS_12790 gene urtB 90316 88703 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence011 <1 555 gene locus_tag LOCUS_12800 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977890.1:SDR family oxidoreductase 611 1222 gene locus_tag LOCUS_12810 611 1222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530047.1 protein_id gnl|my_center|LOCUS_12810 1219 2328 gene locus_tag LOCUS_12820 1219 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3402 2683 gene locus_tag LOCUS_12830 3402 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3530 4105 gene locus_tag LOCUS_12840 3530 4105 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_12840 5121 4318 gene locus_tag LOCUS_12850 5121 4318 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094942.1 protein_id gnl|my_center|LOCUS_12850 6649 5225 gene locus_tag LOCUS_12860 6649 5225 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267715.1 protein_id gnl|my_center|LOCUS_12860 7577 6642 gene locus_tag LOCUS_12870 7577 6642 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919953.1 protein_id gnl|my_center|LOCUS_12870 8317 7574 gene locus_tag LOCUS_12880 8317 7574 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_12880 9954 8314 gene locus_tag LOCUS_12890 9954 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 10825 9971 gene locus_tag LOCUS_12900 10825 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 12215 11082 gene locus_tag LOCUS_12910 12215 11082 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265760.1 protein_id gnl|my_center|LOCUS_12910 12327 12917 gene locus_tag LOCUS_12920 12327 12917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956720.1 protein_id gnl|my_center|LOCUS_12920 12914 13825 gene locus_tag LOCUS_12930 12914 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 16165 14363 gene locus_tag LOCUS_12940 16165 14363 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072291.1 protein_id gnl|my_center|LOCUS_12940 17012 16569 gene locus_tag LOCUS_12950 17012 16569 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_12950 17167 17601 gene locus_tag LOCUS_12960 17167 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 17601 18176 gene locus_tag LOCUS_12970 17601 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18285 18494 gene locus_tag LOCUS_12980 18285 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 18524 18928 gene locus_tag LOCUS_12990 18524 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 21375 19240 gene locus_tag LOCUS_13000 21375 19240 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_13000 22407 21433 gene locus_tag LOCUS_13010 gene cysB 22407 21433 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_13010 23688 22540 gene locus_tag LOCUS_13020 23688 22540 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_13020 24118 24876 gene locus_tag LOCUS_13030 24118 24876 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_13030 24974 25582 gene locus_tag LOCUS_13040 gene petA 24974 25582 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479718.1 protein_id gnl|my_center|LOCUS_13040 25582 26817 gene locus_tag LOCUS_13050 25582 26817 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_13050 26804 27577 gene locus_tag LOCUS_13060 26804 27577 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_13060 27747 28340 gene locus_tag LOCUS_13070 gene sspA 27747 28340 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_13070 28342 28755 gene locus_tag LOCUS_13080 28342 28755 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_13080 29428 28832 gene locus_tag LOCUS_13090 29428 28832 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_13090 29842 29462 gene locus_tag LOCUS_13100 29842 29462 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_13100 31616 29847 gene locus_tag LOCUS_13110 31616 29847 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 protein_id gnl|my_center|LOCUS_13110 31818 32690 gene locus_tag LOCUS_13120 gene rsmI 31818 32690 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_13120 33414 33848 gene locus_tag LOCUS_13130 gene mraZ 33414 33848 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073909.1 protein_id gnl|my_center|LOCUS_13130 33862 34797 gene locus_tag LOCUS_13140 gene rsmH 33862 34797 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_13140 34794 35060 gene locus_tag LOCUS_13150 gene ftsL 34794 35060 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094142.1 protein_id gnl|my_center|LOCUS_13150 35060 36772 gene locus_tag LOCUS_13160 35060 36772 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 protein_id gnl|my_center|LOCUS_13160 36772 38298 gene locus_tag LOCUS_13170 gene murE 36772 38298 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785134.1 protein_id gnl|my_center|LOCUS_13170 38295 39653 gene locus_tag LOCUS_13180 gene murF 38295 39653 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210438.1 protein_id gnl|my_center|LOCUS_13180 39650 40732 gene locus_tag LOCUS_13190 gene mraY 39650 40732 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_13190 40729 42078 gene locus_tag LOCUS_13200 gene murD 40729 42078 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_13200 42075 43271 gene locus_tag LOCUS_13210 gene ftsW 42075 43271 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_13210 43268 44377 gene locus_tag LOCUS_13220 gene murG 43268 44377 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_13220 44374 45819 gene locus_tag LOCUS_13230 gene murC 44374 45819 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_13230 45816 46772 gene locus_tag LOCUS_13240 45816 46772 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_13240 46769 47575 gene locus_tag LOCUS_13250 46769 47575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 47587 48825 gene locus_tag LOCUS_13260 gene ftsA 47587 48825 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_13260 48876 50018 gene locus_tag LOCUS_13270 gene ftsZ 48876 50018 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_13270 50136 51050 gene locus_tag LOCUS_13280 gene lpxC 50136 51050 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377651.1 protein_id gnl|my_center|LOCUS_13280 51484 51047 gene locus_tag LOCUS_13290 51484 51047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 51601 52521 gene locus_tag LOCUS_13300 51601 52521 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_13300 52683 55412 gene locus_tag LOCUS_13310 gene secA 52683 55412 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_13310 55445 56662 gene locus_tag LOCUS_13320 gene argJ 55445 56662 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105001.1 protein_id gnl|my_center|LOCUS_13320 56674 57636 gene locus_tag LOCUS_13330 56674 57636 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_13330 58458 57655 gene locus_tag LOCUS_13340 58458 57655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 58555 59373 gene locus_tag LOCUS_13350 58555 59373 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_13350 59905 59729 gene locus_tag LOCUS_13360 59905 59729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 62000 60720 gene locus_tag LOCUS_13370 gene dctM 62000 60720 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_13370 62548 61997 gene locus_tag LOCUS_13380 62548 61997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 63574 62558 gene locus_tag LOCUS_13390 63574 62558 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814124.1 protein_id gnl|my_center|LOCUS_13390 63736 64884 gene locus_tag LOCUS_13400 63736 64884 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_13400 67248 64921 gene locus_tag LOCUS_13410 67248 64921 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_13410 67593 69572 gene locus_tag LOCUS_13420 67593 69572 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_13420 69678 70178 gene locus_tag LOCUS_13430 69678 70178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 70186 72531 gene locus_tag LOCUS_13440 70186 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 73939 72554 gene locus_tag LOCUS_13450 gene hemN 73939 72554 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_13450 74885 74100 gene locus_tag LOCUS_13460 74885 74100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 76434 74902 gene locus_tag LOCUS_13470 76434 74902 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_13470 77516 76431 gene locus_tag LOCUS_13480 77516 76431 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_13480 77636 78565 gene locus_tag LOCUS_13490 77636 78565 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241008.1 protein_id gnl|my_center|LOCUS_13490 78558 80060 gene locus_tag LOCUS_13500 78558 80060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 80195 81436 gene locus_tag LOCUS_13510 80195 81436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence012 3740 2409 gene locus_tag LOCUS_13520 gene clpX 3740 2409 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_13520 4511 3879 gene locus_tag LOCUS_13530 gene clpP 4511 3879 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_13530 5857 4556 gene locus_tag LOCUS_13540 gene tig 5857 4556 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 protein_id gnl|my_center|LOCUS_13540 6092 6008 gene locus_tag LOCUS_t00110 6092 6008 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6260 6185 gene locus_tag LOCUS_t00120 6260 6185 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6357 6281 gene locus_tag LOCUS_t00130 6357 6281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6453 6377 gene locus_tag LOCUS_t00140 6453 6377 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7939 6521 gene locus_tag LOCUS_13550 gene gltX 7939 6521 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668173.1 protein_id gnl|my_center|LOCUS_13550 8152 8871 gene locus_tag LOCUS_13560 8152 8871 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 protein_id gnl|my_center|LOCUS_13560 9703 8888 gene locus_tag LOCUS_13570 9703 8888 CDS product ribosomal large subunit pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947176.1 protein_id gnl|my_center|LOCUS_13570 9792 10805 gene locus_tag LOCUS_13580 9792 10805 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_13580 12136 10811 gene locus_tag LOCUS_13590 12136 10811 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_13590 12403 13395 gene locus_tag LOCUS_13600 12403 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 13558 14265 gene locus_tag LOCUS_13610 13558 14265 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066872391.1 protein_id gnl|my_center|LOCUS_13610 14348 15517 gene locus_tag LOCUS_13620 14348 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15643 16776 gene locus_tag LOCUS_13630 15643 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 17889 17377 gene locus_tag LOCUS_13640 gene ftnA 17889 17377 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 protein_id gnl|my_center|LOCUS_13640 18152 18331 gene locus_tag LOCUS_13650 18152 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19966 19268 gene locus_tag LOCUS_13660 19966 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 21282 19963 gene locus_tag LOCUS_13670 21282 19963 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_13670 21485 21264 gene locus_tag LOCUS_13680 21485 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 22690 21662 gene locus_tag LOCUS_13690 22690 21662 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_13690 24535 22760 gene locus_tag LOCUS_13700 24535 22760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 24767 25996 gene locus_tag LOCUS_13710 24767 25996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 26146 27249 gene locus_tag LOCUS_13720 26146 27249 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968501.1 protein_id gnl|my_center|LOCUS_13720 27484 29688 gene locus_tag LOCUS_13730 27484 29688 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_13730 30557 30396 gene locus_tag LOCUS_13740 30557 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 30754 30599 gene locus_tag LOCUS_13750 30754 30599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 33437 31332 gene locus_tag LOCUS_13760 33437 31332 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_13760 33787 34596 gene locus_tag LOCUS_13770 gene exbB 33787 34596 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 protein_id gnl|my_center|LOCUS_13770 34593 35018 gene locus_tag LOCUS_13780 gene exbD 34593 35018 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970692.1 protein_id gnl|my_center|LOCUS_13780 35015 35749 gene locus_tag LOCUS_13790 35015 35749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 35801 36343 gene locus_tag LOCUS_13800 35801 36343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 36348 37781 gene locus_tag LOCUS_13810 36348 37781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 40164 37918 gene locus_tag LOCUS_13820 gene parC 40164 37918 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_13820 40378 40557 gene locus_tag LOCUS_13830 40378 40557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 40634 41890 gene locus_tag LOCUS_13840 40634 41890 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968505.1 protein_id gnl|my_center|LOCUS_13840 41951 43399 gene locus_tag LOCUS_13850 41951 43399 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992419.1 protein_id gnl|my_center|LOCUS_13850 43410 44495 gene locus_tag LOCUS_13860 43410 44495 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064172.1 protein_id gnl|my_center|LOCUS_13860 44498 45625 gene locus_tag LOCUS_13870 44498 45625 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 protein_id gnl|my_center|LOCUS_13870 45641 46807 gene locus_tag LOCUS_13880 45641 46807 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_13880 46919 47647 gene locus_tag LOCUS_13890 46919 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 48067 48327 gene locus_tag LOCUS_13900 48067 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 48726 48289 gene locus_tag LOCUS_13910 48726 48289 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160781.1 protein_id gnl|my_center|LOCUS_13910 48756 48932 gene locus_tag LOCUS_13920 48756 48932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 48910 49290 gene locus_tag LOCUS_13930 48910 49290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 49287 49892 gene locus_tag LOCUS_13940 49287 49892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170077.1 protein_id gnl|my_center|LOCUS_13940 50450 49920 gene locus_tag LOCUS_13950 50450 49920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 51167 50667 gene locus_tag LOCUS_13960 51167 50667 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903704.1 protein_id gnl|my_center|LOCUS_13960 52242 51217 gene locus_tag LOCUS_13970 52242 51217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_13970 53096 52320 gene locus_tag LOCUS_13980 53096 52320 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_13980 53245 55098 gene locus_tag LOCUS_13990 gene ftsH 53245 55098 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941840.1 protein_id gnl|my_center|LOCUS_13990 55179 55805 gene locus_tag LOCUS_14000 55179 55805 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966112.1 protein_id gnl|my_center|LOCUS_14000 56101 58203 gene locus_tag LOCUS_14010 56101 58203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 58206 58586 gene locus_tag LOCUS_14020 58206 58586 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721812.1 protein_id gnl|my_center|LOCUS_14020 58579 59028 gene locus_tag LOCUS_14030 58579 59028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 60445 59042 gene locus_tag LOCUS_14040 60445 59042 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_14040 61672 60518 gene locus_tag LOCUS_14050 61672 60518 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086714.1 protein_id gnl|my_center|LOCUS_14050 62999 61800 gene locus_tag LOCUS_14060 62999 61800 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_14060 63552 63124 gene locus_tag LOCUS_14070 63552 63124 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_14070 64733 63549 gene locus_tag LOCUS_14080 64733 63549 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_14080 65590 64787 gene locus_tag LOCUS_14090 65590 64787 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812493.1 protein_id gnl|my_center|LOCUS_14090 65679 66461 gene locus_tag LOCUS_14100 65679 66461 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966886.1 protein_id gnl|my_center|LOCUS_14100 67943 66480 gene locus_tag LOCUS_14110 67943 66480 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024339.1 protein_id gnl|my_center|LOCUS_14110 68357 68175 gene locus_tag LOCUS_14120 68357 68175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 68499 69623 gene locus_tag LOCUS_14130 68499 69623 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_14130 69629 70360 gene locus_tag LOCUS_14140 69629 70360 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799519.1 protein_id gnl|my_center|LOCUS_14140 70344 71240 gene locus_tag LOCUS_14150 70344 71240 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528051.1 protein_id gnl|my_center|LOCUS_14150 71254 72141 gene locus_tag LOCUS_14160 71254 72141 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_14160 72980 72195 gene locus_tag LOCUS_14170 72980 72195 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505733.1 protein_id gnl|my_center|LOCUS_14170 73610 73023 gene locus_tag LOCUS_14180 73610 73023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence013 243 500 gene locus_tag LOCUS_14190 243 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 537 881 gene locus_tag LOCUS_14200 537 881 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_14200 1050 2396 gene locus_tag LOCUS_14210 1050 2396 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_14210 2396 3619 gene locus_tag LOCUS_14220 2396 3619 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_14220 3629 4420 gene locus_tag LOCUS_14230 3629 4420 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_14230 4413 5084 gene locus_tag LOCUS_14240 gene nqrD 4413 5084 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_14240 5084 5692 gene locus_tag LOCUS_14250 gene nqrE 5084 5692 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_14250 5742 6962 gene locus_tag LOCUS_14260 gene nqrF 5742 6962 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 protein_id gnl|my_center|LOCUS_14260 7001 8014 gene locus_tag LOCUS_14270 7001 8014 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 protein_id gnl|my_center|LOCUS_14270 8025 8240 gene locus_tag LOCUS_14280 gene nqrM 8025 8240 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219688.1 protein_id gnl|my_center|LOCUS_14280 8726 8256 gene locus_tag LOCUS_14290 gene ptsN 8726 8256 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_14290 9153 8821 gene locus_tag LOCUS_14300 gene hpf 9153 8821 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_14300 10790 9288 gene locus_tag LOCUS_14310 10790 9288 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 protein_id gnl|my_center|LOCUS_14310 11666 10938 gene locus_tag LOCUS_14320 gene lptB 11666 10938 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_14320 12181 11663 gene locus_tag LOCUS_14330 gene lptA 12181 11663 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 protein_id gnl|my_center|LOCUS_14330 12740 12168 gene locus_tag LOCUS_14340 12740 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 13733 12762 gene locus_tag LOCUS_14350 13733 12762 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_14350 14711 13743 gene locus_tag LOCUS_14360 14711 13743 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_14360 15228 14803 gene locus_tag LOCUS_14370 15228 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 15380 16405 gene locus_tag LOCUS_14380 gene holA 15380 16405 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_14380 16413 17705 gene locus_tag LOCUS_14390 16413 17705 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_14390 17705 18343 gene locus_tag LOCUS_14400 gene nadD 17705 18343 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_14400 18340 18678 gene locus_tag LOCUS_14410 gene rsfS 18340 18678 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_14410 19453 18710 gene locus_tag LOCUS_14420 19453 18710 CDS product complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367168.1 protein_id gnl|my_center|LOCUS_14420 20775 19690 gene locus_tag LOCUS_14430 gene hisC 20775 19690 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040738.1 protein_id gnl|my_center|LOCUS_14430 22112 20796 gene locus_tag LOCUS_14440 gene hisD 22112 20796 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766528.1 protein_id gnl|my_center|LOCUS_14440 23177 22122 gene locus_tag LOCUS_14450 23177 22122 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324402.1 protein_id gnl|my_center|LOCUS_14450 23826 23161 gene locus_tag LOCUS_14460 gene hisG 23826 23161 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_14460 25094 23835 gene locus_tag LOCUS_14470 gene murA 25094 23835 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739059.1 protein_id gnl|my_center|LOCUS_14470 25304 26467 gene locus_tag LOCUS_14480 25304 26467 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_14480 26549 26824 gene locus_tag LOCUS_14490 26549 26824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 27318 26866 gene locus_tag LOCUS_14500 27318 26866 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_14500 27526 28797 gene locus_tag LOCUS_14510 27526 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 28883 29965 gene locus_tag LOCUS_14520 28883 29965 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388956.1 protein_id gnl|my_center|LOCUS_14520 29971 31596 gene locus_tag LOCUS_14530 29971 31596 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_14530 31586 32509 gene locus_tag LOCUS_14540 31586 32509 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_14540 32672 33574 gene locus_tag LOCUS_14550 32672 33574 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808542.1 protein_id gnl|my_center|LOCUS_14550 34411 33614 gene locus_tag LOCUS_14560 34411 33614 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_14560 35303 34518 gene locus_tag LOCUS_14570 35303 34518 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085849.1 protein_id gnl|my_center|LOCUS_14570 38620 35480 gene locus_tag LOCUS_14580 38620 35480 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_14580 39765 38623 gene locus_tag LOCUS_14590 39765 38623 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_14590 40229 39750 gene locus_tag LOCUS_14600 40229 39750 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_14600 40554 40231 gene locus_tag LOCUS_14610 40554 40231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 40456 41439 gene locus_tag LOCUS_14620 gene truD 40456 41439 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_14620 41423 42271 gene locus_tag LOCUS_14630 gene djlA 41423 42271 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200599.1 protein_id gnl|my_center|LOCUS_14630 42347 43735 gene locus_tag LOCUS_14640 gene purB 42347 43735 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371741.1 protein_id gnl|my_center|LOCUS_14640 43738 44166 gene locus_tag LOCUS_14650 43738 44166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143392.1 protein_id gnl|my_center|LOCUS_14650 45049 44216 gene locus_tag LOCUS_14660 45049 44216 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_14660 45933 45214 gene locus_tag LOCUS_14670 45933 45214 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_14670 46410 45973 gene locus_tag LOCUS_14680 46410 45973 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_14680 48052 46394 gene locus_tag LOCUS_14690 48052 46394 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_14690 48877 48092 gene locus_tag LOCUS_14700 48877 48092 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268904.1 protein_id gnl|my_center|LOCUS_14700 49131 50039 gene locus_tag LOCUS_14710 gene cysD 49131 50039 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_14710 50134 51819 gene locus_tag LOCUS_14720 gene cysN 50134 51819 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_14720 51974 52408 gene locus_tag LOCUS_14730 gene rpsF 51974 52408 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856034.1 protein_id gnl|my_center|LOCUS_14730 52436 52660 gene locus_tag LOCUS_14740 gene rpsR 52436 52660 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_14740 52693 53592 gene locus_tag LOCUS_14750 52693 53592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_14750 53559 54098 gene locus_tag LOCUS_14760 gene rplI 53559 54098 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_14760 54250 55644 gene locus_tag LOCUS_14770 54250 55644 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_14770 55652 56722 gene locus_tag LOCUS_14780 gene alr 55652 56722 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_14780 56774 57877 gene locus_tag LOCUS_14790 56774 57877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 58005 58880 gene locus_tag LOCUS_14800 gene galU 58005 58880 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_14800 59278 58925 gene locus_tag LOCUS_14810 59278 58925 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156592.1 protein_id gnl|my_center|LOCUS_14810 60114 59287 gene locus_tag LOCUS_14820 gene dapD 60114 59287 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_14820 61345 60146 gene locus_tag LOCUS_14830 gene dapC 61345 60146 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_14830 62871 61429 gene locus_tag LOCUS_14840 gene mltF 62871 61429 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_14840 63052 65379 gene locus_tag LOCUS_14850 63052 65379 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684941.1 protein_id gnl|my_center|LOCUS_14850 65467 65853 gene locus_tag LOCUS_14860 65467 65853 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_14860 65930 66232 gene locus_tag LOCUS_14870 gene ureA 65930 66232 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_14870 66244 66576 gene locus_tag LOCUS_14880 66244 66576 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence014 <1 1089 gene locus_tag LOCUS_14890 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945833.1:excinuclease ABC subunit UvrB 1304 3883 gene locus_tag LOCUS_14900 gene acnB 1304 3883 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 protein_id gnl|my_center|LOCUS_14900 4551 4003 gene locus_tag LOCUS_14910 4551 4003 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_14910 5288 4914 gene locus_tag LOCUS_14920 5288 4914 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_14920 6816 5596 gene locus_tag LOCUS_14930 gene ccmI 6816 5596 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 protein_id gnl|my_center|LOCUS_14930 7304 6831 gene locus_tag LOCUS_14940 7304 6831 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036834.1 protein_id gnl|my_center|LOCUS_14940 9280 7301 gene locus_tag LOCUS_14950 9280 7301 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_14950 9744 9277 gene locus_tag LOCUS_14960 gene ccmE 9744 9277 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 protein_id gnl|my_center|LOCUS_14960 9896 9741 gene locus_tag LOCUS_14970 9896 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10636 9893 gene locus_tag LOCUS_14980 gene ccmC 10636 9893 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_14980 10667 10816 gene locus_tag LOCUS_14990 10667 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 10908 11774 gene locus_tag LOCUS_15000 gene phnC 10908 11774 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104080.1 protein_id gnl|my_center|LOCUS_15000 11817 12812 gene locus_tag LOCUS_15010 gene phnD 11817 12812 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_15010 12909 13715 gene locus_tag LOCUS_15020 gene phnE 12909 13715 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_15020 13715 14200 gene locus_tag LOCUS_15030 gene phnG 13715 14200 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246944.1 protein_id gnl|my_center|LOCUS_15030 14200 14811 gene locus_tag LOCUS_15040 gene phnH 14200 14811 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965300.1 protein_id gnl|my_center|LOCUS_15040 14802 15899 gene locus_tag LOCUS_15050 14802 15899 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267544.1 protein_id gnl|my_center|LOCUS_15050 15892 16797 gene locus_tag LOCUS_15060 15892 16797 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704078.1 protein_id gnl|my_center|LOCUS_15060 16806 17597 gene locus_tag LOCUS_15070 gene phnK 16806 17597 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003524419.1 protein_id gnl|my_center|LOCUS_15070 17600 18310 gene locus_tag LOCUS_15080 gene phnL 17600 18310 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209287.1 protein_id gnl|my_center|LOCUS_15080 18307 19449 gene locus_tag LOCUS_15090 18307 19449 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403601.1 protein_id gnl|my_center|LOCUS_15090 19446 20204 gene locus_tag LOCUS_15100 19446 20204 CDS product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047139.1 protein_id gnl|my_center|LOCUS_15100 21891 20224 gene locus_tag LOCUS_15110 gene fadD 21891 20224 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758422.1 protein_id gnl|my_center|LOCUS_15110 22716 22003 gene locus_tag LOCUS_15120 22716 22003 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 protein_id gnl|my_center|LOCUS_15120 23601 22885 gene locus_tag LOCUS_15130 23601 22885 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_15130 23937 23701 gene locus_tag LOCUS_15140 