>Feature sequence01 377 772 gene locus_tag LOCUS_00010 gene eif5A 377 772 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_00010 772 936 gene locus_tag LOCUS_00020 772 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 967 2397 gene locus_tag LOCUS_00030 967 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2753 2400 gene locus_tag LOCUS_00040 2753 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2956 3588 gene locus_tag LOCUS_00050 2956 3588 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_00050 3572 4459 gene locus_tag LOCUS_00060 3572 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4516 4812 gene locus_tag LOCUS_00070 gene rpl12p 4516 4812 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_00070 4971 6032 gene locus_tag LOCUS_00080 4971 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6211 6132 gene locus_tag LOCUS_t00010 6211 6132 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6333 6917 gene locus_tag LOCUS_00090 6333 6917 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_00090 7946 6930 gene locus_tag LOCUS_00100 7946 6930 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546360.1 protein_id gnl|my_center|LOCUS_00100 8037 8741 gene locus_tag LOCUS_00110 8037 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9392 8742 gene locus_tag LOCUS_00120 9392 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9608 10570 gene locus_tag LOCUS_00130 9608 10570 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_00130 10567 10851 gene locus_tag LOCUS_00140 10567 10851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10848 11636 gene locus_tag LOCUS_00150 gene rpl4p 10848 11636 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_00150 11638 11895 gene locus_tag LOCUS_00160 11638 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 11986 12684 gene locus_tag LOCUS_00170 11986 12684 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_00170 12690 13100 gene locus_tag LOCUS_00180 gene rpsS 12690 13100 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869675.1 protein_id gnl|my_center|LOCUS_00180 13101 13643 gene locus_tag LOCUS_00190 13101 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13643 14428 gene locus_tag LOCUS_00200 13643 14428 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250487.1 protein_id gnl|my_center|LOCUS_00200 14431 14637 gene locus_tag LOCUS_00210 14431 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 14639 14938 gene locus_tag LOCUS_00220 gene yciH 14639 14938 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_00220 14940 15323 gene locus_tag LOCUS_00230 14940 15323 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_00230 15320 15721 gene locus_tag LOCUS_00240 15320 15721 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_00240 15824 16222 gene locus_tag LOCUS_00250 15824 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 16224 16880 gene locus_tag LOCUS_00260 16224 16880 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762314.1 protein_id gnl|my_center|LOCUS_00260 16966 17496 gene locus_tag LOCUS_00270 16966 17496 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_00270 17498 17728 gene locus_tag LOCUS_00280 17498 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 17765 18142 gene locus_tag LOCUS_00290 17765 18142 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_00290 18144 18686 gene locus_tag LOCUS_00300 18144 18686 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_00300 18686 19102 gene locus_tag LOCUS_00310 18686 19102 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 protein_id gnl|my_center|LOCUS_00310 19102 19503 gene locus_tag LOCUS_00320 19102 19503 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_00320 19611 20084 gene locus_tag LOCUS_00330 19611 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 20084 20986 gene locus_tag LOCUS_00340 20084 20986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20991 21338 gene locus_tag LOCUS_00350 20991 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 21340 21666 gene locus_tag LOCUS_00360 21340 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 21666 22211 gene locus_tag LOCUS_00370 21666 22211 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250470.1 protein_id gnl|my_center|LOCUS_00370 22257 23624 gene locus_tag LOCUS_00380 gene secY 22257 23624 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_00380 23761 24156 gene locus_tag LOCUS_00390 23761 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 24210 25064 gene locus_tag LOCUS_00400 24210 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 24962 25180 gene locus_tag LOCUS_00410 24962 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 25189 26181 gene locus_tag LOCUS_00420 25189 26181 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_00420 26270 28954 gene locus_tag LOCUS_00430 26270 28954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 28957 29481 gene locus_tag LOCUS_00440 28957 29481 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167942160.1 protein_id gnl|my_center|LOCUS_00440 29532 30125 gene locus_tag LOCUS_00450 29532 30125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 30174 30371 gene locus_tag LOCUS_00460 30174 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 30433 31554 gene locus_tag LOCUS_00470 gene gmd 30433 31554 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330038.1 protein_id gnl|my_center|LOCUS_00470 31607 32701 gene locus_tag LOCUS_00480 31607 32701 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_00480 32752 33273 gene locus_tag LOCUS_00490 32752 33273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 33309 33692 gene locus_tag LOCUS_00500 33309 33692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 33722 34831 gene locus_tag LOCUS_00510 33722 34831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 34846 35433 gene locus_tag LOCUS_00520 34846 35433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 35435 36304 gene locus_tag LOCUS_00530 35435 36304 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006843524.1 protein_id gnl|my_center|LOCUS_00530 36356 38566 gene locus_tag LOCUS_00540 36356 38566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 38532 39260 gene locus_tag LOCUS_00550 38532 39260 CDS product inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022640.1 protein_id gnl|my_center|LOCUS_00550 39942 39250 gene locus_tag LOCUS_00560 39942 39250 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_00560 41212 39977 gene locus_tag LOCUS_00570 41212 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 41384 42310 gene locus_tag LOCUS_00580 41384 42310 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_00580 44813 42330 gene locus_tag LOCUS_00590 44813 42330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 45629 44892 gene locus_tag LOCUS_00600 45629 44892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 45733 46458 gene locus_tag LOCUS_00610 45733 46458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 46534 46881 gene locus_tag LOCUS_00620 46534 46881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 48927 46882 gene locus_tag LOCUS_00630 48927 46882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 49876 48929 gene locus_tag LOCUS_00640 49876 48929 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_00640 49975 51576 gene locus_tag LOCUS_00650 49975 51576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 52506 51565 gene locus_tag LOCUS_00660 52506 51565 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965478.1 protein_id gnl|my_center|LOCUS_00660 53352 52546 gene locus_tag LOCUS_00670 53352 52546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 53846 53349 gene locus_tag LOCUS_00680 53846 53349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 54874 53843 gene locus_tag LOCUS_00690 54874 53843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 55647 54931 gene locus_tag LOCUS_00700 55647 54931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 56673 55693 gene locus_tag LOCUS_00710 56673 55693 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_00710 58073 56670 gene locus_tag LOCUS_00720 58073 56670 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_00720 58531 58070 gene locus_tag LOCUS_00730 58531 58070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 60101 58533 gene locus_tag LOCUS_00740 60101 58533 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_00740 61093 60080 gene locus_tag LOCUS_00750 61093 60080 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_00750 61207 61473 gene locus_tag LOCUS_00760 61207 61473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 61737 61644 gene locus_tag LOCUS_t00020 61737 61644 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61866 61789 gene locus_tag LOCUS_t00030 61866 61789 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62050 61968 gene locus_tag LOCUS_t00040 62050 61968 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62164 62625 gene locus_tag LOCUS_00770 62164 62625 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263089.1 protein_id gnl|my_center|LOCUS_00770 62650 62750 gene locus_tag LOCUS_r00010 62650 62750 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence02 3443 3808 gene locus_tag LOCUS_00780 3443 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3805 4056 gene locus_tag LOCUS_00790 3805 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4053 4547 gene locus_tag LOCUS_00800 4053 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4525 5139 gene locus_tag LOCUS_00810 4525 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 5180 6094 gene locus_tag LOCUS_00820 5180 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6268 6137 gene locus_tag LOCUS_00830 6268 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6677 6375 gene locus_tag LOCUS_00840 6677 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 7012 7257 gene locus_tag LOCUS_00850 7012 7257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 7952 7281 gene locus_tag LOCUS_00860 gene radC 7952 7281 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_00860 8529 7987 gene locus_tag LOCUS_00870 gene idi 8529 7987 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_00870 9646 8534 gene locus_tag LOCUS_00880 gene nifV 9646 8534 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418528.1 protein_id gnl|my_center|LOCUS_00880 10109 9648 gene locus_tag LOCUS_00890 10109 9648 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_00890 10248 11102 gene locus_tag LOCUS_00900 10248 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 11104 12270 gene locus_tag LOCUS_00910 11104 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 13386 12262 gene locus_tag LOCUS_00920 13386 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 14730 13390 gene locus_tag LOCUS_00930 gene panF 14730 13390 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_00930 15523 14801 gene locus_tag LOCUS_00940 15523 14801 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_00940 15834 15532 gene locus_tag LOCUS_00950 15834 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 16048 16326 gene locus_tag LOCUS_00960 16048 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16406 16540 gene locus_tag LOCUS_00970 16406 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 16766 16542 gene locus_tag LOCUS_00980 16766 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 16900 17166 gene locus_tag LOCUS_00990 16900 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 17703 17173 gene locus_tag LOCUS_01000 17703 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 18088 18300 gene locus_tag LOCUS_01010 18088 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 18297 18638 gene locus_tag LOCUS_01020 18297 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 18747 30749 gene locus_tag LOCUS_01030 18747 30749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 30761 35758 gene locus_tag LOCUS_01040 30761 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 35844 36707 gene locus_tag LOCUS_01050 35844 36707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 36833 37387 gene locus_tag LOCUS_01060 36833 37387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 37384 38010 gene locus_tag LOCUS_01070 37384 38010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 38012 39730 gene locus_tag LOCUS_01080 38012 39730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 39734 40630 gene locus_tag LOCUS_01090 39734 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 40669 42837 gene locus_tag LOCUS_01100 40669 42837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 43010 43264 gene locus_tag LOCUS_01110 43010 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 43426 44547 gene locus_tag LOCUS_01120 gene potD 43426 44547 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772500.1 protein_id gnl|my_center|LOCUS_01120 44554 45501 gene locus_tag LOCUS_01130 44554 45501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 45560 46597 gene locus_tag LOCUS_01140 45560 46597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 46688 47530 gene locus_tag LOCUS_01150 46688 47530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 47527 48669 gene locus_tag LOCUS_01160 47527 48669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 48666 50006 gene locus_tag LOCUS_01170 48666 50006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 49999 50490 gene locus_tag LOCUS_01180 49999 50490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 50487 51617 gene locus_tag LOCUS_01190 50487 51617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence03 <1 10724 gene locus_tag LOCUS_01200 <1 10724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065037.1:disaggregatase related repeat-containing protein 10824 11381 gene locus_tag LOCUS_01210 10824 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 11423 12379 gene locus_tag LOCUS_01220 11423 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12592 12383 gene locus_tag LOCUS_01230 12592 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 12684 13427 gene locus_tag LOCUS_01240 12684 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 13424 14593 gene locus_tag LOCUS_01250 13424 14593 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_01250 14604 14966 gene locus_tag LOCUS_01260 14604 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 16012 15047 gene locus_tag LOCUS_01270 16012 