>Feature sequence001 256 1071 gene locus_tag LOCUS_00010 256 1071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_00010 1068 2318 gene locus_tag LOCUS_00020 1068 2318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_00020 2778 2990 gene locus_tag LOCUS_00030 2778 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3663 3022 gene locus_tag LOCUS_00040 3663 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258774.1 protein_id gnl|my_center|LOCUS_00040 4210 3650 gene locus_tag LOCUS_00050 4210 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256676.1 protein_id gnl|my_center|LOCUS_00050 4592 4269 gene locus_tag LOCUS_00060 4592 4269 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_00060 4748 5086 gene locus_tag LOCUS_00070 4748 5086 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_00070 5199 5765 gene locus_tag LOCUS_00080 5199 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5877 6254 gene locus_tag LOCUS_00090 5877 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6369 6902 gene locus_tag LOCUS_00100 gene ybeY 6369 6902 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_00100 6895 8598 gene locus_tag LOCUS_00110 6895 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8633 8938 gene locus_tag LOCUS_00120 8633 8938 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_00120 9097 9106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9423 9953 gene locus_tag LOCUS_00130 gene recR 9423 9953 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_00130 10029 10838 gene locus_tag LOCUS_00140 gene recO 10029 10838 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_00140 11021 14140 gene locus_tag LOCUS_00150 gene uvrA 11021 14140 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565362.1 protein_id gnl|my_center|LOCUS_00150 14820 15296 gene locus_tag LOCUS_00160 14820 15296 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259155.1 protein_id gnl|my_center|LOCUS_00160 15872 15360 gene locus_tag LOCUS_00170 15872 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 16814 16185 gene locus_tag LOCUS_00180 16814 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17144 16902 gene locus_tag LOCUS_00190 17144 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17077 18723 gene locus_tag LOCUS_00200 17077 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18828 19583 gene locus_tag LOCUS_00210 18828 19583 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399178.1 protein_id gnl|my_center|LOCUS_00210 19588 20343 gene locus_tag LOCUS_00220 19588 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20340 20918 gene locus_tag LOCUS_00230 20340 20918 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_00230 20968 21759 gene locus_tag LOCUS_00240 20968 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 758 3 gene locus_tag LOCUS_00250 758 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2242 824 gene locus_tag LOCUS_00260 2242 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 3580 2270 gene locus_tag LOCUS_00270 3580 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 4517 3561 gene locus_tag LOCUS_00280 4517 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 4987 6522 gene locus_tag LOCUS_00290 4987 6522 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_00290 6606 7490 gene locus_tag LOCUS_00300 6606 7490 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_00300 7695 8219 gene locus_tag LOCUS_00310 gene uraD 7695 8219 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_00310 8822 10249 gene locus_tag LOCUS_00320 8822 10249 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251229.1 protein_id gnl|my_center|LOCUS_00320 10626 10303 gene locus_tag LOCUS_00330 10626 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 11983 10805 gene locus_tag LOCUS_00340 11983 10805 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_00340 12425 13348 gene locus_tag LOCUS_00350 12425 13348 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898170.1 protein_id gnl|my_center|LOCUS_00350 14906 13749 gene locus_tag LOCUS_00360 14906 13749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_00360 16483 15221 gene locus_tag LOCUS_00370 16483 15221 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_00370 16638 17021 gene locus_tag LOCUS_00380 16638 17021 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_00380 17018 17503 gene locus_tag LOCUS_00390 17018 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 17949 17545 gene locus_tag LOCUS_00400 17949 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 18009 18353 gene locus_tag LOCUS_00410 18009 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 2515 1142 gene locus_tag LOCUS_00420 2515 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 3914 2598 gene locus_tag LOCUS_00430 3914 2598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878633.1 protein_id gnl|my_center|LOCUS_00430 4336 5301 gene locus_tag LOCUS_00440 gene ilvA 4336 5301 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583846.1 protein_id gnl|my_center|LOCUS_00440 6292 5543 gene locus_tag LOCUS_00450 6292 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6484 7509 gene locus_tag LOCUS_00460 6484 7509 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968651.1 protein_id gnl|my_center|LOCUS_00460 7627 11499 gene locus_tag LOCUS_00470 7627 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 12493 11750 gene locus_tag LOCUS_00480 12493 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 13192 12575 gene locus_tag LOCUS_00490 13192 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 13567 14280 gene locus_tag LOCUS_00500 13567 14280 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_00500 16393 14234 gene locus_tag LOCUS_00510 16393 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 16997 16542 gene locus_tag LOCUS_00520 16997 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 <18168 17418 gene locus_tag LOCUS_00530 <18168 17418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967707.1:acyl-CoA dehydrogenase family protein >Feature sequence004 1241 282 gene locus_tag LOCUS_00540 1241 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1966 1268 gene locus_tag LOCUS_00550 gene nthA 1966 1268 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_00550 2273 1986 gene locus_tag LOCUS_00560 2273 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 2596 2285 gene locus_tag LOCUS_00570 2596 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 3533 2724 gene locus_tag LOCUS_00580 3533 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 4832 3834 gene locus_tag LOCUS_00590 4832 3834 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_00590 5743 5204 gene locus_tag LOCUS_00600 5743 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 6625 5795 gene locus_tag LOCUS_00610 6625 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 8167 7124 gene locus_tag LOCUS_00620 8167 7124 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006494597.1 protein_id gnl|my_center|LOCUS_00620 8588 8361 gene locus_tag LOCUS_00630 8588 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9938 8598 gene locus_tag LOCUS_00640 9938 8598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_00640 10969 10043 gene locus_tag LOCUS_00650 10969 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 12853 11189 gene locus_tag LOCUS_00660 12853 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 12786 13076 gene locus_tag LOCUS_00670 12786 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 14583 13306 gene locus_tag LOCUS_00680 14583 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 15512 14580 gene locus_tag LOCUS_00690 gene cysD 15512 14580 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086386.1 protein_id gnl|my_center|LOCUS_00690 16264 15509 gene locus_tag LOCUS_00700 16264 15509 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_00700 <17262 16574 gene locus_tag LOCUS_00710 <17262 16574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256214.1:trypsin-like peptidase domain-containing protein >Feature sequence005 2531 522 gene locus_tag LOCUS_00720 gene yagF 2531 522 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_00720 2694 3863 gene locus_tag LOCUS_00730 2694 3863 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_00730 3941 5110 gene locus_tag LOCUS_00740 3941 5110 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_00740 5741 7456 gene locus_tag LOCUS_00750 5741 7456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530490.1 protein_id gnl|my_center|LOCUS_00750 7456 9384 gene locus_tag LOCUS_00760 7456 9384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530489.1 protein_id gnl|my_center|LOCUS_00760 10655 9549 gene locus_tag LOCUS_00770 gene ruvB 10655 9549 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_00770 11413 10763 gene locus_tag LOCUS_00780 gene ruvA 11413 10763 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 protein_id gnl|my_center|LOCUS_00780 11993 11502 gene locus_tag LOCUS_00790 gene ruvC 11993 11502 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_00790 12157 11960 gene locus_tag LOCUS_00800 12157 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 12357 13049 gene locus_tag LOCUS_00810 12357 13049 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_00810 13077 14228 gene locus_tag LOCUS_00820 gene acdA 13077 14228 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_00820 14464 14994 gene locus_tag LOCUS_00830 14464 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 15387 16325 gene locus_tag LOCUS_00840 gene fabD 15387 16325 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence006 <1 519 gene locus_tag LOCUS_00850 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889481.1:NAD(P)-dependent oxidoreductase 1664 516 gene locus_tag LOCUS_00860 1664 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 1807 2655 gene locus_tag LOCUS_00870 gene couO 1807 2655 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_00870 3513 4244 gene locus_tag LOCUS_00880 3513 4244 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_00880 4244 5014 gene locus_tag LOCUS_00890 4244 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5272 5018 gene locus_tag LOCUS_00900 5272 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5192 5449 gene locus_tag LOCUS_00910 5192 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 5679 6731 gene locus_tag LOCUS_00920 5679 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 6825 7259 gene locus_tag LOCUS_00930 6825 7259 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909108.1 protein_id gnl|my_center|LOCUS_00930 7304 8239 gene locus_tag LOCUS_00940 7304 8239 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_00940 8236 9063 gene locus_tag LOCUS_00950 8236 9063 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_00950 9067 9975 gene locus_tag LOCUS_00960 9067 9975 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_00960 10803 10033 gene locus_tag LOCUS_00970 10803 10033 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972302.1 protein_id gnl|my_center|LOCUS_00970 12315 10936 gene locus_tag LOCUS_00980 12315 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13485 12766 gene locus_tag LOCUS_00990 13485 12766 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_00990 14001 14669 gene locus_tag LOCUS_01000 14001 14669 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence007 1367 186 gene locus_tag LOCUS_01010 1367 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1457 1930 gene locus_tag LOCUS_01020 1457 1930 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084685.1 protein_id gnl|my_center|LOCUS_01020 1984 2922 gene locus_tag LOCUS_01030 1984 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3434 2919 gene locus_tag LOCUS_01040 3434 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 5352 3703 gene locus_tag LOCUS_01050 gene cimA 5352 3703 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_01050 6021 6587 gene locus_tag LOCUS_01060 6021 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 6624 7565 gene locus_tag LOCUS_01070 6624 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 7869 8393 gene locus_tag LOCUS_01080 7869 8393 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_01080 8509 9213 gene locus_tag LOCUS_01090 8509 9213 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_01090 10339 9266 gene locus_tag LOCUS_01100 10339 9266 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_01100 10755 10396 gene locus_tag LOCUS_01110 10755 10396 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_01110 10918 11664 gene locus_tag LOCUS_01120 gene hisH 10918 11664 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_01120 11703 12428 gene locus_tag LOCUS_01130 gene hisA 11703 12428 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_01130 12449 13018 gene locus_tag LOCUS_01140 12449 13018 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_01140 13025 13849 gene locus_tag LOCUS_01150 gene hisF 13025 13849 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_01150 13935 14669 gene locus_tag LOCUS_01160 13935 14669 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729517.1 protein_id gnl|my_center|LOCUS_01160 14988 15620 gene locus_tag LOCUS_01170 gene hisIE 14988 15620 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257923.1 protein_id gnl|my_center|LOCUS_01170 >Feature sequence008 696 16 gene locus_tag LOCUS_01180 696 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3656 825 gene locus_tag LOCUS_01190 3656 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6532 3653 gene locus_tag LOCUS_01200 6532 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7190 6906 gene locus_tag LOCUS_01210 7190 6906 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_01210 