23937 23701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 24495 23965 gene locus_tag LOCUS_15150 24495 23965 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_15150 25438 24536 gene locus_tag LOCUS_15160 25438 24536 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974459.1 protein_id gnl|my_center|LOCUS_15160 25576 26496 gene locus_tag LOCUS_15170 25576 26496 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976359.1 protein_id gnl|my_center|LOCUS_15170 28101 26803 gene locus_tag LOCUS_15180 28101 26803 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883615.1 protein_id gnl|my_center|LOCUS_15180 28745 28089 gene locus_tag LOCUS_15190 28745 28089 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690696.1 protein_id gnl|my_center|LOCUS_15190 29458 28745 gene locus_tag LOCUS_15200 29458 28745 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_15200 30800 29487 gene locus_tag LOCUS_15210 30800 29487 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_15210 30957 32123 gene locus_tag LOCUS_15220 30957 32123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_15220 33144 32170 gene locus_tag LOCUS_15230 33144 32170 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917982.1 protein_id gnl|my_center|LOCUS_15230 33295 34179 gene locus_tag LOCUS_15240 33295 34179 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_15240 34377 34826 gene locus_tag LOCUS_15250 34377 34826 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_15250 35534 34842 gene locus_tag LOCUS_15260 35534 34842 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_15260 36843 35569 gene locus_tag LOCUS_15270 36843 35569 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_15270 37724 37182 gene locus_tag LOCUS_15280 37724 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 37858 38802 gene locus_tag LOCUS_15290 gene ylqF 37858 38802 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247909.1 protein_id gnl|my_center|LOCUS_15290 38823 39818 gene locus_tag LOCUS_15300 38823 39818 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_15300 43495 39815 gene locus_tag LOCUS_15310 gene metH 43495 39815 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 protein_id gnl|my_center|LOCUS_15310 43583 44518 gene locus_tag LOCUS_15320 43583 44518 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_15320 44519 45379 gene locus_tag LOCUS_15330 gene metF 44519 45379 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_15330 47689 45395 gene locus_tag LOCUS_15340 47689 45395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 49119 47803 gene locus_tag LOCUS_15350 49119 47803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 49306 49932 gene locus_tag LOCUS_15360 49306 49932 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_15360 50813 50028 gene locus_tag LOCUS_15370 gene fabI 50813 50028 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 protein_id gnl|my_center|LOCUS_15370 51082 52983 gene locus_tag LOCUS_15380 51082 52983 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_15380 52987 54363 gene locus_tag LOCUS_15390 52987 54363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 54356 55537 gene locus_tag LOCUS_15400 54356 55537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 55534 57186 gene locus_tag LOCUS_15410 55534 57186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965361.1 protein_id gnl|my_center|LOCUS_15410 58786 57155 gene locus_tag LOCUS_15420 58786 57155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 59351 59427 gene locus_tag LOCUS_t00150 59351 59427 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 60597 59473 gene locus_tag LOCUS_15430 gene ald 60597 59473 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 protein_id gnl|my_center|LOCUS_15430 61434 60643 gene locus_tag LOCUS_15440 gene fetB 61434 60643 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_15440 62036 61431 gene locus_tag LOCUS_15450 62036 61431 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_15450 63044 62274 gene locus_tag LOCUS_15460 63044 62274 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_15460 63970 63056 gene locus_tag LOCUS_15470 63970 63056 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_15470 65060 63951 gene locus_tag LOCUS_15480 65060 63951 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence015 <1 601 gene locus_tag LOCUS_15490 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929929.1:acyl-CoA dehydrogenase family protein 635 1456 gene locus_tag LOCUS_15500 gene atuE 635 1456 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_15500 1453 3408 gene locus_tag LOCUS_15510 gene atuF 1453 3408 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_15510 4257 3472 gene locus_tag LOCUS_15520 4257 3472 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388288.1 protein_id gnl|my_center|LOCUS_15520 4354 5232 gene locus_tag LOCUS_15530 4354 5232 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_15530 5404 6663 gene locus_tag LOCUS_15540 5404 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7475 6675 gene locus_tag LOCUS_15550 7475 6675 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_15550 7556 8158 gene locus_tag LOCUS_15560 gene cobO 7556 8158 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192682.1 protein_id gnl|my_center|LOCUS_15560 8210 8845 gene locus_tag LOCUS_15570 8210 8845 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_15570 12584 8835 gene locus_tag LOCUS_15580 gene hrpA 12584 8835 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560359.1 protein_id gnl|my_center|LOCUS_15580 13425 12748 gene locus_tag LOCUS_15590 13425 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 13642 13821 gene locus_tag LOCUS_15600 13642 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 13880 14833 gene locus_tag LOCUS_15610 13880 14833 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_15610 15406 14825 gene locus_tag LOCUS_15620 15406 14825 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_15620 16327 15455 gene locus_tag LOCUS_15630 gene sucD 16327 15455 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_15630 17492 16329 gene locus_tag LOCUS_15640 gene sucC 17492 16329 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444794.1 protein_id gnl|my_center|LOCUS_15640 19052 17616 gene locus_tag LOCUS_15650 gene lpdA 19052 17616 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_15650 20336 19077 gene locus_tag LOCUS_15660 gene odhB 20336 19077 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_15660 23218 20345 gene locus_tag LOCUS_15670 23218 20345 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_15670 23851 24435 gene locus_tag LOCUS_15680 23851 24435 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817027.1 protein_id gnl|my_center|LOCUS_15680 25023 24841 gene locus_tag LOCUS_15690 25023 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 25770 25694 gene locus_tag LOCUS_t00160 25770 25694 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25876 25800 gene locus_tag LOCUS_t00170 25876 25800 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27883 25970 gene locus_tag LOCUS_15700 gene thiC 27883 25970 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_15700 28321 29610 gene locus_tag LOCUS_15710 gene opmH 28321 29610 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_15710 29630 30187 gene locus_tag LOCUS_15720 29630 30187 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_15720 30203 31117 gene locus_tag LOCUS_15730 30203 31117 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267129.1 protein_id gnl|my_center|LOCUS_15730 31117 32403 gene locus_tag LOCUS_15740 gene waaA 31117 32403 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_15740 33093 32377 gene locus_tag LOCUS_15750 33093 32377 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_15750 33213 34196 gene locus_tag LOCUS_15760 33213 34196 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 protein_id gnl|my_center|LOCUS_15760 34407 34204 gene locus_tag LOCUS_15770 34407 34204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 34314 35270 gene locus_tag LOCUS_15780 34314 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 35267 36031 gene locus_tag LOCUS_15790 35267 36031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737152.1 protein_id gnl|my_center|LOCUS_15790 36063 36836 gene locus_tag LOCUS_15800 36063 36836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 protein_id gnl|my_center|LOCUS_15800 36882 37571 gene locus_tag LOCUS_15810 36882 37571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 protein_id gnl|my_center|LOCUS_15810 37575 38267 gene locus_tag LOCUS_15820 gene nocM 37575 38267 CDS product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 protein_id gnl|my_center|LOCUS_15820 38388 38915 gene locus_tag LOCUS_15830 38388 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 39801 39046 gene locus_tag LOCUS_15840 39801 39046 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_15840 39786 40028 gene locus_tag LOCUS_15850 39786 40028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 40025 41269 gene locus_tag LOCUS_15860 gene lysA 40025 41269 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262842.1 protein_id gnl|my_center|LOCUS_15860 42051 41308 gene locus_tag LOCUS_15870 42051 41308 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_15870 42598 42044 gene locus_tag LOCUS_15880 gene gmhB 42598 42044 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_15880 44678 42603 gene locus_tag LOCUS_15890 gene glyS 44678 42603 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 protein_id gnl|my_center|LOCUS_15890 45604 44678 gene locus_tag LOCUS_15900 gene glyQ 45604 44678 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_15900 45818 46399 gene locus_tag LOCUS_15910 45818 46399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 46539 47588 gene locus_tag LOCUS_15920 46539 47588 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_15920 47597 47815 gene locus_tag LOCUS_15930 47597 47815 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035794.1 protein_id gnl|my_center|LOCUS_15930 48089 49498 gene locus_tag LOCUS_15940 gene glnA 48089 49498 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 protein_id gnl|my_center|LOCUS_15940 49609 50172 gene locus_tag LOCUS_15950 49609 50172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 50360 51442 gene locus_tag LOCUS_15960 gene glnL 50360 51442 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_15960 51435 52835 gene locus_tag LOCUS_15970 gene ntrC 51435 52835 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_15970 53747 52872 gene locus_tag LOCUS_15980 53747 52872 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_15980 54545 53757 gene locus_tag LOCUS_15990 54545 53757 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_15990 55217 54573 gene locus_tag LOCUS_16000 gene rsmG 55217 54573 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_16000 57109 55217 gene locus_tag LOCUS_16010 gene mnmG 57109 55217 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 protein_id gnl|my_center|LOCUS_16010 57315 57785 gene locus_tag LOCUS_16020 57315 57785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 57925 58212 gene locus_tag LOCUS_16030 gene groES 57925 58212 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_16030 58282 59934 gene locus_tag LOCUS_16040 gene groL 58282 59934 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 protein_id gnl|my_center|LOCUS_16040 60114 61628 gene locus_tag LOCUS_16050 gene gshA 60114 61628 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_16050 61720 62610 gene locus_tag LOCUS_16060 61720 62610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 63959 62622 gene locus_tag LOCUS_16070 63959 62622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 65394 64009 gene locus_tag LOCUS_16080 gene mpl 65394 64009 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence016 1665 2450 gene locus_tag LOCUS_16090 1665 2450 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_16090 3152 2478 gene locus_tag LOCUS_16100 gene radC 3152 2478 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_16100 3255 4472 gene locus_tag LOCUS_16110 gene coaBC 3255 4472 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16110 4469 4930 gene locus_tag LOCUS_16120 gene dut 4469 4930 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 protein_id gnl|my_center|LOCUS_16120 4964 6337 gene locus_tag LOCUS_16130 4964 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6371 7249 gene locus_tag LOCUS_16140 gene argB 6371 7249 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_16140 7278 8858 gene locus_tag LOCUS_16150 gene fadD5 7278 8858 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_16150 9026 9670 gene locus_tag LOCUS_16160 9026 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9718 11292 gene locus_tag LOCUS_16170 9718 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 11292 12179 gene locus_tag LOCUS_16180 11292 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 12216 13475 gene locus_tag LOCUS_16190 12216 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 13500 15011 gene locus_tag LOCUS_16200 13500 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 15343 15732 gene locus_tag LOCUS_16210 15343 15732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 15769 16311 gene locus_tag LOCUS_16220 15769 16311 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 protein_id gnl|my_center|LOCUS_16220 16734 16408 gene locus_tag LOCUS_16230 gene trxA 16734 16408 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_16230 17393 17097 gene locus_tag LOCUS_16240 17393 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16240 18745 17522 gene locus_tag LOCUS_16250 gene ubiH 18745 17522 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_16250 20061 18742 gene locus_tag LOCUS_16260 gene pepP 20061 18742 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_16260 20630 20088 gene locus_tag LOCUS_16270 20630 20088 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_16270 20857 21084 gene locus_tag LOCUS_16280 20857 21084 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_16280 21081 21374 gene locus_tag LOCUS_16290 21081 21374 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380079.1 protein_id gnl|my_center|LOCUS_16290 21643 22209 gene locus_tag LOCUS_16300 21643 22209 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946330.1 protein_id gnl|my_center|LOCUS_16300 23705 22191 gene locus_tag LOCUS_16310 gene ilvA 23705 22191 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_16310 23928 24395 gene locus_tag LOCUS_16320 23928 24395 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_16320 24418 25152 gene locus_tag LOCUS_16330 24418 25152 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815312.1 protein_id gnl|my_center|LOCUS_16330 26576 25176 gene locus_tag LOCUS_16340 26576 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_16340 28087 26972 gene locus_tag LOCUS_16350 28087 26972 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_16350 30415 28418 gene locus_tag LOCUS_16360 30415 28418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 30628 30990 gene locus_tag LOCUS_16370 30628 30990 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244324.1 protein_id gnl|my_center|LOCUS_16370 31051 31686 gene locus_tag LOCUS_16380 31051 31686 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706087.1 protein_id gnl|my_center|LOCUS_16380 32630 31716 gene locus_tag LOCUS_16390 32630 31716 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_16390 32778 34055 gene locus_tag LOCUS_16400 32778 34055 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_16400 34077 35024 gene locus_tag LOCUS_16410 34077 35024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_16410 36731 35016 gene locus_tag LOCUS_16420 36731 35016 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_16420 38168 36804 gene locus_tag LOCUS_16430 38168 36804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 38865 38521 gene locus_tag LOCUS_16440 38865 38521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 39464 38961 gene locus_tag LOCUS_16450 39464 38961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 40354 39464 gene locus_tag LOCUS_16460 40354 39464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_16460 40455 41198 gene locus_tag LOCUS_16470 gene fabG 40455 41198 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_16470 41229 42830 gene locus_tag LOCUS_16480 41229 42830 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_16480 42856 44004 gene locus_tag LOCUS_16490 42856 44004 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_16490 44234 45064 gene locus_tag LOCUS_16500 44234 45064 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200941.1 protein_id gnl|my_center|LOCUS_16500 46092 45097 gene locus_tag LOCUS_16510 46092 45097 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_16510 46571 46251 gene locus_tag LOCUS_16520 46571 46251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 47725 46697 gene locus_tag LOCUS_16530 47725 46697 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_16530 48335 47940 gene locus_tag LOCUS_16540 48335 47940 CDS product DUF3465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044128232.1 protein_id gnl|my_center|LOCUS_16540 48736 51405 gene locus_tag LOCUS_16550 48736 51405 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_16550 52158 51676 gene locus_tag LOCUS_16560 gene ybaK 52158 51676 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262324.1 protein_id gnl|my_center|LOCUS_16560 52704 52333 gene locus_tag LOCUS_16570 52704 52333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 53355 52735 gene locus_tag LOCUS_16580 53355 52735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 54439 53360 gene locus_tag LOCUS_16590 54439 53360 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_16590 55295 54420 gene locus_tag LOCUS_16600 55295 54420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_16600 55725 57815 gene locus_tag LOCUS_16610 55725 57815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 57921 58883 gene locus_tag LOCUS_16620 gene arsS 57921 58883 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_16620 59160 59540 gene locus_tag LOCUS_16630 59160 59540 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_16630 59537 60232 gene locus_tag LOCUS_16640 59537 60232 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_16640 60229 60876 gene locus_tag LOCUS_16650 60229 60876 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113134.1 protein_id gnl|my_center|LOCUS_16650 61346 60930 gene locus_tag LOCUS_16660 61346 60930 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_16660 61786 61343 gene locus_tag LOCUS_16670 61786 61343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 61992 62870 gene locus_tag LOCUS_16680 61992 62870 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_16680 62956 63777 gene locus_tag LOCUS_16690 62956 63777 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_16690 63796 64854 gene locus_tag LOCUS_16700 63796 64854 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence017 202 480 gene locus_tag LOCUS_16710 202 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16710 537 1358 gene locus_tag LOCUS_16720 537 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16720 2158 1769 gene locus_tag LOCUS_16730 2158 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2408 2145 gene locus_tag LOCUS_16740 2408 2145 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965479.1 protein_id gnl|my_center|LOCUS_16740 2496 2891 gene locus_tag LOCUS_16750 2496 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3125 2952 gene locus_tag LOCUS_16760 3125 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3072 3359 gene locus_tag LOCUS_16770 3072 3359 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_16770 3356 3580 gene locus_tag LOCUS_16780 3356 3580 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_16780 3733 4131 gene locus_tag LOCUS_16790 3733 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16790 4104 4442 gene locus_tag LOCUS_16800 4104 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4601 5104 gene locus_tag LOCUS_16810 4601 5104 CDS product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_16810 5204 5821 gene locus_tag LOCUS_16820 5204 5821 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_16820 5942 6328 gene locus_tag LOCUS_16830 5942 6328 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_16830 6413 7252 gene locus_tag LOCUS_16840 6413 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 7272 7436 gene locus_tag LOCUS_16850 7272 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7606 8064 gene locus_tag LOCUS_16860 7606 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8428 9042 gene locus_tag LOCUS_16870 gene ureG 8428 9042 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117800.1 protein_id gnl|my_center|LOCUS_16870 9347 9168 gene locus_tag LOCUS_16880 9347 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10250 9351 gene locus_tag LOCUS_16890 gene liuE 10250 9351 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_16890 10349 10993 gene locus_tag LOCUS_16900 10349 10993 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572360.1 protein_id gnl|my_center|LOCUS_16900 12006 11026 gene locus_tag LOCUS_16910 12006 11026 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_16910 12577 12029 gene locus_tag LOCUS_16920 gene pgsA 12577 12029 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_16920 14375 12618 gene locus_tag LOCUS_16930 gene uvrC 14375 12618 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268071.1 protein_id gnl|my_center|LOCUS_16930 15441 14473 gene locus_tag LOCUS_16940 15441 14473 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_16940 16466 15438 gene locus_tag LOCUS_16950 gene plsX 16466 15438 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054091481.1 protein_id gnl|my_center|LOCUS_16950 16817 16608 gene locus_tag LOCUS_16960 gene rpmF 16817 16608 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_16960 17132 16833 gene locus_tag LOCUS_16970 17132 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 17977 17624 gene locus_tag LOCUS_16980 17977 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 18465 17974 gene locus_tag LOCUS_16990 18465 17974 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_16990 18853 20055 gene locus_tag LOCUS_17000 18853 20055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_17000 20324 20070 gene locus_tag LOCUS_17010 20324 20070 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_17010 20516 21289 gene locus_tag LOCUS_17020 gene map 20516 21289 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_17020 21306 23957 gene locus_tag LOCUS_17030 21306 23957 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266972.1 protein_id gnl|my_center|LOCUS_17030 23963 25105 gene locus_tag LOCUS_17040 gene dapE 23963 25105 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_17040 25209 25133 gene locus_tag LOCUS_t00180 25209 25133 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 25627 25271 gene locus_tag LOCUS_17050 25627 25271 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_17050 25907 25608 gene locus_tag LOCUS_17060 gene ihfA 25907 25608 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_17060 28287 25912 gene locus_tag LOCUS_17070 gene pheT 28287 25912 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261851.1 protein_id gnl|my_center|LOCUS_17070 29354 28341 gene locus_tag LOCUS_17080 gene pheS 29354 28341 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 protein_id gnl|my_center|LOCUS_17080 29764 29426 gene locus_tag LOCUS_17090 gene rplT 29764 29426 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_17090 30557 30087 gene locus_tag LOCUS_17100 gene infC 30557 30087 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_17100 32540 30630 gene locus_tag LOCUS_17110 gene thrS 32540 30630 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443963.1 protein_id gnl|my_center|LOCUS_17110 32808 35405 gene locus_tag LOCUS_17120 gene clpB 32808 35405 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_17120 35607 36290 gene locus_tag LOCUS_17130 35607 36290 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 protein_id gnl|my_center|LOCUS_17130 36407 37288 gene locus_tag LOCUS_17140 36407 37288 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072656.1 protein_id gnl|my_center|LOCUS_17140 37346 37828 gene locus_tag LOCUS_17150 37346 37828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 38721 37861 gene locus_tag LOCUS_17160 gene trxA 38721 37861 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_17160 38880 40034 gene locus_tag LOCUS_17170 38880 40034 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229254.1 protein_id gnl|my_center|LOCUS_17170 40070 41587 gene locus_tag LOCUS_17180 40070 41587 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_17180 43069 41708 gene locus_tag LOCUS_17190 43069 41708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 43614 46148 gene locus_tag LOCUS_17200 gene mutS 43614 46148 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957974.1 protein_id gnl|my_center|LOCUS_17200 46214 47071 gene locus_tag LOCUS_17210 46214 47071 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_17210 47076 48746 gene locus_tag LOCUS_17220 gene recN 47076 48746 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420633.1 protein_id gnl|my_center|LOCUS_17220 48764 49072 gene locus_tag LOCUS_17230 48764 49072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 49538 49128 gene locus_tag LOCUS_17240 gene fur 49538 49128 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_17240 49716 50099 gene locus_tag LOCUS_17250 49716 50099 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946121.1 protein_id gnl|my_center|LOCUS_17250 50092 51102 gene locus_tag LOCUS_17260 50092 51102 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_17260 51099 51743 gene locus_tag LOCUS_17270 51099 51743 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090251772.1 protein_id gnl|my_center|LOCUS_17270 51740 52978 gene locus_tag LOCUS_17280 51740 52978 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_17280 52975 53673 gene locus_tag LOCUS_17290 52975 53673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 53673 54455 gene locus_tag LOCUS_17300 53673 54455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 54452 55228 gene locus_tag LOCUS_17310 gene cobJ 54452 55228 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390737.1 protein_id gnl|my_center|LOCUS_17310 55225 55983 gene locus_tag LOCUS_17320 gene cobM 55225 55983 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104407.1 protein_id gnl|my_center|LOCUS_17320 56108 56503 gene locus_tag LOCUS_17330 56108 56503 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262576.1 protein_id gnl|my_center|LOCUS_17330 56563 58983 gene locus_tag LOCUS_17340 56563 58983 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_17340 58976 60163 gene locus_tag LOCUS_17350 gene hemW 58976 60163 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_17350 60207 60446 gene locus_tag LOCUS_17360 60207 60446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 61514 60465 gene locus_tag LOCUS_17370 61514 60465 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 protein_id gnl|my_center|LOCUS_17370 62156 61530 gene locus_tag LOCUS_17380 gene lolA 62156 61530 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_17380 64440 62176 gene locus_tag LOCUS_17390 gene ftsK 64440 62176 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence018 1500 280 gene locus_tag LOCUS_17400 1500 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2867 1614 gene locus_tag LOCUS_17410 2867 1614 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269187.1 protein_id gnl|my_center|LOCUS_17410 3129 4181 gene locus_tag LOCUS_17420 3129 4181 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_17420 4248 4724 gene locus_tag LOCUS_17430 4248 4724 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_17430 4743 5630 gene locus_tag LOCUS_17440 4743 5630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_17440 5657 6655 gene locus_tag LOCUS_17450 5657 6655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_17450 8092 6659 gene locus_tag LOCUS_17460 8092 6659 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_17460 8210 8464 gene locus_tag LOCUS_17470 8210 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 8516 9301 gene locus_tag LOCUS_17480 8516 9301 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_17480 9357 9845 gene locus_tag LOCUS_17490 9357 9845 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_17490 9938 10765 gene locus_tag LOCUS_17500 9938 10765 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 protein_id gnl|my_center|LOCUS_17500 10826 11710 gene locus_tag LOCUS_17510 10826 11710 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216609.1 protein_id gnl|my_center|LOCUS_17510 12443 11763 gene locus_tag LOCUS_17520 12443 11763 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_17520 12990 12466 gene locus_tag LOCUS_17530 12990 12466 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_17530 13173 13955 gene locus_tag LOCUS_17540 13173 13955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 13997 14368 gene locus_tag LOCUS_17550 13997 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 14393 15586 gene locus_tag LOCUS_17560 14393 15586 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_17560 15631 16410 gene locus_tag LOCUS_17570 15631 