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 17862 16174 gene locus_tag LOCUS_01280 17862 16174 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_01280 18315 17899 gene locus_tag LOCUS_01290 18315 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 18437 20017 gene locus_tag LOCUS_01300 18437 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 20101 20718 gene locus_tag LOCUS_01310 20101 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 20826 22748 gene locus_tag LOCUS_01320 20826 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 22842 23702 gene locus_tag LOCUS_01330 22842 23702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 24626 23703 gene locus_tag LOCUS_01340 24626 23703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 27443 24708 gene locus_tag LOCUS_01350 gene ppsA 27443 24708 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_01350 28983 28480 gene locus_tag LOCUS_01360 28983 28480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 29193 29035 gene locus_tag LOCUS_01370 29193 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 29523 29296 gene locus_tag LOCUS_01380 29523 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 30189 29947 gene locus_tag LOCUS_01390 30189 29947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 31906 30911 gene locus_tag LOCUS_01400 31906 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 32219 31998 gene locus_tag LOCUS_01410 32219 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 33502 33140 gene locus_tag LOCUS_01420 33502 33140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 34097 33807 gene locus_tag LOCUS_01430 34097 33807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 35573 35175 gene locus_tag LOCUS_01440 35573 35175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 36562 36203 gene locus_tag LOCUS_01450 36562 36203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 37013 36627 gene locus_tag LOCUS_01460 37013 36627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 37576 37361 gene locus_tag LOCUS_01470 37576 37361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 38152 37718 gene locus_tag LOCUS_01480 38152 37718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 40421 38481 gene locus_tag LOCUS_01490 40421 38481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 40875 40429 gene locus_tag LOCUS_01500 40875 40429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 41024 41782 gene locus_tag LOCUS_01510 41024 41782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 42897 41818 gene locus_tag LOCUS_01520 42897 41818 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_01520 43388 43017 gene locus_tag LOCUS_01530 43388 43017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 43985 43434 gene locus_tag LOCUS_01540 gene rplJ 43985 43434 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_01540 44256 43987 gene locus_tag LOCUS_01550 44256 43987 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence04 958 137 gene locus_tag LOCUS_01560 958 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 1202 3970 gene locus_tag LOCUS_01570 1202 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3982 4947 gene locus_tag LOCUS_01580 3982 4947 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_01580 4949 5881 gene locus_tag LOCUS_01590 4949 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 5965 6807 gene locus_tag LOCUS_01600 5965 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7610 6804 gene locus_tag LOCUS_01610 7610 6804 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496413.1 protein_id gnl|my_center|LOCUS_01610 9359 7659 gene locus_tag LOCUS_01620 9359 7659 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_01620 9662 9734 gene locus_tag LOCUS_t00050 9662 9734 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9734 10183 gene locus_tag LOCUS_01630 9734 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 10281 11189 gene locus_tag LOCUS_01640 gene rnz 10281 11189 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_01640 11671 11192 gene locus_tag LOCUS_01650 11671 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 12042 11797 gene locus_tag LOCUS_01660 12042 11797 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_01660 12164 14596 gene locus_tag LOCUS_01670 12164 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 14642 15961 gene locus_tag LOCUS_01680 14642 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 16210 16283 gene locus_tag LOCUS_t00060 16210 16283 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16334 16663 gene locus_tag LOCUS_01690 16334 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 16992 16666 gene locus_tag LOCUS_01700 gene albA 16992 16666 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869708.1 protein_id gnl|my_center|LOCUS_01700 17182 16973 gene locus_tag LOCUS_01710 17182 16973 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_01710 18192 17320 gene locus_tag LOCUS_01720 18192 17320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 18751 18239 gene locus_tag LOCUS_01730 gene endA 18751 18239 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_01730 19049 19121 gene locus_tag LOCUS_t00070 19049 19121 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19240 19773 gene locus_tag LOCUS_01740 gene yjjX 19240 19773 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_01740 19800 20099 gene locus_tag LOCUS_01750 19800 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20382 20963 gene locus_tag LOCUS_01760 20382 20963 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_01760 21013 22011 gene locus_tag LOCUS_01770 21013 22011 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_01770 22012 23202 gene locus_tag LOCUS_01780 22012 23202 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 protein_id gnl|my_center|LOCUS_01780 23632 23210 gene locus_tag LOCUS_01790 23632 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 23705 24805 gene locus_tag LOCUS_01800 23705 24805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 24810 25520 gene locus_tag LOCUS_01810 24810 25520 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_01810 25648 26088 gene locus_tag LOCUS_01820 gene nrdR 25648 26088 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_01820 26093 29230 gene locus_tag LOCUS_01830 26093 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 29324 30349 gene locus_tag LOCUS_01840 29324 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 30402 30478 gene locus_tag LOCUS_t00080 30402 30478 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30583 30864 gene locus_tag LOCUS_01850 30583 30864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 30834 31442 gene locus_tag LOCUS_01860 30834 31442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 31547 31750 gene locus_tag LOCUS_01870 31547 31750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 31750 35004 gene locus_tag LOCUS_01880 31750 35004 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_01880 35006 38593 gene locus_tag LOCUS_01890 35006 38593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38595 38831 gene locus_tag LOCUS_01900 38595 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 38833 39258 gene locus_tag LOCUS_01910 38833 39258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 39416 39829 gene locus_tag LOCUS_01920 39416 39829 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762452.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence05 778 413 gene locus_tag LOCUS_01930 778 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 1809 1009 gene locus_tag LOCUS_01940 1809 1009 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262191.1 protein_id gnl|my_center|LOCUS_01940 2265 1828 gene locus_tag LOCUS_01950 2265 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 2983 2438 gene locus_tag LOCUS_01960 2983 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3397 3008 gene locus_tag LOCUS_01970 3397 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4224 3424 gene locus_tag LOCUS_01980 4224 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4734 4321 gene locus_tag LOCUS_01990 4734 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5491 4736 gene locus_tag LOCUS_02000 5491 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6218 7432 gene locus_tag LOCUS_02010 6218 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7749 7677 gene locus_tag LOCUS_t00090 7749 7677 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7829 8194 gene locus_tag LOCUS_02020 7829 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 10773 8233 gene locus_tag LOCUS_02030 10773 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11711 10962 gene locus_tag LOCUS_02040 11711 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 12409 11780 gene locus_tag LOCUS_02050 12409 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 12664 13236 gene locus_tag LOCUS_02060 12664 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 13330 13938 gene locus_tag LOCUS_02070 13330 13938 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_02070 14024 14206 gene locus_tag LOCUS_02080 14024 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 14772 14122 gene locus_tag LOCUS_02090 14772 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 14911 14717 gene locus_tag LOCUS_02100 14911 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 15665 14904 gene locus_tag LOCUS_02110 15665 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 16075 16857 gene locus_tag LOCUS_02120 16075 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 17354 18523 gene locus_tag LOCUS_02130 17354 18523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 18616 19107 gene locus_tag LOCUS_02140 18616 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 19109 19528 gene locus_tag LOCUS_02150 19109 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 20156 21661 gene locus_tag LOCUS_02160 gene guaB 20156 21661 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_02160 21658 23091 gene locus_tag LOCUS_02170 21658 23091 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_02170 23120 23458 gene locus_tag LOCUS_02180 23120 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 23452 23700 gene locus_tag LOCUS_02190 23452 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 23826 24764 gene locus_tag LOCUS_02200 23826 24764 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_02200 25783 24956 gene locus_tag LOCUS_02210 25783 24956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 25967 26464 gene locus_tag LOCUS_02220 25967 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 26494 26904 gene locus_tag LOCUS_02230 26494 26904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 26991 28379 gene locus_tag LOCUS_02240 26991 28379 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 protein_id gnl|my_center|LOCUS_02240 28876 28454 gene locus_tag LOCUS_02250 28876 28454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 29918 29034 gene locus_tag LOCUS_02260 29918 29034 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_02260 30288 30124 gene locus_tag LOCUS_02270 30288 30124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 30227 32053 gene locus_tag LOCUS_02280 30227 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence06 <1 837 gene locus_tag LOCUS_02290 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319540.1:carbohydrate kinase family protein 834 1601 gene locus_tag LOCUS_02300 gene fba1 834 1601 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_02300 1598 2236 gene locus_tag LOCUS_02310 gene tpiA 1598 2236 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_02310 2229 3044 gene locus_tag LOCUS_02320 2229 3044 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166738.1 protein_id gnl|my_center|LOCUS_02320 3127 3588 gene locus_tag LOCUS_02330 3127 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3741 3577 gene locus_tag LOCUS_02340 3741 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4165 3845 gene locus_tag LOCUS_02350 gene grxD 4165 3845 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_02350 4412 4155 gene locus_tag LOCUS_02360 4412 4155 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125238.1 protein_id gnl|my_center|LOCUS_02360 6210 4459 gene locus_tag LOCUS_02370 6210 4459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444166.1 protein_id gnl|my_center|LOCUS_02370 8035 6320 gene locus_tag LOCUS_02380 8035 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8165 8551 gene locus_tag LOCUS_02390 8165 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 9058 8645 gene locus_tag LOCUS_02400 9058 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 9230 10558 gene locus_tag LOCUS_02410 9230 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11687 10566 gene locus_tag LOCUS_02420 11687 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12104 11772 gene locus_tag LOCUS_02430 12104 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13217 12147 gene locus_tag LOCUS_02440 gene dnaJ 13217 12147 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964595.1 protein_id gnl|my_center|LOCUS_02440 15152 13248 gene locus_tag LOCUS_02450 gene dnaK 15152 13248 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_02450 15618 15145 gene locus_tag LOCUS_02460 15618 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 16076 15693 gene locus_tag LOCUS_02470 16076 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 16172 17989 gene locus_tag LOCUS_02480 16172 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 18234 18735 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttagctaaagaaagaggatttg 19474 19013 gene locus_tag LOCUS_02490 19474 19013 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225779.1 protein_id gnl|my_center|LOCUS_02490 19602 20120 gene locus_tag LOCUS_02500 19602 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 20117 20530 gene locus_tag LOCUS_02510 20117 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 20532 21236 gene locus_tag LOCUS_02520 20532 21236 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868125.1 protein_id gnl|my_center|LOCUS_02520 22267 21269 gene locus_tag LOCUS_02530 22267 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 22346 22780 gene locus_tag LOCUS_02540 22346 22780 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_02540 22877 23374 gene locus_tag LOCUS_02550 22877 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 23426 