7895 8926 gene locus_tag LOCUS_01220 7895 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01220 8961 9257 gene locus_tag LOCUS_01230 8961 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 9279 9503 gene locus_tag LOCUS_01240 9279 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9604 10146 gene locus_tag LOCUS_01250 9604 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10198 11808 gene locus_tag LOCUS_01260 10198 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12475 11867 gene locus_tag LOCUS_01270 12475 11867 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257095.1 protein_id gnl|my_center|LOCUS_01270 13720 12584 gene locus_tag LOCUS_01280 13720 12584 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_01280 15469 14021 gene locus_tag LOCUS_01290 15469 14021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence009 1917 748 gene locus_tag LOCUS_01300 1917 748 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_01300 3415 2009 gene locus_tag LOCUS_01310 3415 2009 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537701.1 protein_id gnl|my_center|LOCUS_01310 4249 3626 gene locus_tag LOCUS_01320 gene lepB 4249 3626 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257166.1 protein_id gnl|my_center|LOCUS_01320 4567 4301 gene locus_tag LOCUS_01330 4567 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4463 5029 gene locus_tag LOCUS_01340 4463 5029 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_01340 5093 6046 gene locus_tag LOCUS_01350 5093 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 6280 7200 gene locus_tag LOCUS_01360 6280 7200 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_01360 7563 8171 gene locus_tag LOCUS_01370 gene dcd 7563 8171 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058109.1 protein_id gnl|my_center|LOCUS_01370 8174 9280 gene locus_tag LOCUS_01380 gene ribD 8174 9280 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_01380 9322 9933 gene locus_tag LOCUS_01390 gene ribE 9322 9933 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258063.1 protein_id gnl|my_center|LOCUS_01390 9911 11170 gene locus_tag LOCUS_01400 9911 11170 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_01400 11229 11663 gene locus_tag LOCUS_01410 gene ribE 11229 11663 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_01410 11785 12264 gene locus_tag LOCUS_01420 11785 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 12657 13811 gene locus_tag LOCUS_01430 gene dinB 12657 13811 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_01430 13910 13983 gene locus_tag LOCUS_t00010 13910 13983 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13987 14063 gene locus_tag LOCUS_t00020 13987 14063 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 508 92 gene locus_tag LOCUS_01440 508 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 643 1998 gene locus_tag LOCUS_01450 643 1998 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_01450 4259 2250 gene locus_tag LOCUS_01460 gene fusA 4259 2250 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01460 6573 4444 gene locus_tag LOCUS_01470 6573 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6930 8276 gene locus_tag LOCUS_01480 6930 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8527 9675 gene locus_tag LOCUS_01490 gene hflK 8527 9675 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_01490 9677 10759 gene locus_tag LOCUS_01500 gene hflC 9677 10759 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209155.1 protein_id gnl|my_center|LOCUS_01500 11349 10882 gene locus_tag LOCUS_01510 11349 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 12348 11566 gene locus_tag LOCUS_01520 12348 11566 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_01520 12502 13410 gene locus_tag LOCUS_01530 12502 13410 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878803.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence011 118 930 gene locus_tag LOCUS_01540 118 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 1046 1699 gene locus_tag LOCUS_01550 1046 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 1708 3255 gene locus_tag LOCUS_01560 1708 3255 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929142.1 protein_id gnl|my_center|LOCUS_01560 3256 5436 gene locus_tag LOCUS_01570 3256 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5441 6352 gene locus_tag LOCUS_01580 gene secF 5441 6352 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_01580 6511 7368 gene locus_tag LOCUS_01590 6511 7368 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881054.1 protein_id gnl|my_center|LOCUS_01590 7391 7762 gene locus_tag LOCUS_01600 7391 7762 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_01600 7894 9342 gene locus_tag LOCUS_01610 7894 9342 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808711.1 protein_id gnl|my_center|LOCUS_01610 10261 9428 gene locus_tag LOCUS_01620 10261 9428 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_01620 11156 10326 gene locus_tag LOCUS_01630 11156 10326 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_01630 11721 11194 gene locus_tag LOCUS_01640 11721 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13571 11718 gene locus_tag LOCUS_01650 gene selB 13571 11718 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence012 1255 458 gene locus_tag LOCUS_01660 1255 458 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940024.1 protein_id gnl|my_center|LOCUS_01660 2361 1255 gene locus_tag LOCUS_01670 gene mqnE 2361 1255 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_01670 4256 2463 gene locus_tag LOCUS_01680 4256 2463 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_01680 4874 4260 gene locus_tag LOCUS_01690 4874 4260 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_01690 5761 4874 gene locus_tag LOCUS_01700 gene ubiA 5761 4874 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_01700 6440 5754 gene locus_tag LOCUS_01710 6440 5754 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809583.1 protein_id gnl|my_center|LOCUS_01710 6659 7936 gene locus_tag LOCUS_01720 6659 7936 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106275831.1 protein_id gnl|my_center|LOCUS_01720 8164 9351 gene locus_tag LOCUS_01730 gene ahbC 8164 9351 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938157.1 protein_id gnl|my_center|LOCUS_01730 9348 10550 gene locus_tag LOCUS_01740 9348 10550 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_01740 10791 11675 gene locus_tag LOCUS_01750 10791 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 11723 12472 gene locus_tag LOCUS_01760 11723 12472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence013 1099 464 gene locus_tag LOCUS_01770 1099 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4020 1441 gene locus_tag LOCUS_01780 4020 1441 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_01780 4456 4100 gene locus_tag LOCUS_01790 4456 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5454 4453 gene locus_tag LOCUS_01800 5454 4453 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_01800 5619 6074 gene locus_tag LOCUS_01810 5619 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6189 7376 gene locus_tag LOCUS_01820 6189 7376 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_01820 7379 8203 gene locus_tag LOCUS_01830 7379 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8381 8824 gene locus_tag LOCUS_01840 8381 8824 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_01840 9013 9669 gene locus_tag LOCUS_01850 9013 9669 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545581.1 protein_id gnl|my_center|LOCUS_01850 9712 10608 gene locus_tag LOCUS_01860 9712 10608 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_01860 10823 11857 gene locus_tag LOCUS_01870 10823 11857 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_01870 11976 12632 gene locus_tag LOCUS_01880 11976 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence014 1768 608 gene locus_tag LOCUS_01890 1768 608 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_01890 2472 1774 gene locus_tag LOCUS_01900 gene npdG 2472 1774 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_01900 2835 3740 gene locus_tag LOCUS_01910 2835 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3878 5245 gene locus_tag LOCUS_01920 3878 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5298 6632 gene locus_tag LOCUS_01930 5298 6632 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_01930 6674 8065 gene locus_tag LOCUS_01940 6674 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9608 8142 gene locus_tag LOCUS_01950 gene pyk 9608 8142 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_01950 9888 10541 gene locus_tag LOCUS_01960 9888 10541 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_01960 10544 11950 gene locus_tag LOCUS_01970 10544 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13006 12662 gene locus_tag LOCUS_01980 13006 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence015 24 1256 gene locus_tag LOCUS_01990 24 1256 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_01990 1256 2542 gene locus_tag LOCUS_02000 1256 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3895 2579 gene locus_tag LOCUS_02010 3895 2579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391912.1 protein_id gnl|my_center|LOCUS_02010 4121 3909 gene locus_tag LOCUS_02020 4121 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4199 6172 gene locus_tag LOCUS_02030 4199 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 6512 6276 gene locus_tag LOCUS_02040 6512 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6435 6617 gene locus_tag LOCUS_02050 6435 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6836 8320 gene locus_tag LOCUS_02060 6836 8320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_02060 9349 8414 gene locus_tag LOCUS_02070 9349 8414 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_02070 9988 9350 gene locus_tag LOCUS_02080 9988 9350 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_02080 10115 10573 gene locus_tag LOCUS_02090 gene soxR 10115 10573 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_02090 12515 10773 gene locus_tag LOCUS_02100 12515 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence016 3759 2527 gene locus_tag LOCUS_02110 3759 2527 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_02110 7201 3953 gene locus_tag LOCUS_02120 7201 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8472 7198 gene locus_tag LOCUS_02130 8472 7198 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_02130 10317 8695 gene locus_tag LOCUS_02140 gene groL 10317 8695 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_02140 10695 10390 gene locus_tag LOCUS_02150 gene groES 10695 10390 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence017 <1 1113 gene locus_tag LOCUS_02160 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869596.1:ATP-dependent zinc metalloprotease FtsH 1201 2169 gene locus_tag LOCUS_02170 gene egtD 1201 2169 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146537107.1 protein_id gnl|my_center|LOCUS_02170 3328 2519 gene locus_tag LOCUS_02180 3328 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3831 3325 gene locus_tag LOCUS_02190 3831 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3919 4236 gene locus_tag LOCUS_02200 3919 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4275 5567 gene locus_tag LOCUS_02210 4275 5567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_02210 6481 5987 gene locus_tag LOCUS_02220 6481 5987 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_02220 7344 6478 gene locus_tag LOCUS_02230 7344 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7654 8091 gene locus_tag LOCUS_02240 7654 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8226 8663 gene locus_tag LOCUS_02250 8226 8663 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476513.1 protein_id gnl|my_center|LOCUS_02250 8796 9563 gene locus_tag LOCUS_02260 8796 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9609 10307 gene locus_tag LOCUS_02270 9609 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02270 11186 10329 gene locus_tag LOCUS_02280 11186 10329 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808075.1 protein_id gnl|my_center|LOCUS_02280 12233 11343 gene locus_tag LOCUS_02290 12233 11343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence018 1137 274 gene locus_tag LOCUS_02300 1137 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2671 1304 gene locus_tag LOCUS_02310 2671 1304 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_02310 3125 2775 gene locus_tag LOCUS_02320 3125 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3873 3241 gene locus_tag LOCUS_02330 3873 3241 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813333.1 protein_id gnl|my_center|LOCUS_02330 8073 4192 gene locus_tag LOCUS_02340 8073 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8176 8883 gene locus_tag LOCUS_02350 8176 8883 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258735.1 protein_id gnl|my_center|LOCUS_02350 9658 8876 gene locus_tag LOCUS_02360 9658 8876 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_02360 11214 9745 gene locus_tag LOCUS_02370 11214 9745 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence019 221 976 gene locus_tag LOCUS_02380 221 976 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_02380 1792 1088 gene locus_tag LOCUS_02390 1792 1088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_02390 2582 1875 gene locus_tag LOCUS_02400 2582 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4870 2843 gene locus_tag LOCUS_02410 4870 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5021 6850 gene locus_tag LOCUS_02420 5021 