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 16939 16430 gene locus_tag LOCUS_17580 16939 16430 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_17580 17734 16940 gene locus_tag LOCUS_17590 17734 16940 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_17590 18532 17741 gene locus_tag LOCUS_17600 gene lgt 18532 17741 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_17600 18621 19667 gene locus_tag LOCUS_17610 gene queA 18621 19667 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_17610 19664 20776 gene locus_tag LOCUS_17620 gene tgt 19664 20776 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021291.1 protein_id gnl|my_center|LOCUS_17620 20811 21137 gene locus_tag LOCUS_17630 gene yajC 20811 21137 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_17630 21183 23036 gene locus_tag LOCUS_17640 gene secD 21183 23036 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816910.1 protein_id gnl|my_center|LOCUS_17640 23046 23993 gene locus_tag LOCUS_17650 gene secF 23046 23993 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_17650 24821 24042 gene locus_tag LOCUS_17660 24821 24042 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_17660 24898 25629 gene locus_tag LOCUS_17670 gene trmJ 24898 25629 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 protein_id gnl|my_center|LOCUS_17670 25702 26478 gene locus_tag LOCUS_17680 gene cysE 25702 26478 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_17680 26545 27012 gene locus_tag LOCUS_17690 gene iscR 26545 27012 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659892.1 protein_id gnl|my_center|LOCUS_17690 27065 28285 gene locus_tag LOCUS_17700 gene iscS 27065 28285 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_17700 28318 28704 gene locus_tag LOCUS_17710 gene iscU 28318 28704 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_17710 28727 29050 gene locus_tag LOCUS_17720 gene iscA 28727 29050 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_17720 29136 29693 gene locus_tag LOCUS_17730 gene hscB 29136 29693 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261361.1 protein_id gnl|my_center|LOCUS_17730 29693 31573 gene locus_tag LOCUS_17740 gene hscA 29693 31573 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 protein_id gnl|my_center|LOCUS_17740 31583 31921 gene locus_tag LOCUS_17750 gene fdx 31583 31921 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 protein_id gnl|my_center|LOCUS_17750 31929 32123 gene locus_tag LOCUS_17760 gene iscX 31929 32123 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192531.1 protein_id gnl|my_center|LOCUS_17760 34205 32169 gene locus_tag LOCUS_17770 gene rep 34205 32169 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 protein_id gnl|my_center|LOCUS_17770 34611 34234 gene locus_tag LOCUS_17780 34611 34234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 34896 34615 gene locus_tag LOCUS_17790 34896 34615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 35074 35640 gene locus_tag LOCUS_17800 gene ampD 35074 35640 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_17800 35661 36548 gene locus_tag LOCUS_17810 35661 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 37585 36545 gene locus_tag LOCUS_17820 gene rnd 37585 36545 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_17820 38902 37694 gene locus_tag LOCUS_17830 38902 37694 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_17830 39021 40442 gene locus_tag LOCUS_17840 39021 40442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 41851 40736 gene locus_tag LOCUS_17850 gene zapE 41851 40736 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_17850 42493 42945 gene locus_tag LOCUS_17860 42493 42945 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973065.1 protein_id gnl|my_center|LOCUS_17860 42955 43701 gene locus_tag LOCUS_17870 gene hisA 42955 43701 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_17870 43708 44478 gene locus_tag LOCUS_17880 gene hisF 43708 44478 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_17880 44513 44902 gene locus_tag LOCUS_17890 gene hisI 44513 44902 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_17890 44899 45225 gene locus_tag LOCUS_17900 44899 45225 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687491.1 protein_id gnl|my_center|LOCUS_17900 45244 45489 gene locus_tag LOCUS_17910 gene tatA 45244 45489 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 protein_id gnl|my_center|LOCUS_17910 45504 45872 gene locus_tag LOCUS_17920 45504 45872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 45897 46655 gene locus_tag LOCUS_17930 gene tatC 45897 46655 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257554.1 protein_id gnl|my_center|LOCUS_17930 46916 47998 gene locus_tag LOCUS_17940 gene nadA 46916 47998 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_17940 48096 48632 gene locus_tag LOCUS_17950 gene fabA 48096 48632 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_17950 48669 49874 gene locus_tag LOCUS_17960 gene fabB 48669 49874 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_17960 51102 49894 gene locus_tag LOCUS_17970 gene flgL 51102 49894 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_17970 53023 51128 gene locus_tag LOCUS_17980 gene flgK 53023 51128 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_17980 53978 53049 gene locus_tag LOCUS_17990 gene flgJ 53978 53049 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_17990 55120 53990 gene locus_tag LOCUS_18000 55120 53990 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_18000 55869 55141 gene locus_tag LOCUS_18010 gene flgH 55869 55141 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_18010 56663 55878 gene locus_tag LOCUS_18020 gene flgG 56663 55878 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 protein_id gnl|my_center|LOCUS_18020 57433 56693 gene locus_tag LOCUS_18030 57433 56693 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_18030 58715 57456 gene locus_tag LOCUS_18040 gene flgE 58715 57456 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073130.1 protein_id gnl|my_center|LOCUS_18040 59415 58744 gene locus_tag LOCUS_18050 gene flgD 59415 58744 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_18050 59843 59436 gene locus_tag LOCUS_18060 gene flgC 59843 59436 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_18060 60229 59846 gene locus_tag LOCUS_18070 gene flgB 60229 59846 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_18070 61425 60487 gene locus_tag LOCUS_18080 61425 60487 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_18080 61625 62320 gene locus_tag LOCUS_18090 gene flgA 61625 62320 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098745.1 protein_id gnl|my_center|LOCUS_18090 62402 62486 gene locus_tag LOCUS_t00190 62402 62486 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 62515 62588 gene locus_tag LOCUS_t00200 62515 62588 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62646 62721 gene locus_tag LOCUS_t00210 62646 62721 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 <1 788 gene locus_tag LOCUS_18100 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941271.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 1574 792 gene locus_tag LOCUS_18110 1574 792 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086104.1 protein_id gnl|my_center|LOCUS_18110 2899 1574 gene locus_tag LOCUS_18120 2899 1574 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_18120 4364 2928 gene locus_tag LOCUS_18130 gene gatB 4364 2928 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_18130 5835 4381 gene locus_tag LOCUS_18140 gene gatA 5835 4381 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_18140 6437 5955 gene locus_tag LOCUS_18150 6437 5955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6763 6476 gene locus_tag LOCUS_18160 gene gatC 6763 6476 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_18160 6915 7961 gene locus_tag LOCUS_18170 6915 7961 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_18170 7991 8881 gene locus_tag LOCUS_18180 gene mreC 7991 8881 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_18180 8868 9359 gene locus_tag LOCUS_18190 gene mreD 8868 9359 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_18190 9370 10356 gene locus_tag LOCUS_18200 9370 10356 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_18200 11502 10564 gene locus_tag LOCUS_18210 11502 10564 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312586.1 protein_id gnl|my_center|LOCUS_18210 11838 11506 gene locus_tag LOCUS_18220 11838 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 14371 11840 gene locus_tag LOCUS_18230 gene nirB 14371 11840 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_18230 16083 14899 gene locus_tag LOCUS_18240 16083 14899 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_18240 17475 16096 gene locus_tag LOCUS_18250 17475 16096 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_18250 18278 17595 gene locus_tag LOCUS_18260 18278 17595 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927987.1 protein_id gnl|my_center|LOCUS_18260 18572 19657 gene locus_tag LOCUS_18270 18572 19657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972747.1 protein_id gnl|my_center|LOCUS_18270 19679 21010 gene locus_tag LOCUS_18280 19679 21010 CDS product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242231.1 protein_id gnl|my_center|LOCUS_18280 21067 21924 gene locus_tag LOCUS_18290 21067 21924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 protein_id gnl|my_center|LOCUS_18290 21927 22757 gene locus_tag LOCUS_18300 21927 22757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 protein_id gnl|my_center|LOCUS_18300 22754 23449 gene locus_tag LOCUS_18310 22754 23449 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088325.1 protein_id gnl|my_center|LOCUS_18310 24129 23446 gene locus_tag LOCUS_18320 24129 23446 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_18320 24235 25272 gene locus_tag LOCUS_18330 24235 25272 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_18330 25289 25783 gene locus_tag LOCUS_18340 25289 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 25780 27090 gene locus_tag LOCUS_18350 25780 27090 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_18350 27117 27476 gene locus_tag LOCUS_18360 27117 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 28034 27492 gene locus_tag LOCUS_18370 28034 27492 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_18370 29614 28121 gene locus_tag LOCUS_18380 29614 28121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 30357 29767 gene locus_tag LOCUS_18390 30357 29767 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 protein_id gnl|my_center|LOCUS_18390 32629 30347 gene locus_tag LOCUS_18400 gene dsbD 32629 30347 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931570.1 protein_id gnl|my_center|LOCUS_18400 32956 32636 gene locus_tag LOCUS_18410 32956 32636 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_18410 33955 33098 gene locus_tag LOCUS_18420 33955 33098 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_18420 34022 34249 gene locus_tag LOCUS_18430 34022 34249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214913.1 protein_id gnl|my_center|LOCUS_18430 36441 34291 gene locus_tag LOCUS_18440 36441 34291 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479526.1 protein_id gnl|my_center|LOCUS_18440 37227 36469 gene locus_tag LOCUS_18450 37227 36469 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073094.1 protein_id gnl|my_center|LOCUS_18450 37624 37238 gene locus_tag LOCUS_18460 gene cheY 37624 37238 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_18460 38420 37689 gene locus_tag LOCUS_18470 gene fliA 38420 37689 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 protein_id gnl|my_center|LOCUS_18470 39307 38417 gene locus_tag LOCUS_18480 39307 38417 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881781.1 protein_id gnl|my_center|LOCUS_18480 40808 39294 gene locus_tag LOCUS_18490 gene flhF 40808 39294 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881782.1 protein_id gnl|my_center|LOCUS_18490 42980 40875 gene locus_tag LOCUS_18500 gene flhA 42980 40875 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881783.1 protein_id gnl|my_center|LOCUS_18500 44131 42977 gene locus_tag LOCUS_18510 gene flhB 44131 42977 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_18510 44907 44134 gene locus_tag LOCUS_18520 gene fliR 44907 44134 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_18520 45183 44914 gene locus_tag LOCUS_18530 gene fliQ 45183 44914 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 protein_id gnl|my_center|LOCUS_18530 46001 45252 gene locus_tag LOCUS_18540 gene fliP 46001 45252 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_18540 46446 45994 gene locus_tag LOCUS_18550 46446 45994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 46955 46443 gene locus_tag LOCUS_18560 gene fliN 46955 46443 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 protein_id gnl|my_center|LOCUS_18560 47995 46952 gene locus_tag LOCUS_18570 gene fliM 47995 46952 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073105.1 protein_id gnl|my_center|LOCUS_18570 48553 48011 gene locus_tag LOCUS_18580 gene fliL 48553 48011 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_18580 50782 48908 gene locus_tag LOCUS_18590 50782 48908 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625952.1 protein_id gnl|my_center|LOCUS_18590 51068 52309 gene locus_tag LOCUS_18600 51068 52309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_18600 53322 52306 gene locus_tag LOCUS_18610 53322 52306 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898842.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence020 1337 393 gene locus_tag LOCUS_18620 1337 393 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262758.1 protein_id gnl|my_center|LOCUS_18620 1512 1877 gene locus_tag LOCUS_18630 gene zur 1512 1877 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381268.1 protein_id gnl|my_center|LOCUS_18630 1874 2611 gene locus_tag LOCUS_18640 gene znuC 1874 2611 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114128.1 protein_id gnl|my_center|LOCUS_18640 2608 3411 gene locus_tag LOCUS_18650 gene znuB 2608 3411 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_18650 3468 4259 gene locus_tag LOCUS_18660 3468 4259 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243515.1 protein_id gnl|my_center|LOCUS_18660 5085 4321 gene locus_tag LOCUS_18670 5085 4321 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_18670 5542 6336 gene locus_tag LOCUS_18680 5542 6336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_18680 6338 8281 gene locus_tag LOCUS_18690 6338 8281 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_18690 8283 9176 gene locus_tag LOCUS_18700 8283 9176 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_18700 9179 10252 gene locus_tag LOCUS_18710 9179 10252 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_18710 10298 11551 gene locus_tag LOCUS_18720 10298 11551 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992486.1 protein_id gnl|my_center|LOCUS_18720 11555 12343 gene locus_tag LOCUS_18730 11555 12343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_18730 12992 13783 gene locus_tag LOCUS_18740 12992 13783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_18740 13784 15736 gene locus_tag LOCUS_18750 13784 15736 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_18750 15752 16651 gene locus_tag LOCUS_18760 15752 16651 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_18760 16667 17740 gene locus_tag LOCUS_18770 16667 17740 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_18770 17787 19028 gene locus_tag LOCUS_18780 17787 19028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992486.1 protein_id gnl|my_center|LOCUS_18780 19192 20430 gene locus_tag LOCUS_18790 19192 20430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992486.1 protein_id gnl|my_center|LOCUS_18790 21496 20501 gene locus_tag LOCUS_18800 gene fabK 21496 20501 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_18800 24353 21654 gene locus_tag LOCUS_18810 24353 21654 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_18810 24562 24323 gene locus_tag LOCUS_18820 24562 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 26040 24982 gene locus_tag LOCUS_18830 gene hemE 26040 24982 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635049.1 protein_id gnl|my_center|LOCUS_18830 27462 26056 gene locus_tag LOCUS_18840 27462 26056 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_18840 28000 27593 gene locus_tag LOCUS_18850 28000 27593 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_18850 28274 28059 gene locus_tag LOCUS_18860 gene rpsU 28274 28059 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_18860 28413 29462 gene locus_tag LOCUS_18870 gene tsaD 28413 29462 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038897.1 protein_id gnl|my_center|LOCUS_18870 30064 29459 gene locus_tag LOCUS_18880 gene plsY 30064 29459 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770791.1 protein_id gnl|my_center|LOCUS_18880 30997 30128 gene locus_tag LOCUS_18890 gene rpoH 30997 30128 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 protein_id gnl|my_center|LOCUS_18890 32099 31128 gene locus_tag LOCUS_18900 gene ftsX 32099 31128 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_18900 32776 32096 gene locus_tag LOCUS_18910 gene ftsE 32776 32096 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_18910 33769 32786 gene locus_tag LOCUS_18920 33769 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 33861 35213 gene locus_tag LOCUS_18930 33861 35213 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_18930 35210 36541 gene locus_tag LOCUS_18940 35210 36541 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_18940 36576 37112 gene locus_tag LOCUS_18950 gene rsmD 36576 37112 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455148.1 protein_id gnl|my_center|LOCUS_18950 37209 37697 gene locus_tag LOCUS_18960 gene coaD 37209 37697 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_18960 37728 37982 gene locus_tag LOCUS_18970 37728 37982 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_18970 38019 39050 gene locus_tag LOCUS_18980 gene hemH 38019 39050 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_18980 40126 39149 gene locus_tag LOCUS_18990 40126 39149 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_18990 40541 40140 gene locus_tag LOCUS_19000 40541 40140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 40753 43104 gene locus_tag LOCUS_19010 40753 43104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 45496 43088 gene locus_tag LOCUS_19020 gene lon 45496 43088 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_19020 46465 45527 gene locus_tag LOCUS_19030 46465 45527 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_19030 46657 48264 gene locus_tag LOCUS_19040 46657 48264 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence021 78 506 gene locus_tag LOCUS_19050 78 506 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_19050 490 3012 gene locus_tag LOCUS_19060 gene copA 490 3012 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083955.1 protein_id gnl|my_center|LOCUS_19060 3188 3838 gene locus_tag LOCUS_19070 3188 3838 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918499.1 protein_id gnl|my_center|LOCUS_19070 4288 5670 gene locus_tag LOCUS_19080 4288 5670 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_19080 5893 6891 gene locus_tag LOCUS_19090 5893 6891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_19090 6934 7788 gene locus_tag LOCUS_19100 6934 7788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_19100 8035 8637 gene locus_tag LOCUS_19110 8035 8637 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_19110 8734 8928 gene locus_tag LOCUS_19120 8734 8928 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_19120 9954 9028 gene locus_tag LOCUS_19130 9954 9028 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_19130 9970 10677 gene locus_tag LOCUS_19140 9970 10677 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947996.1 protein_id gnl|my_center|LOCUS_19140 10698 11582 gene locus_tag LOCUS_19150 10698 11582 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_19150 11814 12974 gene locus_tag LOCUS_19160 11814 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 13779 13030 gene locus_tag LOCUS_19170 13779 13030 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_19170 15344 13776 gene locus_tag LOCUS_19180 15344 13776 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_19180 15914 15399 gene locus_tag LOCUS_19190 15914 15399 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_19190 16104 16871 gene locus_tag LOCUS_19200 16104 16871 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_19200 17007 18551 gene locus_tag LOCUS_19210 gene ppx 17007 18551 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 protein_id gnl|my_center|LOCUS_19210 20649 18565 gene locus_tag LOCUS_19220 gene ppk1 20649 18565 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206067.1 protein_id gnl|my_center|LOCUS_19220 21198 20989 gene locus_tag LOCUS_19230 21198 20989 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_19230 23154 21421 gene locus_tag LOCUS_19240 23154 21421 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_19240 23396 23629 gene locus_tag LOCUS_19250 23396 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 24395 23919 gene locus_tag LOCUS_19260 24395 23919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 26408 24606 gene locus_tag LOCUS_19270 26408 24606 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_19270 27637 26522 gene locus_tag LOCUS_19280 27637 26522 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_19280 28764 27637 gene locus_tag LOCUS_19290 28764 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 28978 28751 gene locus_tag LOCUS_19300 28978 28751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 30439 28991 gene locus_tag LOCUS_19310 30439 28991 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_19310 30683 31216 gene locus_tag LOCUS_19320 30683 31216 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_19320 31216 31902 gene locus_tag LOCUS_19330 31216 31902 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 protein_id gnl|my_center|LOCUS_19330 32756 31878 gene locus_tag LOCUS_19340 32756 31878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 32994 33890 gene locus_tag LOCUS_19350 32994 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 34013 34849 gene locus_tag LOCUS_19360 34013 34849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 35181 34858 gene locus_tag LOCUS_19370 35181 34858 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425954.1 protein_id gnl|my_center|LOCUS_19370 35854 35174 gene locus_tag LOCUS_19380 35854 35174 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071889.1 protein_id gnl|my_center|LOCUS_19380 37174 35939 gene locus_tag LOCUS_19390 37174 35939 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_19390 38306 37188 gene locus_tag LOCUS_19400 38306 37188 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_19400 38519 38980 gene locus_tag LOCUS_19410 38519 38980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 39710 39012 gene locus_tag LOCUS_19420 39710 39012 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811176.1 protein_id gnl|my_center|LOCUS_19420 40347 39739 gene locus_tag LOCUS_19430 40347 39739 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_19430 40537 41169 gene locus_tag LOCUS_19440 40537 41169 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_19440 41193 42155 gene locus_tag LOCUS_19450 41193 42155 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_19450 42561 42190 gene locus_tag LOCUS_19460 42561 42190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 42820 42575 gene locus_tag LOCUS_19470 42820 42575 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072548.1 protein_id gnl|my_center|LOCUS_19470 42949 44583 gene locus_tag LOCUS_19480 42949 44583 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 protein_id gnl|my_center|LOCUS_19480 45135 45620 gene locus_tag LOCUS_19490 45135 45620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 47144 45783 gene locus_tag LOCUS_19500 47144 45783 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_19500 47964 47194 gene locus_tag LOCUS_19510 47964 47194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence022 1353 664 gene locus_tag LOCUS_19520 1353 664 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_19520 2240 1350 gene locus_tag LOCUS_19530 2240 1350 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958577.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19530 2546 3148 gene locus_tag LOCUS_19540 2546 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3158 3964 gene locus_tag LOCUS_19550 gene mazG 3158 3964 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209374.1 protein_id gnl|my_center|LOCUS_19550 4681 3992 gene locus_tag LOCUS_19560 4681 3992 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_19560 4775 5182 gene locus_tag LOCUS_19570 4775 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5814 5176 gene locus_tag LOCUS_19580 gene rsxG 5814 5176 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_19580 6839 5814 gene locus_tag LOCUS_19590 gene rsxD 6839 5814 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_19590 8653 6842 gene locus_tag LOCUS_19600 8653 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 9333 8767 gene locus_tag LOCUS_19610 gene rsxB 9333 8767 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_19610 9919 9338 gene locus_tag LOCUS_19620 gene rsxA 9919 9338 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_19620 10143 10505 gene locus_tag LOCUS_19630 10143 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 12016 10502 gene locus_tag LOCUS_19640 12016 10502 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193099.1 protein_id gnl|my_center|LOCUS_19640 12201 12923 gene locus_tag LOCUS_19650 12201 12923 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477496.1 protein_id gnl|my_center|LOCUS_19650 13152 14150 gene locus_tag LOCUS_19660 13152 14150 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_19660 14165 15046 gene locus_tag LOCUS_19670 14165 15046 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 protein_id gnl|my_center|LOCUS_19670 15509 15108 gene locus_tag LOCUS_19680 15509 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 16762 16001 gene locus_tag LOCUS_19690 16762 16001 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_19690 17010 17816 gene locus_tag LOCUS_19700 17010 17816 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_19700 18122 18526 gene locus_tag LOCUS_19710 18122 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 18663 20495 gene locus_tag LOCUS_19720 gene typA 18663 20495 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_19720 21463 20510 gene locus_tag LOCUS_19730 gene ribF 21463 20510 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371105.1 protein_id gnl|my_center|LOCUS_19730 22457 21579 gene locus_tag LOCUS_19740 gene tesB 22457 21579 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072014.1 protein_id gnl|my_center|LOCUS_19740 23350 22712 gene locus_tag LOCUS_19750 gene crp 23350 22712 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212297.1 protein_id gnl|my_center|LOCUS_19750 23539 23847 gene locus_tag LOCUS_19760 23539 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 24463 25551 gene locus_tag LOCUS_19770 gene gcvT 24463 25551 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 protein_id gnl|my_center|LOCUS_19770 25570 25956 gene locus_tag LOCUS_19780 gene gcvH 25570 25956 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_19780 26074 28926 gene locus_tag LOCUS_19790 gene gcvP 26074 28926 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_19790 29024 29881 gene locus_tag LOCUS_19800 29024 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 31207 29876 gene locus_tag LOCUS_19810 gene rimO 31207 29876 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 protein_id gnl|my_center|LOCUS_19810 32346 31435 gene locus_tag LOCUS_19820 gene cysK 32346 31435 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_19820 34041 32401 gene locus_tag LOCUS_19830 34041 32401 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_19830 34178 35812 gene locus_tag LOCUS_19840 gene pilS 34178 35812 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_19840 35812 37146 gene locus_tag LOCUS_19850 gene pilR 35812 37146 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_19850 37419 37820 gene locus_tag LOCUS_19860 37419 37820 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_19860 37897 38298 gene locus_tag LOCUS_19870 gene pilA 37897 38298 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_19870 38431 40137 gene locus_tag LOCUS_19880 gene pilB 38431 40137 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_19880 40143 41366 gene locus_tag LOCUS_19890 40143 41366 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_19890 41420 42301 gene locus_tag LOCUS_19900 41420 42301 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_19900 42390 42995 gene locus_tag LOCUS_19910 gene coaE 42390 42995 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_19910 43606 43004 gene locus_tag LOCUS_19920 43606 43004 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_19920 44726 43590 gene locus_tag LOCUS_19930 44726 43590 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_19930 