23815 gene locus_tag LOCUS_02560 23426 23815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 25493 23856 gene locus_tag LOCUS_02570 25493 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 25867 25580 gene locus_tag LOCUS_02580 25867 25580 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_02580 26301 25909 gene locus_tag LOCUS_02590 26301 25909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 26537 26382 gene locus_tag LOCUS_02600 26537 26382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 27477 26629 gene locus_tag LOCUS_02610 27477 26629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 28957 27788 gene locus_tag LOCUS_02620 28957 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence07 1182 604 gene locus_tag LOCUS_02630 gene trmY 1182 604 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256106.1 protein_id gnl|my_center|LOCUS_02630 2090 1218 gene locus_tag LOCUS_02640 2090 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3494 2124 gene locus_tag LOCUS_02650 gene cysS 3494 2124 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_02650 4405 3491 gene locus_tag LOCUS_02660 4405 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5015 4449 gene locus_tag LOCUS_02670 5015 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5200 5127 gene locus_tag LOCUS_t00100 5200 5127 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5574 5266 gene locus_tag LOCUS_02680 5574 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6715 5990 gene locus_tag LOCUS_02690 6715 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6918 7847 gene locus_tag LOCUS_02700 6918 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 8135 7854 gene locus_tag LOCUS_02710 8135 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8629 8273 gene locus_tag LOCUS_02720 8629 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 8795 9208 gene locus_tag LOCUS_02730 8795 9208 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_02730 9511 9236 gene locus_tag LOCUS_02740 9511 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 9779 10114 gene locus_tag LOCUS_02750 9779 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 10118 10321 gene locus_tag LOCUS_02760 10118 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11016 10378 gene locus_tag LOCUS_02770 11016 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 12195 11248 gene locus_tag LOCUS_02780 12195 11248 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546027.1 protein_id gnl|my_center|LOCUS_02780 16176 12448 gene locus_tag LOCUS_r00020 16176 12448 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 16686 16414 gene locus_tag LOCUS_02790 16686 16414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 16914 16842 gene locus_tag LOCUS_t00110 16914 16842 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18660 17259 gene locus_tag LOCUS_r00030 18660 17259 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 19243 19046 gene locus_tag LOCUS_02800 19243 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 20018 19458 gene locus_tag LOCUS_02810 20018 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 20093 20269 gene locus_tag LOCUS_02820 20093 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 20269 20526 gene locus_tag LOCUS_02830 20269 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 20523 21110 gene locus_tag LOCUS_02840 20523 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 22115 21147 gene locus_tag LOCUS_02850 22115 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22773 22237 gene locus_tag LOCUS_02860 22773 22237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 22804 22965 gene locus_tag LOCUS_02870 22804 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 23390 23019 gene locus_tag LOCUS_02880 23390 23019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 24233 23502 gene locus_tag LOCUS_02890 24233 23502 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476584.1 protein_id gnl|my_center|LOCUS_02890 25441 24233 gene locus_tag LOCUS_02900 gene eno 25441 24233 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_02900 25877 25473 gene locus_tag LOCUS_02910 25877 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 26707 25880 gene locus_tag LOCUS_02920 gene rrp42 26707 25880 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_02920 27425 26697 gene locus_tag LOCUS_02930 gene rrp41 27425 26697 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence08 159 320 gene locus_tag LOCUS_02940 159 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 358 1137 gene locus_tag LOCUS_02950 358 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2207 1143 gene locus_tag LOCUS_02960 gene msrB 2207 1143 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_02960 2346 2909 gene locus_tag LOCUS_02970 2346 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2906 3541 gene locus_tag LOCUS_02980 2906 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3566 4042 gene locus_tag LOCUS_02990 3566 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5329 4043 gene locus_tag LOCUS_03000 5329 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 7183 5360 gene locus_tag LOCUS_03010 7183 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 8848 7223 gene locus_tag LOCUS_03020 8848 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 8962 9684 gene locus_tag LOCUS_03030 gene pcn 8962 9684 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_03030 9770 9973 gene locus_tag LOCUS_03040 9770 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9958 10761 gene locus_tag LOCUS_03050 9958 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10780 14016 gene locus_tag LOCUS_03060 10780 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 14013 14768 gene locus_tag LOCUS_03070 14013 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 14780 18508 gene locus_tag LOCUS_03080 14780 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 18546 19313 gene locus_tag LOCUS_03090 18546 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 19306 23586 gene locus_tag LOCUS_03100 19306 23586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 23634 24131 gene locus_tag LOCUS_03110 23634 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 24128 25081 gene locus_tag LOCUS_03120 24128 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 25072 25656 gene locus_tag LOCUS_03130 25072 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 25646 26155 gene locus_tag LOCUS_03140 25646 26155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence09 1298 402 gene locus_tag LOCUS_03150 gene htpX 1298 402 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989629.1 protein_id gnl|my_center|LOCUS_03150 1667 1335 gene locus_tag LOCUS_03160 1667 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2436 1873 gene locus_tag LOCUS_03170 2436 1873 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_03170 2478 2687 gene locus_tag LOCUS_03180 2478 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2737 3111 gene locus_tag LOCUS_03190 2737 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3038 3424 gene locus_tag LOCUS_03200 3038 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3417 4718 gene locus_tag LOCUS_03210 gene nifS 3417 4718 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_03210 4715 6358 gene locus_tag LOCUS_03220 4715 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6679 6464 gene locus_tag LOCUS_03230 6679 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7081 6782 gene locus_tag LOCUS_03240 7081 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8001 7087 gene locus_tag LOCUS_03250 gene pyrB 8001 7087 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_03250 9499 8318 gene locus_tag LOCUS_03260 9499 8318 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_03260 10455 9523 gene locus_tag LOCUS_03270 10455 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10714 11163 gene locus_tag LOCUS_03280 10714 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 11160 11918 gene locus_tag LOCUS_03290 11160 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12313 11927 gene locus_tag LOCUS_03300 12313 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 12710 12420 gene locus_tag LOCUS_03310 12710 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13555 12749 gene locus_tag LOCUS_03320 13555 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 14660 13770 gene locus_tag LOCUS_03330 14660 13770 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065652.1 protein_id gnl|my_center|LOCUS_03330 14752 15006 gene locus_tag LOCUS_03340 14752 15006 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546808.1 protein_id gnl|my_center|LOCUS_03340 15063 15599 gene locus_tag LOCUS_03350 15063 15599 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_03350 15601 16266 gene locus_tag LOCUS_03360 15601 16266 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_03360 16648 16385 gene locus_tag LOCUS_03370 16648 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226987603.1 protein_id gnl|my_center|LOCUS_03370 16884 16648 gene locus_tag LOCUS_03380 16884 16648 CDS product DUF2683 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496745.1 protein_id gnl|my_center|LOCUS_03380 17460 17720 gene locus_tag LOCUS_03390 17460 17720 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_03390 17710 18540 gene locus_tag LOCUS_03400 17710 18540 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546387.1 protein_id gnl|my_center|LOCUS_03400 18542 19066 gene locus_tag LOCUS_03410 18542 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 19063 19926 gene locus_tag LOCUS_03420 19063 19926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 20483 20046 gene locus_tag LOCUS_03430 20483 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 21819 20560 gene locus_tag LOCUS_03440 21819 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 22458 21937 gene locus_tag LOCUS_03450 22458 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 23450 22656 gene locus_tag LOCUS_03460 23450 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 24193 24023 gene locus_tag LOCUS_03470 24193 24023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 24373 25530 gene locus_tag LOCUS_03480 24373 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence10 1245 223 gene locus_tag LOCUS_03490 1245 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1689 1291 gene locus_tag LOCUS_03500 1689 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3073 1742 gene locus_tag LOCUS_03510 gene gatA 3073 1742 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870673.1 protein_id gnl|my_center|LOCUS_03510 3333 3070 gene locus_tag LOCUS_03520 3333 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3405 3752 gene locus_tag LOCUS_03530 3405 3752 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_03530 5125 3848 gene locus_tag LOCUS_03540 gene aspS 5125 3848 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_03540 5196 7694 gene locus_tag LOCUS_03550 5196 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 7730 7960 gene locus_tag LOCUS_03560 7730 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7970 8152 gene locus_tag LOCUS_03570 7970 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 9578 8145 gene locus_tag LOCUS_03580 9578 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 9648 9920 gene locus_tag LOCUS_03590 9648 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 11822 9963 gene locus_tag LOCUS_03600 11822 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 11988 12344 gene locus_tag LOCUS_03610 11988 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12568 12638 gene locus_tag LOCUS_t00120 12568 12638 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12734 13648 gene locus_tag LOCUS_03620 12734 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 13669 14463 gene locus_tag LOCUS_03630 13669 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 14563 16050 gene locus_tag LOCUS_03640 14563 16050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 17325 16060 gene locus_tag LOCUS_03650 gene gatD 17325 16060 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_03650 17484 18803 gene locus_tag LOCUS_03660 gene gatB 17484 18803 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496410.1 protein_id gnl|my_center|LOCUS_03660 18902 19144 gene locus_tag LOCUS_03670 18902 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 20297 19173 gene locus_tag LOCUS_03680 20297 19173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 20408 20481 gene locus_tag LOCUS_t00130 20408 20481 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20740 22191 gene locus_tag LOCUS_03690 gene proS 20740 22191 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_03690 22250 22525 gene locus_tag LOCUS_03700 22250 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 22722 23375 gene locus_tag LOCUS_03710 22722 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 23428 24072 gene locus_tag LOCUS_03720 23428 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 24363 24548 gene locus_tag LOCUS_03730 24363 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 24562 24687 gene locus_tag LOCUS_03740 24562 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence11 1016 1897 gene locus_tag LOCUS_03750 1016 1897 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023329.1 protein_id gnl|my_center|LOCUS_03750 2190 2023 gene locus_tag LOCUS_03760 2190 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2749 2405 gene locus_tag LOCUS_03770 2749 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 3731 2790 gene locus_tag LOCUS_03780 gene trxB 3731 2790 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272320.1 protein_id gnl|my_center|LOCUS_03780 3895 5772 gene locus_tag LOCUS_03790 3895 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6591 6115 gene locus_tag LOCUS_03800 6591 6115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_03800 7843 6623 gene locus_tag LOCUS_03810 gene truD 7843 6623 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_03810 9331 7970 gene locus_tag LOCUS_03820 9331 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 9887 9390 gene locus_tag LOCUS_03830 9887 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10237 11826 gene locus_tag LOCUS_03840 gene thsB 10237 11826 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_03840 11925 11997 gene locus_tag LOCUS_t00140 11925 11997 