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7406 6840 gene locus_tag LOCUS_02430 7406 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7518 8312 gene locus_tag LOCUS_02440 gene azf 7518 8312 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_02440 9427 8321 gene locus_tag LOCUS_02450 gene dgoD 9427 8321 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_02450 10413 9460 gene locus_tag LOCUS_02460 gene ispH 10413 9460 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_02460 10809 11102 gene locus_tag LOCUS_02470 10809 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 11227 11397 gene locus_tag LOCUS_02480 11227 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence020 <1 690 gene locus_tag LOCUS_02490 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728259.1:LLM class F420-dependent oxidoreductase 2683 1205 gene locus_tag LOCUS_02500 2683 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3640 2852 gene locus_tag LOCUS_02510 gene pcaD 3640 2852 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_02510 5404 4412 gene locus_tag LOCUS_02520 5404 4412 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 protein_id gnl|my_center|LOCUS_02520 6439 5519 gene locus_tag LOCUS_02530 6439 5519 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727690.1 protein_id gnl|my_center|LOCUS_02530 7223 6717 gene locus_tag LOCUS_02540 7223 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8417 7260 gene locus_tag LOCUS_02550 8417 7260 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225183.1 protein_id gnl|my_center|LOCUS_02550 8565 9791 gene locus_tag LOCUS_02560 8565 9791 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_02560 9972 10451 gene locus_tag LOCUS_02570 9972 10451 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381269.1 protein_id gnl|my_center|LOCUS_02570 10597 11094 gene locus_tag LOCUS_02580 10597 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence021 1043 2410 gene locus_tag LOCUS_02590 1043 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 2415 3128 gene locus_tag LOCUS_02600 2415 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7140 3163 gene locus_tag LOCUS_02610 7140 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7847 7149 gene locus_tag LOCUS_02620 7847 7149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_02620 7964 8578 gene locus_tag LOCUS_02630 7964 8578 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_02630 9216 8575 gene locus_tag LOCUS_02640 9216 8575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_02640 9437 9970 gene locus_tag LOCUS_02650 9437 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10750 9992 gene locus_tag LOCUS_02660 gene cofE 10750 9992 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence022 1345 158 gene locus_tag LOCUS_02670 gene holB 1345 158 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_02670 2669 1353 gene locus_tag LOCUS_02680 gene lysA 2669 1353 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_02680 3099 4040 gene locus_tag LOCUS_02690 gene selD 3099 4040 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_02690 4611 4306 gene locus_tag LOCUS_02700 4611 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4522 8232 gene locus_tag LOCUS_02710 4522 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 <11254 8280 gene locus_tag LOCUS_02720 <11254 8280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986028.1:isoleucine--tRNA ligase >Feature sequence023 363 974 gene locus_tag LOCUS_02730 363 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 971 1819 gene locus_tag LOCUS_02740 971 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 3030 1837 gene locus_tag LOCUS_02750 gene larC 3030 1837 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_02750 3940 3065 gene locus_tag LOCUS_02760 gene larE 3940 3065 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_02760 5246 3996 gene locus_tag LOCUS_02770 gene radA 5246 3996 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_02770 5200 5523 gene locus_tag LOCUS_02780 5200 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 6420 5581 gene locus_tag LOCUS_02790 6420 5581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_02790 9181 6671 gene locus_tag LOCUS_02800 9181 6671 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_02800 10755 9214 gene locus_tag LOCUS_02810 10755 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence024 <1 1764 gene locus_tag LOCUS_02820 <1 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391369.1:thioredoxin domain-containing protein 1915 2277 gene locus_tag LOCUS_02830 1915 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3945 3049 gene locus_tag LOCUS_02840 gene garR 3945 3049 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_02840 4810 4025 gene locus_tag LOCUS_02850 4810 4025 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_02850 5104 6558 gene locus_tag LOCUS_02860 5104 6558 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_02860 6640 7779 gene locus_tag LOCUS_02870 gene thiO 6640 7779 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103297.1 protein_id gnl|my_center|LOCUS_02870 7776 8450 gene locus_tag LOCUS_02880 7776 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 8918 9505 gene locus_tag LOCUS_02890 gene pyrR 8918 9505 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_02890 9634 10620 gene locus_tag LOCUS_02900 9634 10620 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257760.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence025 176 2455 gene locus_tag LOCUS_02910 176 2455 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_02910 2665 3000 gene locus_tag LOCUS_02920 2665 3000 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545583.1 protein_id gnl|my_center|LOCUS_02920 3066 3731 gene locus_tag LOCUS_02930 gene folE 3066 3731 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_02930 3771 4511 gene locus_tag LOCUS_02940 3771 4511 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_02940 4528 5202 gene locus_tag LOCUS_02950 4528 5202 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_02950 5326 5703 gene locus_tag LOCUS_02960 gene folB 5326 5703 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_02960 6559 6035 gene locus_tag LOCUS_02970 6559 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6756 7979 gene locus_tag LOCUS_02980 gene trpB 6756 7979 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392850.1 protein_id gnl|my_center|LOCUS_02980 8169 8537 gene locus_tag LOCUS_02990 8169 8537 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124480.1 protein_id gnl|my_center|LOCUS_02990 8528 9055 gene locus_tag LOCUS_03000 8528 9055 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_03000 9052 9630 gene locus_tag LOCUS_03010 9052 9630 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396799.1 protein_id gnl|my_center|LOCUS_03010 9746 10825 gene locus_tag LOCUS_03020 gene nuoD 9746 10825 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence026 1329 280 gene locus_tag LOCUS_03030 1329 280 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_03030 1597 3426 gene locus_tag LOCUS_03040 gene ilvD 1597 3426 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_03040 3686 3898 gene locus_tag LOCUS_03050 3686 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4852 4127 gene locus_tag LOCUS_03060 4852 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6529 5222 gene locus_tag LOCUS_03070 6529 5222 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728152.1 protein_id gnl|my_center|LOCUS_03070 6790 8211 gene locus_tag LOCUS_03080 6790 8211 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_03080 8416 9465 gene locus_tag LOCUS_03090 8416 9465 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence027 3918 64 gene locus_tag LOCUS_03100 3918 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4399 5337 gene locus_tag LOCUS_03110 4399 5337 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_03110 5325 5540 gene locus_tag LOCUS_03120 5325 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5577 6125 gene locus_tag LOCUS_03130 5577 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6167 7480 gene locus_tag LOCUS_03140 gene hemL 6167 7480 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_03140 7567 8763 gene locus_tag LOCUS_03150 7567 8763 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_03150 8821 9672 gene locus_tag LOCUS_03160 8821 9672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence028 <1 831 gene locus_tag LOCUS_03170 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439092.1:amidohydrolase 1506 877 gene locus_tag LOCUS_03180 1506 877 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_03180 2163 1582 gene locus_tag LOCUS_03190 2163 1582 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_03190 3521 2217 gene locus_tag LOCUS_03200 gene aroA 3521 2217 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_03200 4567 3569 gene locus_tag LOCUS_03210 4567 3569 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_03210 5758 4967 gene locus_tag LOCUS_03220 5758 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6710 5751 gene locus_tag LOCUS_03230 6710 5751 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 protein_id gnl|my_center|LOCUS_03230 7684 6842 gene locus_tag LOCUS_03240 7684 6842 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_03240 7571 7837 gene locus_tag LOCUS_03250 7571 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 8910 7912 gene locus_tag LOCUS_03260 8910 7912 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_03260 9178 8903 gene locus_tag LOCUS_03270 9178 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 9223 10221 gene locus_tag LOCUS_03280 9223 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence029 505 1425 gene locus_tag LOCUS_03290 505 1425 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_03290 1655 3127 gene locus_tag LOCUS_03300 1655 3127 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777065.1 protein_id gnl|my_center|LOCUS_03300 3135 5156 gene locus_tag LOCUS_03310 gene tkt 3135 5156 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_03310 5197 5655 gene locus_tag LOCUS_03320 gene rpiB 5197 5655 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525805.1 protein_id gnl|my_center|LOCUS_03320 5770 6897 gene locus_tag LOCUS_03330 5770 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03330 6917 8542 gene locus_tag LOCUS_03340 6917 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 8769 9674 gene locus_tag LOCUS_03350 8769 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence030 796 2076 gene locus_tag LOCUS_03360 796 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2088 2597 gene locus_tag LOCUS_03370 gene smpB 2088 2597 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_03370 2710 3064 gene locus_tag LOCUS_tm00010 2710 3064 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4895 3897 gene locus_tag LOCUS_03380 4895 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6102 4954 gene locus_tag LOCUS_03390 6102 4954 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_03390 7552 6152 gene locus_tag LOCUS_03400 7552 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7621 7809 gene locus_tag LOCUS_03410 7621 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 8768 8142 gene locus_tag LOCUS_03420 8768 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <10279 8912 gene locus_tag LOCUS_03430 <10279 8912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392261.1:HAMP domain-containing methyl-accepting chemotaxis protein >Feature sequence031 <1 909 gene locus_tag LOCUS_03440 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027326.1:S-(hydroxymethyl)mycothiol dehydrogenase 1486 2061 gene locus_tag LOCUS_03450 1486 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2485 5910 gene locus_tag LOCUS_03460 2485 5910 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889569.1 protein_id gnl|my_center|LOCUS_03460 8412 5911 gene locus_tag LOCUS_03470 8412 5911 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_03470 8411 8665 gene locus_tag LOCUS_03480 8411 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9420 8569 gene locus_tag LOCUS_03490 9420 8569 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_03490 9851 9420 gene locus_tag LOCUS_03500 gene ruvX 9851 9420 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence032 1149 430 gene locus_tag LOCUS_03510 1149 430 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_03510 1790 1254 gene locus_tag LOCUS_03520 1790 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2388 1858 gene locus_tag LOCUS_03530 2388 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2935 2423 gene locus_tag LOCUS_03540 2935 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_03540 4202 3096 gene locus_tag LOCUS_03550 4202 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 5293 4598 gene locus_tag LOCUS_03560 5293 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5734 6465 gene locus_tag LOCUS_03570 5734 6465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079853.1 protein_id gnl|my_center|LOCUS_03570 6765 7358 gene locus_tag LOCUS_03580 6765 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8246 7431 gene locus_tag LOCUS_03590 8246 7431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_03590 9144 8239 gene locus_tag LOCUS_03600 9144 8239 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_03600 9392 10162 gene locus_tag LOCUS_03610 9392 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence033 <1 1548 gene locus_tag LOCUS_03620 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098594.1:sigma E protease regulator RseP 1613 2737 gene locus_tag LOCUS_03630 gene ispG 1613 2737 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_03630 2892 4649 gene locus_tag LOCUS_03640 2892 4649 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_03640 5211 4735 gene locus_tag LOCUS_03650 5211 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 5428 5763 gene locus_tag LOCUS_03660 5428 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5813 7228 gene locus_tag LOCUS_03670 5813 7228 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539274.1 protein_id gnl|my_center|LOCUS_03670 7319 7840 gene locus_tag LOCUS_03680 7319 7840 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_03680 9067 7889 gene locus_tag LOCUS_03690 9067 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 9702 9166 gene locus_tag LOCUS_03700 9702 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence034 1628 558 gene locus_tag LOCUS_03710 1628 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2293 1916 gene locus_tag LOCUS_03720 2293 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03720 2534 3442 gene locus_tag LOCUS_03730 2534 3442 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973511.1 protein_id gnl|my_center|LOCUS_03730 3500 4417 gene locus_tag LOCUS_03740 3500 4417 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_03740 5890 4877 gene locus_tag LOCUS_03750 5890 4877 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_03750 6212 6982 gene locus_tag LOCUS_03760 6212 6982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_03760 7178 8728 gene locus_tag LOCUS_03770 7178 8728 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777065.