44882 46063 gene locus_tag LOCUS_19940 44882 46063 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463327.1 protein_id gnl|my_center|LOCUS_19940 47023 46121 gene locus_tag LOCUS_19950 47023 46121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence023 1038 1250 gene locus_tag LOCUS_19960 1038 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1806 1282 gene locus_tag LOCUS_19970 1806 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2129 1815 gene locus_tag LOCUS_19980 2129 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2740 3486 gene locus_tag LOCUS_19990 gene phoU 2740 3486 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_19990 4203 3493 gene locus_tag LOCUS_20000 gene lpxH 4203 3493 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_20000 4708 4211 gene locus_tag LOCUS_20010 4708 4211 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_20010 5363 4728 gene locus_tag LOCUS_20020 gene ppiB 5363 4728 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158275.1 protein_id gnl|my_center|LOCUS_20020 5419 6828 gene locus_tag LOCUS_20030 gene cysS 5419 6828 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_20030 7411 6854 gene locus_tag LOCUS_20040 7411 6854 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195150.1 protein_id gnl|my_center|LOCUS_20040 8658 7543 gene locus_tag LOCUS_20050 8658 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 10126 8762 gene locus_tag LOCUS_20060 gene accC 10126 8762 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_20060 11359 10130 gene locus_tag LOCUS_20070 11359 10130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 protein_id gnl|my_center|LOCUS_20070 11737 11483 gene locus_tag LOCUS_20080 11737 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 13364 11799 gene locus_tag LOCUS_20090 13364 11799 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_20090 14931 13375 gene locus_tag LOCUS_20100 14931 13375 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_20100 15468 16394 gene locus_tag LOCUS_20110 15468 16394 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 protein_id gnl|my_center|LOCUS_20110 16442 17227 gene locus_tag LOCUS_20120 16442 17227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 17365 17281 gene locus_tag LOCUS_t00220 17365 17281 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17749 17381 gene locus_tag LOCUS_20130 gene secG 17749 17381 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_20130 18528 17749 gene locus_tag LOCUS_20140 gene tpiA 18528 17749 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769081.1 protein_id gnl|my_center|LOCUS_20140 19936 18596 gene locus_tag LOCUS_20150 gene glmM 19936 18596 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_20150 20893 20036 gene locus_tag LOCUS_20160 gene folP 20893 20036 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 protein_id gnl|my_center|LOCUS_20160 22901 20958 gene locus_tag LOCUS_20170 gene ftsH 22901 20958 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_20170 23582 22962 gene locus_tag LOCUS_20180 gene rlmE 23582 22962 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443939.1 protein_id gnl|my_center|LOCUS_20180 23667 23960 gene locus_tag LOCUS_20190 gene yhbY 23667 23960 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918374.1 protein_id gnl|my_center|LOCUS_20190 23957 25141 gene locus_tag LOCUS_20200 gene purT 23957 25141 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366002.1 protein_id gnl|my_center|LOCUS_20200 25638 25207 gene locus_tag LOCUS_20210 gene nudB 25638 25207 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_20210 27434 25650 gene locus_tag LOCUS_20220 gene aspS 27434 25650 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_20220 27565 28548 gene locus_tag LOCUS_20230 27565 28548 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_20230 28545 28967 gene locus_tag LOCUS_20240 28545 28967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 29802 28969 gene locus_tag LOCUS_20250 29802 28969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 30319 29825 gene locus_tag LOCUS_20260 30319 29825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 31008 30379 gene locus_tag LOCUS_20270 31008 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 32104 31157 gene locus_tag LOCUS_20280 32104 31157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 32842 32201 gene locus_tag LOCUS_20290 32842 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 36019 32858 gene locus_tag LOCUS_20300 36019 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 36536 37714 gene locus_tag LOCUS_20310 36536 37714 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_20310 37747 38055 gene locus_tag LOCUS_20320 37747 38055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 38087 39034 gene locus_tag LOCUS_20330 38087 39034 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_20330 39957 39031 gene locus_tag LOCUS_20340 39957 39031 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_20340 40148 40702 gene locus_tag LOCUS_20350 40148 40702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 40765 41418 gene locus_tag LOCUS_20360 40765 41418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 41427 42194 gene locus_tag LOCUS_20370 41427 42194 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942145.1 protein_id gnl|my_center|LOCUS_20370 42199 42894 gene locus_tag LOCUS_20380 42199 42894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence024 <1 1808 gene locus_tag LOCUS_20390 <1 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229660.1:acetyl-CoA carboxylase biotin carboxylase subunit 2775 1873 gene locus_tag LOCUS_20400 2775 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4016 3123 gene locus_tag LOCUS_20410 gene mmsB 4016 3123 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811743.1 protein_id gnl|my_center|LOCUS_20410 5148 4027 gene locus_tag LOCUS_20420 5148 4027 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_20420 6340 5180 gene locus_tag LOCUS_20430 6340 5180 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_20430 7895 6357 gene locus_tag LOCUS_20440 7895 6357 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 protein_id gnl|my_center|LOCUS_20440 8230 8078 gene locus_tag LOCUS_20450 8230 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 9502 8345 gene locus_tag LOCUS_20460 9502 8345 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225693.1 protein_id gnl|my_center|LOCUS_20460 9681 10361 gene locus_tag LOCUS_20470 9681 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 14297 10407 gene locus_tag LOCUS_20480 gene purL 14297 10407 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_20480 16093 14489 gene locus_tag LOCUS_20490 gene ahpF 16093 14489 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071236.1 protein_id gnl|my_center|LOCUS_20490 16747 16184 gene locus_tag LOCUS_20500 gene ahpC 16747 16184 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_20500 16890 17798 gene locus_tag LOCUS_20510 16890 17798 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457564.1 protein_id gnl|my_center|LOCUS_20510 17875 18236 gene locus_tag LOCUS_tm00010 17875 18236 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18954 19973 gene locus_tag LOCUS_20520 gene fic 18954 19973 CDS product adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073937.1 protein_id gnl|my_center|LOCUS_20520 20590 23430 gene locus_tag LOCUS_20530 20590 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 24153 23440 gene locus_tag LOCUS_20540 24153 23440 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_20540 25124 24150 gene locus_tag LOCUS_20550 25124 24150 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_20550 25780 25121 gene locus_tag LOCUS_20560 25780 25121 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970601.1 protein_id gnl|my_center|LOCUS_20560 25988 26908 gene locus_tag LOCUS_20570 25988 26908 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_20570 27419 26997 gene locus_tag LOCUS_20580 27419 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 27721 27476 gene locus_tag LOCUS_20590 27721 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 31300 27845 gene locus_tag LOCUS_20600 31300 27845 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_20600 32398 31799 gene locus_tag LOCUS_20610 32398 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 33852 32995 gene locus_tag LOCUS_20620 33852 32995 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_20620 35345 33852 gene locus_tag LOCUS_20630 35345 33852 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_20630 36110 35625 gene locus_tag LOCUS_20640 36110 35625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 36616 36113 gene locus_tag LOCUS_20650 36616 36113 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966159.1 protein_id gnl|my_center|LOCUS_20650 36853 38700 gene locus_tag LOCUS_20660 36853 38700 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_20660 38926 39255 gene locus_tag LOCUS_20670 38926 39255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20670 40285 39422 gene locus_tag LOCUS_20680 40285 39422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence025 2061 757 gene locus_tag LOCUS_20690 2061 757 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_20690 3554 2385 gene locus_tag LOCUS_20700 3554 2385 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_20700 5063 3855 gene locus_tag LOCUS_20710 5063 3855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_20710 5448 6434 gene locus_tag LOCUS_20720 5448 6434 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024927297.1 protein_id gnl|my_center|LOCUS_20720 8626 6620 gene locus_tag LOCUS_20730 8626 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 8899 9564 gene locus_tag LOCUS_20740 8899 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 9911 9711 gene locus_tag LOCUS_20750 9911 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10320 10015 gene locus_tag LOCUS_20760 10320 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20760 10861 10367 gene locus_tag LOCUS_20770 10861 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 12650 11166 gene locus_tag LOCUS_20780 12650 11166 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_20780 12735 13613 gene locus_tag LOCUS_20790 gene ilvE 12735 13613 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_20790 13610 14221 gene locus_tag LOCUS_20800 13610 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14258 14596 gene locus_tag LOCUS_20810 14258 14596 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764940.1 protein_id gnl|my_center|LOCUS_20810 16303 14636 gene locus_tag LOCUS_20820 gene leuA 16303 14636 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706534.1 protein_id gnl|my_center|LOCUS_20820 16497 16973 gene locus_tag LOCUS_20830 16497 16973 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_20830 17156 19159 gene locus_tag LOCUS_20840 gene atuF 17156 19159 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_20840 19160 20776 gene locus_tag LOCUS_20850 gene atuC 19160 20776 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_20850 21699 20812 gene locus_tag LOCUS_20860 gene hslO 21699 20812 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081545.1 protein_id gnl|my_center|LOCUS_20860 21812 23932 gene locus_tag LOCUS_20870 21812 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 24011 25147 gene locus_tag LOCUS_20880 24011 25147 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_20880 26938 25181 gene locus_tag LOCUS_20890 gene lpdA 26938 25181 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_20890 28401 26995 gene locus_tag LOCUS_20900 gene aceF 28401 26995 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_20900 31093 28430 gene locus_tag LOCUS_20910 gene aceE 31093 28430 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_20910 31327 32535 gene locus_tag LOCUS_20920 31327 32535 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_20920 33157 33780 gene locus_tag LOCUS_20930 gene upp 33157 33780 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894672.1 protein_id gnl|my_center|LOCUS_20930 33824 34447 gene locus_tag LOCUS_20940 33824 34447 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_20940 34582 36285 gene locus_tag LOCUS_20950 34582 36285 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_20950 36729 36259 gene locus_tag LOCUS_20960 36729 36259 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_20960 38994 37570 gene locus_tag LOCUS_20970 38994 37570 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263049.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence026 231 623 gene locus_tag LOCUS_20980 gene tusD 231 623 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707698.1 protein_id gnl|my_center|LOCUS_20980 633 998 gene locus_tag LOCUS_20990 gene tusC 633 998 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_20990 1004 1309 gene locus_tag LOCUS_21000 gene tusB 1004 1309 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_21000 1317 1652 gene locus_tag LOCUS_21010 1317 1652 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_21010 1971 1684 gene locus_tag LOCUS_21020 1971 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2192 2818 gene locus_tag LOCUS_21030 2192 2818 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080830.1 protein_id gnl|my_center|LOCUS_21030 2888 3997 gene locus_tag LOCUS_21040 2888 3997 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_21040 3998 7057 gene locus_tag LOCUS_21050 3998 7057 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_21050 7761 7120 gene locus_tag LOCUS_21060 7761 7120 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_21060 8246 7779 gene locus_tag LOCUS_21070 8246 7779 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 protein_id gnl|my_center|LOCUS_21070 8723 8310 gene locus_tag LOCUS_21080 8723 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 8752 9621 gene locus_tag LOCUS_21090 8752 9621 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_21090 9718 11001 gene locus_tag LOCUS_21100 gene eno 9718 11001 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_21100 11025 11360 gene locus_tag LOCUS_21110 11025 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 11357 12064 gene locus_tag LOCUS_21120 gene ispD 11357 12064 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262540.1 protein_id gnl|my_center|LOCUS_21120 12061 12558 gene locus_tag LOCUS_21130 gene ispF 12061 12558 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 protein_id gnl|my_center|LOCUS_21130 12558 13580 gene locus_tag LOCUS_21140 gene nagZ 12558 13580 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_21140 13594 14751 gene locus_tag LOCUS_21150 13594 14751 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_21150 14748 15503 gene locus_tag LOCUS_21160 14748 15503 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_21160 16444 15521 gene locus_tag LOCUS_21170 16444 15521 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_21170 16556 18544 gene locus_tag LOCUS_21180 16556 18544 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 protein_id gnl|my_center|LOCUS_21180 19351 18566 gene locus_tag LOCUS_21190 19351 18566 CDS product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825630.1 protein_id gnl|my_center|LOCUS_21190 22820 19368 gene locus_tag LOCUS_21200 gene mfd 22820 19368 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_21200 23880 22894 gene locus_tag LOCUS_21210 gene aroC 23880 22894 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918470.1 protein_id gnl|my_center|LOCUS_21210 24769 24077 gene locus_tag LOCUS_21220 24769 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21220 25053 24748 gene locus_tag LOCUS_21230 25053 24748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21230 25869 25183 gene locus_tag LOCUS_21240 25869 25183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 26046 25870 gene locus_tag LOCUS_21250 26046 25870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 26045 26536 gene locus_tag LOCUS_21260 gene nrdR 26045 26536 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379141.1 protein_id gnl|my_center|LOCUS_21260 26554 27654 gene locus_tag LOCUS_21270 gene ribD 26554 27654 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073316.1 protein_id gnl|my_center|LOCUS_21270 27660 28319 gene locus_tag LOCUS_21280 27660 28319 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_21280 28419 29522 gene locus_tag LOCUS_21290 gene ribBA 28419 29522 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_21290 29581 30051 gene locus_tag LOCUS_21300 gene ribE 29581 30051 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 protein_id gnl|my_center|LOCUS_21300 30064 30555 gene locus_tag LOCUS_21310 gene nusB 30064 30555 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_21310 30542 31534 gene locus_tag LOCUS_21320 gene thiL 30542 31534 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208664.1 protein_id gnl|my_center|LOCUS_21320 31650 32042 gene locus_tag LOCUS_21330 gene pgpA 31650 32042 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283269.1 protein_id gnl|my_center|LOCUS_21330 32061 32555 gene locus_tag LOCUS_21340 32061 32555 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070475.1 protein_id gnl|my_center|LOCUS_21340 34199 32586 gene locus_tag LOCUS_21350 gene fadK 34199 32586 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_21350 34680 34381 gene locus_tag LOCUS_21360 34680 34381 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261655.1 protein_id gnl|my_center|LOCUS_21360 35361 34693 gene locus_tag LOCUS_21370 35361 34693 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947024.1 protein_id gnl|my_center|LOCUS_21370 37046 35421 gene locus_tag LOCUS_21380 37046 35421 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039161.1 protein_id gnl|my_center|LOCUS_21380 37209 37829 gene locus_tag LOCUS_21390 37209 37829 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_21390 37854 38696 gene locus_tag LOCUS_21400 37854 38696 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence027 2239 1655 gene locus_tag LOCUS_21410 2239 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2879 2697 gene locus_tag LOCUS_21420 2879 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3902 3048 gene locus_tag LOCUS_21430 3902 3048 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 protein_id gnl|my_center|LOCUS_21430 5041 3926 gene locus_tag LOCUS_21440 5041 3926 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_21440 5996 5058 gene locus_tag LOCUS_21450 5996 5058 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_21450 6550 5993 gene locus_tag LOCUS_21460 gene hutZ 6550 5993 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_21460 7816 6647 gene locus_tag LOCUS_21470 7816 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 9900 7843 gene locus_tag LOCUS_21480 9900 7843 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_21480 10426 10337 gene locus_tag LOCUS_t00230 10426 10337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10606 11265 gene locus_tag LOCUS_21490 10606 11265 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_21490 11339 11527 gene locus_tag LOCUS_21500 11339 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 12237 11524 gene locus_tag LOCUS_21510 gene tsaB 12237 11524 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_21510 14180 12234 gene locus_tag LOCUS_21520 14180 12234 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_21520 14670 14182 gene locus_tag LOCUS_21530 14670 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 15489 14962 gene locus_tag LOCUS_21540 15489 14962 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 protein_id gnl|my_center|LOCUS_21540 16417 16223 gene locus_tag LOCUS_21550 16417 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21550 16743 16564 gene locus_tag LOCUS_21560 16743 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 16976 16692 gene locus_tag LOCUS_21570 16976 16692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 17130 16969 gene locus_tag LOCUS_21580 17130 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 17757 17206 gene locus_tag LOCUS_21590 17757 17206 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_21590 18024 18737 gene locus_tag LOCUS_21600 18024 18737 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_21600 19265 18876 gene locus_tag LOCUS_21610 19265 18876 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237965.1 protein_id gnl|my_center|LOCUS_21610 19795 19304 gene locus_tag LOCUS_21620 19795 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 20899 19970 gene locus_tag LOCUS_21630 20899 19970 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170228.1 protein_id gnl|my_center|LOCUS_21630 21591 21034 gene locus_tag LOCUS_21640 21591 21034 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_21640 21729 22130 gene locus_tag LOCUS_21650 21729 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 22140 23045 gene locus_tag LOCUS_21660 22140 23045 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113965.1 protein_id gnl|my_center|LOCUS_21660 23099 23560 gene locus_tag LOCUS_21670 23099 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 24631 23741 gene locus_tag LOCUS_21680 24631 23741 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268113.1 protein_id gnl|my_center|LOCUS_21680 24775 25407 gene locus_tag LOCUS_21690 24775 25407 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_21690 25543 25980 gene locus_tag LOCUS_21700 25543 25980 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_21700 26062 27027 gene locus_tag LOCUS_21710 26062 27027 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 protein_id gnl|my_center|LOCUS_21710 27086 27895 gene locus_tag LOCUS_21720 gene ygiD 27086 27895 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 protein_id gnl|my_center|LOCUS_21720 29308 28634 gene locus_tag LOCUS_21730 29308 28634 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227981.1 protein_id gnl|my_center|LOCUS_21730 30788 30648 gene locus_tag LOCUS_21740 30788 30648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 31016 30834 gene locus_tag LOCUS_21750 31016 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 31187 31396 gene locus_tag LOCUS_21760 31187 31396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 31579 31992 gene locus_tag LOCUS_21770 31579 31992 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_21770 32081 32653 gene locus_tag LOCUS_21780 32081 32653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_21780 34478 33870 gene locus_tag LOCUS_21790 34478 33870 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_21790 34702 34457 gene locus_tag LOCUS_21800 34702 34457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 35420 34707 gene locus_tag LOCUS_21810 35420 34707 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_21810 36261 35413 gene locus_tag LOCUS_21820 36261 35413 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_21820 <36899 36272 gene locus_tag LOCUS_21830 <36899 36272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226013866.1:SDR family oxidoreductase >Feature sequence028 818 555 gene locus_tag LOCUS_21840 818 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 993 1949 gene locus_tag LOCUS_21850 993 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2154 3809 gene locus_tag LOCUS_21860 2154 3809 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072668.1 protein_id gnl|my_center|LOCUS_21860 4426 4689 gene locus_tag LOCUS_21870 4426 4689 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_21870 4750 5604 gene locus_tag LOCUS_21880 4750 5604 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706877.1 protein_id gnl|my_center|LOCUS_21880 5595 6341 gene locus_tag LOCUS_21890 5595 6341 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 protein_id gnl|my_center|LOCUS_21890 6352 6798 gene locus_tag LOCUS_21900 6352 6798 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_21900 6894 7166 gene locus_tag LOCUS_21910 6894 7166 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777585.1 protein_id gnl|my_center|LOCUS_21910 7342 8154 gene locus_tag LOCUS_21920 gene birA 7342 8154 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_21920 8158 8880 gene locus_tag LOCUS_21930 8158 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21930 8889 9812 gene locus_tag LOCUS_21940 8889 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 9825 11402 gene locus_tag LOCUS_21950 9825 11402 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225131.1 protein_id gnl|my_center|LOCUS_21950 11494 12834 gene locus_tag LOCUS_21960 11494 12834 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926974.1 protein_id gnl|my_center|LOCUS_21960 14143 12824 gene locus_tag LOCUS_21970 gene yegQ 14143 12824 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_21970 14976 14200 gene locus_tag LOCUS_21980 14976 14200 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089114.1 protein_id gnl|my_center|LOCUS_21980 15135 15917 gene locus_tag LOCUS_21990 15135 15917 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350445.1 protein_id gnl|my_center|LOCUS_21990 17622 15985 gene locus_tag LOCUS_22000 17622 15985 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104682.1 protein_id gnl|my_center|LOCUS_22000 18769 17741 gene locus_tag LOCUS_22010 gene waaF 18769 17741 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_22010 19994 19044 gene locus_tag LOCUS_22020 gene rfaD 19994 19044 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_22020 21424 19991 gene locus_tag LOCUS_22030 gene hldE 21424 19991 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817219.1 protein_id gnl|my_center|LOCUS_22030 22479 21532 gene locus_tag LOCUS_22040 22479 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 23506 22520 gene locus_tag LOCUS_22050 23506 22520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 24576 23524 gene locus_tag LOCUS_22060 24576 23524 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_22060 25724 24573 gene locus_tag LOCUS_22070 25724 24573 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038827.1 protein_id gnl|my_center|LOCUS_22070 26776 25850 gene locus_tag LOCUS_22080 26776 25850 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_22080 29707 26801 gene locus_tag LOCUS_22090 gene glnE 29707 26801 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_22090 29807 30832 gene locus_tag LOCUS_22100 29807 30832 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_22100 30931 32613 gene locus_tag LOCUS_22110 30931 32613 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_22110 32600 33643 gene locus_tag LOCUS_22120 32600 33643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_22120 33733 34797 gene locus_tag LOCUS_22130 gene cobW 33733 34797 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192861.1 protein_id gnl|my_center|LOCUS_22130 35539 35084 gene locus_tag LOCUS_22140 35539 35084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence029 <1 691 gene locus_tag LOCUS_22150 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083683.1:DNA polymerase IV 2316 709 gene locus_tag LOCUS_22160 2316 709 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_22160 2607 3404 gene locus_tag LOCUS_22170 2607 3404 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_22170 4313 3510 gene locus_tag LOCUS_22180 4313 3510 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 protein_id gnl|my_center|LOCUS_22180 4550 5053 gene locus_tag LOCUS_22190 4550 5053 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_22190 5072 5593 gene locus_tag LOCUS_22200 5072 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 5583 6071 gene locus_tag LOCUS_22210 5583 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 6071 6967 gene locus_tag LOCUS_22220 6071 6967 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008487788.1 protein_id gnl|my_center|LOCUS_22220 6976 7395 gene locus_tag LOCUS_22230 6976 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8509 7400 gene locus_tag LOCUS_22240 8509 7400 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_22240 9036 8542 gene locus_tag LOCUS_22250 gene purE 9036 8542 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_22250 10181 9099 gene locus_tag LOCUS_22260 10181 9099 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_22260 11772 10621 gene locus_tag LOCUS_22270 11772 10621 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_22270 14491 11861 gene locus_tag LOCUS_22280 gene pepN 14491 11861 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_22280 14712 15488 gene locus_tag LOCUS_22290 14712 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 15840 16355 gene locus_tag LOCUS_22300 gene cobU 15840 16355 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_22300 16368 17420 gene locus_tag LOCUS_22310 gene cobT 16368 17420 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_22310 17413 18024 gene locus_tag LOCUS_22320 17413 18024 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_22320 18024 18758 gene locus_tag LOCUS_22330 18024 18758 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_22330 19837 18770 gene locus_tag LOCUS_22340 19837 18770 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227775.