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12133 12321 gene locus_tag LOCUS_03850 12133 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 12296 12565 gene locus_tag LOCUS_03860 12296 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12618 13217 gene locus_tag LOCUS_03870 12618 13217 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_03870 13233 13811 gene locus_tag LOCUS_03880 13233 13811 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114232.1 protein_id gnl|my_center|LOCUS_03880 13818 14936 gene locus_tag LOCUS_03890 gene cfa 13818 14936 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_03890 15669 14944 gene locus_tag LOCUS_03900 15669 14944 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_03900 16173 15721 gene locus_tag LOCUS_03910 16173 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 16544 17743 gene locus_tag LOCUS_03920 16544 17743 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_03920 17745 19067 gene locus_tag LOCUS_03930 17745 19067 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_03930 19057 19365 gene locus_tag LOCUS_03940 19057 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 19368 20144 gene locus_tag LOCUS_03950 19368 20144 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_03950 20131 20469 gene locus_tag LOCUS_03960 20131 20469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 20551 22509 gene locus_tag LOCUS_03970 20551 22509 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_03970 22573 23388 gene locus_tag LOCUS_03980 22573 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 23449 24444 gene locus_tag LOCUS_03990 gene gap 23449 24444 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence12 <1 1434 gene locus_tag LOCUS_04000 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876179.1:SMC family ATPase 1490 1798 gene locus_tag LOCUS_04010 1490 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1848 2102 gene locus_tag LOCUS_04020 1848 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2393 2103 gene locus_tag LOCUS_04030 2393 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2473 2997 gene locus_tag LOCUS_04040 2473 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2994 3734 gene locus_tag LOCUS_04050 gene radB 2994 3734 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869752.1 protein_id gnl|my_center|LOCUS_04050 3783 4769 gene locus_tag LOCUS_04060 gene dph2 3783 4769 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_04060 4822 5334 gene locus_tag LOCUS_04070 4822 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5851 5363 gene locus_tag LOCUS_04080 gene bcp 5851 5363 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_04080 8105 5895 gene locus_tag LOCUS_04090 gene topA 8105 5895 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496891.1 protein_id gnl|my_center|LOCUS_04090 9116 8184 gene locus_tag LOCUS_04100 9116 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 11527 9107 gene locus_tag LOCUS_04110 11527 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 12051 11518 gene locus_tag LOCUS_04120 12051 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12442 12044 gene locus_tag LOCUS_04130 12442 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 12852 12439 gene locus_tag LOCUS_04140 12852 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 13097 13726 gene locus_tag LOCUS_04150 13097 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 13730 15370 gene locus_tag LOCUS_04160 13730 15370 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_04160 15371 16255 gene locus_tag LOCUS_04170 15371 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 16252 17169 gene locus_tag LOCUS_04180 16252 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 17216 17929 gene locus_tag LOCUS_04190 17216 17929 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083183.1 protein_id gnl|my_center|LOCUS_04190 18446 18003 gene locus_tag LOCUS_04200 18446 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 19116 18526 gene locus_tag LOCUS_04210 19116 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19115 21574 gene locus_tag LOCUS_04220 gene valS 19115 21574 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870520.1 protein_id gnl|my_center|LOCUS_04220 21576 22451 gene locus_tag LOCUS_04230 21576 22451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence13 529 332 gene locus_tag LOCUS_04240 529 332 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_04240 2327 582 gene locus_tag LOCUS_04250 2327 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2457 3194 gene locus_tag LOCUS_04260 2457 3194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210674.1 protein_id gnl|my_center|LOCUS_04260 3198 4412 gene locus_tag LOCUS_04270 3198 4412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_04270 4413 5624 gene locus_tag LOCUS_04280 4413 5624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023110.1 protein_id gnl|my_center|LOCUS_04280 6545 5679 gene locus_tag LOCUS_04290 6545 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6639 6992 gene locus_tag LOCUS_04300 6639 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7026 7406 gene locus_tag LOCUS_04310 7026 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7410 7712 gene locus_tag LOCUS_04320 7410 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 7715 8251 gene locus_tag LOCUS_04330 7715 8251 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_04330 8253 8732 gene locus_tag LOCUS_04340 8253 8732 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_04340 8734 9291 gene locus_tag LOCUS_04350 8734 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9291 9677 gene locus_tag LOCUS_04360 9291 9677 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875677.1 protein_id gnl|my_center|LOCUS_04360 9706 10422 gene locus_tag LOCUS_04370 9706 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 10580 10664 gene locus_tag LOCUS_t00150 10580 10664 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10672 11115 gene locus_tag LOCUS_04380 10672 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11093 11530 gene locus_tag LOCUS_04390 gene rplM 11093 11530 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_04390 11527 11928 gene locus_tag LOCUS_04400 11527 11928 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_04400 11989 12306 gene locus_tag LOCUS_04410 11989 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 12836 12303 gene locus_tag LOCUS_04420 12836 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 12974 13204 gene locus_tag LOCUS_04430 12974 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14057 13230 gene locus_tag LOCUS_04440 14057 13230 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_04440 14286 14546 gene locus_tag LOCUS_04450 14286 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 15511 15041 gene locus_tag LOCUS_04460 15511 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15927 15646 gene locus_tag LOCUS_04470 15927 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 16080 16301 gene locus_tag LOCUS_04480 16080 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 16528 16334 gene locus_tag LOCUS_04490 16528 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16561 16875 gene locus_tag LOCUS_04500 16561 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 17175 17783 gene locus_tag LOCUS_04510 17175 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 18540 18055 gene locus_tag LOCUS_04520 18540 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 19228 18575 gene locus_tag LOCUS_04530 19228 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 19595 19326 gene locus_tag LOCUS_04540 19595 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19674 21737 gene locus_tag LOCUS_04550 19674 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 21823 21743 gene locus_tag LOCUS_t00160 21823 21743 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22372 21968 gene locus_tag LOCUS_04560 22372 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence14 <1 906 gene locus_tag LOCUS_04570 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272458.1:calcium-transporting P-type ATPase, PMR1-type 1059 1298 gene locus_tag LOCUS_04580 1059 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1338 2531 gene locus_tag LOCUS_04590 1338 2531 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_04590 4206 2506 gene locus_tag LOCUS_04600 4206 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4803 4261 gene locus_tag LOCUS_04610 4803 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5746 4829 gene locus_tag LOCUS_04620 5746 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 11448 5779 gene locus_tag LOCUS_04630 11448 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11616 12353 gene locus_tag LOCUS_04640 11616 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13038 12355 gene locus_tag LOCUS_04650 13038 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 14593 13040 gene locus_tag LOCUS_04660 14593 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04660 14654 15415 gene locus_tag LOCUS_04670 14654 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 16030 15398 gene locus_tag LOCUS_04680 16030 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 16161 16451 gene locus_tag LOCUS_04690 16161 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 16673 17164 gene locus_tag LOCUS_04700 16673 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17215 17751 gene locus_tag LOCUS_04710 17215 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17751 18236 gene locus_tag LOCUS_04720 17751 18236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 19085 18336 gene locus_tag LOCUS_04730 19085 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 19496 19092 gene locus_tag LOCUS_04740 19496 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence15 340 630 gene locus_tag LOCUS_04750 340 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 633 917 gene locus_tag LOCUS_04760 633 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2086 923 gene locus_tag LOCUS_04770 gene hisS 2086 923 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657568.1 protein_id gnl|my_center|LOCUS_04770 2380 2309 gene locus_tag LOCUS_t00170 2380 2309 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3426 2512 gene locus_tag LOCUS_04780 3426 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3874 3554 gene locus_tag LOCUS_04790 3874 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4466 3948 gene locus_tag LOCUS_04800 4466 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4719 5057 gene locus_tag LOCUS_04810 4719 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5135 5479 gene locus_tag LOCUS_04820 5135 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6390 5476 gene locus_tag LOCUS_04830 gene gnd 6390 5476 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_04830 7157 6390 gene locus_tag LOCUS_04840 7157 6390 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 protein_id gnl|my_center|LOCUS_04840 7252 9066 gene locus_tag LOCUS_04850 7252 9066 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_04850 9736 9068 gene locus_tag LOCUS_04860 9736 9068 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215682.1 protein_id gnl|my_center|LOCUS_04860 10566 9736 gene locus_tag LOCUS_04870 gene fsa 10566 9736 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_04870 10793 10563 gene locus_tag LOCUS_04880 10793 10563 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_04880 11441 10794 gene locus_tag LOCUS_04890 gene rpe 11441 10794 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476597.1 protein_id gnl|my_center|LOCUS_04890 11884 11438 gene locus_tag LOCUS_04900 11884 11438 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_04900 12807 11881 gene locus_tag LOCUS_04910 12807 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 13708 12878 gene locus_tag LOCUS_04920 13708 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 13767 14252 gene locus_tag LOCUS_04930 13767 14252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence16 108 704 gene locus_tag LOCUS_04940 108 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 704 1933 gene locus_tag LOCUS_04950 gene icaA 704 1933 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 protein_id gnl|my_center|LOCUS_04950 1935 2594 gene locus_tag LOCUS_04960 1935 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2734 3534 gene locus_tag LOCUS_04970 2734 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4320 3547 gene locus_tag LOCUS_04980 4320 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 6410 4356 gene locus_tag LOCUS_04990 6410 4356 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_04990 7300 6452 gene locus_tag LOCUS_05000 7300 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 7888 7325 gene locus_tag LOCUS_05010 7888 7325 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_05010 8832 7921 gene locus_tag LOCUS_05020 8832 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9047 8832 gene locus_tag LOCUS_05030 9047 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9636 9037 gene locus_tag LOCUS_05040 9636 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 10369 9773 gene locus_tag LOCUS_05050 10369 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10889 10500 gene locus_tag LOCUS_05060 10889 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 11156 10911 gene locus_tag LOCUS_05070 11156 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 11669 11286 gene locus_tag LOCUS_05080 11669 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 12015 11692 gene locus_tag LOCUS_05090 12015 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 12641 12027 gene locus_tag LOCUS_05100 12641 12027 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_05100 14399 12708 gene locus_tag LOCUS_05110 14399 12708 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_05110 14489 14806 gene locus_tag LOCUS_05120 14489 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15122 14817 gene locus_tag LOCUS_05130 15122 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 15898 15332 gene locus_tag LOCUS_05140 15898 15332 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_05140 16894 16007 gene locus_tag LOCUS_05150 16894 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 17171 17755 gene locus_tag LOCUS_05160 17171 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 18031 17958 