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence035 1229 804 gene locus_tag LOCUS_03780 1229 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1586 1242 gene locus_tag LOCUS_03790 1586 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 1845 2213 gene locus_tag LOCUS_03800 1845 2213 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_03800 3279 2230 gene locus_tag LOCUS_03810 gene mtnA 3279 2230 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529406.1 protein_id gnl|my_center|LOCUS_03810 4106 3468 gene locus_tag LOCUS_03820 4106 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4398 5570 gene locus_tag LOCUS_03830 4398 5570 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_03830 6217 6141 gene locus_tag LOCUS_t00030 6217 6141 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8065 6566 gene locus_tag LOCUS_03840 8065 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence036 1775 687 gene locus_tag LOCUS_03850 1775 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3568 1955 gene locus_tag LOCUS_03860 3568 1955 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_03860 4984 3602 gene locus_tag LOCUS_03870 4984 3602 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_03870 5141 5623 gene locus_tag LOCUS_03880 5141 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5714 6538 gene locus_tag LOCUS_03890 5714 6538 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_03890 8039 6582 gene locus_tag LOCUS_03900 8039 6582 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_03900 <9775 8352 gene locus_tag LOCUS_03910 <9775 8352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141470.1:S9 family peptidase >Feature sequence037 32 1243 gene locus_tag LOCUS_03920 32 1243 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524840.1 protein_id gnl|my_center|LOCUS_03920 1254 2462 gene locus_tag LOCUS_03930 1254 2462 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971597.1 protein_id gnl|my_center|LOCUS_03930 2673 3491 gene locus_tag LOCUS_03940 2673 3491 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085602.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 4726 3701 gene locus_tag LOCUS_03950 4726 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5855 4887 gene locus_tag LOCUS_03960 5855 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5924 8368 gene locus_tag LOCUS_03970 5924 8368 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence038 1290 109 gene locus_tag LOCUS_03980 gene rhmD 1290 109 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_03980 2259 3356 gene locus_tag LOCUS_03990 2259 3356 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_03990 3382 5475 gene locus_tag LOCUS_04000 3382 5475 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975036.1 protein_id gnl|my_center|LOCUS_04000 5752 7248 gene locus_tag LOCUS_04010 5752 7248 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 protein_id gnl|my_center|LOCUS_04010 7486 7776 gene locus_tag LOCUS_04020 7486 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 7778 8650 gene locus_tag LOCUS_04030 7778 8650 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730401.1 protein_id gnl|my_center|LOCUS_04030 <9719 9165 gene locus_tag LOCUS_04040 <9719 9165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106007140.1:DedA family protein >Feature sequence039 <1 916 gene locus_tag LOCUS_04050 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258615.1:class I tRNA ligase family protein 1013 1231 gene locus_tag LOCUS_04060 1013 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1445 3379 gene locus_tag LOCUS_04070 1445 3379 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_04070 4180 3500 gene locus_tag LOCUS_04080 4180 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4350 5051 gene locus_tag LOCUS_04090 4350 5051 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225617.1 protein_id gnl|my_center|LOCUS_04090 7506 5335 gene locus_tag LOCUS_04100 7506 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 8770 8027 gene locus_tag LOCUS_04110 8770 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8744 8977 gene locus_tag LOCUS_04120 8744 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9684 9208 gene locus_tag LOCUS_04130 9684 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence040 1270 515 gene locus_tag LOCUS_04140 gene pyrH 1270 515 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254608.1 protein_id gnl|my_center|LOCUS_04140 1826 1323 gene locus_tag LOCUS_04150 gene tsf 1826 1323 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_04150 3310 1922 gene locus_tag LOCUS_04160 3310 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4031 3357 gene locus_tag LOCUS_04170 4031 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4293 5201 gene locus_tag LOCUS_04180 4293 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6077 5331 gene locus_tag LOCUS_04190 6077 5331 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_04190 6315 7925 gene locus_tag LOCUS_04200 6315 7925 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_04200 8810 8307 gene locus_tag LOCUS_04210 8810 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 9020 8829 gene locus_tag LOCUS_04220 9020 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9608 9252 gene locus_tag LOCUS_04230 9608 9252 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence041 214 1287 gene locus_tag LOCUS_04240 gene hrcA 214 1287 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_04240 1391 2521 gene locus_tag LOCUS_04250 gene dnaJ 1391 2521 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_04250 2561 3466 gene locus_tag LOCUS_04260 2561 3466 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_04260 3473 4228 gene locus_tag LOCUS_04270 3473 4228 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_04270 5249 4245 gene locus_tag LOCUS_04280 5249 4245 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_04280 5900 5253 gene locus_tag LOCUS_04290 gene plsY 5900 5253 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140665.1 protein_id gnl|my_center|LOCUS_04290 7222 5900 gene locus_tag LOCUS_04300 gene der 7222 5900 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_04300 8148 7228 gene locus_tag LOCUS_04310 gene argF 8148 7228 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_04310 9520 8357 gene locus_tag LOCUS_04320 9520 8357 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence042 <1 2705 gene locus_tag LOCUS_04330 <1 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091304129.1:AAA family ATPase 2787 4181 gene locus_tag LOCUS_04340 2787 4181 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_04340 4946 4509 gene locus_tag LOCUS_04350 4946 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5153 5767 gene locus_tag LOCUS_04360 5153 5767 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_04360 5953 6567 gene locus_tag LOCUS_04370 5953 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7936 6605 gene locus_tag LOCUS_04380 7936 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8159 7833 gene locus_tag LOCUS_04390 8159 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8350 8982 gene locus_tag LOCUS_04400 8350 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence043 487 1107 gene locus_tag LOCUS_04410 487 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2722 1457 gene locus_tag LOCUS_04420 2722 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4322 2907 gene locus_tag LOCUS_04430 gene glmU 4322 2907 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_04430 4578 4665 gene locus_tag LOCUS_t00040 4578 4665 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4733 4822 gene locus_tag LOCUS_t00050 4733 4822 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4894 6048 gene locus_tag LOCUS_04440 gene dprA 4894 6048 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_04440 6014 8272 gene locus_tag LOCUS_04450 gene topA 6014 8272 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_04450 8345 9355 gene locus_tag LOCUS_04460 gene xerC 8345 9355 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence044 1238 2158 gene locus_tag LOCUS_04470 1238 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2124 3236 gene locus_tag LOCUS_04480 2124 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4042 3476 gene locus_tag LOCUS_04490 gene thpR 4042 3476 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391396.1 protein_id gnl|my_center|LOCUS_04490 4732 5574 gene locus_tag LOCUS_04500 4732 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5694 6134 gene locus_tag LOCUS_04510 5694 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7047 6235 gene locus_tag LOCUS_04520 7047 6235 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_04520 7387 7875 gene locus_tag LOCUS_04530 7387 7875 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence045 1591 185 gene locus_tag LOCUS_04540 1591 185 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_04540 3028 1625 gene locus_tag LOCUS_04550 3028 1625 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_04550 4500 3058 gene locus_tag LOCUS_04560 4500 3058 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112543.1 protein_id gnl|my_center|LOCUS_04560 5481 4600 gene locus_tag LOCUS_04570 5481 4600 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_04570 5876 6676 gene locus_tag LOCUS_04580 5876 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6692 7792 gene locus_tag LOCUS_04590 6692 7792 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_04590 7789 8856 gene locus_tag LOCUS_04600 7789 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence046 104 787 gene locus_tag LOCUS_04610 gene rplD 104 787 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258232.1 protein_id gnl|my_center|LOCUS_04610 784 1068 gene locus_tag LOCUS_04620 gene rplW 784 1068 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_04620 1069 1899 gene locus_tag LOCUS_04630 gene rplB 1069 1899 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_04630 1929 2213 gene locus_tag LOCUS_04640 gene rpsS 1929 2213 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_04640 2272 2613 gene locus_tag LOCUS_04650 2272 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2615 3538 gene locus_tag LOCUS_04660 2615 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3542 3958 gene locus_tag LOCUS_04670 gene rplP 3542 3958 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_04670 3971 4177 gene locus_tag LOCUS_04680 gene rpmC 3971 4177 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938606.1 protein_id gnl|my_center|LOCUS_04680 4174 4503 gene locus_tag LOCUS_04690 4174 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4504 4872 gene locus_tag LOCUS_04700 gene rplN 4504 4872 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_04700 4875 5186 gene locus_tag LOCUS_04710 gene rplX 4875 5186 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_04710 5248 5757 gene locus_tag LOCUS_04720 gene rplE 5248 5757 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583357.1 protein_id gnl|my_center|LOCUS_04720 5785 5994 gene locus_tag LOCUS_04730 5785 5994 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_04730 6117 6521 gene locus_tag LOCUS_04740 gene rpsH 6117 6521 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_04740 6540 7085 gene locus_tag LOCUS_04750 gene rplF 6540 7085 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_04750 7127 7459 gene locus_tag LOCUS_04760 gene rplR 7127 7459 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_04760 7482 7652 gene locus_tag LOCUS_04770 7482 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7649 8128 gene locus_tag LOCUS_04780 gene rpsE 7649 8128 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_04780 8134 8316 gene locus_tag LOCUS_04790 gene rpmD 8134 8316 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_04790 8360 8800 gene locus_tag LOCUS_04800 gene rplO 8360 8800 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258250.