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22340 20098 21003 gene locus_tag LOCUS_22350 gene folD 20098 21003 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_22350 21042 22226 gene locus_tag LOCUS_22360 21042 22226 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809196.1 protein_id gnl|my_center|LOCUS_22360 22903 22346 gene locus_tag LOCUS_22370 22903 22346 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477406.1 protein_id gnl|my_center|LOCUS_22370 23562 22906 gene locus_tag LOCUS_22380 23562 22906 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_22380 23718 24230 gene locus_tag LOCUS_22390 gene rppH 23718 24230 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 protein_id gnl|my_center|LOCUS_22390 25123 24227 gene locus_tag LOCUS_22400 25123 24227 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_22400 25243 26058 gene locus_tag LOCUS_22410 25243 26058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 26126 27472 gene locus_tag LOCUS_22420 26126 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 27513 29081 gene locus_tag LOCUS_22430 27513 29081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 30364 29366 gene locus_tag LOCUS_22440 30364 29366 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_22440 31395 30364 gene locus_tag LOCUS_22450 31395 30364 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_22450 31730 33145 gene locus_tag LOCUS_22460 31730 33145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence030 154 1698 gene locus_tag LOCUS_22470 154 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1695 4793 gene locus_tag LOCUS_22480 1695 4793 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_22480 5957 5094 gene locus_tag LOCUS_22490 5957 5094 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_22490 6677 6132 gene locus_tag LOCUS_22500 6677 6132 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_22500 7276 6674 gene locus_tag LOCUS_22510 gene paaY 7276 6674 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_22510 7569 8480 gene locus_tag LOCUS_22520 gene paaG 7569 8480 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705609.1 protein_id gnl|my_center|LOCUS_22520 8485 8931 gene locus_tag LOCUS_22530 gene paaI 8485 8931 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_22530 8924 10129 gene locus_tag LOCUS_22540 gene pcaF 8924 10129 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_22540 10942 10130 gene locus_tag LOCUS_22550 gene tcdA 10942 10130 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_22550 12504 10960 gene locus_tag LOCUS_22560 gene mmdA 12504 10960 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_22560 12848 12531 gene locus_tag LOCUS_22570 12848 12531 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595967.1 protein_id gnl|my_center|LOCUS_22570 13954 12923 gene locus_tag LOCUS_22580 13954 12923 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391186.1 protein_id gnl|my_center|LOCUS_22580 15379 14114 gene locus_tag LOCUS_22590 15379 14114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_22590 15660 16688 gene locus_tag LOCUS_22600 15660 16688 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_22600 16688 17641 gene locus_tag LOCUS_22610 16688 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_22610 17690 18082 gene locus_tag LOCUS_22620 gene msrB 17690 18082 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_22620 18217 19032 gene locus_tag LOCUS_22630 18217 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 21686 19038 gene locus_tag LOCUS_22640 gene polA 21686 19038 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_22640 21903 23963 gene locus_tag LOCUS_22650 gene prsK 21903 23963 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_22650 23960 25312 gene locus_tag LOCUS_22660 gene prsR 23960 25312 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_22660 25315 26286 gene locus_tag LOCUS_22670 25315 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 26427 29156 gene locus_tag LOCUS_22680 26427 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 32085 29173 gene locus_tag LOCUS_22690 32085 29173 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_22690 32519 34231 gene locus_tag LOCUS_22700 32519 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence031 1628 1128 gene locus_tag LOCUS_22710 gene cheW 1628 1128 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 protein_id gnl|my_center|LOCUS_22710 3752 1647 gene locus_tag LOCUS_22720 3752 1647 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_22720 4121 3759 gene locus_tag LOCUS_22730 4121 3759 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_22730 5237 4335 gene locus_tag LOCUS_22740 5237 4335 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382901.1 protein_id gnl|my_center|LOCUS_22740 5354 7159 gene locus_tag LOCUS_22750 gene atzF 5354 7159 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243176.1 protein_id gnl|my_center|LOCUS_22750 7173 8792 gene locus_tag LOCUS_22760 7173 8792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083856.1 protein_id gnl|my_center|LOCUS_22760 8808 9830 gene locus_tag LOCUS_22770 8808 9830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_22770 9842 10693 gene locus_tag LOCUS_22780 9842 10693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_22780 10706 12424 gene locus_tag LOCUS_22790 10706 12424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083859.1 protein_id gnl|my_center|LOCUS_22790 13181 12630 gene locus_tag LOCUS_22800 13181 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 16319 13296 gene locus_tag LOCUS_22810 16319 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 16670 18121 gene locus_tag LOCUS_22820 16670 18121 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_22820 18158 19066 gene locus_tag LOCUS_22830 gene mak 18158 19066 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219315.1 protein_id gnl|my_center|LOCUS_22830 19816 19067 gene locus_tag LOCUS_22840 gene fabG 19816 19067 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815632.1 protein_id gnl|my_center|LOCUS_22840 19904 22120 gene locus_tag LOCUS_22850 gene rnr 19904 22120 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_22850 22130 22906 gene locus_tag LOCUS_22860 gene rlmB 22130 22906 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_22860 23551 22886 gene locus_tag LOCUS_22870 gene ccmB 23551 22886 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_22870 24176 23568 gene locus_tag LOCUS_22880 gene ccmA 24176 23568 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420299.1 protein_id gnl|my_center|LOCUS_22880 24833 24204 gene locus_tag LOCUS_22890 24833 24204 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661285.1 protein_id gnl|my_center|LOCUS_22890 25126 26157 gene locus_tag LOCUS_22900 gene recA 25126 26157 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_22900 26234 26611 gene locus_tag LOCUS_22910 26234 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 26627 29227 gene locus_tag LOCUS_22920 gene alaS 26627 29227 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047198.1 protein_id gnl|my_center|LOCUS_22920 29263 30519 gene locus_tag LOCUS_22930 29263 30519 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369901.1 protein_id gnl|my_center|LOCUS_22930 30639 30830 gene locus_tag LOCUS_22940 gene csrA 30639 30830 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_22940 30974 31066 gene locus_tag LOCUS_t00240 30974 31066 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32090 31488 gene locus_tag LOCUS_22950 32090 31488 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_22950 32597 32163 gene locus_tag LOCUS_22960 32597 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 33411 32770 gene locus_tag LOCUS_22970 33411 32770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403754.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence032 321 557 gene locus_tag LOCUS_22980 321 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 550 1995 gene locus_tag LOCUS_22990 550 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1992 2462 gene locus_tag LOCUS_23000 1992 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2464 2901 gene locus_tag LOCUS_23010 2464 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2898 3134 gene locus_tag LOCUS_23020 2898 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3143 3322 gene locus_tag LOCUS_23030 3143 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4795 3668 gene locus_tag LOCUS_23040 4795 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5230 4850 gene locus_tag LOCUS_23050 5230 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 5755 5246 gene locus_tag LOCUS_23060 5755 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 6019 5759 gene locus_tag LOCUS_23070 6019 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 6516 6133 gene locus_tag LOCUS_23080 6516 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7064 6513 gene locus_tag LOCUS_23090 7064 6513 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_23090 7327 7061 gene locus_tag LOCUS_23100 7327 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 7990 7535 gene locus_tag LOCUS_23110 7990 7535 CDS product YrhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265797.1 protein_id gnl|my_center|LOCUS_23110 8511 7987 gene locus_tag LOCUS_23120 8511 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 9543 8926 gene locus_tag LOCUS_23130 9543 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 9774 9553 gene locus_tag LOCUS_23140 9774 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 9966 9784 gene locus_tag LOCUS_23150 9966 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 10399 9968 gene locus_tag LOCUS_23160 10399 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 11243 10422 gene locus_tag LOCUS_23170 11243 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 12051 11488 gene locus_tag LOCUS_23180 12051 11488 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_23180 12759 12406 gene locus_tag LOCUS_23190 12759 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 13130 12927 gene locus_tag LOCUS_23200 13130 12927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 13755 13120 gene locus_tag LOCUS_23210 gene parA 13755 13120 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 protein_id gnl|my_center|LOCUS_23210 13897 14964 gene locus_tag LOCUS_23220 13897 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 15082 15366 gene locus_tag LOCUS_23230 15082 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 15740 16813 gene locus_tag LOCUS_23240 15740 16813 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107001.1 protein_id gnl|my_center|LOCUS_23240 17418 17131 gene locus_tag LOCUS_23250 17418 17131 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740380.1 protein_id gnl|my_center|LOCUS_23250 17701 17411 gene locus_tag LOCUS_23260 17701 17411 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967242.1 protein_id gnl|my_center|LOCUS_23260 17872 18735 gene locus_tag LOCUS_23270 17872 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 18817 19149 gene locus_tag LOCUS_23280 18817 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 19262 20227 gene locus_tag LOCUS_23290 19262 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 20211 20390 gene locus_tag LOCUS_23300 20211 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 20818 20636 gene locus_tag LOCUS_23310 20818 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 21217 20840 gene locus_tag LOCUS_23320 21217 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 21772 21260 gene locus_tag LOCUS_23330 21772 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 22213 21788 gene locus_tag LOCUS_23340 22213 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 22598 22320 gene locus_tag LOCUS_23350 22598 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 23803 22595 gene locus_tag LOCUS_23360 23803 22595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_23360 24856 24560 gene locus_tag LOCUS_23370 24856 24560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 25254 24868 gene locus_tag LOCUS_23380 25254 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 25805 25251 gene locus_tag LOCUS_23390 25805 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 26853 26059 gene locus_tag LOCUS_23400 26853 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 27094 26855 gene locus_tag LOCUS_23410 27094 26855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 29052 27091 gene locus_tag LOCUS_23420 29052 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 31339 29045 gene locus_tag LOCUS_23430 31339 29045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 31599 31339 gene locus_tag LOCUS_23440 31599 31339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 32508 31612 gene locus_tag LOCUS_23450 32508 31612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence033 1284 646 gene locus_tag LOCUS_23460 gene tmk 1284 646 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_23460 2281 1292 gene locus_tag LOCUS_23470 gene mltG 2281 1292 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_23470 3619 2381 gene locus_tag LOCUS_23480 gene fabF 3619 2381 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_23480 3955 3716 gene locus_tag LOCUS_23490 gene acpP 3955 3716 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_23490 4862 4119 gene locus_tag LOCUS_23500 gene fabG 4862 4119 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_23500 5804 4863 gene locus_tag LOCUS_23510 gene fabD 5804 4863 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 protein_id gnl|my_center|LOCUS_23510 6645 5842 gene locus_tag LOCUS_23520 gene dapB 6645 5842 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071373.1 protein_id gnl|my_center|LOCUS_23520 9167 6900 gene locus_tag LOCUS_23530 gene ligA 9167 6900 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104653.1 protein_id gnl|my_center|LOCUS_23530 10055 9174 gene locus_tag LOCUS_23540 gene zipA 10055 9174 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405868.1 protein_id gnl|my_center|LOCUS_23540 13510 10193 gene locus_tag LOCUS_23550 gene smc 13510 10193 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_23550 13796 15067 gene locus_tag LOCUS_23560 13796 15067 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_23560 15097 15873 gene locus_tag LOCUS_23570 gene cysZ 15097 15873 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408742.1 protein_id gnl|my_center|LOCUS_23570 15870 16700 gene locus_tag LOCUS_23580 15870 16700 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_23580 16697 17044 gene locus_tag LOCUS_23590 16697 17044 CDS product O-6-alkylguanine-DNA--cysteine-protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174014.1 protein_id gnl|my_center|LOCUS_23590 17416 17093 gene locus_tag LOCUS_23600 17416 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 18128 17406 gene locus_tag LOCUS_23610 18128 17406 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 protein_id gnl|my_center|LOCUS_23610 18463 20334 gene locus_tag LOCUS_23620 18463 20334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 20407 22074 gene locus_tag LOCUS_23630 20407 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880803.1 protein_id gnl|my_center|LOCUS_23630 22216 22881 gene locus_tag LOCUS_23640 22216 22881 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_23640 23681 22899 gene locus_tag LOCUS_23650 23681 22899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_23650 24757 23678 gene locus_tag LOCUS_23660 gene bamC 24757 23678 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225338.1 protein_id gnl|my_center|LOCUS_23660 25657 24782 gene locus_tag LOCUS_23670 gene dapA 25657 24782 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_23670 25752 26225 gene locus_tag LOCUS_23680 25752 26225 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_23680 27442 26354 gene locus_tag LOCUS_23690 27442 26354 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_23690 27655 28866 gene locus_tag LOCUS_23700 27655 28866 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_23700 29057 30469 gene locus_tag LOCUS_23710 29057 30469 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_23710 30469 30756 gene locus_tag LOCUS_23720 30469 30756 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence034 1444 719 gene locus_tag LOCUS_23730 gene cas5c 1444 719 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_23730 3697 1460 gene locus_tag LOCUS_23740 gene cas3 3697 1460 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_23740 5847 4405 gene locus_tag LOCUS_23750 gene sbcB 5847 4405 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_23750 6655 5858 gene locus_tag LOCUS_23760 6655 5858 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_23760 6787 7578 gene locus_tag LOCUS_23770 6787 7578 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067764.1 protein_id gnl|my_center|LOCUS_23770 8858 7659 gene locus_tag LOCUS_23780 8858 7659 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_23780 9725 8880 gene locus_tag LOCUS_23790 9725 8880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_23790 10981 9752 gene locus_tag LOCUS_23800 10981 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 12112 11054 gene locus_tag LOCUS_23810 12112 11054 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_23810 13003 12116 gene locus_tag LOCUS_23820 13003 12116 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_23820 14973 13021 gene locus_tag LOCUS_23830 14973 13021 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_23830 15784 14984 gene locus_tag LOCUS_23840 15784 14984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_23840 16219 17067 gene locus_tag LOCUS_23850 16219 17067 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808542.1 protein_id gnl|my_center|LOCUS_23850 17966 17121 gene locus_tag LOCUS_23860 17966 17121 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_23860 18742 17978 gene locus_tag LOCUS_23870 gene pomA 18742 17978 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418107.1 protein_id gnl|my_center|LOCUS_23870 19440 19132 gene locus_tag LOCUS_23880 19440 19132 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 protein_id gnl|my_center|LOCUS_23880 20186 19593 gene locus_tag LOCUS_23890 20186 19593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 20410 21579 gene locus_tag LOCUS_23900 20410 21579 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 protein_id gnl|my_center|LOCUS_23900 21634 22803 gene locus_tag LOCUS_23910 21634 22803 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809196.1 protein_id gnl|my_center|LOCUS_23910 24537 22879 gene locus_tag LOCUS_23920 24537 22879 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_23920 24903 24670 gene locus_tag LOCUS_23930 24903 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 25925 24903 gene locus_tag LOCUS_23940 gene hypE 25925 24903 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_23940 27106 25922 gene locus_tag LOCUS_23950 gene hypD 27106 25922 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338278.1 protein_id gnl|my_center|LOCUS_23950 27396 27103 gene locus_tag LOCUS_23960 gene hybG 27396 27103 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817175.1 protein_id gnl|my_center|LOCUS_23960 29843 27387 gene locus_tag LOCUS_23970 gene hypF 29843 27387 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 protein_id gnl|my_center|LOCUS_23970 30695 29856 gene locus_tag LOCUS_23980 gene hypB 30695 29856 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388924.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence035 1028 246 gene locus_tag LOCUS_23990 1028 246 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371138.1 protein_id gnl|my_center|LOCUS_23990 1106 2092 gene locus_tag LOCUS_24000 gene rluD 1106 2092 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 protein_id gnl|my_center|LOCUS_24000 2103 2828 gene locus_tag LOCUS_24010 gene pgeF 2103 2828 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_24010 4782 2878 gene locus_tag LOCUS_24020 gene dxs 4782 2878 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_24020 5719 4832 gene locus_tag LOCUS_24030 gene ispA 5719 4832 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_24030 5984 5712 gene locus_tag LOCUS_24040 5984 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 7422 6055 gene locus_tag LOCUS_24050 gene radA 7422 6055 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 protein_id gnl|my_center|LOCUS_24050 8761 7466 gene locus_tag LOCUS_24060 8761 7466 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_24060 9745 8939 gene locus_tag LOCUS_24070 9745 8939 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_24070 9955 10719 gene locus_tag LOCUS_24080 9955 10719 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_24080 10798 12156 gene locus_tag LOCUS_24090 gene ffh 10798 12156 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_24090 12342 13775 gene locus_tag LOCUS_24100 gene fleQ 12342 13775 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_24100 13889 15052 gene locus_tag LOCUS_24110 13889 15052 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 protein_id gnl|my_center|LOCUS_24110 15084 16466 gene locus_tag LOCUS_24120 15084 16466 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_24120 16492 16821 gene locus_tag LOCUS_24130 gene fliE 16492 16821 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_24130 16849 18681 gene locus_tag LOCUS_24140 gene fliF 16849 18681 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268443.1 protein_id gnl|my_center|LOCUS_24140 18684 19700 gene locus_tag LOCUS_24150 gene fliG 18684 19700 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_24150 19693 20376 gene locus_tag LOCUS_24160 gene fliH 19693 20376 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767003.1 protein_id gnl|my_center|LOCUS_24160 20354 21760 gene locus_tag LOCUS_24170 gene fliI 20354 21760 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_24170 21757 22197 gene locus_tag LOCUS_24180 gene fliJ 21757 22197 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_24180 22955 22203 gene locus_tag LOCUS_24190 gene anr 22955 22203 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_24190 23384 24805 gene locus_tag LOCUS_24200 gene ccoN 23384 24805 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_24200 24821 25435 gene locus_tag LOCUS_24210 gene ccoO 24821 25435 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_24210 25440 25622 gene locus_tag LOCUS_24220 25440 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 25615 26508 gene locus_tag LOCUS_24230 gene ccoP 25615 26508 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261906.1 protein_id gnl|my_center|LOCUS_24230 26704 28137 gene locus_tag LOCUS_24240 gene ccoG 26704 28137 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_24240 28157 28663 gene locus_tag LOCUS_24250 28157 28663 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261907.1 protein_id gnl|my_center|LOCUS_24250 28716 29462 gene locus_tag LOCUS_24260 28716 29462 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 protein_id gnl|my_center|LOCUS_24260 29603 30094 gene locus_tag LOCUS_24270 29603 30094 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence036 429 1589 gene locus_tag LOCUS_24280 429 1589 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_24280 1743 2903 gene locus_tag LOCUS_24290 1743 2903 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_24290 2931 4094 gene locus_tag LOCUS_24300 2931 4094 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726858.1 protein_id gnl|my_center|LOCUS_24300 4199 5362 gene locus_tag LOCUS_24310 4199 5362 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086601.1 protein_id gnl|my_center|LOCUS_24310 5373 6326 gene locus_tag LOCUS_24320 5373 6326 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 protein_id gnl|my_center|LOCUS_24320 7201 6404 gene locus_tag LOCUS_24330 7201 6404 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921367.1 protein_id gnl|my_center|LOCUS_24330 7889 7323 gene locus_tag LOCUS_24340 7889 7323 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261513.1 protein_id gnl|my_center|LOCUS_24340 8926 8117 gene locus_tag LOCUS_24350 gene rhdA 8926 8117 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_24350 10582 8936 gene locus_tag LOCUS_24360 gene nadB 10582 8936 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_24360 10750 11340 gene locus_tag LOCUS_24370 gene rpoE 10750 11340 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_24370 11337 11948 gene locus_tag LOCUS_24380 11337 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 11951 12925 gene locus_tag LOCUS_24390 11951 12925 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524615.1 protein_id gnl|my_center|LOCUS_24390 12927 13391 gene locus_tag LOCUS_24400 gene rseC 12927 13391 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209675.1 protein_id gnl|my_center|LOCUS_24400 13499 13738 gene locus_tag LOCUS_24410 13499 13738 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_24410 13741 15534 gene locus_tag LOCUS_24420 gene lepA 13741 15534 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947592.1 protein_id gnl|my_center|LOCUS_24420 15544 16356 gene locus_tag LOCUS_24430 gene lepB 15544 16356 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363711.1 protein_id gnl|my_center|LOCUS_24430 16417 16785 gene locus_tag LOCUS_24440 16417 16785 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207369.1 protein_id gnl|my_center|LOCUS_24440 16782 17462 gene locus_tag LOCUS_24450 gene rnc 16782 17462 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_24450 17459 18349 gene locus_tag LOCUS_24460 gene era 17459 18349 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_24460 18358 19074 gene locus_tag LOCUS_24470 gene recO 18358 19074 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 protein_id gnl|my_center|LOCUS_24470 19087 19905 gene locus_tag LOCUS_24480 19087 19905 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_24480 20008 20094 gene locus_tag LOCUS_t00250 20008 20094 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21109 20231 gene locus_tag LOCUS_24490 21109 20231 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998802.1 protein_id gnl|my_center|LOCUS_24490 22003 21305 gene locus_tag LOCUS_24500 22003 21305 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083670.1 protein_id gnl|my_center|LOCUS_24500 22128 22442 gene locus_tag LOCUS_24510 22128 22442 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_24510 22439 22918 gene locus_tag LOCUS_24520 22439 22918 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224367.1 protein_id gnl|my_center|LOCUS_24520 24244 22958 gene locus_tag LOCUS_24530 24244 22958 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_24530 26922 24286 gene locus_tag LOCUS_24540 gene aceE 26922 24286 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444499.1 protein_id gnl|my_center|LOCUS_24540 <29121 27249 gene locus_tag LOCUS_24550 <29121 27249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:YDG domain-containing protein >Feature sequence037 1831 464 gene locus_tag LOCUS_24560 1831 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2088 3413 gene locus_tag LOCUS_24570 2088 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4689 3604 gene locus_tag LOCUS_24580 gene thrC 4689 3604 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_24580 6012 4699 gene locus_tag LOCUS_24590 6012 4699 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_24590 7210 5999 gene locus_tag LOCUS_24600 gene alaC 7210 5999 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_24600 8721 7324 gene locus_tag LOCUS_24610 gene cysG 8721 7324 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_24610 9639 8734 gene locus_tag LOCUS_24620 9639 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 10297 9797 gene locus_tag LOCUS_24630 10297 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 15385 10583 gene locus_tag LOCUS_24640 15385 10583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 15469 16782 gene locus_tag LOCUS_24650 15469 16782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 protein_id gnl|my_center|LOCUS_24650 16790 17698 gene locus_tag LOCUS_24660 16790 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 17959 17648 gene locus_tag LOCUS_24670 17959 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 18570 17959 gene locus_tag LOCUS_24680 18570 17959 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_24680 19040 18567 gene locus_tag LOCUS_24690 gene mlaD 19040 18567 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_24690 19849 19073 gene locus_tag LOCUS_24700 gene mlaE 19849 19073 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_24700 20670 19852 gene locus_tag LOCUS_24710 gene mlaF 20670 19852 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_24710 22087 20717 gene locus_tag LOCUS_24720 gene xseA 22087 20717 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815788.1 protein_id gnl|my_center|LOCUS_24720 22278 22084 gene locus_tag LOCUS_24730 22278 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 24789 22303 gene locus_tag LOCUS_24740 24789 22303 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_24740 25259 26671 gene locus_tag LOCUS_24750 25259 26671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence038 704 345 gene locus_tag LOCUS_24760 704 345 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_24760 1838 720 gene locus_tag LOCUS_24770 gene cfa 1838 720 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_24770 2388 3089 gene locus_tag LOCUS_24780 2388 3089 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_24780 3111 3842 gene locus_tag LOCUS_24790 3111 3842 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_24790 3933 4670 gene locus_tag LOCUS_24800 3933 4670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_24800 