gene locus_tag LOCUS_t00180 18031 17958 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 18361 18080 gene locus_tag LOCUS_05170 18361 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 19006 18395 gene locus_tag LOCUS_05180 19006 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence17 960 625 gene locus_tag LOCUS_05190 960 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1092 1685 gene locus_tag LOCUS_05200 1092 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1669 2202 gene locus_tag LOCUS_05210 1669 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2243 2707 gene locus_tag LOCUS_05220 2243 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2800 3414 gene locus_tag LOCUS_05230 2800 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3550 4080 gene locus_tag LOCUS_05240 3550 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 4260 5816 gene locus_tag LOCUS_05250 4260 5816 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_05250 5937 6107 gene locus_tag LOCUS_05260 5937 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6100 7410 gene locus_tag LOCUS_05270 6100 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7496 8338 gene locus_tag LOCUS_05280 7496 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 8397 9134 gene locus_tag LOCUS_05290 8397 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 9417 9824 gene locus_tag LOCUS_05300 9417 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9879 11189 gene locus_tag LOCUS_05310 9879 11189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_05310 11224 11532 gene locus_tag LOCUS_05320 11224 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 11594 12193 gene locus_tag LOCUS_05330 11594 12193 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831217.1 protein_id gnl|my_center|LOCUS_05330 12983 12195 gene locus_tag LOCUS_05340 12983 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13148 13348 gene locus_tag LOCUS_05350 13148 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 13366 13980 gene locus_tag LOCUS_05360 13366 13980 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_05360 14024 14431 gene locus_tag LOCUS_05370 14024 14431 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_05370 14510 15982 gene locus_tag LOCUS_05380 14510 15982 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_05380 16083 17501 gene locus_tag LOCUS_05390 16083 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18239 17529 gene locus_tag LOCUS_05400 18239 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19089 18274 gene locus_tag LOCUS_05410 19089 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence18 1668 121 gene locus_tag LOCUS_05420 1668 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1902 1822 gene locus_tag LOCUS_t00190 1902 1822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2093 2845 gene locus_tag LOCUS_05430 2093 2845 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_05430 2946 3323 gene locus_tag LOCUS_05440 2946 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4068 3328 gene locus_tag LOCUS_05450 4068 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4181 4846 gene locus_tag LOCUS_05460 4181 4846 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_05460 4833 5462 gene locus_tag LOCUS_05470 4833 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5464 6183 gene locus_tag LOCUS_05480 5464 6183 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_05480 6273 6857 gene locus_tag LOCUS_05490 6273 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6864 8810 gene locus_tag LOCUS_05500 gene acs 6864 8810 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_05500 8895 10418 gene locus_tag LOCUS_05510 8895 10418 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_05510 10418 11335 gene locus_tag LOCUS_05520 10418 11335 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_05520 11920 11342 gene locus_tag LOCUS_05530 11920 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 12717 11917 gene locus_tag LOCUS_05540 12717 11917 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895851.1 protein_id gnl|my_center|LOCUS_05540 13000 13725 gene locus_tag LOCUS_05550 gene dph5 13000 13725 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_05550 14010 13747 gene locus_tag LOCUS_05560 14010 13747 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883007.1 protein_id gnl|my_center|LOCUS_05560 14108 16942 gene locus_tag LOCUS_05570 gene ileS 14108 16942 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_05570 17029 17835 gene locus_tag LOCUS_05580 gene trmBL2 17029 17835 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_05580 <19213 17860 gene locus_tag LOCUS_05590 <19213 17860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964359.1:arginine--tRNA ligase >Feature sequence19 188 331 gene locus_tag LOCUS_05600 188 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 773 1171 gene locus_tag LOCUS_05610 773 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1774 1172 gene locus_tag LOCUS_05620 1774 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1856 2116 gene locus_tag LOCUS_05630 1856 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2281 2742 gene locus_tag LOCUS_05640 2281 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2872 4707 gene locus_tag LOCUS_05650 2872 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5244 4735 gene locus_tag LOCUS_05660 5244 4735 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640350.1 protein_id gnl|my_center|LOCUS_05660 5738 5244 gene locus_tag LOCUS_05670 5738 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6187 5735 gene locus_tag LOCUS_05680 6187 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6511 7149 gene locus_tag LOCUS_05690 6511 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7267 7347 gene locus_tag LOCUS_t00200 7267 7347 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7410 7586 gene locus_tag LOCUS_05700 7410 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7715 8152 gene locus_tag LOCUS_05710 7715 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 8815 8498 gene locus_tag LOCUS_05720 8815 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9719 8808 gene locus_tag LOCUS_05730 9719 8808 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773450.1 protein_id gnl|my_center|LOCUS_05730 10123 9770 gene locus_tag LOCUS_05740 10123 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10387 10307 gene locus_tag LOCUS_t00210 10387 10307 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11127 10630 gene locus_tag LOCUS_05750 11127 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 11572 11231 gene locus_tag LOCUS_05760 gene rpsJ 11572 11231 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_05760 11714 12409 gene locus_tag LOCUS_05770 11714 12409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12411 12923 gene locus_tag LOCUS_05780 12411 12923 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036317.1 protein_id gnl|my_center|LOCUS_05780 13964 12924 gene locus_tag LOCUS_05790 13964 12924 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_05790 14700 14113 gene locus_tag LOCUS_05800 14700 14113 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844776.1 protein_id gnl|my_center|LOCUS_05800 15254 14703 gene locus_tag LOCUS_05810 15254 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 15362 15640 gene locus_tag LOCUS_05820 15362 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15700 15978 gene locus_tag LOCUS_05830 15700 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 15994 16212 gene locus_tag LOCUS_05840 15994 16212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16322 17017 gene locus_tag LOCUS_05850 16322 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17069 17142 gene locus_tag LOCUS_t00220 17069 17142 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17236 18207 gene locus_tag LOCUS_05860 17236 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18208 18399 gene locus_tag LOCUS_05870 18208 18399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence20 937 80 gene locus_tag LOCUS_05880 937 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1094 900 gene locus_tag LOCUS_05890 1094 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3355 1325 gene locus_tag LOCUS_05900 3355 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4506 3391 gene locus_tag LOCUS_05910 4506 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4716 4567 gene locus_tag LOCUS_05920 4716 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9887 4701 gene locus_tag LOCUS_05930 9887 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11222 9957 gene locus_tag LOCUS_05940 11222 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 12605 11277 gene locus_tag LOCUS_05950 12605 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13408 12800 gene locus_tag LOCUS_05960 13408 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 13604 13395 gene locus_tag LOCUS_05970 13604 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 14852 13638 gene locus_tag LOCUS_05980 14852 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 15333 14845 gene locus_tag LOCUS_05990 15333 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16963 15326 gene locus_tag LOCUS_06000 16963 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 17077 17721 gene locus_tag LOCUS_06010 17077 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence21 380 1597 gene locus_tag LOCUS_06020 380 1597 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_06020 1683 3278 gene locus_tag LOCUS_06030 1683 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3275 6763 gene locus_tag LOCUS_06040 gene polC 3275 6763 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_06040 7298 6972 gene locus_tag LOCUS_06050 7298 6972 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_06050 7458 7288 gene locus_tag LOCUS_06060 7458 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8687 7497 gene locus_tag LOCUS_06070 8687 7497 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_06070 9468 8728 gene locus_tag LOCUS_06080 9468 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10010 9465 gene locus_tag LOCUS_06090 10010 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10678 10007 gene locus_tag LOCUS_06100 10678 10007 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870074.1 protein_id gnl|my_center|LOCUS_06100 10973 10713 gene locus_tag LOCUS_06110 10973 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11007 11921 gene locus_tag LOCUS_06120 11007 11921 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_06120 11918 12202 gene locus_tag LOCUS_06130 11918 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12785 12171 gene locus_tag LOCUS_06140 12785 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 15089 12786 gene locus_tag LOCUS_06150 15089 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 15811 15086 gene locus_tag LOCUS_06160 15811 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16063 17877 gene locus_tag LOCUS_06170 16063 17877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence22 433 83 gene locus_tag LOCUS_06180 433 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1220 435 gene locus_tag LOCUS_06190 1220 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1396 1806 gene locus_tag LOCUS_06200 1396 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2913 1957 gene locus_tag LOCUS_06210 2913 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4973 3084 gene locus_tag LOCUS_06220 4973 3084 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_06220 5646 4984 gene locus_tag LOCUS_06230 gene psmB 5646 4984 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_06230 5724 6179 gene locus_tag LOCUS_06240 5724 6179 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064560.1 protein_id gnl|my_center|LOCUS_06240 6226 6414 gene locus_tag LOCUS_06250 6226 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7004 6492 gene locus_tag LOCUS_06260 7004 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7033 7212 gene locus_tag LOCUS_06270 7033 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 7383 7691 gene locus_tag LOCUS_06280 7383 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7716 8081 gene locus_tag LOCUS_06290 gene eif1A 7716 8081 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_06290 8294 9238 gene locus_tag LOCUS_06300 8294 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 9273 9824 gene locus_tag LOCUS_06310 9273 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9886 9958 gene locus_tag LOCUS_t00230 9886 9958 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9926 10309 gene locus_tag LOCUS_06320 9926 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10354 10617 gene locus_tag LOCUS_06330 10354 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10619 10867 gene locus_tag LOCUS_06340 10619 10867 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020433.1 protein_id gnl|my_center|LOCUS_06340 11076 10897 gene locus_tag LOCUS_06350 11076 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11184 12311 gene locus_tag LOCUS_06360 gene mnmA 11184 12311 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644602.1 protein_id gnl|my_center|LOCUS_06360 12539 13714 gene locus_tag LOCUS_06370 12539 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 13711 14343 gene locus_tag LOCUS_06380 13711 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 14431 14676 gene locus_tag LOCUS_06390 14431 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 15244 14654 gene locus_tag LOCUS_06400 15244 14654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 15277 15846 gene locus_tag LOCUS_06410 15277 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 16123 16728 gene locus_tag LOCUS_06420 16123 16728 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729926.1 protein_id gnl|my_center|LOCUS_06420 <17781 16850 gene locus_tag LOCUS_06430 <17781 16850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023772.1:cell division protein FtsZ >Feature sequence23 1080 1154 gene locus_tag LOCUS_t00240 1080 1154 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1374 4169 gene locus_tag LOCUS_06440 gene uvrA 1374 4169 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_06440 4460 4161 gene locus_tag LOCUS_06450 4460 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4754 4491 gene locus_tag LOCUS_06460 4754 