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence047 1211 459 gene locus_tag LOCUS_04810 1211 459 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808754.1 protein_id gnl|my_center|LOCUS_04810 2105 1344 gene locus_tag LOCUS_04820 2105 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2595 2437 gene locus_tag LOCUS_04830 2595 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3196 2750 gene locus_tag LOCUS_04840 3196 2750 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088906.1 protein_id gnl|my_center|LOCUS_04840 3663 3382 gene locus_tag LOCUS_04850 3663 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5138 3660 gene locus_tag LOCUS_04860 5138 3660 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966044.1 protein_id gnl|my_center|LOCUS_04860 5664 5320 gene locus_tag LOCUS_04870 5664 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5584 6609 gene locus_tag LOCUS_04880 gene larA 5584 6609 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224947.1 protein_id gnl|my_center|LOCUS_04880 6698 7135 gene locus_tag LOCUS_04890 6698 7135 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_04890 7442 7167 gene locus_tag LOCUS_04900 7442 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7613 8578 gene locus_tag LOCUS_04910 7613 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence048 <1 1258 gene locus_tag LOCUS_04920 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085749.1:thiamine pyrophosphate-binding protein 1674 2780 gene locus_tag LOCUS_04930 1674 2780 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_04930 2777 4429 gene locus_tag LOCUS_04940 2777 4429 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_04940 4426 5598 gene locus_tag LOCUS_04950 4426 5598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256230.1 protein_id gnl|my_center|LOCUS_04950 7034 5751 gene locus_tag LOCUS_04960 7034 5751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_04960 8093 7149 gene locus_tag LOCUS_04970 8093 7149 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_04970 8849 8220 gene locus_tag LOCUS_04980 8849 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence049 356 102 gene locus_tag LOCUS_04990 356 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 493 1296 gene locus_tag LOCUS_05000 493 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1335 2165 gene locus_tag LOCUS_05010 gene fabG 1335 2165 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_05010 2313 2711 gene locus_tag LOCUS_05020 2313 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3746 2811 gene locus_tag LOCUS_05030 3746 2811 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228092.1 protein_id gnl|my_center|LOCUS_05030 4801 3752 gene locus_tag LOCUS_05040 4801 3752 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_05040 5621 5070 gene locus_tag LOCUS_05050 5621 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5888 7252 gene locus_tag LOCUS_05060 5888 7252 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_05060 7303 8577 gene locus_tag LOCUS_05070 gene fabF 7303 8577 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence050 1278 286 gene locus_tag LOCUS_05080 1278 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 1457 4261 gene locus_tag LOCUS_05090 gene ppc 1457 4261 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_05090 4762 4307 gene locus_tag LOCUS_05100 4762 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5212 4901 gene locus_tag LOCUS_05110 5212 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5546 5361 gene locus_tag LOCUS_05120 5546 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7150 5648 gene locus_tag LOCUS_05130 7150 5648 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_05130 8423 7335 gene locus_tag LOCUS_05140 8423 7335 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence051 1107 280 gene locus_tag LOCUS_05150 1107 280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103283.1 protein_id gnl|my_center|LOCUS_05150 1931 1104 gene locus_tag LOCUS_05160 1931 1104 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_05160 2818 1928 gene locus_tag LOCUS_05170 2818 1928 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_05170 2887 3846 gene locus_tag LOCUS_05180 2887 3846 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_05180 4304 3924 gene locus_tag LOCUS_05190 4304 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4544 4936 gene locus_tag LOCUS_05200 4544 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4939 5682 gene locus_tag LOCUS_05210 4939 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6738 5791 gene locus_tag LOCUS_05220 6738 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7928 6735 gene locus_tag LOCUS_05230 gene dgaE 7928 6735 CDS product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_05230 <8708 8158 gene locus_tag LOCUS_05240 <8708 8158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256764.1:ATP-binding protein >Feature sequence052 1708 491 gene locus_tag LOCUS_05250 1708 491 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888964.1 protein_id gnl|my_center|LOCUS_05250 2967 1924 gene locus_tag LOCUS_05260 2967 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4674 2971 gene locus_tag LOCUS_05270 4674 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5520 4759 gene locus_tag LOCUS_05280 5520 4759 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_05280 6563 5586 gene locus_tag LOCUS_05290 6563 5586 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_05290 6982 8169 gene locus_tag LOCUS_05300 gene nifS 6982 8169 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence053 402 1325 gene locus_tag LOCUS_05310 gene pdhA 402 1325 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_05310 1388 2365 gene locus_tag LOCUS_05320 1388 2365 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_05320 2494 3714 gene locus_tag LOCUS_05330 2494 3714 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_05330 3831 5450 gene locus_tag LOCUS_05340 3831 5450 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_05340 6044 5526 gene locus_tag LOCUS_05350 6044 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7679 6216 gene locus_tag LOCUS_05360 7679 6216 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909313.1 protein_id gnl|my_center|LOCUS_05360 8374 7694 gene locus_tag LOCUS_05370 8374 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence054 2106 1522 gene locus_tag LOCUS_05380 2106 1522 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993549.1 protein_id gnl|my_center|LOCUS_05380 2253 2564 gene locus_tag LOCUS_05390 2253 2564 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_05390 2561 3010 gene locus_tag LOCUS_05400 2561 3010 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969510.1 protein_id gnl|my_center|LOCUS_05400 3090 3662 gene locus_tag LOCUS_05410 3090 3662 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_05410 4630 3878 gene locus_tag LOCUS_05420 4630 3878 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392252.1 protein_id gnl|my_center|LOCUS_05420 6471 4645 gene locus_tag LOCUS_05430 6471 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 7304 6606 gene locus_tag LOCUS_05440 7304 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 8330 7305 gene locus_tag LOCUS_05450 8330 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence055 1236 82 gene locus_tag LOCUS_05460 1236 82 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_05460 3014 1233 gene locus_tag LOCUS_05470 3014 1233 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_05470 3832 2966 gene locus_tag LOCUS_05480 gene degU 3832 2966 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_05480 4212 4568 gene locus_tag LOCUS_05490 4212 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4809 5552 gene locus_tag LOCUS_05500 4809 5552 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256823.1 protein_id gnl|my_center|LOCUS_05500 5569 6255 gene locus_tag LOCUS_05510 5569 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6603 7139 gene locus_tag LOCUS_05520 6603 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05520 >Feature sequence056 <1 2896 gene locus_tag LOCUS_05530 <1 2896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141493.1:ATP-binding protein 3729 2908 gene locus_tag LOCUS_05540 3729 2908 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_05540 4222 3758 gene locus_tag LOCUS_05550 4222 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4448 7336 gene locus_tag LOCUS_05560 gene polA 4448 7336 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence057 490 1581 gene locus_tag LOCUS_05570 490 1581 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_05570 1571 1924 gene locus_tag LOCUS_05580 gene rplQ 1571 1924 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_05580 1992 2768 gene locus_tag LOCUS_05590 gene truA 1992 2768 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_05590 2780 3241 gene locus_tag LOCUS_05600 gene rplM 2780 3241 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_05600 3242 3640 gene locus_tag LOCUS_05610 gene rpsI 3242 3640 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_05610 4649 3786 gene locus_tag LOCUS_05620 gene prmC 4649 3786 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_05620 5680 4658 gene locus_tag LOCUS_05630 gene prfA 5680 4658 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_05630 7128 5845 gene locus_tag LOCUS_05640 gene hisS 7128 5845 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_05640 <8269 7237 gene locus_tag LOCUS_05650 <8269 7237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058024.1:GuaB3 family IMP dehydrogenase-related protein >Feature sequence058 585 1235 gene locus_tag LOCUS_05660 585 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1494 1931 gene locus_tag LOCUS_05670 1494 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2175 3827 gene locus_tag LOCUS_05680 2175 3827 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_05680 3958 4341 gene locus_tag LOCUS_05690 3958 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4373 5134 gene locus_tag LOCUS_05700 4373 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5585 6523 gene locus_tag LOCUS_05710 5585 6523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_05710 6539 7531 gene locus_tag LOCUS_05720 6539 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence059 509 889 gene locus_tag LOCUS_05730 509 889 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_05730 1487 1047 gene locus_tag LOCUS_05740 1487 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2587 1595 gene locus_tag LOCUS_05750 2587 1595 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437556.1 protein_id gnl|my_center|LOCUS_05750 3385 2588 gene locus_tag LOCUS_05760 3385 2588 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_05760 3723 4436 gene locus_tag LOCUS_05770 gene rsmG 3723 4436 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_05770 4433 5572 gene locus_tag LOCUS_05780 4433 5572 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259095.1 protein_id gnl|my_center|LOCUS_05780 5697 5772 gene locus_tag LOCUS_t00060 5697 5772 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6026 7219 gene locus_tag LOCUS_05790 6026 7219 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence060 687 232 gene locus_tag LOCUS_05800 687 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1719 1084 gene locus_tag LOCUS_05810 1719 1084 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_05810 1966 2325 gene locus_tag LOCUS_05820 1966 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3769 2363 gene locus_tag LOCUS_05830 gene sthA 3769 2363 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_05830 4750 3869 gene locus_tag LOCUS_05840 4750 3869 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289156.1 protein_id gnl|my_center|LOCUS_05840 6456 4999 gene locus_tag LOCUS_05850 6456 4999 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_05850 7251 6496 gene locus_tag LOCUS_05860 7251 6496 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640330.