4694 6244 gene locus_tag LOCUS_24810 4694 6244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_24810 6749 6967 gene locus_tag LOCUS_24820 6749 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 7183 9348 gene locus_tag LOCUS_24830 gene recQ 7183 9348 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_24830 9596 10147 gene locus_tag LOCUS_24840 9596 10147 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528836.1 protein_id gnl|my_center|LOCUS_24840 10504 11295 gene locus_tag LOCUS_24850 10504 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 11948 11415 gene locus_tag LOCUS_24860 11948 11415 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_24860 13031 12090 gene locus_tag LOCUS_24870 13031 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 13294 14814 gene locus_tag LOCUS_24880 13294 14814 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009697454.1 protein_id gnl|my_center|LOCUS_24880 14966 18643 gene locus_tag LOCUS_24890 14966 18643 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_24890 18990 18640 gene locus_tag LOCUS_24900 18990 18640 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616592.1 protein_id gnl|my_center|LOCUS_24900 19059 19526 gene locus_tag LOCUS_24910 19059 19526 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_24910 20427 19615 gene locus_tag LOCUS_24920 20427 19615 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494169.1 protein_id gnl|my_center|LOCUS_24920 20534 21553 gene locus_tag LOCUS_24930 20534 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 21760 21578 gene locus_tag LOCUS_24940 21760 21578 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391039.1 protein_id gnl|my_center|LOCUS_24940 23138 21831 gene locus_tag LOCUS_24950 23138 21831 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_24950 23758 23135 gene locus_tag LOCUS_24960 23758 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 24892 23855 gene locus_tag LOCUS_24970 24892 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 26182 25133 gene locus_tag LOCUS_24980 26182 25133 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence039 1686 52 gene locus_tag LOCUS_24990 1686 52 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_24990 1991 3772 gene locus_tag LOCUS_25000 1991 3772 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_25000 4499 3825 gene locus_tag LOCUS_25010 4499 3825 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_25010 6044 4581 gene locus_tag LOCUS_25020 gene ubiD 6044 4581 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_25020 7050 6022 gene locus_tag LOCUS_25030 7050 6022 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_25030 8114 7338 gene locus_tag LOCUS_25040 8114 7338 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_25040 8192 8830 gene locus_tag LOCUS_25050 gene pyrE 8192 8830 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_25050 9455 8895 gene locus_tag LOCUS_25060 9455 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 11936 9762 gene locus_tag LOCUS_25070 gene uvrD 11936 9762 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383420.1 protein_id gnl|my_center|LOCUS_25070 12354 12034 gene locus_tag LOCUS_25080 12354 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 14247 12553 gene locus_tag LOCUS_25090 gene ubiB 14247 12553 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_25090 14849 14250 gene locus_tag LOCUS_25100 14849 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 15624 14872 gene locus_tag LOCUS_25110 gene ubiE 15624 14872 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 protein_id gnl|my_center|LOCUS_25110 16012 15662 gene locus_tag LOCUS_25120 16012 15662 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_25120 17349 16024 gene locus_tag LOCUS_25130 gene hslU 17349 16024 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293370.1 protein_id gnl|my_center|LOCUS_25130 17894 17346 gene locus_tag LOCUS_25140 gene hslV 17894 17346 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_25140 18105 19943 gene locus_tag LOCUS_25150 gene fimW 18105 19943 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_25150 20848 19949 gene locus_tag LOCUS_25160 gene xerC 20848 19949 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_25160 21560 20868 gene locus_tag LOCUS_25170 21560 20868 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_25170 22387 21557 gene locus_tag LOCUS_25180 gene dapF 22387 21557 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_25180 22563 23117 gene locus_tag LOCUS_25190 22563 23117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 23166 24167 gene locus_tag LOCUS_25200 23166 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 24801 24178 gene locus_tag LOCUS_25210 gene yihA 24801 24178 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence040 218 862 gene locus_tag LOCUS_25220 218 862 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_25220 1391 879 gene locus_tag LOCUS_25230 1391 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881788.1 protein_id gnl|my_center|LOCUS_25230 2653 1379 gene locus_tag LOCUS_25240 2653 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3561 2653 gene locus_tag LOCUS_25250 3561 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 4405 3521 gene locus_tag LOCUS_25260 4405 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4969 4508 gene locus_tag LOCUS_25270 4969 4508 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_25270 5792 5055 gene locus_tag LOCUS_25280 5792 5055 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114021.1 protein_id gnl|my_center|LOCUS_25280 6886 5789 gene locus_tag LOCUS_25290 6886 5789 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114022.1 protein_id gnl|my_center|LOCUS_25290 8408 7374 gene locus_tag LOCUS_25300 8408 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 9736 8708 gene locus_tag LOCUS_25310 gene meaB 9736 8708 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_25310 11939 9738 gene locus_tag LOCUS_25320 gene scpA 11939 9738 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_25320 14014 11939 gene locus_tag LOCUS_25330 14014 11939 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390233.1 protein_id gnl|my_center|LOCUS_25330 15344 14193 gene locus_tag LOCUS_25340 15344 14193 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_25340 16586 16089 gene locus_tag LOCUS_25350 16586 16089 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530144.1 protein_id gnl|my_center|LOCUS_25350 16958 16716 gene locus_tag LOCUS_25360 16958 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 17412 16951 gene locus_tag LOCUS_25370 17412 16951 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027459.1 protein_id gnl|my_center|LOCUS_25370 19024 19341 gene locus_tag LOCUS_25380 19024 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25380 20048 19896 gene locus_tag LOCUS_25390 20048 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 21536 20343 gene locus_tag LOCUS_25400 21536 20343 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_25400 21844 22392 gene locus_tag LOCUS_25410 21844 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 22556 23308 gene locus_tag LOCUS_25420 22556 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 23651 23421 gene locus_tag LOCUS_25430 23651 23421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 23721 24029 gene locus_tag LOCUS_25440 23721 24029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 24073 24594 gene locus_tag LOCUS_25450 24073 24594 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence041 819 139 gene locus_tag LOCUS_25460 gene thyX 819 139 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_25460 1035 853 gene locus_tag LOCUS_25470 1035 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2307 1039 gene locus_tag LOCUS_25480 2307 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2579 2304 gene locus_tag LOCUS_25490 2579 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3000 2728 gene locus_tag LOCUS_25500 3000 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3206 3000 gene locus_tag LOCUS_25510 3206 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 3457 3248 gene locus_tag LOCUS_25520 3457 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3922 3785 gene locus_tag LOCUS_25530 3922 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4320 3913 gene locus_tag LOCUS_25540 4320 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4883 4317 gene locus_tag LOCUS_25550 4883 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 6262 4880 gene locus_tag LOCUS_25560 6262 4880 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072910.1 protein_id gnl|my_center|LOCUS_25560 6500 6267 gene locus_tag LOCUS_25570 6500 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 7068 6514 gene locus_tag LOCUS_25580 7068 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7387 7157 gene locus_tag LOCUS_25590 7387 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 8111 7506 gene locus_tag LOCUS_25600 8111 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8910 8122 gene locus_tag LOCUS_25610 8910 8122 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_25610 9790 8963 gene locus_tag LOCUS_25620 9790 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 10495 9812 gene locus_tag LOCUS_25630 10495 9812 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816505.1 protein_id gnl|my_center|LOCUS_25630 10696 10496 gene locus_tag LOCUS_25640 10696 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 11541 11002 gene locus_tag LOCUS_25650 11541 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 12601 12110 gene locus_tag LOCUS_25660 12601 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12896 13099 gene locus_tag LOCUS_25670 12896 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 13234 13713 gene locus_tag LOCUS_25680 13234 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 13724 14047 gene locus_tag LOCUS_25690 13724 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 14034 14243 gene locus_tag LOCUS_25700 14034 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 14250 14325 gene locus_tag LOCUS_t00260 14250 14325 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14455 14808 gene locus_tag LOCUS_25710 14455 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 14979 15055 gene locus_tag LOCUS_t00270 14979 15055 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15084 15596 gene locus_tag LOCUS_25720 15084 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 15589 16470 gene locus_tag LOCUS_25730 15589 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 16361 17041 gene locus_tag LOCUS_25740 16361 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 17038 17394 gene locus_tag LOCUS_25750 17038 17394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 17321 17650 gene locus_tag LOCUS_25760 17321 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 17637 18008 gene locus_tag LOCUS_25770 17637 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 18005 18478 gene locus_tag LOCUS_25780 18005 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 18465 18680 gene locus_tag LOCUS_25790 18465 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 18604 19095 gene locus_tag LOCUS_25800 18604 19095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19191 19376 gene locus_tag LOCUS_25810 19191 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 19373 19747 gene locus_tag LOCUS_25820 19373 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 19744 20109 gene locus_tag LOCUS_25830 19744 20109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 20126 20641 gene locus_tag LOCUS_25840 20126 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 20869 21273 gene locus_tag LOCUS_25850 20869 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 21276 21773 gene locus_tag LOCUS_25860 21276 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 21774 22115 gene locus_tag LOCUS_25870 21774 22115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 22115 22342 gene locus_tag LOCUS_25880 22115 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 22335 22910 gene locus_tag LOCUS_25890 22335 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 22873 24459 gene locus_tag LOCUS_25900 22873 24459 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705882.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence042 1393 710 gene locus_tag LOCUS_25910 1393 710 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_25910 3177 1417 gene locus_tag LOCUS_25920 gene argS 3177 1417 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_25920 5501 3273 gene locus_tag LOCUS_25930 gene priA 5501 3273 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208938.1 protein_id gnl|my_center|LOCUS_25930 6740 6270 gene locus_tag LOCUS_25940 6740 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041217540.1 protein_id gnl|my_center|LOCUS_25940 7168 6806 gene locus_tag LOCUS_25950 7168 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 7285 7887 gene locus_tag LOCUS_25960 gene wrbA 7285 7887 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528068.1 protein_id gnl|my_center|LOCUS_25960 8170 9084 gene locus_tag LOCUS_25970 8170 9084 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389504.1 protein_id gnl|my_center|LOCUS_25970 9086 10408 gene locus_tag LOCUS_25980 gene livM 9086 10408 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389503.1 protein_id gnl|my_center|LOCUS_25980 10405 11211 gene locus_tag LOCUS_25990 10405 11211 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389502.1 protein_id gnl|my_center|LOCUS_25990 11208 11948 gene locus_tag LOCUS_26000 11208 11948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_26000 11949 12269 gene locus_tag LOCUS_26010 11949 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389500.1 protein_id gnl|my_center|LOCUS_26010 12402 13505 gene locus_tag LOCUS_26020 12402 13505 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389499.1 protein_id gnl|my_center|LOCUS_26020 16823 13608 gene locus_tag LOCUS_26030 16823 13608 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_26030 17865 16816 gene locus_tag LOCUS_26040 17865 16816 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_26040 19165 17888 gene locus_tag LOCUS_26050 19165 17888 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_26050 19499 23986 gene locus_tag LOCUS_26060 gene gltB 19499 23986 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence043 527 1339 gene locus_tag LOCUS_26070 527 1339 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_26070 1343 2359 gene locus_tag LOCUS_26080 gene murB 1343 2359 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770641.1 protein_id gnl|my_center|LOCUS_26080 2547 2780 gene locus_tag LOCUS_26090 2547 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 3743 2844 gene locus_tag LOCUS_26100 3743 2844 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 protein_id gnl|my_center|LOCUS_26100 3873 4514 gene locus_tag LOCUS_26110 3873 4514 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_26110 4950 4558 gene locus_tag LOCUS_26120 4950 4558 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_26120 5498 5422 gene locus_tag LOCUS_t00280 5498 5422 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7410 5536 gene locus_tag LOCUS_26130 gene rpoD 7410 5536 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262669.1 protein_id gnl|my_center|LOCUS_26130 7638 7713 gene locus_tag LOCUS_t00290 7638 7713 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7867 8841 gene locus_tag LOCUS_26140 7867 8841 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689040.1 protein_id gnl|my_center|LOCUS_26140 8872 9219 gene locus_tag LOCUS_26150 8872 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 9216 9443 gene locus_tag LOCUS_26160 9216 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 9512 9697 gene locus_tag LOCUS_26170 9512 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 9672 10079 gene locus_tag LOCUS_26180 9672 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 10491 10183 gene locus_tag LOCUS_26190 10491 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 10739 10503 gene locus_tag LOCUS_26200 10739 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 11099 10845 gene locus_tag LOCUS_26210 11099 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 11387 11148 gene locus_tag LOCUS_26220 11387 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 11776 11384 gene locus_tag LOCUS_26230 11776 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 14649 11773 gene locus_tag LOCUS_26240 14649 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 14850 14665 gene locus_tag LOCUS_26250 14850 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 15215 14847 gene locus_tag LOCUS_26260 15215 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 16104 15262 gene locus_tag LOCUS_26270 16104 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 17560 16115 gene locus_tag LOCUS_26280 17560 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 17886 17557 gene locus_tag LOCUS_26290 17886 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 18169 19074 gene locus_tag LOCUS_26300 18169 19074 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_26300 19095 19325 gene locus_tag LOCUS_26310 19095 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 19582 19839 gene locus_tag LOCUS_26320 19582 19839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 20187 20498 gene locus_tag LOCUS_26330 20187 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20670 20909 gene locus_tag LOCUS_26340 20670 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141034.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence044 1510 2256 gene locus_tag LOCUS_26350 gene surE 1510 2256 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_26350 2256 2939 gene locus_tag LOCUS_26360 2256 2939 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_26360 3171 3614 gene locus_tag LOCUS_26370 3171 3614 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_26370 3617 4492 gene locus_tag LOCUS_26380 3617 4492 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_26380 4639 5640 gene locus_tag LOCUS_26390 gene rpoS 4639 5640 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_26390 5917 6960 gene locus_tag LOCUS_26400 5917 6960 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728996.1 protein_id gnl|my_center|LOCUS_26400 7051 7650 gene locus_tag LOCUS_26410 7051 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 7650 8957 gene locus_tag LOCUS_26420 7650 8957 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_26420 10380 8980 gene locus_tag LOCUS_26430 10380 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390314.1 protein_id gnl|my_center|LOCUS_26430 10589 12190 gene locus_tag LOCUS_26440 10589 12190 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957930.1 protein_id gnl|my_center|LOCUS_26440 12203 14215 gene locus_tag LOCUS_26450 12203 14215 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768562.1 protein_id gnl|my_center|LOCUS_26450 14961 14212 gene locus_tag LOCUS_26460 14961 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 15273 14983 gene locus_tag LOCUS_26470 15273 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 15653 18064 gene locus_tag LOCUS_26480 15653 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 18073 19476 gene locus_tag LOCUS_26490 18073 19476 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_26490 20135 21400 gene locus_tag LOCUS_26500 20135 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 21414 22364 gene locus_tag LOCUS_26510 21414 22364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence045 136 1839 gene locus_tag LOCUS_26520 gene ureC 136 1839 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_26520 1849 2295 gene locus_tag LOCUS_26530 gene ureE 1849 2295 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 protein_id gnl|my_center|LOCUS_26530 2308 2979 gene locus_tag LOCUS_26540 2308 2979 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_26540 3947 3138 gene locus_tag LOCUS_26550 3947 3138 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 protein_id gnl|my_center|LOCUS_26550 4672 3956 gene locus_tag LOCUS_26560 4672 3956 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_26560 5839 4748 gene locus_tag LOCUS_26570 5839 4748 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532787.1 protein_id gnl|my_center|LOCUS_26570 6854 5931 gene locus_tag LOCUS_26580 6854 5931 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_26580 7458 7024 gene locus_tag LOCUS_26590 7458 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 8758 7481 gene locus_tag LOCUS_26600 gene serS 8758 7481 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072887.1 protein_id gnl|my_center|LOCUS_26600 9187 8813 gene locus_tag LOCUS_26610 gene crcB 9187 8813 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_26610 9297 10406 gene locus_tag LOCUS_26620 gene queG 9297 10406 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_26620 10521 11276 gene locus_tag LOCUS_26630 10521 11276 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_26630 12112 11966 gene locus_tag LOCUS_26640 12112 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 12148 12411 gene locus_tag LOCUS_26650 12148 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 12423 13328 gene locus_tag LOCUS_26660 12423 13328 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024414.1 protein_id gnl|my_center|LOCUS_26660 13360 16146 gene locus_tag LOCUS_26670 13360 16146 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048879517.1 protein_id gnl|my_center|LOCUS_26670 16143 17144 gene locus_tag LOCUS_26680 16143 17144 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_26680 17227 19197 gene locus_tag LOCUS_26690 17227 19197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_26690 19190 20416 gene locus_tag LOCUS_26700 19190 20416 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039746.1 protein_id gnl|my_center|LOCUS_26700 20466 20987 gene locus_tag LOCUS_26710 20466 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 21363 22193 gene locus_tag LOCUS_26720 21363 22193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence046 1473 1204 gene locus_tag LOCUS_26730 1473 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 1779 1528 gene locus_tag LOCUS_26740 1779 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 2337 2056 gene locus_tag LOCUS_26750 2337 2056 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455023.1 protein_id gnl|my_center|LOCUS_26750 3246 2452 gene locus_tag LOCUS_26760 gene pstB 3246 2452 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_26760 4303 3230 gene locus_tag LOCUS_26770 gene pstA 4303 3230 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864528.1 protein_id gnl|my_center|LOCUS_26770 5319 4390 gene locus_tag LOCUS_26780 5319 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 7937 5460 gene locus_tag LOCUS_26790 7937 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9071 8052 gene locus_tag LOCUS_26800 9071 8052 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_26800 10153 9068 gene locus_tag LOCUS_26810 10153 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 13286 10164 gene locus_tag LOCUS_26820 13286 10164 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_26820 14391 13264 gene locus_tag LOCUS_26830 14391 13264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 15025 14393 gene locus_tag LOCUS_26840 15025 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 15486 15043 gene locus_tag LOCUS_26850 15486 15043 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_26850 16064 15459 gene locus_tag LOCUS_26860 16064 15459 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_26860 17369 16074 gene locus_tag LOCUS_26870 17369 16074 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 protein_id gnl|my_center|LOCUS_26870 18124 17369 gene locus_tag LOCUS_26880 18124 17369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 20002 18365 gene locus_tag LOCUS_26890 20002 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 18416 18492 gene locus_tag LOCUS_t00300 18416 18492 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20306 19992 gene locus_tag LOCUS_26900 20306 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 20920 20531 gene locus_tag LOCUS_26910 20920 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 21188 20898 gene locus_tag LOCUS_26920 21188 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 21475 21266 gene locus_tag LOCUS_26930 21475 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence047 <1 1938 gene locus_tag LOCUS_26940 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001003185.1:heavy metal translocating P-type ATPase 1951 2235 gene locus_tag LOCUS_26950 1951 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2261 2914 gene locus_tag LOCUS_26960 2261 2914 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966090.1 protein_id gnl|my_center|LOCUS_26960 2925 3377 gene locus_tag LOCUS_26970 2925 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3435 3803 gene locus_tag LOCUS_26980 3435 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3827 5335 gene locus_tag LOCUS_26990 3827 5335 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_26990 5332 6273 gene locus_tag LOCUS_27000 5332 6273 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_27000 6270 7625 gene locus_tag LOCUS_27010 6270 7625 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946756.1 protein_id gnl|my_center|LOCUS_27010 7696 8154 gene locus_tag LOCUS_27020 7696 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 8188 8445 gene locus_tag LOCUS_27030 8188 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 8471 9619 gene locus_tag LOCUS_27040 8471 9619 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_27040 9629 11983 gene locus_tag LOCUS_27050 9629 11983 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_27050 11996 12976 gene locus_tag LOCUS_27060 gene hflK 11996 12976 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_27060 12973 13929 gene locus_tag LOCUS_27070 gene hflC 12973 13929 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655940.1 protein_id gnl|my_center|LOCUS_27070 14067 14438 gene locus_tag LOCUS_27080 14067 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 14449 16311 gene locus_tag LOCUS_27090 gene ftsH 14449 16311 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143134.1 protein_id gnl|my_center|LOCUS_27090 16686 16456 gene locus_tag LOCUS_27100 16686 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 16973 16689 gene locus_tag LOCUS_27110 gene merP 16973 16689 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735441.1 protein_id gnl|my_center|LOCUS_27110 17332 16985 gene locus_tag LOCUS_27120 17332 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 17783 17382 gene locus_tag LOCUS_27130 gene merR 17783 17382 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_27130 18340 17978 gene locus_tag LOCUS_27140 18340 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 18991 18410 gene locus_tag LOCUS_27150 18991 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 19301 19011 gene locus_tag LOCUS_27160 19301 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 <20133 19354 gene locus_tag LOCUS_27170 <20133 19354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090361384.1:copper resistance protein B >Feature sequence048 565 2769 gene locus_tag LOCUS_27180 565 2769 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_27180 2818 4740 gene locus_tag LOCUS_27190 2818 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4722 6260 gene locus_tag LOCUS_27200 4722 6260 CDS product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 protein_id gnl|my_center|LOCUS_27200 6328 7059 gene locus_tag LOCUS_27210 gene cmoA 6328 7059 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 protein_id gnl|my_center|LOCUS_27210 7056 8045 gene locus_tag LOCUS_27220 gene cmoB 7056 8045 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816529.1 protein_id gnl|my_center|LOCUS_27220 8255 8049 gene locus_tag LOCUS_27230 8255 8049 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 protein_id gnl|my_center|LOCUS_27230 9254 8271 gene locus_tag LOCUS_27240 9254 8271 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836384.1 protein_id gnl|my_center|LOCUS_27240 9249 9461 gene locus_tag LOCUS_27250 9249 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9458 10531 gene locus_tag LOCUS_27260 gene glcE 9458 10531 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_27260 10537 11766 gene locus_tag LOCUS_27270 gene glcF 10537 11766 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_27270 11891 11966 gene locus_tag LOCUS_t00310 11891 11966 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12121 13092 gene locus_tag LOCUS_27280 12121 13092 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_27280 13326 15917 gene locus_tag LOCUS_27290 13326 15917 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 protein_id gnl|my_center|LOCUS_27290 15976 16404 gene locus_tag LOCUS_27300 15976 16404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 16832 17872 gene locus_tag LOCUS_27310 16832 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 18688 17924 gene locus_tag LOCUS_27320 18688 17924 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_27320 19150 18752 gene locus_tag LOCUS_27330 19150 18752 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_27330 19538 19185 gene locus_tag LOCUS_27340 19538 19185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence049 1435 719 gene locus_tag LOCUS_27350 gene dnr 1435 719 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_27350 1719 2279 gene locus_tag LOCUS_27360 1719 2279 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_27360 2302 2748 gene locus_tag LOCUS_27370 2302 2748 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_27370 2880 3794 gene locus_tag LOCUS_27380 2880 3794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104755.1 protein_id gnl|my_center|LOCUS_27380 3802 4575 gene locus_tag LOCUS_27390 3802 4575 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_27390 4623 5588 gene locus_tag LOCUS_27400 gene dusA 4623 5588 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884460.1 protein_id gnl|my_center|LOCUS_27400 6427 5576 gene locus_tag LOCUS_27410 6427 5576 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261581.1 protein_id gnl|my_center|LOCUS_27410 6574 6909 gene locus_tag LOCUS_27420 6574 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 7044 9080 gene locus_tag LOCUS_27430 7044 9080 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_27430 9415 9125 gene locus_tag LOCUS_27440 9415 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9706 9449 gene locus_tag LOCUS_27450 9706 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 9810 12479 gene locus_tag LOCUS_27460 9810 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 12511 12981 gene locus_tag LOCUS_27470 12511 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 13749 13030 gene locus_tag LOCUS_27480 13749 13030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_27480 16164 13831 gene locus_tag LOCUS_27490 16164 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 16329 17192 gene locus_tag LOCUS_27500 16329 17192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_27500 17230 18435 gene locus_tag LOCUS_27510 17230 18435 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382995.