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4841 6409 gene locus_tag LOCUS_06470 gene uvrC 4841 6409 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_06470 6449 8401 gene locus_tag LOCUS_06480 gene uvrB 6449 8401 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_06480 8445 9938 gene locus_tag LOCUS_06490 8445 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9971 10498 gene locus_tag LOCUS_06500 9971 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 12664 10508 gene locus_tag LOCUS_06510 12664 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 13629 12685 gene locus_tag LOCUS_06520 13629 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 14257 13673 gene locus_tag LOCUS_06530 14257 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15252 14302 gene locus_tag LOCUS_06540 15252 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 16026 15292 gene locus_tag LOCUS_06550 16026 15292 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141595.1 protein_id gnl|my_center|LOCUS_06550 16652 16269 gene locus_tag LOCUS_06560 16652 16269 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_06560 17086 16655 gene locus_tag LOCUS_06570 17086 16655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence24 472 921 gene locus_tag LOCUS_06580 472 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 983 1894 gene locus_tag LOCUS_06590 gene map 983 1894 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_06590 4219 1895 gene locus_tag LOCUS_06600 4219 1895 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_06600 4673 4230 gene locus_tag LOCUS_06610 4673 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5132 4764 gene locus_tag LOCUS_06620 5132 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5488 6054 gene locus_tag LOCUS_06630 5488 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6090 6353 gene locus_tag LOCUS_06640 6090 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6464 6739 gene locus_tag LOCUS_06650 6464 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6806 6881 gene locus_tag LOCUS_t00250 6806 6881 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7074 8072 gene locus_tag LOCUS_06660 7074 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 8476 8108 gene locus_tag LOCUS_06670 8476 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8797 8531 gene locus_tag LOCUS_06680 8797 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9020 10303 gene locus_tag LOCUS_06690 gene serS 9020 10303 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_06690 10303 10956 gene locus_tag LOCUS_06700 10303 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 10998 11165 gene locus_tag LOCUS_06710 10998 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11162 11491 gene locus_tag LOCUS_06720 11162 11491 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902267.1 protein_id gnl|my_center|LOCUS_06720 11546 12097 gene locus_tag LOCUS_06730 11546 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 12137 12574 gene locus_tag LOCUS_06740 12137 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 12643 13083 gene locus_tag LOCUS_06750 12643 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 13170 13922 gene locus_tag LOCUS_06760 gene minD 13170 13922 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_06760 14279 13926 gene locus_tag LOCUS_06770 14279 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15655 14279 gene locus_tag LOCUS_06780 gene metG 15655 14279 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880800.1 protein_id gnl|my_center|LOCUS_06780 16108 15686 gene locus_tag LOCUS_06790 16108 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence25 874 89 gene locus_tag LOCUS_06800 874 89 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06800 1271 861 gene locus_tag LOCUS_06810 1271 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2399 1365 gene locus_tag LOCUS_06820 2399 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3442 2399 gene locus_tag LOCUS_06830 gene disA 3442 2399 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_06830 3694 4230 gene locus_tag LOCUS_06840 3694 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4227 5267 gene locus_tag LOCUS_06850 gene kae1 4227 5267 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868890.1 protein_id gnl|my_center|LOCUS_06850 5260 5868 gene locus_tag LOCUS_06860 5260 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5963 6259 gene locus_tag LOCUS_06870 5963 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6311 6607 gene locus_tag LOCUS_06880 6311 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6608 6877 gene locus_tag LOCUS_06890 6608 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6942 7874 gene locus_tag LOCUS_06900 6942 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 7983 9887 gene locus_tag LOCUS_06910 gene gyrB 7983 9887 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_06910 9958 10317 gene locus_tag LOCUS_06920 9958 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 10317 10640 gene locus_tag LOCUS_06930 10317 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 10637 13207 gene locus_tag LOCUS_06940 gene gyrA 10637 13207 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_06940 13872 13213 gene locus_tag LOCUS_06950 13872 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 15131 13923 gene locus_tag LOCUS_06960 15131 13923 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_06960 15808 15173 gene locus_tag LOCUS_06970 15808 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 16060 15860 gene locus_tag LOCUS_06980 16060 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence26 1234 74 gene locus_tag LOCUS_06990 1234 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1719 1276 gene locus_tag LOCUS_07000 1719 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2325 1738 gene locus_tag LOCUS_07010 2325 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2605 3729 gene locus_tag LOCUS_07020 2605 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3794 5287 gene locus_tag LOCUS_07030 3794 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5333 5647 gene locus_tag LOCUS_07040 5333 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5836 8544 gene locus_tag LOCUS_07050 5836 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 8541 9179 gene locus_tag LOCUS_07060 8541 9179 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_07060 9187 9663 gene locus_tag LOCUS_07070 9187 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9694 10854 gene locus_tag LOCUS_07080 9694 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10894 11706 gene locus_tag LOCUS_07090 gene murQ 10894 11706 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_07090 12304 11996 gene locus_tag LOCUS_07100 12304 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 12369 13064 gene locus_tag LOCUS_07110 12369 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 13323 13138 gene locus_tag LOCUS_07120 13323 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 13756 13421 gene locus_tag LOCUS_07130 13756 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14083 13757 gene locus_tag LOCUS_07140 14083 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 14286 14083 gene locus_tag LOCUS_07150 14286 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 14461 14279 gene locus_tag LOCUS_07160 14461 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 15386 14400 gene locus_tag LOCUS_07170 15386 14400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 15777 15388 gene locus_tag LOCUS_07180 15777 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence27 321 118 gene locus_tag LOCUS_07190 321 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 499 831 gene locus_tag LOCUS_07200 499 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1424 1774 gene locus_tag LOCUS_07210 1424 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2643 2107 gene locus_tag LOCUS_07220 2643 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2924 3268 gene locus_tag LOCUS_07230 2924 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3395 3916 gene locus_tag LOCUS_07240 3395 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4012 4257 gene locus_tag LOCUS_07250 4012 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4653 4297 gene locus_tag LOCUS_07260 4653 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4917 4714 gene locus_tag LOCUS_07270 4917 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4995 5222 gene locus_tag LOCUS_07280 4995 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5491 5237 gene locus_tag LOCUS_07290 5491 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 5590 5841 gene locus_tag LOCUS_07300 5590 5841 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_07300 7042 5843 gene locus_tag LOCUS_07310 7042 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7093 7710 gene locus_tag LOCUS_07320 7093 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 7759 9249 gene locus_tag LOCUS_07330 7759 9249 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_07330 9808 9236 gene locus_tag LOCUS_07340 9808 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 10858 9809 gene locus_tag LOCUS_07350 10858 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10978 11268 gene locus_tag LOCUS_07360 10978 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 11467 11745 gene locus_tag LOCUS_07370 11467 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12232 11747 gene locus_tag LOCUS_07380 12232 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 <15045 12237 gene locus_tag LOCUS_07390 <15045 12237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:TaqI-like C-terminal specificity domain-containing protein >Feature sequence28 1894 281 gene locus_tag LOCUS_07400 gene pyrG 1894 281 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_07400 1996 3378 gene locus_tag LOCUS_07410 gene pafA 1996 3378 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 protein_id gnl|my_center|LOCUS_07410 3533 14179 gene locus_tag LOCUS_07420 3533 14179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence29 403 558 gene locus_tag LOCUS_07430 403 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 872 555 gene locus_tag LOCUS_07440 872 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2294 1083 gene locus_tag LOCUS_07450 2294 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2412 2699 gene locus_tag LOCUS_07460 2412 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3183 2701 gene locus_tag LOCUS_07470 3183 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4506 3352 gene locus_tag LOCUS_07480 gene dnaG 4506 3352 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_07480 5420 5100 gene locus_tag LOCUS_07490 5420 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5987 5421 gene locus_tag LOCUS_07500 5987 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6259 6047 gene locus_tag LOCUS_07510 6259 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7772 6486 gene locus_tag LOCUS_07520 gene tuf 7772 6486 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_07520 8443 7871 gene locus_tag LOCUS_07530 8443 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9111 9476 gene locus_tag LOCUS_07540 9111 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12327 10168 gene locus_tag LOCUS_07550 12327 10168 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_07550 13085 12492 gene locus_tag LOCUS_07560 gene rpsG 13085 12492 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250028.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence30 2648 3007 gene locus_tag LOCUS_07570 2648 3007 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_07570 3126 4070 gene locus_tag LOCUS_07580 3126 4070 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_07580 4162 4854 gene locus_tag LOCUS_07590 4162 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4817 4901 gene locus_tag LOCUS_t00260 4817 4901 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11348 4959 gene locus_tag LOCUS_07600 11348 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 12763 11345 gene locus_tag LOCUS_07610 12763 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence31 363 43 gene locus_tag LOCUS_07620 363 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 730 398 gene locus_tag LOCUS_07630 730 398 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 protein_id gnl|my_center|LOCUS_07630 1056 724 gene locus_tag LOCUS_07640 1056 724 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 protein_id gnl|my_center|LOCUS_07640 1393 1160 gene locus_tag LOCUS_07650 1393 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1828 1397 gene locus_tag LOCUS_07660 1828 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2034 1843 gene locus_tag LOCUS_07670 2034 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2636 2034 gene locus_tag LOCUS_07680 gene rpoE 2636 2034 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_07680 3060 2674 gene locus_tag LOCUS_07690 3060 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3111 3671 gene locus_tag LOCUS_07700 3111 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3668 4342 gene locus_tag LOCUS_07710 3668 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4444 5520 gene locus_tag LOCUS_07720 4444 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5499 5570 gene locus_tag LOCUS_t00270 5499 5570 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6078 5578 gene locus_tag LOCUS_07730 6078 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6203 6763 gene locus_tag LOCUS_07740 6203 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6760 7518 gene locus_tag LOCUS_07750 6760 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7549 7830 gene locus_tag LOCUS_07760 7549 7830 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_07760 7867 8550 gene locus_tag LOCUS_07770 gene pyrH 7867 8550 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_07770 9289 8624 gene locus_tag LOCUS_07780 9289 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9995 9342 gene locus_tag LOCUS_07790 9995 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 10120 10338 gene locus_tag LOCUS_07800 10120 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020107.1 protein_id gnl|my_center|LOCUS_07800 10335 10577 gene locus_tag LOCUS_07810 10335 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10622 11188 gene locus_tag LOCUS_07820 10622 