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence061 1349 429 gene locus_tag LOCUS_05870 1349 429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_05870 2260 1412 gene locus_tag LOCUS_05880 2260 1412 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083944.1 protein_id gnl|my_center|LOCUS_05880 3250 2546 gene locus_tag LOCUS_05890 3250 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3821 3465 gene locus_tag LOCUS_05900 3821 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4304 3936 gene locus_tag LOCUS_05910 4304 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4889 5992 gene locus_tag LOCUS_05920 4889 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6144 6881 gene locus_tag LOCUS_05930 6144 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05930 6878 7423 gene locus_tag LOCUS_05940 6878 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence062 509 976 gene locus_tag LOCUS_05950 509 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1741 1037 gene locus_tag LOCUS_05960 1741 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3763 1817 gene locus_tag LOCUS_05970 3763 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4218 3703 gene locus_tag LOCUS_05980 4218 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 4659 5444 gene locus_tag LOCUS_05990 4659 5444 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090312.1 protein_id gnl|my_center|LOCUS_05990 5441 6109 gene locus_tag LOCUS_06000 5441 6109 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_06000 6261 6578 gene locus_tag LOCUS_06010 6261 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7014 6547 gene locus_tag LOCUS_06020 7014 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence063 1022 312 gene locus_tag LOCUS_06030 gene yycF 1022 312 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357947.1 protein_id gnl|my_center|LOCUS_06030 1476 1808 gene locus_tag LOCUS_06040 1476 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2898 1864 gene locus_tag LOCUS_06050 2898 1864 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_06050 4060 3080 gene locus_tag LOCUS_06060 4060 3080 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_06060 4200 5303 gene locus_tag LOCUS_06070 4200 5303 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763300.1 protein_id gnl|my_center|LOCUS_06070 5418 7529 gene locus_tag LOCUS_06080 5418 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence064 1920 19 gene locus_tag LOCUS_06090 1920 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2889 2107 gene locus_tag LOCUS_06100 gene rlmB 2889 2107 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_06100 3110 3595 gene locus_tag LOCUS_06110 3110 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4914 3607 gene locus_tag LOCUS_06120 4914 3607 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_06120 6382 5063 gene locus_tag LOCUS_06130 6382 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6685 7134 gene locus_tag LOCUS_06140 6685 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence065 142 408 gene locus_tag LOCUS_06150 142 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 1344 487 gene locus_tag LOCUS_06160 1344 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1849 2454 gene locus_tag LOCUS_06170 1849 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2545 4839 gene locus_tag LOCUS_06180 2545 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 4829 7183 gene locus_tag LOCUS_06190 4829 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence066 491 2032 gene locus_tag LOCUS_06200 gene purH 491 2032 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_06200 2038 2778 gene locus_tag LOCUS_06210 2038 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2966 3964 gene locus_tag LOCUS_06220 2966 3964 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_06220 5678 4209 gene locus_tag LOCUS_06230 gene tilS 5678 4209 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_06230 6955 5675 gene locus_tag LOCUS_06240 6955 5675 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence067 3499 524 gene locus_tag LOCUS_06250 3499 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3925 5208 gene locus_tag LOCUS_06260 3925 5208 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_06260 5205 6017 gene locus_tag LOCUS_06270 gene cysQ 5205 6017 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886919.1 protein_id gnl|my_center|LOCUS_06270 6145 7458 gene locus_tag LOCUS_06280 6145 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence068 1942 956 gene locus_tag LOCUS_06290 1942 956 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972097.1 protein_id gnl|my_center|LOCUS_06290 3015 2032 gene locus_tag LOCUS_06300 3015 2032 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969520.1 protein_id gnl|my_center|LOCUS_06300 4053 3061 gene locus_tag LOCUS_06310 4053 3061 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_06310 5059 4073 gene locus_tag LOCUS_06320 gene tdh 5059 4073 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_06320 6115 5141 gene locus_tag LOCUS_06330 gene gutB 6115 5141 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_06330 6417 7487 gene locus_tag LOCUS_06340 6417 7487 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684060.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence069 167 514 gene locus_tag LOCUS_06350 167 514 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_06350 511 1104 gene locus_tag LOCUS_06360 gene yqeK 511 1104 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460891.1 protein_id gnl|my_center|LOCUS_06360 2227 1313 gene locus_tag LOCUS_06370 2227 1313 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965351.1 protein_id gnl|my_center|LOCUS_06370 2440 2228 gene locus_tag LOCUS_06380 2440 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2485 2946 gene locus_tag LOCUS_06390 2485 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3443 2991 gene locus_tag LOCUS_06400 3443 2991 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_06400 3657 4826 gene locus_tag LOCUS_06410 gene dgoD 3657 4826 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_06410 4889 6040 gene locus_tag LOCUS_06420 gene dgoD 4889 6040 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_06420 7064 6273 gene locus_tag LOCUS_06430 7064 6273 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence070 506 1348 gene locus_tag LOCUS_06440 506 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1541 2245 gene locus_tag LOCUS_06450 1541 2245 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476385.1 protein_id gnl|my_center|LOCUS_06450 2402 4075 gene locus_tag LOCUS_06460 2402 4075 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942078.1 protein_id gnl|my_center|LOCUS_06460 5285 4155 gene locus_tag LOCUS_06470 gene dgoD 5285 4155 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_06470 6171 5440 gene locus_tag LOCUS_06480 6171 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6490 6894 gene locus_tag LOCUS_06490 6490 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7197 6784 gene locus_tag LOCUS_06500 7197 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence071 <1 786 gene locus_tag LOCUS_06510 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967441.1:beta-propeller fold lactonase family protein 982 1941 gene locus_tag LOCUS_06520 982 1941 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_06520 2075 2917 gene locus_tag LOCUS_06530 gene pstC 2075 2917 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_06530 2917 3876 gene locus_tag LOCUS_06540 gene pstA 2917 3876 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_06540 3880 4803 gene locus_tag LOCUS_06550 gene pstB 3880 4803 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_06550 4874 5245 gene locus_tag LOCUS_06560 4874 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence072 1128 2984 gene locus_tag LOCUS_06570 1128 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3323 5404 gene locus_tag LOCUS_06580 3323 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence073 2286 229 gene locus_tag LOCUS_06590 2286 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3671 2724 gene locus_tag LOCUS_06600 3671 2724 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_06600 4011 4205 gene locus_tag LOCUS_06610 4011 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5562 4639 gene locus_tag LOCUS_06620 gene fmt 5562 4639 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_06620 5947 5696 gene locus_tag LOCUS_06630 5947 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5883 6584 gene locus_tag LOCUS_06640 5883 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6586 7026 gene locus_tag LOCUS_06650 6586 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence074 388 2610 gene locus_tag LOCUS_06660 388 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2890 3708 gene locus_tag LOCUS_06670 2890 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4985 3705 gene locus_tag LOCUS_06680 4985 3705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_06680 5222 6088 gene locus_tag LOCUS_06690 5222 6088 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705540.1 protein_id gnl|my_center|LOCUS_06690 6248 7018 gene locus_tag LOCUS_06700 gene yfaU 6248 7018 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992992.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence075 259 26 gene locus_tag LOCUS_06710 259 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 735 529 gene locus_tag LOCUS_06720 735 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3490 872 gene locus_tag LOCUS_06730 3490 872 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_06730 3759 3493 gene locus_tag LOCUS_06740 3759 3493 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_06740 3935 4294 gene locus_tag LOCUS_06750 3935 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4637 5398 gene locus_tag LOCUS_06760 4637 5398 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_06760 5514 5795 gene locus_tag LOCUS_06770 5514 5795 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_06770 <7330 5938 gene locus_tag LOCUS_06780 <7330 5938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228113.1:nitrite/sulfite reductase >Feature sequence076 715 1770 gene locus_tag LOCUS_06790 715 1770 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972726.1 protein_id gnl|my_center|LOCUS_06790 2051 2983 gene locus_tag LOCUS_06800 2051 2983 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256486.1 protein_id gnl|my_center|LOCUS_06800 3475 3137 gene locus_tag LOCUS_06810 3475 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4749 3811 gene locus_tag LOCUS_06820 4749 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4820 5617 gene locus_tag LOCUS_06830 4820 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6657 5632 gene locus_tag LOCUS_06840 6657 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6980 6654 gene locus_tag LOCUS_06850 6980 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 6865 7218 gene locus_tag LOCUS_06860 6865 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence077 433 1413 gene locus_tag LOCUS_06870 433 1413 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_06870 1474 1692 gene locus_tag LOCUS_06880 1474 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1771 2067 gene locus_tag LOCUS_06890 1771 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3343 2156 gene locus_tag LOCUS_06900 3343 2156 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974857.1 protein_id gnl|my_center|LOCUS_06900 4849 3629 gene locus_tag LOCUS_06910 4849 3629 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194774.1 protein_id gnl|my_center|LOCUS_06910 5095 6195 gene locus_tag LOCUS_06920 5095 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 <7265 6371 gene locus_tag LOCUS_06930 <7265 6371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968789.1:MFS transporter >Feature sequence078 1408 1070 gene locus_tag LOCUS_06940 1408 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1737 2051 gene locus_tag LOCUS_06950 1737 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2863 2228 gene locus_tag LOCUS_06960 2863 2228 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_06960 3374 3162 gene locus_tag LOCUS_06970 3374 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3355 4986 gene locus_tag LOCUS_06980 3355 4986 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_06980 5568 5209 gene locus_tag LOCUS_06990 5568 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5776 6435 gene locus_tag LOCUS_07000 5776 6435 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_07000 6655 6568 gene locus_tag LOCUS_t00070 6655 6568 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 1245 166 gene locus_tag LOCUS_07010 1245 166 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_07010 1447 2319 gene locus_tag LOCUS_07020 1447 2319 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_07020 2392 3351 gene locus_tag LOCUS_07030 gene rbsK 2392 3351 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_07030 3498 3746 gene locus_tag LOCUS_07040 3498 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7108 3791 gene locus_tag LOCUS_07050 7108 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence080 749 201 gene locus_tag LOCUS_07060 749 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1186 857 gene locus_tag LOCUS_07070 1186 857 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_07070 2648 1200 gene locus_tag LOCUS_07080 2648 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2815 3417 gene locus_tag LOCUS_07090 gene pdxH 2815 3417 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_07090 5026 3737 gene locus_tag LOCUS_07100 5026 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6968 5628 gene locus_tag LOCUS_07110 6968 5628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence081 <1 802 gene locus_tag LOCUS_07120 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403503.1:glucose 1-dehydrogenase 2235 871 gene locus_tag LOCUS_07130 2235 871 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_07130 2459 2232 gene locus_tag LOCUS_07140 2459 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2954 2574 gene locus_tag LOCUS_07150 gene rplL 2954 2574 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_07150 3970 3062 gene locus_tag LOCUS_07160 3970 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4935 4222 gene locus_tag LOCUS_07170 gene rplA 4935 4222 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_07170 5418 4993 gene locus_tag LOCUS_07180 gene rplK 5418 4993 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_07180 5930 5472 gene locus_tag LOCUS_07190 gene nusG 5930 5472 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_07190 6287 6048 gene locus_tag LOCUS_07200 6287 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence082 3700 164 gene locus_tag LOCUS_07210 gene mfd 3700 164 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_07210 3927 5201 gene locus_tag LOCUS_07220 gene proB 3927 5201 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 protein_id gnl|my_center|LOCUS_07220 5198 6478 gene locus_tag LOCUS_07230 5198 6478 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 protein_id gnl|my_center|LOCUS_07230 6481 6798 gene locus_tag LOCUS_07240 6481 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence083 <1 785 gene locus_tag LOCUS_07250 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein 1665 946 gene locus_tag LOCUS_07260 1665 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1922 1995 gene locus_tag LOCUS_t00080 1922 1995 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3388 2288 gene locus_tag LOCUS_07270 3388 2288 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368432.1 protein_id gnl|my_center|LOCUS_07270 4651 3476 gene locus_tag LOCUS_07280 4651 3476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368431.1 protein_id gnl|my_center|LOCUS_07280 6094 4868 gene locus_tag LOCUS_07290 6094 4868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_07290 5991 6251 gene locus_tag LOCUS_07300 5991 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 <6983 6297 gene locus_tag LOCUS_07310 <6983 6297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258475.