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence050 1162 137 gene locus_tag LOCUS_27520 1162 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27520 1564 1199 gene locus_tag LOCUS_27530 1564 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27530 2048 1644 gene locus_tag LOCUS_27540 2048 1644 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_27540 3458 2163 gene locus_tag LOCUS_27550 gene ectB 3458 2163 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_27550 3782 3474 gene locus_tag LOCUS_27560 3782 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 4241 4753 gene locus_tag LOCUS_27570 gene cosR 4241 4753 CDS product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_27570 5665 4955 gene locus_tag LOCUS_27580 5665 4955 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_27580 6215 5667 gene locus_tag LOCUS_27590 6215 5667 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 protein_id gnl|my_center|LOCUS_27590 7061 6282 gene locus_tag LOCUS_27600 7061 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_27600 7326 7192 gene locus_tag LOCUS_27610 7326 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 7955 7419 gene locus_tag LOCUS_27620 7955 7419 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 protein_id gnl|my_center|LOCUS_27620 8267 8665 gene locus_tag LOCUS_27630 8267 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 9565 8894 gene locus_tag LOCUS_27640 9565 8894 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311274.1 protein_id gnl|my_center|LOCUS_27640 9965 9555 gene locus_tag LOCUS_27650 9965 9555 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 protein_id gnl|my_center|LOCUS_27650 10068 10940 gene locus_tag LOCUS_27660 10068 10940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_27660 13079 11946 gene locus_tag LOCUS_27670 13079 11946 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922286.1 protein_id gnl|my_center|LOCUS_27670 14846 13137 gene locus_tag LOCUS_27680 14846 13137 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961450.1 protein_id gnl|my_center|LOCUS_27680 14890 16068 gene locus_tag LOCUS_27690 14890 16068 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_27690 16108 16548 gene locus_tag LOCUS_27700 16108 16548 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_27700 17014 16616 gene locus_tag LOCUS_27710 17014 16616 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897979.1 protein_id gnl|my_center|LOCUS_27710 18192 17017 gene locus_tag LOCUS_27720 18192 17017 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_27720 18675 18235 gene locus_tag LOCUS_27730 18675 18235 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259467.1 protein_id gnl|my_center|LOCUS_27730 19103 18672 gene locus_tag LOCUS_27740 19103 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence051 165 2627 gene locus_tag LOCUS_27750 gene leuS 165 2627 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 protein_id gnl|my_center|LOCUS_27750 2660 3166 gene locus_tag LOCUS_27760 gene lptE 2660 3166 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217671.1 protein_id gnl|my_center|LOCUS_27760 4536 3244 gene locus_tag LOCUS_27770 gene gltA 4536 3244 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_27770 6028 4706 gene locus_tag LOCUS_27780 gene argA 6028 4706 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211624.1 protein_id gnl|my_center|LOCUS_27780 6104 6697 gene locus_tag LOCUS_27790 6104 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 7886 6732 gene locus_tag LOCUS_27800 gene argE 7886 6732 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_27800 8660 7923 gene locus_tag LOCUS_27810 8660 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8732 9010 gene locus_tag LOCUS_27820 8732 9010 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_27820 9051 10850 gene locus_tag LOCUS_27830 9051 10850 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_27830 12371 10914 gene locus_tag LOCUS_27840 gene nhaD 12371 10914 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_27840 14125 12398 gene locus_tag LOCUS_27850 14125 12398 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_27850 14331 15584 gene locus_tag LOCUS_27860 14331 15584 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_27860 16064 15627 gene locus_tag LOCUS_27870 16064 15627 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_27870 16336 16536 gene locus_tag LOCUS_27880 16336 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 17459 16578 gene locus_tag LOCUS_27890 17459 16578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_27890 17596 17886 gene locus_tag LOCUS_27900 17596 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 17898 18641 gene locus_tag LOCUS_27910 17898 18641 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531062.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence052 896 132 gene locus_tag LOCUS_27920 gene kdsB 896 132 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 protein_id gnl|my_center|LOCUS_27920 1099 896 gene locus_tag LOCUS_27930 1099 896 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_27930 2084 1101 gene locus_tag LOCUS_27940 gene lpxK 2084 1101 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 protein_id gnl|my_center|LOCUS_27940 3773 2094 gene locus_tag LOCUS_27950 gene msbA 3773 2094 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 protein_id gnl|my_center|LOCUS_27950 4306 3890 gene locus_tag LOCUS_27960 4306 3890 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_27960 4971 4303 gene locus_tag LOCUS_27970 4971 4303 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_27970 7260 5077 gene locus_tag LOCUS_27980 7260 5077 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_27980 7751 8095 gene locus_tag LOCUS_27990 7751 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 8769 8092 gene locus_tag LOCUS_28000 gene lolD 8769 8092 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_28000 10009 8762 gene locus_tag LOCUS_28010 10009 8762 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_28010 10153 12051 gene locus_tag LOCUS_28020 10153 12051 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140040.1 protein_id gnl|my_center|LOCUS_28020 13529 12093 gene locus_tag LOCUS_28030 13529 12093 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_28030 14002 13526 gene locus_tag LOCUS_28040 14002 13526 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478513.1 protein_id gnl|my_center|LOCUS_28040 14964 14005 gene locus_tag LOCUS_28050 14964 14005 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167741.1 protein_id gnl|my_center|LOCUS_28050 16101 14977 gene locus_tag LOCUS_28060 gene gmd 16101 14977 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706703.1 protein_id gnl|my_center|LOCUS_28060 16337 16104 gene locus_tag LOCUS_28070 16337 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence053 <1 613 gene locus_tag LOCUS_28080 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229253.1:TetR/AcrR family transcriptional regulator 610 1833 gene locus_tag LOCUS_28090 610 1833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_28090 4730 1848 gene locus_tag LOCUS_28100 gene rne 4730 1848 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_28100 5381 6334 gene locus_tag LOCUS_28110 gene rluC 5381 6334 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_28110 6327 6995 gene locus_tag LOCUS_28120 6327 6995 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_28120 7007 8032 gene locus_tag LOCUS_28130 gene sppA 7007 8032 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_28130 8123 8776 gene locus_tag LOCUS_28140 8123 8776 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_28140 8845 10329 gene locus_tag LOCUS_28150 8845 10329 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_28150 10339 10761 gene locus_tag LOCUS_28160 gene tsaE 10339 10761 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_28160 10866 12146 gene locus_tag LOCUS_28170 gene amiB 10866 12146 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_28170 12742 12221 gene locus_tag LOCUS_28180 gene ppa 12742 12221 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_28180 13693 12902 gene locus_tag LOCUS_28190 13693 12902 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_28190 14527 13754 gene locus_tag LOCUS_28200 gene menB 14527 13754 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_28200 15353 14574 gene locus_tag LOCUS_28210 15353 14574 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_28210 16209 15433 gene locus_tag LOCUS_28220 16209 15433 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence054 <1 828 gene locus_tag LOCUS_28230 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338304.1:SIR2 family protein 1093 1269 gene locus_tag LOCUS_28240 1093 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1657 1382 gene locus_tag LOCUS_28250 1657 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2332 2042 gene locus_tag LOCUS_28260 2332 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28260 2957 2451 gene locus_tag LOCUS_28270 2957 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3949 3008 gene locus_tag LOCUS_28280 3949 3008 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_28280 5486 4542 gene locus_tag LOCUS_28290 5486 4542 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_28290 6100 5486 gene locus_tag LOCUS_28300 6100 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6544 6242 gene locus_tag LOCUS_28310 6544 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 9684 6559 gene locus_tag LOCUS_28320 9684 6559 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_28320 11432 9699 gene locus_tag LOCUS_28330 11432 9699 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_28330 12730 11429 gene locus_tag LOCUS_28340 12730 11429 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_28340 13281 12730 gene locus_tag LOCUS_28350 13281 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 14007 14429 gene locus_tag LOCUS_28360 14007 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 14494 14697 gene locus_tag LOCUS_28370 14494 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 14718 15152 gene locus_tag LOCUS_28380 14718 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 15536 15446 gene locus_tag LOCUS_t00320 15536 15446 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15938 15612 gene locus_tag LOCUS_28390 15938 15612 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704589.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence055 1129 917 gene locus_tag LOCUS_28400 1129 917 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 protein_id gnl|my_center|LOCUS_28400 2885 1488 gene locus_tag LOCUS_28410 2885 1488 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_28410 3839 2892 gene locus_tag LOCUS_28420 3839 2892 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_28420 5001 3892 gene locus_tag LOCUS_28430 5001 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 5923 5120 gene locus_tag LOCUS_28440 5923 5120 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_28440 6794 6015 gene locus_tag LOCUS_28450 6794 6015 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_28450 8315 6849 gene locus_tag LOCUS_28460 8315 6849 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555084.1 protein_id gnl|my_center|LOCUS_28460 8432 9106 gene locus_tag LOCUS_28470 8432 9106 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_28470 9269 10273 gene locus_tag LOCUS_28480 gene galE 9269 10273 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_28480 10934 10311 gene locus_tag LOCUS_28490 gene ubiX 10934 10311 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_28490 11035 12405 gene locus_tag LOCUS_28500 gene mtaB 11035 12405 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_28500 12514 14361 gene locus_tag LOCUS_28510 12514 14361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626097.1 protein_id gnl|my_center|LOCUS_28510 <15455 14438 gene locus_tag LOCUS_28520 <15455 14438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764764.1:DegQ family serine endoprotease >Feature sequence056 1006 1314 gene locus_tag LOCUS_28530 gene rplU 1006 1314 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 protein_id gnl|my_center|LOCUS_28530 1371 1631 gene locus_tag LOCUS_28540 gene rpmA 1371 1631 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 protein_id gnl|my_center|LOCUS_28540 1741 2769 gene locus_tag LOCUS_28550 gene cgtA 1741 2769 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_28550 2756 3880 gene locus_tag LOCUS_28560 gene proB 2756 3880 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_28560 5475 4168 gene locus_tag LOCUS_28570 5475 4168 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_28570 6060 5518 gene locus_tag LOCUS_28580 6060 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 7357 6230 gene locus_tag LOCUS_28590 7357 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 7703 9328 gene locus_tag LOCUS_28600 7703 9328 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_28600 9365 10525 gene locus_tag LOCUS_28610 9365 10525 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529278.1 protein_id gnl|my_center|LOCUS_28610 10548 11765 gene locus_tag LOCUS_28620 10548 11765 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_28620 11765 12895 gene locus_tag LOCUS_28630 11765 12895 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_28630 12882 14504 gene locus_tag LOCUS_28640 gene atuC 12882 14504 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence057 <1 1414 gene locus_tag LOCUS_28650 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262668.1:DNA primase 1754 1425 gene locus_tag LOCUS_28660 1754 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2199 1759 gene locus_tag LOCUS_28670 gene fliS 2199 1759 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 protein_id gnl|my_center|LOCUS_28670 3605 2226 gene locus_tag LOCUS_28680 gene fliD 3605 2226 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_28680 4122 3715 gene locus_tag LOCUS_28690 4122 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 5622 4198 gene locus_tag LOCUS_28700 5622 4198 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_28700 5924 6769 gene locus_tag LOCUS_28710 5924 6769 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 protein_id gnl|my_center|LOCUS_28710 6806 7573 gene locus_tag LOCUS_28720 6806 7573 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_28720 7860 8312 gene locus_tag LOCUS_28730 gene aroQ 7860 8312 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_28730 8325 8780 gene locus_tag LOCUS_28740 gene accB 8325 8780 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_28740 8800 10143 gene locus_tag LOCUS_28750 gene accC 8800 10143 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 protein_id gnl|my_center|LOCUS_28750 10151 11032 gene locus_tag LOCUS_28760 gene prmA 10151 11032 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244650.1 protein_id gnl|my_center|LOCUS_28760 11048 11881 gene locus_tag LOCUS_28770 11048 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 12090 13094 gene locus_tag LOCUS_28780 gene dusB 12090 13094 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210062.1 protein_id gnl|my_center|LOCUS_28780 13091 13354 gene locus_tag LOCUS_28790 13091 13354 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687442.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence058 3438 1975 gene locus_tag LOCUS_28800 gene rng 3438 1975 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_28800 4081 3506 gene locus_tag LOCUS_28810 4081 3506 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_28810 4630 4097 gene locus_tag LOCUS_28820 gene rlmH 4630 4097 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_28820 5181 4567 gene locus_tag LOCUS_28830 gene nudF 5181 4567 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_28830 5795 5178 gene locus_tag LOCUS_28840 5795 5178 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_28840 5794 6504 gene locus_tag LOCUS_28850 5794 6504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_28850 6501 8993 gene locus_tag LOCUS_28860 6501 8993 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_28860 9040 11223 gene locus_tag LOCUS_28870 gene relA 9040 11223 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_28870 11300 11953 gene locus_tag LOCUS_28880 gene nth 11300 11953 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_28880 11950 12426 gene locus_tag LOCUS_28890 11950 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 12590 14038 gene locus_tag LOCUS_28900 12590 14038 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072336.1 protein_id gnl|my_center|LOCUS_28900 <14723 14097 gene locus_tag LOCUS_28910 <14723 14097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063173710.1:nitroreductase >Feature sequence059 2702 1719 gene locus_tag LOCUS_28920 2702 1719 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_28920 3609 2854 gene locus_tag LOCUS_28930 3609 2854 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 protein_id gnl|my_center|LOCUS_28930 4094 3606 gene locus_tag LOCUS_28940 4094 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5353 4091 gene locus_tag LOCUS_28950 gene exeL 5353 4091 CDS product GspL family type II secretion system protein ExeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704547.1 protein_id gnl|my_center|LOCUS_28950 6378 5356 gene locus_tag LOCUS_28960 gene gspK 6378 5356 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_28960 6998 6375 gene locus_tag LOCUS_28970 gene lspJ 6998 6375 CDS product GspJ family T2SS minor pseudopilin variant LspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947089.1 protein_id gnl|my_center|LOCUS_28970 7366 6995 gene locus_tag LOCUS_28980 7366 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 7902 7366 gene locus_tag LOCUS_28990 7902 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 8362 7916 gene locus_tag LOCUS_29000 gene xcpT 8362 7916 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_29000 10466 8427 gene locus_tag LOCUS_29010 gene prlC 10466 8427 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_29010 10721 10518 gene locus_tag LOCUS_29020 10721 10518 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_29020 10904 11242 gene locus_tag LOCUS_29030 gene glnK 10904 11242 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_29030 11245 12537 gene locus_tag LOCUS_29040 gene amt 11245 12537 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_29040 12660 13136 gene locus_tag LOCUS_29050 12660 13136 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_29050 13200 13275 gene locus_tag LOCUS_t00330 13200 13275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13356 13429 gene locus_tag LOCUS_t00340 13356 13429 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13445 13531 gene locus_tag LOCUS_t00350 13445 13531 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 <1 1260 gene locus_tag LOCUS_29060 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073745.1:MFS transporter 1415 1867 gene locus_tag LOCUS_29070 gene ssb 1415 1867 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_29070 1930 3093 gene locus_tag LOCUS_29080 gene metK 1930 3093 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_29080 3104 4408 gene locus_tag LOCUS_29090 gene ahcY 3104 4408 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_29090 4546 5874 gene locus_tag LOCUS_29100 4546 5874 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_29100 6038 7441 gene locus_tag LOCUS_29110 6038 7441 CDS product UDP-glucose--undecaprenyl-phosphate glucose-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183107.1 protein_id gnl|my_center|LOCUS_29110 7558 8835 gene locus_tag LOCUS_29120 gene miaB 7558 8835 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_29120 8908 9876 gene locus_tag LOCUS_29130 8908 9876 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_29130 9869 10360 gene locus_tag LOCUS_29140 9869 10360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 10367 11200 gene locus_tag LOCUS_29150 10367 11200 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_29150 11254 12816 gene locus_tag LOCUS_29160 gene lnt 11254 12816 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_29160 12836 13906 gene locus_tag LOCUS_29170 12836 13906 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113430.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence061 1203 115 gene locus_tag LOCUS_29180 gene modC 1203 115 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_29180 1895 1200 gene locus_tag LOCUS_29190 gene modB 1895 1200 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_29190 2596 1901 gene locus_tag LOCUS_29200 gene modA 2596 1901 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463409.1 protein_id gnl|my_center|LOCUS_29200 2814 3251 gene locus_tag LOCUS_29210 2814 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 3490 4086 gene locus_tag LOCUS_29220 3490 4086 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 protein_id gnl|my_center|LOCUS_29220 4267 4839 gene locus_tag LOCUS_29230 4267 4839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29230 4842 6101 gene locus_tag LOCUS_29240 4842 6101 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_29240 6115 6702 gene locus_tag LOCUS_29250 6115 6702 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412093.1 protein_id gnl|my_center|LOCUS_29250 8134 7919 gene locus_tag LOCUS_29260 8134 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 8258 8731 gene locus_tag LOCUS_29270 8258 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 8781 9962 gene locus_tag LOCUS_29280 8781 9962 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_29280 11174 10167 gene locus_tag LOCUS_29290 11174 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 11891 11481 gene locus_tag LOCUS_29300 11891 11481 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672395.1 protein_id gnl|my_center|LOCUS_29300 12301 11906 gene locus_tag LOCUS_29310 12301 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 12903 12301 gene locus_tag LOCUS_29320 12903 12301 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_29320 13691 12936 gene locus_tag LOCUS_29330 13691 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence062 439 1722 gene locus_tag LOCUS_29340 439 1722 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_29340 1877 2395 gene locus_tag LOCUS_29350 1877 2395 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_29350 2465 3277 gene locus_tag LOCUS_29360 2465 3277 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_29360 4175 3321 gene locus_tag LOCUS_29370 4175 3321 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808542.1 protein_id gnl|my_center|LOCUS_29370 5592 4279 gene locus_tag LOCUS_29380 5592 4279 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262236.1 protein_id gnl|my_center|LOCUS_29380 6586 5669 gene locus_tag LOCUS_29390 6586 5669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_29390 7786 6800 gene locus_tag LOCUS_29400 7786 6800 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_29400 9202 7805 gene locus_tag LOCUS_29410 9202 7805 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105412.1 protein_id gnl|my_center|LOCUS_29410 10023 9235 gene locus_tag LOCUS_29420 10023 9235 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_29420 12850 10010 gene locus_tag LOCUS_29430 gene uvrA 12850 10010 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_29430 13192 12926 gene locus_tag LOCUS_29440 13192 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence063 1044 3233 gene locus_tag LOCUS_29450 1044 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 6214 3371 gene locus_tag LOCUS_29460 6214 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 6423 7112 gene locus_tag LOCUS_29470 6423 7112 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967273.1 protein_id gnl|my_center|LOCUS_29470 7162 8346 gene locus_tag LOCUS_29480 7162 8346 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_29480 8558 10495 gene locus_tag LOCUS_29490 gene acs 8558 10495 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_29490 10749 12281 gene locus_tag LOCUS_29500 10749 12281 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence064 496 696 gene locus_tag LOCUS_29510 496 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1479 766 gene locus_tag LOCUS_29520 1479 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_29520 1736 1482 gene locus_tag LOCUS_29530 1736 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 2181 1720 gene locus_tag LOCUS_29540 2181 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2349 3227 gene locus_tag LOCUS_29550 2349 3227 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_29550 3241 3723 gene locus_tag LOCUS_29560 3241 3723 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_29560 3720 5990 gene locus_tag LOCUS_29570 3720 5990 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_29570 5995 6234 gene locus_tag LOCUS_29580 5995 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 6353 7516 gene locus_tag LOCUS_29590 6353 7516 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_29590 7529 8767 gene locus_tag LOCUS_29600 7529 8767 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089117.1 protein_id gnl|my_center|LOCUS_29600 8896 8678 gene locus_tag LOCUS_29610 8896 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 9797 10291 gene locus_tag LOCUS_29620 gene fabA 9797 10291 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 protein_id gnl|my_center|LOCUS_29620 10374 10766 gene locus_tag LOCUS_29630 10374 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 11648 12208 gene locus_tag LOCUS_29640 11648 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 12258 12737 gene locus_tag LOCUS_29650 12258 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222812.1 protein_id gnl|my_center|LOCUS_29650 >Feature sequence065 <1 876 gene locus_tag LOCUS_29660 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250764.1:cation:proton antiporter 963 1550 gene locus_tag LOCUS_29670 963 1550 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389514.1 protein_id gnl|my_center|LOCUS_29670 1642 2094 gene locus_tag LOCUS_29680 1642 2094 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_29680 2855 2112 gene locus_tag LOCUS_29690 2855 2112 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_29690 2994 4082 gene locus_tag LOCUS_29700 gene mtnA 2994 4082 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_29700 4072 4722 gene locus_tag LOCUS_29710 4072 4722 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_29710 5616 4765 gene locus_tag LOCUS_29720 5616 4765 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_29720 5874 9185 gene locus_tag LOCUS_29730 5874 9185 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_29730 9228 10673 gene locus_tag LOCUS_29740 9228 10673 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_29740 10709 11662 gene locus_tag LOCUS_29750 10709 11662 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_29750 11789 12511 gene locus_tag LOCUS_29760 11789 12511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926963.1 protein_id gnl|my_center|LOCUS_29760 >Feature sequence066 31 1506 gene locus_tag LOCUS_29770 31 1506 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_29770 1592 2965 gene locus_tag LOCUS_29780 1592 2965 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_29780 3140 3970 gene locus_tag LOCUS_29790 3140 3970 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_29790 3989 4663 gene locus_tag LOCUS_29800 3989 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4722 5480 gene locus_tag LOCUS_29810 4722 5480 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_29810 5579 6025 gene locus_tag LOCUS_29820 5579 6025 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_29820 7143 6067 gene locus_tag LOCUS_29830 gene lptG 7143 6067 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957820.1 protein_id gnl|my_center|LOCUS_29830 8246 7140 gene locus_tag LOCUS_29840 gene lptF 8246 7140 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_29840 8440 9930 gene locus_tag LOCUS_29850 8440 9930 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_29850 9946 10389 gene locus_tag LOCUS_29860 gene holC 9946 10389 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_29860 10407 10733 gene locus_tag LOCUS_29870 10407 10733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 10872 11279 gene locus_tag LOCUS_29880 10872 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence067 492 166 gene locus_tag LOCUS_29890 492 166 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447541.1 protein_id gnl|my_center|LOCUS_29890 1601 666 gene locus_tag LOCUS_29900 1601 666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296616.1 protein_id gnl|my_center|LOCUS_29900 1763 3886 gene locus_tag LOCUS_29910 1763 3886 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927211.1 protein_id gnl|my_center|LOCUS_29910 4027 4242 gene locus_tag LOCUS_29920 4027 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4242 4475 gene locus_tag LOCUS_29930 4242 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29930 4500 5354 gene locus_tag LOCUS_29940 4500 5354 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116544.1 protein_id gnl|my_center|LOCUS_29940 5397 6716 gene locus_tag LOCUS_29950 5397 6716 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_29950 7813 6704 gene locus_tag LOCUS_29960 7813 6704 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_29960 9109 7907 gene locus_tag LOCUS_29970 9109 7907 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_29970 11503 9137 gene locus_tag LOCUS_29980 11503 9137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967586.