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11230 12651 gene locus_tag LOCUS_07830 11230 12651 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence32 <1 911 gene locus_tag LOCUS_07840 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878279.1:tyrosine--tRNA ligase 964 2604 gene locus_tag LOCUS_07850 964 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2579 3673 gene locus_tag LOCUS_07860 2579 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3844 4269 gene locus_tag LOCUS_07870 3844 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 4522 4271 gene locus_tag LOCUS_07880 4522 4271 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_07880 4758 4522 gene locus_tag LOCUS_07890 4758 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066280.1 protein_id gnl|my_center|LOCUS_07890 4850 5767 gene locus_tag LOCUS_07900 4850 5767 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_07900 5914 5759 gene locus_tag LOCUS_07910 5914 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6070 6276 gene locus_tag LOCUS_07920 6070 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6264 6602 gene locus_tag LOCUS_07930 6264 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7278 6634 gene locus_tag LOCUS_07940 7278 6634 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_07940 9376 7280 gene locus_tag LOCUS_07950 9376 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10062 9478 gene locus_tag LOCUS_07960 10062 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 10349 11455 gene locus_tag LOCUS_07970 10349 11455 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_07970 12200 11463 gene locus_tag LOCUS_07980 12200 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12251 12505 gene locus_tag LOCUS_07990 12251 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence33 527 363 gene locus_tag LOCUS_08000 527 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 610 960 gene locus_tag LOCUS_08010 610 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1355 963 gene locus_tag LOCUS_08020 gene msrB 1355 963 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_08020 1791 1339 gene locus_tag LOCUS_08030 gene msrA 1791 1339 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_08030 2200 1826 gene locus_tag LOCUS_08040 2200 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3958 2240 gene locus_tag LOCUS_08050 3958 2240 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_08050 4363 3989 gene locus_tag LOCUS_08060 4363 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4889 4398 gene locus_tag LOCUS_08070 4889 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5678 4950 gene locus_tag LOCUS_08080 5678 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6306 5809 gene locus_tag LOCUS_08090 6306 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6565 6356 gene locus_tag LOCUS_08100 6565 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6619 6792 gene locus_tag LOCUS_08110 6619 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7127 7041 gene locus_tag LOCUS_t00280 7127 7041 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7430 7353 gene locus_tag LOCUS_t00290 7430 7353 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7482 8138 gene locus_tag LOCUS_08120 gene rnhB 7482 8138 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_08120 8767 8135 gene locus_tag LOCUS_08130 8767 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 8883 11747 gene locus_tag LOCUS_08140 8883 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 11773 12471 gene locus_tag LOCUS_08150 11773 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence34 2090 345 gene locus_tag LOCUS_08160 2090 345 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_08160 2483 2115 gene locus_tag LOCUS_08170 2483 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3018 2488 gene locus_tag LOCUS_08180 3018 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3176 4024 gene locus_tag LOCUS_08190 3176 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4030 4692 gene locus_tag LOCUS_08200 4030 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4689 5273 gene locus_tag LOCUS_08210 4689 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 6385 5270 gene locus_tag LOCUS_08220 6385 5270 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_08220 6659 6474 gene locus_tag LOCUS_08230 6659 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6737 7000 gene locus_tag LOCUS_08240 6737 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 7033 7857 gene locus_tag LOCUS_08250 7033 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7898 8656 gene locus_tag LOCUS_08260 7898 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8783 9454 gene locus_tag LOCUS_08270 8783 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10063 9476 gene locus_tag LOCUS_08280 10063 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10172 10816 gene locus_tag LOCUS_08290 10172 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10886 11845 gene locus_tag LOCUS_08300 10886 11845 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence35 1443 766 gene locus_tag LOCUS_08310 1443 766 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250587.1 protein_id gnl|my_center|LOCUS_08310 1531 1833 gene locus_tag LOCUS_08320 1531 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1881 2246 gene locus_tag LOCUS_08330 1881 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2946 2263 gene locus_tag LOCUS_08340 gene psmA 2946 2263 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_08340 3071 4006 gene locus_tag LOCUS_08350 3071 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4246 4019 gene locus_tag LOCUS_08360 4246 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4477 4250 gene locus_tag LOCUS_08370 4477 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7269 4540 gene locus_tag LOCUS_08380 7269 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 7341 8672 gene locus_tag LOCUS_08390 7341 8672 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_08390 8558 9052 gene locus_tag LOCUS_08400 8558 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 9057 9599 gene locus_tag LOCUS_08410 9057 9599 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence36 61 318 gene locus_tag LOCUS_08420 61 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 639 364 gene locus_tag LOCUS_08430 639 364 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_08430 873 1817 gene locus_tag LOCUS_08440 873 1817 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146527.1 protein_id gnl|my_center|LOCUS_08440 1819 2292 gene locus_tag LOCUS_08450 1819 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2327 2743 gene locus_tag LOCUS_08460 2327 2743 CDS product Holliday junction resolvase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680619.1 protein_id gnl|my_center|LOCUS_08460 2806 3861 gene locus_tag LOCUS_08470 gene radA 2806 3861 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_08470 4245 4868 gene locus_tag LOCUS_08480 4245 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4861 5130 gene locus_tag LOCUS_08490 4861 5130 CDS product YafQ family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870686.1 protein_id gnl|my_center|LOCUS_08490 5375 6040 gene locus_tag LOCUS_08500 5375 6040 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963996.1 protein_id gnl|my_center|LOCUS_08500 6510 6055 gene locus_tag LOCUS_08510 6510 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6802 6512 gene locus_tag LOCUS_08520 6802 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7782 6844 gene locus_tag LOCUS_08530 7782 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7907 8230 gene locus_tag LOCUS_08540 7907 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 8351 9937 gene locus_tag LOCUS_08550 8351 9937 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463528.1 protein_id gnl|my_center|LOCUS_08550 9959 10405 gene locus_tag LOCUS_08560 9959 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence37 301 552 gene locus_tag LOCUS_08570 301 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 606 1958 gene locus_tag LOCUS_08580 606 1958 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_08580 2004 2174 gene locus_tag LOCUS_08590 2004 2174 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_08590 2212 2913 gene locus_tag LOCUS_08600 2212 2913 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_08600 3660 3052 gene locus_tag LOCUS_08610 gene udg 3660 3052 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_08610 8557 3701 gene locus_tag LOCUS_08620 8557 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9938 8808 gene locus_tag LOCUS_08630 9938 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence38 322 1230 gene locus_tag LOCUS_08640 322 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1520 1335 gene locus_tag LOCUS_08650 1520 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1617 1480 gene locus_tag LOCUS_08660 1617 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1728 1886 gene locus_tag LOCUS_08670 1728 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1883 2188 gene locus_tag LOCUS_08680 1883 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2189 2575 gene locus_tag LOCUS_08690 2189 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2572 3357 gene locus_tag LOCUS_08700 2572 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3359 6280 gene locus_tag LOCUS_08710 3359 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6353 6613 gene locus_tag LOCUS_08720 6353 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7544 6606 gene locus_tag LOCUS_08730 7544 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7670 7954 gene locus_tag LOCUS_08740 7670 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8501 8028 gene locus_tag LOCUS_08750 8501 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence39 1278 1514 gene locus_tag LOCUS_08760 1278 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1492 1734 gene locus_tag LOCUS_08770 1492 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1734 2186 gene locus_tag LOCUS_08780 1734 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2189 2395 gene locus_tag LOCUS_08790 2189 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2495 3037 gene locus_tag LOCUS_08800 2495 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3040 3288 gene locus_tag LOCUS_08810 3040 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3311 3871 gene locus_tag LOCUS_08820 3311 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 3906 4499 gene locus_tag LOCUS_08830 3906 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4575 5111 gene locus_tag LOCUS_08840 4575 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5132 5566 gene locus_tag LOCUS_08850 5132 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5570 6688 gene locus_tag LOCUS_08860 5570 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6753 7547 gene locus_tag LOCUS_08870 6753 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7540 7737 gene locus_tag LOCUS_08880 7540 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 7713 8147 gene locus_tag LOCUS_08890 7713 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8268 8792 gene locus_tag LOCUS_08900 8268 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 8789 9064 gene locus_tag LOCUS_08910 8789 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence40 544 410 gene locus_tag LOCUS_08920 544 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 668 739 gene locus_tag LOCUS_t00300 668 739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1208 1510 gene locus_tag LOCUS_08930 1208 1510 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_08930 1610 2341 gene locus_tag LOCUS_08940 1610 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2334 2825 gene locus_tag LOCUS_08950 2334 2825 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657947.1 protein_id gnl|my_center|LOCUS_08950 3060 2833 gene locus_tag LOCUS_08960 3060 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3567 3100 gene locus_tag LOCUS_08970 3567 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3640 3728 gene locus_tag LOCUS_t00310 3640 3728 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4293 3736 gene locus_tag LOCUS_08980 4293 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4373 5458 gene locus_tag LOCUS_08990 gene ftsY 4373 5458 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_08990 5512 6867 gene locus_tag LOCUS_09000 5512 6867 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869593.1 protein_id gnl|my_center|LOCUS_09000 6869 7345 gene locus_tag LOCUS_09010 6869 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7342 7947 gene locus_tag LOCUS_09020 7342 7947 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_09020 8055 8130 gene locus_tag LOCUS_t00320 8055 8130 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence41 1218 1586 gene locus_tag LOCUS_09030 1218 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2154 1681 gene locus_tag LOCUS_09040 2154 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2655 2260 gene locus_tag LOCUS_09050 2655 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3172 2780 gene locus_tag LOCUS_09060 3172 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3550 3335 gene locus_tag LOCUS_09070 3550 3335 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_09070 4195 3626 gene locus_tag LOCUS_09080 4195 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4322 4248 gene locus_tag LOCUS_t00330 4322 4248 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5020 4358 gene locus_tag LOCUS_09090 5020 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5848 5141 gene locus_tag LOCUS_09100 5848 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6124 5942 gene locus_tag LOCUS_09110 6124 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 7278 6154 gene locus_tag LOCUS_09120 gene ftsZ 7278 6154 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence42 1286 840 gene locus_tag LOCUS_09130 1286 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1408 3876 gene locus_tag LOCUS_09140 1408 3876 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546245.1 protein_id gnl|my_center|LOCUS_09140 2011 2102 gene locus_tag LOCUS_t00340 2011 2102 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3919 4545 gene locus_tag LOCUS_09150 3919 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4600 5073 gene locus_tag LOCUS_09160 4600 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 6202 5078 gene locus_tag LOCUS_09170 6202 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6359 7375 gene locus_tag LOCUS_09180 6359 7375 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878356.