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme >Feature sequence084 1096 83 gene locus_tag LOCUS_07320 1096 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2390 1248 gene locus_tag LOCUS_07330 2390 1248 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_07330 3877 2483 gene locus_tag LOCUS_07340 3877 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4092 5000 gene locus_tag LOCUS_07350 4092 5000 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_07350 5116 6393 gene locus_tag LOCUS_07360 5116 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence085 156 1055 gene locus_tag LOCUS_07370 156 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1098 2015 gene locus_tag LOCUS_07380 1098 2015 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043110.1 protein_id gnl|my_center|LOCUS_07380 2255 3088 gene locus_tag LOCUS_07390 2255 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3407 3120 gene locus_tag LOCUS_07400 3407 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3792 3295 gene locus_tag LOCUS_07410 3792 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4831 3776 gene locus_tag LOCUS_07420 4831 3776 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_07420 5020 5283 gene locus_tag LOCUS_07430 5020 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 6026 5280 gene locus_tag LOCUS_07440 6026 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <6944 6030 gene locus_tag LOCUS_07450 <6944 6030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948020.1:competence/damage-inducible protein A >Feature sequence086 968 699 gene locus_tag LOCUS_07460 968 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1251 2618 gene locus_tag LOCUS_07470 1251 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3753 2644 gene locus_tag LOCUS_07480 3753 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4430 3750 gene locus_tag LOCUS_07490 4430 3750 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_07490 5322 4579 gene locus_tag LOCUS_07500 5322 4579 CDS product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 protein_id gnl|my_center|LOCUS_07500 6715 5420 gene locus_tag LOCUS_07510 6715 5420 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence087 648 1571 gene locus_tag LOCUS_07520 648 1571 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_07520 2722 1859 gene locus_tag LOCUS_07530 gene fabL 2722 1859 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_07530 3446 2691 gene locus_tag LOCUS_07540 gene fabG 3446 2691 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_07540 4493 3468 gene locus_tag LOCUS_07550 4493 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4975 4535 gene locus_tag LOCUS_07560 4975 4535 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_07560 5367 4972 gene locus_tag LOCUS_07570 5367 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5914 5549 gene locus_tag LOCUS_07580 5914 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence088 3336 2671 gene locus_tag LOCUS_07590 3336 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 3698 4114 gene locus_tag LOCUS_07600 gene rpsL 3698 4114 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_07600 4405 4785 gene locus_tag LOCUS_07610 gene rpsG 4405 4785 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence089 711 2339 gene locus_tag LOCUS_07620 711 2339 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_07620 3766 2633 gene locus_tag LOCUS_07630 gene solA 3766 2633 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_07630 4455 3763 gene locus_tag LOCUS_07640 4455 3763 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_07640 5456 4458 gene locus_tag LOCUS_07650 5456 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence090 1350 343 gene locus_tag LOCUS_07660 1350 343 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258602.1 protein_id gnl|my_center|LOCUS_07660 3704 1479 gene locus_tag LOCUS_07670 3704 1479 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_07670 6712 3812 gene locus_tag LOCUS_07680 6712 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence091 344 1549 gene locus_tag LOCUS_07690 344 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2367 1546 gene locus_tag LOCUS_07700 2367 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2419 2997 gene locus_tag LOCUS_07710 2419 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3360 3076 gene locus_tag LOCUS_07720 3360 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3731 3360 gene locus_tag LOCUS_07730 3731 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4610 3741 gene locus_tag LOCUS_07740 4610 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4951 4613 gene locus_tag LOCUS_07750 4951 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5312 5103 gene locus_tag LOCUS_07760 5312 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence092 1020 118 gene locus_tag LOCUS_07770 1020 118 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_07770 2255 1134 gene locus_tag LOCUS_07780 2255 1134 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_07780 3643 2825 gene locus_tag LOCUS_07790 gene pcaD 3643 2825 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_07790 5474 3714 gene locus_tag LOCUS_07800 5474 3714 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_07800 5672 5950 gene locus_tag LOCUS_07810 5672 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 5961 6305 gene locus_tag LOCUS_07820 5961 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence093 <1 546 gene locus_tag LOCUS_07830 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085126.1:adenylate/guanylate cyclase domain-containing protein 872 1543 gene locus_tag LOCUS_07840 872 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2447 1635 gene locus_tag LOCUS_07850 2447 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2766 2437 gene locus_tag LOCUS_07860 2766 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4057 2837 gene locus_tag LOCUS_07870 gene xseA 4057 2837 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838345.1 protein_id gnl|my_center|LOCUS_07870 4724 4158 gene locus_tag LOCUS_07880 gene efp 4724 4158 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_07880 5919 4831 gene locus_tag LOCUS_07890 5919 4831 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 protein_id gnl|my_center|LOCUS_07890 6419 5916 gene locus_tag LOCUS_07900 gene aroQ 6419 5916 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256299.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence094 1535 375 gene locus_tag LOCUS_07910 1535 375 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259183.1 protein_id gnl|my_center|LOCUS_07910 1766 2761 gene locus_tag LOCUS_07920 gene cofD 1766 2761 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_07920 2791 3453 gene locus_tag LOCUS_07930 2791 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3483 4427 gene locus_tag LOCUS_07940 3483 4427 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229093.1 protein_id gnl|my_center|LOCUS_07940 4914 4453 gene locus_tag LOCUS_07950 4914 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <6590 5375 gene locus_tag LOCUS_07960 <6590 5375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176674.1:MFS transporter >Feature sequence095 <1 665 gene locus_tag LOCUS_07970 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762093.1:alcohol dehydrogenase catalytic domain-containing protein 760 1233 gene locus_tag LOCUS_07980 760 1233 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_07980 1731 1339 gene locus_tag LOCUS_07990 1731 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2652 1732 gene locus_tag LOCUS_08000 gene ispE 2652 1732 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_08000 3587 2652 gene locus_tag LOCUS_08010 gene rsmA 3587 2652 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256787.1 protein_id gnl|my_center|LOCUS_08010 3988 4878 gene locus_tag LOCUS_08020 gene galU 3988 4878 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389966.1 protein_id gnl|my_center|LOCUS_08020 5052 5573 gene locus_tag LOCUS_08030 5052 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6551 5820 gene locus_tag LOCUS_08040 6551 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence096 4060 542 gene locus_tag LOCUS_08050 4060 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5595 4744 gene locus_tag LOCUS_08060 5595 4744 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140485.1 protein_id gnl|my_center|LOCUS_08060 6153 5851 gene locus_tag LOCUS_08070 6153 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence097 <1 1047 gene locus_tag LOCUS_08080 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931942.1:6-phosphofructokinase 1097 1834 gene locus_tag LOCUS_08090 1097 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3289 1934 gene locus_tag LOCUS_08100 3289 1934 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_08100 3735 3349 gene locus_tag LOCUS_08110 3735 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5129 3732 gene locus_tag LOCUS_08120 gene selA 5129 3732 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_08120 5254 5877 gene locus_tag LOCUS_08130 gene coaE 5254 5877 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence098 385 1221 gene locus_tag LOCUS_08140 gene panB 385 1221 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_08140 1283 2101 gene locus_tag LOCUS_08150 gene panC 1283 2101 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258070.1 protein_id gnl|my_center|LOCUS_08150 2157 3014 gene locus_tag LOCUS_08160 gene surE 2157 3014 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698379.1 protein_id gnl|my_center|LOCUS_08160 3807 3028 gene locus_tag LOCUS_08170 3807 3028 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064244.1 protein_id gnl|my_center|LOCUS_08170 3961 5955 gene locus_tag LOCUS_08180 3961 5955 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence099 <1 1902 gene locus_tag LOCUS_08190 <1 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968069.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 2032 2595 gene locus_tag LOCUS_08200 2032 2595 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_08200 2767 2630 gene locus_tag LOCUS_08210 2767 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3466 2804 gene locus_tag LOCUS_08220 gene arsM 3466 2804 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08220 5255 3531 gene locus_tag LOCUS_08230 5255 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence100 591 373 gene locus_tag LOCUS_08240 591 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1218 715 gene locus_tag LOCUS_08250 1218 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1572 1246 gene locus_tag LOCUS_08260 1572 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2665 1580 gene locus_tag LOCUS_08270 2665 1580 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_08270 4293 3010 gene locus_tag LOCUS_08280 gene tyrS 4293 3010 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_08280 5243 4290 gene locus_tag LOCUS_08290 5243 4290 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_08290 <6294 5358 gene locus_tag LOCUS_08300 <6294 5358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258092.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence101 <1 2821 gene locus_tag LOCUS_08310 <1 2821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031572.1:helix-turn-helix transcriptional regulator 2839 3597 gene locus_tag LOCUS_08320 2839 3597 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_08320 5073 4246 gene locus_tag LOCUS_08330 5073 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5289 5612 gene locus_tag LOCUS_08340 5289 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5687 6010 gene locus_tag LOCUS_08350 5687 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence102 336 2270 gene locus_tag LOCUS_08360 336 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2433 3281 gene locus_tag LOCUS_08370 2433 3281 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_08370 4415 3357 gene locus_tag LOCUS_08380 4415 3357 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_08380 4666 5598 gene locus_tag LOCUS_08390 4666 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5653 6045 gene locus_tag LOCUS_08400 5653 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence103 3069 1885 gene locus_tag LOCUS_08410 3069 1885 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_08410 5136 3484 gene locus_tag LOCUS_08420 5136 3484 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_08420 <6099 5427 gene locus_tag LOCUS_08430 <6099 5427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903197.