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence068 <1 2571 gene locus_tag LOCUS_29990 <1 2571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein 2714 3397 gene locus_tag LOCUS_30000 2714 3397 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_30000 3478 5085 gene locus_tag LOCUS_30010 3478 5085 CDS product acetyl-/propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412778.1 protein_id gnl|my_center|LOCUS_30010 5908 5201 gene locus_tag LOCUS_30020 5908 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 8328 6778 gene locus_tag LOCUS_30030 8328 6778 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_30030 9478 8348 gene locus_tag LOCUS_30040 9478 8348 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704335.1 protein_id gnl|my_center|LOCUS_30040 9909 9475 gene locus_tag LOCUS_30050 9909 9475 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113137.1 protein_id gnl|my_center|LOCUS_30050 10052 10975 gene locus_tag LOCUS_30060 10052 10975 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_30060 11245 11054 gene locus_tag LOCUS_30070 11245 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence069 87 545 gene locus_tag LOCUS_30080 87 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 1458 910 gene locus_tag LOCUS_30090 1458 910 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207652.1 protein_id gnl|my_center|LOCUS_30090 2373 2026 gene locus_tag LOCUS_30100 2373 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3091 2636 gene locus_tag LOCUS_30110 3091 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 3949 3167 gene locus_tag LOCUS_30120 3949 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 4397 3939 gene locus_tag LOCUS_30130 4397 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 5155 4550 gene locus_tag LOCUS_30140 5155 4550 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_30140 6121 5726 gene locus_tag LOCUS_30150 6121 5726 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_30150 6582 6196 gene locus_tag LOCUS_30160 6582 6196 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071691.1 protein_id gnl|my_center|LOCUS_30160 6729 6980 gene locus_tag LOCUS_30170 gene yefM 6729 6980 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_30170 6977 7231 gene locus_tag LOCUS_30180 gene yoeB 6977 7231 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_30180 7731 7312 gene locus_tag LOCUS_30190 7731 7312 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228430.1 protein_id gnl|my_center|LOCUS_30190 8409 8149 gene locus_tag LOCUS_30200 8409 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 9317 8907 gene locus_tag LOCUS_30210 9317 8907 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084163.1 protein_id gnl|my_center|LOCUS_30210 11288 9456 gene locus_tag LOCUS_30220 11288 9456 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_30220 11546 11621 gene locus_tag LOCUS_t00360 11546 11621 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence070 1015 497 gene locus_tag LOCUS_30230 1015 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1193 1636 gene locus_tag LOCUS_30240 1193 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence071 <1 1399 gene locus_tag LOCUS_30250 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389287.1:chloride channel protein 2089 1412 gene locus_tag LOCUS_30260 2089 1412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626425.1 protein_id gnl|my_center|LOCUS_30260 2871 2086 gene locus_tag LOCUS_30270 gene cbiQ 2871 2086 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626426.1 protein_id gnl|my_center|LOCUS_30270 3461 2871 gene locus_tag LOCUS_30280 3461 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626606.1 protein_id gnl|my_center|LOCUS_30280 4102 3458 gene locus_tag LOCUS_30290 gene cbiM 4102 3458 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_30290 4919 4104 gene locus_tag LOCUS_30300 4919 4104 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679851.1 protein_id gnl|my_center|LOCUS_30300 6070 5372 gene locus_tag LOCUS_30310 6070 5372 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118330.1 protein_id gnl|my_center|LOCUS_30310 6819 6154 gene locus_tag LOCUS_30320 6819 6154 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_30320 7540 6863 gene locus_tag LOCUS_30330 gene purN 7540 6863 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770445.1 protein_id gnl|my_center|LOCUS_30330 8610 7537 gene locus_tag LOCUS_30340 gene purM 8610 7537 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 protein_id gnl|my_center|LOCUS_30340 8687 9823 gene locus_tag LOCUS_30350 8687 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 9843 10544 gene locus_tag LOCUS_30360 gene hda 9843 10544 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443937.1 protein_id gnl|my_center|LOCUS_30360 10897 10550 gene locus_tag LOCUS_30370 10897 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 11287 10931 gene locus_tag LOCUS_30380 gene arsC 11287 10931 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314592.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence072 598 320 gene locus_tag LOCUS_30390 598 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 3612 598 gene locus_tag LOCUS_30400 3612 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 5830 3626 gene locus_tag LOCUS_30410 5830 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 7431 5827 gene locus_tag LOCUS_30420 7431 5827 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387943.1 protein_id gnl|my_center|LOCUS_30420 9250 7433 gene locus_tag LOCUS_30430 9250 7433 CDS product type III-B CRISPR module-associated Cmr3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388905.1 protein_id gnl|my_center|LOCUS_30430 10737 9253 gene locus_tag LOCUS_30440 10737 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467686.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence073 315 785 gene locus_tag LOCUS_30450 315 785 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_30450 822 1886 gene locus_tag LOCUS_30460 822 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 4121 1914 gene locus_tag LOCUS_30470 4121 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 5203 4817 gene locus_tag LOCUS_30480 5203 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 5955 5266 gene locus_tag LOCUS_30490 5955 5266 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_30490 6245 5976 gene locus_tag LOCUS_30500 6245 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 6911 6261 gene locus_tag LOCUS_30510 6911 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 7268 6996 gene locus_tag LOCUS_30520 7268 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 9982 7523 gene locus_tag LOCUS_30530 9982 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 10418 9942 gene locus_tag LOCUS_30540 10418 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence074 1499 168 gene locus_tag LOCUS_30550 1499 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1906 1502 gene locus_tag LOCUS_30560 1906 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 3609 2239 gene locus_tag LOCUS_30570 3609 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3796 4581 gene locus_tag LOCUS_30580 3796 4581 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_30580 5009 4584 gene locus_tag LOCUS_30590 5009 4584 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_30590 5210 6820 gene locus_tag LOCUS_30600 5210 6820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 6817 8013 gene locus_tag LOCUS_30610 6817 8013 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_30610 7985 9160 gene locus_tag LOCUS_30620 7985 9160 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence075 964 578 gene locus_tag LOCUS_30630 gene gloA 964 578 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_30630 1208 1750 gene locus_tag LOCUS_30640 1208 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1775 2545 gene locus_tag LOCUS_30650 1775 2545 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_30650 2538 3983 gene locus_tag LOCUS_30660 2538 3983 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531459.1 protein_id gnl|my_center|LOCUS_30660 4097 5464 gene locus_tag LOCUS_30670 4097 5464 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482874.1 protein_id gnl|my_center|LOCUS_30670 5461 5979 gene locus_tag LOCUS_30680 5461 5979 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_30680 6060 6713 gene locus_tag LOCUS_30690 6060 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 7055 8254 gene locus_tag LOCUS_30700 gene zigA 7055 8254 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_30700 8251 8928 gene locus_tag LOCUS_30710 8251 8928 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence076 2460 886 gene locus_tag LOCUS_30720 gene guaA 2460 886 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266918.1 protein_id gnl|my_center|LOCUS_30720 3962 2502 gene locus_tag LOCUS_30730 gene guaB 3962 2502 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192833.1 protein_id gnl|my_center|LOCUS_30730 5545 4085 gene locus_tag LOCUS_30740 5545 4085 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_30740 5736 8135 gene locus_tag LOCUS_30750 gene extM 5736 8135 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_30750 8204 8998 gene locus_tag LOCUS_30760 8204 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence077 <1 3064 gene locus_tag LOCUS_30770 <1 3064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930410.1:chitobiase/beta-hexosaminidase C-terminal domain-containing protein 3226 3891 gene locus_tag LOCUS_30780 3226 3891 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015358.1 protein_id gnl|my_center|LOCUS_30780 4670 3927 gene locus_tag LOCUS_30790 4670 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 5371 4667 gene locus_tag LOCUS_30800 5371 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_30800 6901 5558 gene locus_tag LOCUS_30810 6901 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence078 <1 1165 gene locus_tag LOCUS_30820 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943324.1:ribosome-associated ATPase/putative transporter RbbA 1176 2297 gene locus_tag LOCUS_30830 1176 2297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_30830 2318 3232 gene locus_tag LOCUS_30840 2318 3232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_30840 4317 3229 gene locus_tag LOCUS_30850 4317 3229 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_30850 4460 5095 gene locus_tag LOCUS_30860 4460 5095 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_30860 5160 5915 gene locus_tag LOCUS_30870 5160 5915 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 protein_id gnl|my_center|LOCUS_30870 6304 5960 gene locus_tag LOCUS_30880 6304 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 <8550 6311 gene locus_tag LOCUS_30890 <8550 6311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037738.1:YhdP family protein >Feature sequence079 589 1203 gene locus_tag LOCUS_30900 589 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 2025 1231 gene locus_tag LOCUS_30910 2025 1231 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258858.1 protein_id gnl|my_center|LOCUS_30910 2248 2769 gene locus_tag LOCUS_30920 2248 2769 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_30920 2769 3164 gene locus_tag LOCUS_30930 gene pilV 2769 3164 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_30930 3168 4178 gene locus_tag LOCUS_30940 3168 4178 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_30940 4189 4725 gene locus_tag LOCUS_30950 4189 4725 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_30950 4758 8201 gene locus_tag LOCUS_30960 4758 8201 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence080 1389 1063 gene locus_tag LOCUS_30970 1389 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30970 1799 1392 gene locus_tag LOCUS_30980 gene cueR 1799 1392 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_30980 5328 2197 gene locus_tag LOCUS_30990 5328 2197 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_30990 7066 5321 gene locus_tag LOCUS_31000 7066 5321 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_31000 7404 7063 gene locus_tag LOCUS_31010 7404 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7294 7752 gene locus_tag LOCUS_31020 7294 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence081 220 1395 gene locus_tag LOCUS_31030 gene hflK 220 1395 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_31030 1395 2267 gene locus_tag LOCUS_31040 gene hflC 1395 2267 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_31040 2522 3724 gene locus_tag LOCUS_31050 2522 3724 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 protein_id gnl|my_center|LOCUS_31050 3726 5027 gene locus_tag LOCUS_31060 3726 5027 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422343.1 protein_id gnl|my_center|LOCUS_31060 6076 5129 gene locus_tag LOCUS_31070 6076 5129 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947102.1 protein_id gnl|my_center|LOCUS_31070 6492 6088 gene locus_tag LOCUS_31080 gene mce 6492 6088 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 protein_id gnl|my_center|LOCUS_31080 <7694 6538 gene locus_tag LOCUS_31090 <7694 6538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387813.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence082 1768 158 gene locus_tag LOCUS_31100 gene murJ 1768 158 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_31100 2115 1825 gene locus_tag LOCUS_31110 2115 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3287 2400 gene locus_tag LOCUS_31120 3287 2400 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_31120 3807 3589 gene locus_tag LOCUS_31130 3807 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 4061 5017 gene locus_tag LOCUS_31140 4061 5017 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence083 <1 574 gene locus_tag LOCUS_31150 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001120888.1:IS91-like element ISVsa3 family transposase 594 773 gene locus_tag LOCUS_31160 594 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1945 1052 gene locus_tag LOCUS_31170 1945 1052 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968807.1 protein_id gnl|my_center|LOCUS_31170 2050 2334 gene locus_tag LOCUS_31180 2050 2334 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261920.1 protein_id gnl|my_center|LOCUS_31180 2348 2824 gene locus_tag LOCUS_31190 2348 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 2824 3591 gene locus_tag LOCUS_31200 2824 3591 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532409.1 protein_id gnl|my_center|LOCUS_31200 3748 4239 gene locus_tag LOCUS_31210 3748 4239 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400653.1 protein_id gnl|my_center|LOCUS_31210 5678 4452 gene locus_tag LOCUS_31220 5678 4452 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528678.1 protein_id gnl|my_center|LOCUS_31220 <6791 5794 gene locus_tag LOCUS_31230 <6791 5794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948100.1:class I SAM-dependent methyltransferase >Feature sequence084 1311 349 gene locus_tag LOCUS_31240 1311 349 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_31240 1477 2187 gene locus_tag LOCUS_31250 1477 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3565 2666 gene locus_tag LOCUS_31260 3565 2666 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808542.1 protein_id gnl|my_center|LOCUS_31260 3713 4915 gene locus_tag LOCUS_31270 3713 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 5395 4898 gene locus_tag LOCUS_31280 gene mobA 5395 4898 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_31280 6176 5541 gene locus_tag LOCUS_31290 6176 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence085 121 1209 gene locus_tag LOCUS_31300 gene modC 121 1209 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_31300 1987 1238 gene locus_tag LOCUS_31310 1987 1238 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_31310 2246 1977 gene locus_tag LOCUS_31320 2246 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2938 2243 gene locus_tag LOCUS_31330 2938 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3159 2935 gene locus_tag LOCUS_31340 gene nifT 3159 2935 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388753.1 protein_id gnl|my_center|LOCUS_31340 4797 3226 gene locus_tag LOCUS_31350 gene nifK 4797 3226 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_31350 6388 4910 gene locus_tag LOCUS_31360 gene nifD 6388 4910 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence086 2019 1621 gene locus_tag LOCUS_31370 2019 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2716 2012 gene locus_tag LOCUS_31380 2716 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3335 2709 gene locus_tag LOCUS_31390 3335 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 4246 3332 gene locus_tag LOCUS_31400 4246 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 4392 4853 gene locus_tag LOCUS_31410 4392 4853 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807963.1 protein_id gnl|my_center|LOCUS_31410 4864 5739 gene locus_tag LOCUS_31420 4864 5739 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_31420 <6367 5730 gene locus_tag LOCUS_31430 <6367 5730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121907.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence087 658 1422 gene locus_tag LOCUS_31440 658 1422 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_31440 1502 1954 gene locus_tag LOCUS_31450 1502 1954 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_31450 2706 1951 gene locus_tag LOCUS_31460 2706 1951 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_31460 2845 3933 gene locus_tag LOCUS_31470 gene mtnA 2845 3933 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_31470 3923 4573 gene locus_tag LOCUS_31480 3923 4573 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_31480 5470 4619 gene locus_tag LOCUS_31490 5470 4619 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence088 177 926 gene locus_tag LOCUS_31500 177 926 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930110.1 protein_id gnl|my_center|LOCUS_31500 937 1881 gene locus_tag LOCUS_31510 937 1881 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_31510 2027 3811 gene locus_tag LOCUS_31520 2027 3811 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_31520 4253 3861 gene locus_tag LOCUS_31530 gene gpt 4253 3861 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208704.1 protein_id gnl|my_center|LOCUS_31530 4621 4866 gene locus_tag LOCUS_31540 4621 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 4904 6214 gene locus_tag LOCUS_31550 gene hflX 4904 6214 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460351.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence089 <1 2416 gene locus_tag LOCUS_31560 <1 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815475.1:valine--tRNA ligase 2563 3351 gene locus_tag LOCUS_31570 2563 3351 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_31570 3503 3979 gene locus_tag LOCUS_31580 3503 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 5673 4069 gene locus_tag LOCUS_31590 5673 4069 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence090 241 1578 gene locus_tag LOCUS_31600 gene phoR 241 1578 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_31600 2444 1569 gene locus_tag LOCUS_31610 2444 1569 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_31610 2970 2455 gene locus_tag LOCUS_31620 2970 2455 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807963.1 protein_id gnl|my_center|LOCUS_31620 3060 3974 gene locus_tag LOCUS_31630 3060 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3971 4597 gene locus_tag LOCUS_31640 3971 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 4590 5294 gene locus_tag LOCUS_31650 4590 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 5287 5685 gene locus_tag LOCUS_31660 5287 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence091 <1 559 gene locus_tag LOCUS_31670 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071887.1:YafY family protein 622 1008 gene locus_tag LOCUS_31680 622 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1099 1533 gene locus_tag LOCUS_31690 1099 1533 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920775.1 protein_id gnl|my_center|LOCUS_31690 1708 3966 gene locus_tag LOCUS_31700 1708 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 5055 3991 gene locus_tag LOCUS_31710 5055 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 5590 5099 gene locus_tag LOCUS_31720 5590 5099 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence092 697 1977 gene locus_tag LOCUS_31730 697 1977 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943927.1 protein_id gnl|my_center|LOCUS_31730 3180 1972 gene locus_tag LOCUS_31740 3180 1972 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_31740 3291 4058 gene locus_tag LOCUS_31750 3291 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4055 5569 gene locus_tag LOCUS_31760 4055 5569 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence093 <1 1083 gene locus_tag LOCUS_31770 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071212.1:phosphoglycerate kinase 1243 1725 gene locus_tag LOCUS_31780 1243 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 2959 1790 gene locus_tag LOCUS_31790 2959 1790 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_31790 3045 3359 gene locus_tag LOCUS_31800 3045 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 3413 3838 gene locus_tag LOCUS_31810 3413 3838 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_31810 5098 3914 gene locus_tag LOCUS_31820 5098 3914 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257345.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence094 706 329 gene locus_tag LOCUS_31830 706 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1076 2350 gene locus_tag LOCUS_31840 1076 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2347 3204 gene locus_tag LOCUS_31850 2347 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3209 4948 gene locus_tag LOCUS_31860 3209 4948 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974229.1 protein_id gnl|my_center|LOCUS_31860 4961 5248 gene locus_tag LOCUS_31870 4961 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence095 <1 666 gene locus_tag LOCUS_31880 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046083149.1:type I-E CRISPR-associated protein Cse1/CasA 686 1252 gene locus_tag LOCUS_31890 686 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 1255 2292 gene locus_tag LOCUS_31900 gene cas7e 1255 2292 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_31900 2295 3023 gene locus_tag LOCUS_31910 gene cas5e 2295 3023 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_31910 3010 3735 gene locus_tag LOCUS_31920 gene cas6e 3010 3735 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281463.1 protein_id gnl|my_center|LOCUS_31920 3759 4703 gene locus_tag LOCUS_31930 gene cas1e 3759 4703 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220066.1 protein_id gnl|my_center|LOCUS_31930 4707 5009 gene locus_tag LOCUS_31940 gene cas2e 4707 5009 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_31940 5104 >5251 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccacacccgtggggatgaa >Feature sequence096 1995 7 gene locus_tag LOCUS_31950 1995 7 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921462.1 protein_id gnl|my_center|LOCUS_31950 3676 2393 gene locus_tag LOCUS_31960 3676 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence097 968 893 gene locus_tag LOCUS_t00370 968 893 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1372 3021 gene locus_tag LOCUS_31970 gene dnaX 1372 3021 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948444.1 protein_id gnl|my_center|LOCUS_31970 3048 3371 gene locus_tag LOCUS_31980 3048 3371 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_31980 3394 3984 gene locus_tag LOCUS_31990 gene recR 3394 3984 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence098 1287 970 gene locus_tag LOCUS_32000 1287 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2313 1408 gene locus_tag LOCUS_32010 2313 1408 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_32010 3318 2419 gene locus_tag LOCUS_32020 3318 2419 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_32020 3395 3787 gene locus_tag LOCUS_32030 gene cadR 3395 3787 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405262.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence099 1666 443 gene locus_tag LOCUS_32040 gene mshG 1666 443 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_32040 3404 1692 gene locus_tag LOCUS_32050 gene mshE 3404 1692 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_32050 4375 3407 gene locus_tag LOCUS_32060 4375 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence100 <1 1962 gene locus_tag LOCUS_32070 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920248.1:CusA/CzcA family heavy metal efflux RND transporter 2879 1980 gene locus_tag LOCUS_32080 2879 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 3278 3814 gene locus_tag LOCUS_32090 3278 3814 CDS product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144322.1 protein_id gnl|my_center|LOCUS_32090 3930 4172 gene locus_tag LOCUS_32100 3930 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 4180 4398 gene locus_tag LOCUS_32110 4180 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence101 453 61 gene locus_tag LOCUS_32120 gene tusD 453 61 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707698.1 protein_id gnl|my_center|LOCUS_32120 1698 646 gene locus_tag LOCUS_32130 1698 646 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_32130 2246 1710 gene locus_tag LOCUS_32140 gene cheD 2246 1710 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_32140 3106 2276 gene locus_tag LOCUS_32150 3106 2276 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881719.1 protein_id gnl|my_center|LOCUS_32150 3531 3121 gene locus_tag LOCUS_32160 3531 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 4042 3542 gene locus_tag LOCUS_32170 gene cheW 4042 3542 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence102 2982 2128 gene locus_tag LOCUS_32180 2982 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence103 1756 2160 gene locus_tag LOCUS_32190 1756 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 2433 2209 gene locus_tag LOCUS_32200 2433 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3821 2532 gene locus_tag LOCUS_32210 3821 2532 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005023250.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence104 1697 537 gene locus_tag LOCUS_32220 1697 537 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_32220 2444 1833 gene locus_tag LOCUS_32230 gene ruvA 2444 1833 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406125.1 protein_id gnl|my_center|LOCUS_32230 2955 2446 gene locus_tag LOCUS_32240 gene ruvC 2955 2446 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211201.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence105 1545 517 gene locus_tag LOCUS_32250 gene pyrC 1545 517 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764852.1 protein_id gnl|my_center|LOCUS_32250 1613 2134 gene locus_tag LOCUS_32260 1613 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence106 654 1133 gene locus_tag LOCUS_32270 gene thpR 654 1133 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_32270 1704 1270 gene locus_tag LOCUS_32280 gene trxC 1704 1270 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_32280 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110