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence43 <1 1338 gene locus_tag LOCUS_09190 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990782.1:ATPase, T2SS/T4P/T4SS family 1384 1551 gene locus_tag LOCUS_09200 1384 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1548 3716 gene locus_tag LOCUS_09210 1548 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3731 4129 gene locus_tag LOCUS_09220 3731 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4176 4313 gene locus_tag LOCUS_09230 4176 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4310 5632 gene locus_tag LOCUS_09240 4310 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5623 6111 gene locus_tag LOCUS_09250 5623 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 6253 6933 gene locus_tag LOCUS_09260 6253 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence44 752 1231 gene locus_tag LOCUS_09270 752 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1285 1779 gene locus_tag LOCUS_09280 1285 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1809 2762 gene locus_tag LOCUS_09290 1809 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2862 4307 gene locus_tag LOCUS_09300 2862 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4570 5829 gene locus_tag LOCUS_09310 4570 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 <6422 5859 gene locus_tag LOCUS_09320 <6422 5859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877167.1:formylmethanofuran dehydrogenase subunit C >Feature sequence45 1319 54 gene locus_tag LOCUS_09330 1319 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1719 1351 gene locus_tag LOCUS_09340 1719 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2195 2485 gene locus_tag LOCUS_09350 2195 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2649 2834 gene locus_tag LOCUS_09360 2649 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2836 3165 gene locus_tag LOCUS_09370 2836 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3172 3648 gene locus_tag LOCUS_09380 3172 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3645 4205 gene locus_tag LOCUS_09390 3645 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4314 4631 gene locus_tag LOCUS_09400 4314 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4633 5088 gene locus_tag LOCUS_09410 4633 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5159 5614 gene locus_tag LOCUS_09420 5159 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence46 582 950 gene locus_tag LOCUS_09430 582 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 955 1200 gene locus_tag LOCUS_09440 955 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1197 1403 gene locus_tag LOCUS_09450 1197 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1400 1825 gene locus_tag LOCUS_09460 1400 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1816 2244 gene locus_tag LOCUS_09470 1816 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2247 2459 gene locus_tag LOCUS_09480 2247 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2461 3030 gene locus_tag LOCUS_09490 2461 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3027 3257 gene locus_tag LOCUS_09500 3027 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3356 4195 gene locus_tag LOCUS_09510 3356 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 4188 4349 gene locus_tag LOCUS_09520 4188 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4495 5493 gene locus_tag LOCUS_09530 4495 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 5675 5490 gene locus_tag LOCUS_09540 5675 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence47 173 901 gene locus_tag LOCUS_09550 173 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762387.1 protein_id gnl|my_center|LOCUS_09550 950 1798 gene locus_tag LOCUS_09560 950 1798 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208309.1 protein_id gnl|my_center|LOCUS_09560 1905 2288 gene locus_tag LOCUS_09570 1905 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2942 2313 gene locus_tag LOCUS_09580 2942 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3238 3969 gene locus_tag LOCUS_09590 3238 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3966 4865 gene locus_tag LOCUS_09600 3966 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5130 4927 gene locus_tag LOCUS_09610 5130 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 5220 5585 gene locus_tag LOCUS_09620 5220 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence48 606 448 gene locus_tag LOCUS_09630 606 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 890 818 gene locus_tag LOCUS_t00350 890 818 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 943 1422 gene locus_tag LOCUS_09640 943 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2024 1425 gene locus_tag LOCUS_09650 2024 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3711 2047 gene locus_tag LOCUS_09660 gene pheT 3711 2047 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_09660 5251 3713 gene locus_tag LOCUS_09670 5251 3713 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence49 2 319 gene locus_tag LOCUS_09680 2 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 542 240 gene locus_tag LOCUS_09690 542 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 820 647 gene locus_tag LOCUS_09700 820 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1147 821 gene locus_tag LOCUS_09710 1147 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1520 1245 gene locus_tag LOCUS_09720 1520 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1756 1517 gene locus_tag LOCUS_09730 1756 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1967 1758 gene locus_tag LOCUS_09740 1967 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2247 2071 gene locus_tag LOCUS_09750 2247 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2429 2244 gene locus_tag LOCUS_09760 2429 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2548 2426 gene locus_tag LOCUS_09770 2548 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2758 2555 gene locus_tag LOCUS_09780 2758 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2979 2755 gene locus_tag LOCUS_09790 2979 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3531 3148 gene locus_tag LOCUS_09800 3531 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3939 3643 gene locus_tag LOCUS_09810 3939 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4135 3980 gene locus_tag LOCUS_09820 4135 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4392 4162 gene locus_tag LOCUS_09830 4392 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence50 417 968 gene locus_tag LOCUS_09840 417 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 965 2797 gene locus_tag LOCUS_09850 965 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3038 4606 gene locus_tag LOCUS_09860 3038 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence51 680 1729 gene locus_tag LOCUS_09870 680 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence52 133 705 gene locus_tag LOCUS_09880 133 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 726 1061 gene locus_tag LOCUS_09890 726 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2434 1058 gene locus_tag LOCUS_09900 2434 1058 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_09900 2959 2477 gene locus_tag LOCUS_09910 2959 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3139 3408 gene locus_tag LOCUS_09920 3139 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3421 4239 gene locus_tag LOCUS_09930 3421 4239 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942887.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence53 143 310 gene locus_tag LOCUS_09940 143 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2329 1205 gene locus_tag LOCUS_09950 2329 1205 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_09950 3317 2364 gene locus_tag LOCUS_09960 3317 2364 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence54 1955 2707 gene locus_tag LOCUS_09970 1955 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2694 3056 gene locus_tag LOCUS_09980 2694 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence55 99 254 gene locus_tag LOCUS_09990 99 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 205 384 gene locus_tag LOCUS_10000 205 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 969 496 gene locus_tag LOCUS_10010 969 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1510 962 gene locus_tag LOCUS_10020 1510 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3497 1719 gene locus_tag LOCUS_10030 3497 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence56 <3466 1603 gene locus_tag LOCUS_10040 <3466 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861850.1:helicase-related protein >Feature sequence57 275 105 gene locus_tag LOCUS_10050 275 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 462 268 gene locus_tag LOCUS_10060 462 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 671 459 gene locus_tag LOCUS_10070 671 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 972 790 gene locus_tag LOCUS_10080 972 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2610 2068 gene locus_tag LOCUS_10090 2610 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence58 834 283 gene locus_tag LOCUS_10100 834 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 916 1575 gene locus_tag LOCUS_10110 916 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1616 2269 gene locus_tag LOCUS_10120 1616 2269 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020659.1 protein_id gnl|my_center|LOCUS_10120 <3190 2266 gene locus_tag LOCUS_10130 <3190 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978230.1:translation initiation factor IF-2 >Feature sequence59 309 974 gene locus_tag LOCUS_10140 309 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1605 1120 gene locus_tag LOCUS_10150 1605 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence60 775 2061 gene locus_tag LOCUS_10160 775 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 <2983 2327 gene locus_tag LOCUS_10170 <2983 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004116510.1:DNA-binding protein >Feature sequence61 48 290 gene locus_tag LOCUS_10180 48 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 283 885 gene locus_tag LOCUS_10190 283 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 885 1070 gene locus_tag LOCUS_10200 885 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1077 1901 gene locus_tag LOCUS_10210 1077 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2492 1908 gene locus_tag LOCUS_10220 2492 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence62 >Feature sequence63 159 536 gene locus_tag LOCUS_10230 159 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 539 694 gene locus_tag LOCUS_10240 539 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 691 834 gene locus_tag LOCUS_10250 691 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 831 1052 gene locus_tag LOCUS_10260 831 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1027 1206 gene locus_tag LOCUS_10270 1027 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1325 1678 gene locus_tag LOCUS_10280 1325 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1675 2364 gene locus_tag LOCUS_10290 1675 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence64 396 1193 gene locus_tag LOCUS_10300 396 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1195 1512 gene locus_tag LOCUS_10310 1195 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1514 1693 gene locus_tag LOCUS_10320 1514 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1817 2365 gene locus_tag LOCUS_10330 1817 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence65 264 1055 gene locus_tag LOCUS_10340 264 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1273 1572 gene locus_tag LOCUS_10350 1273 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence66 224 562 gene locus_tag LOCUS_10360 224 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 608 928 gene locus_tag LOCUS_10370 608 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence67 198 431 gene locus_tag LOCUS_10380 198 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 433 621 gene locus_tag LOCUS_10390 433 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 841 984 gene locus_tag LOCUS_10400 841 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 993 1193 gene locus_tag LOCUS_10410 993 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1150 1305 gene locus_tag LOCUS_10420 1150 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence68 <1 1391 gene locus_tag LOCUS_10430 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392350.1:radical SAM protein >Feature sequence69 1656 1378 gene locus_tag LOCUS_10440 1656 1378 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_10440 1942 1691 gene locus_tag LOCUS_10450 1942 1691 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_10450 2159 1935 gene locus_tag LOCUS_10460 2159 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence70 1212 784 gene locus_tag LOCUS_10470 1212 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1371 1222 gene locus_tag LOCUS_10480 1371 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1343 1561 gene locus_tag LOCUS_10490 1343 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 <2172 1645 gene locus_tag LOCUS_10500 <2172 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963442.1:erythromycin esterase family protein >Feature sequence71 372 1724 gene locus_tag LOCUS_10510 372 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2096 1881 gene locus_tag LOCUS_10520 2096 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence72 1019 630 gene locus_tag LOCUS_10530 1019 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence73 380 1615 gene locus_tag LOCUS_10540 380 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1977 1612 gene locus_tag LOCUS_10550 1977 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence74 1236 1667 gene locus_tag LOCUS_10560 1236 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1916 1698 gene locus_tag LOCUS_10570 1916 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570