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence104 2185 1790 gene locus_tag LOCUS_08440 2185 1790 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_08440 3018 2224 gene locus_tag LOCUS_08450 3018 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3235 4194 gene locus_tag LOCUS_08460 3235 4194 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021352.1 protein_id gnl|my_center|LOCUS_08460 5018 4245 gene locus_tag LOCUS_08470 5018 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5837 5064 gene locus_tag LOCUS_08480 5837 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence105 2019 886 gene locus_tag LOCUS_08490 2019 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2502 2239 gene locus_tag LOCUS_08500 gene yidD 2502 2239 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_08500 2924 2505 gene locus_tag LOCUS_08510 gene rnpA 2924 2505 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256030.1 protein_id gnl|my_center|LOCUS_08510 3275 4126 gene locus_tag LOCUS_08520 3275 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4329 5333 gene locus_tag LOCUS_08530 4329 5333 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence106 <1 906 gene locus_tag LOCUS_08540 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010080872.1:quinolinate synthase NadA 927 1781 gene locus_tag LOCUS_08550 gene nadC 927 1781 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_08550 1874 3382 gene locus_tag LOCUS_08560 1874 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3895 3446 gene locus_tag LOCUS_08570 3895 3446 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898745.1 protein_id gnl|my_center|LOCUS_08570 4409 3975 gene locus_tag LOCUS_08580 gene dtd 4409 3975 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_08580 4607 4804 gene locus_tag LOCUS_08590 4607 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 <5971 5121 gene locus_tag LOCUS_08600 <5971 5121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768344.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence107 1194 379 gene locus_tag LOCUS_08610 1194 379 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_08610 2197 1196 gene locus_tag LOCUS_08620 2197 1196 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_08620 3141 2212 gene locus_tag LOCUS_08630 gene ilvE 3141 2212 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_08630 3976 3278 gene locus_tag LOCUS_08640 3976 3278 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_08640 4832 4068 gene locus_tag LOCUS_08650 4832 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 <5965 4850 gene locus_tag LOCUS_08660 <5965 4850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980451.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence108 697 3258 gene locus_tag LOCUS_08670 gene tkt 697 3258 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_08670 3315 4118 gene locus_tag LOCUS_08680 3315 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4544 5815 gene locus_tag LOCUS_08690 4544 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence109 421 1293 gene locus_tag LOCUS_08700 421 1293 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_08700 2773 1835 gene locus_tag LOCUS_08710 2773 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3083 3730 gene locus_tag LOCUS_08720 3083 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4421 3732 gene locus_tag LOCUS_08730 4421 3732 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256260.1 protein_id gnl|my_center|LOCUS_08730 4543 5664 gene locus_tag LOCUS_08740 4543 5664 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence110 791 1360 gene locus_tag LOCUS_08750 gene orn 791 1360 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763007.1 protein_id gnl|my_center|LOCUS_08750 1748 1461 gene locus_tag LOCUS_08760 gene clpS 1748 1461 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140748.1 protein_id gnl|my_center|LOCUS_08760 2670 1765 gene locus_tag LOCUS_08770 2670 1765 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_08770 3131 3979 gene locus_tag LOCUS_08780 3131 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4511 5473 gene locus_tag LOCUS_08790 4511 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence111 890 975 gene locus_tag LOCUS_t00090 890 975 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1036 1111 gene locus_tag LOCUS_t00100 1036 1111 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1311 1387 gene locus_tag LOCUS_t00110 1311 1387 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1489 2460 gene locus_tag LOCUS_08800 1489 2460 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_08800 2539 3903 gene locus_tag LOCUS_08810 2539 3903 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence112 133 1161 gene locus_tag LOCUS_08820 133 1161 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700775.1 protein_id gnl|my_center|LOCUS_08820 1584 1189 gene locus_tag LOCUS_08830 1584 1189 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088081.1 protein_id gnl|my_center|LOCUS_08830 1935 1654 gene locus_tag LOCUS_08840 gene bauB 1935 1654 CDS product beta-alanine degradation protein BauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083790.1 protein_id gnl|my_center|LOCUS_08840 2183 3259 gene locus_tag LOCUS_08850 2183 3259 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965454.1 protein_id gnl|my_center|LOCUS_08850 5068 3518 gene locus_tag LOCUS_08860 5068 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 5830 5153 gene locus_tag LOCUS_08870 5830 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence113 1663 437 gene locus_tag LOCUS_08880 1663 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2984 1734 gene locus_tag LOCUS_08890 2984 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4051 3323 gene locus_tag LOCUS_08900 4051 3323 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08900 4268 5581 gene locus_tag LOCUS_08910 gene hemA 4268 5581 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence114 32 1309 gene locus_tag LOCUS_08920 32 1309 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815840.1 protein_id gnl|my_center|LOCUS_08920 1368 2678 gene locus_tag LOCUS_08930 1368 2678 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_08930 2765 4090 gene locus_tag LOCUS_08940 2765 4090 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_08940 4091 5362 gene locus_tag LOCUS_08950 4091 5362 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420380.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence115 1329 28 gene locus_tag LOCUS_08960 1329 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1650 2390 gene locus_tag LOCUS_08970 1650 2390 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_08970 2433 2825 gene locus_tag LOCUS_08980 2433 2825 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_08980 2827 3507 gene locus_tag LOCUS_08990 gene tenA 2827 3507 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_08990 4664 3798 gene locus_tag LOCUS_09000 4664 3798 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211711.1 protein_id gnl|my_center|LOCUS_09000 4759 4995 gene locus_tag LOCUS_09010 4759 4995 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256580.1 protein_id gnl|my_center|LOCUS_09010 5060 5440 gene locus_tag LOCUS_09020 gene crcB 5060 5440 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011704.1 protein_id gnl|my_center|LOCUS_09020 5594 5520 gene locus_tag LOCUS_t00120 5594 5520 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 739 1356 gene locus_tag LOCUS_09030 739 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2645 1650 gene locus_tag LOCUS_09040 2645 1650 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_09040 2958 2671 gene locus_tag LOCUS_09050 2958 2671 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755918.1 protein_id gnl|my_center|LOCUS_09050 3766 3005 gene locus_tag LOCUS_09060 3766 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5023 3881 gene locus_tag LOCUS_09070 5023 3881 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_09070 <5807 5111 gene locus_tag LOCUS_09080 <5807 5111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974245.1:aldo/keto reductase >Feature sequence117 324 626 gene locus_tag LOCUS_09090 324 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 729 1022 gene locus_tag LOCUS_09100 729 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1051 1725 gene locus_tag LOCUS_09110 1051 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2278 1784 gene locus_tag LOCUS_09120 2278 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3013 2303 gene locus_tag LOCUS_09130 gene plsY 3013 2303 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_09130 4022 3015 gene locus_tag LOCUS_09140 4022 3015 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_09140 5680 4151 gene locus_tag LOCUS_09150 gene rny 5680 4151 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence118 1652 528 gene locus_tag LOCUS_09160 1652 528 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972708.1 protein_id gnl|my_center|LOCUS_09160 2552 1704 gene locus_tag LOCUS_09170 2552 1704 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104400.1 protein_id gnl|my_center|LOCUS_09170 3865 2582 gene locus_tag LOCUS_09180 3865 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 5079 3865 gene locus_tag LOCUS_09190 5079 3865 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence119 1408 356 gene locus_tag LOCUS_09200 1408 356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_09200 1561 1788 gene locus_tag LOCUS_09210 1561 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1808 2344 gene locus_tag LOCUS_09220 1808 2344 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402240.1 protein_id gnl|my_center|LOCUS_09220 3496 2516 gene locus_tag LOCUS_09230 gene ala 3496 2516 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_09230 4445 3576 gene locus_tag LOCUS_09240 gene thiD 4445 3576 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_09240 5092 4442 gene locus_tag LOCUS_09250 gene tenA 5092 4442 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144491.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence120 1417 695 gene locus_tag LOCUS_09260 1417 695 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_09260 1519 2148 gene locus_tag LOCUS_09270 gene raiA 1519 2148 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257276.1 protein_id gnl|my_center|LOCUS_09270 2862 2173 gene locus_tag LOCUS_09280 2862 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 <5573 2875 gene locus_tag LOCUS_09290 <5573 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence121 2037 862 gene locus_tag LOCUS_09300 2037 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3395 2088 gene locus_tag LOCUS_09310 3395 2088 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 protein_id gnl|my_center|LOCUS_09310 4763 3399 gene locus_tag LOCUS_09320 4763 3399 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_09320 4885 5049 gene locus_tag LOCUS_09330 4885 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5095 5277 gene locus_tag LOCUS_09340 5095 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence122 2080 632 gene locus_tag LOCUS_09350 gene purF 2080 632 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257473.1 protein_id gnl|my_center|LOCUS_09350 2971 2225 gene locus_tag LOCUS_09360 2971 2225 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_09360 3161 4189 gene locus_tag LOCUS_09370 3161 4189 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence123 560 48 gene locus_tag LOCUS_09380 560 48 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_09380 1326 664 gene locus_tag LOCUS_09390 1326 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09390 1767 1390 gene locus_tag LOCUS_09400 1767 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09400 1933 3195 gene locus_tag LOCUS_09410 gene recF 1933 3195 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_09410 3182 4093 gene locus_tag LOCUS_09420 gene cobB 3182 4093 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence124 2258 1182 gene locus_tag LOCUS_09430 2258 1182 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_09430 2562 3473 gene locus_tag LOCUS_09440 2562 3473 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_09440 4235 3516 gene locus_tag LOCUS_09450 4235 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5385 4843 gene locus_tag LOCUS_09460 5385 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence125 250 507 gene locus_tag LOCUS_09470 250 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 682 975 gene locus_tag LOCUS_09480 682 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1419 1075 gene locus_tag LOCUS_09490 1419 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1572 1438 gene locus_tag LOCUS_09500 1572 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2583 1606 gene locus_tag LOCUS_09510 2583 1606 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_09510 3616 2840 gene locus_tag LOCUS_09520 3616 2840 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255254.1 protein_id gnl|my_center|LOCUS_09520 4925 3744 gene locus_tag LOCUS_09530 4925 3744 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939838.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence126 140 1900 gene locus_tag LOCUS_09540 140 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2984 2127 gene locus_tag LOCUS_09550 2984 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3238 4404 gene locus_tag LOCUS_09560 3238 4404 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_09560 <5333 4552 gene locus_tag LOCUS_09570 <5333 4552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258659.1:1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein >Feature sequence127 771 1220 gene locus_tag LOCUS_09580 gene mraZ 771 1220 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_09580 1684 1259 gene locus_tag LOCUS_09590 1684 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3816 1696 gene locus_tag LOCUS_09600 3816 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence128 631 260 gene locus_tag LOCUS_09610 631 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1069 2676 gene locus_tag LOCUS_09620 1069 2676 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889728.1 protein_id gnl|my_center|LOCUS_09620 2874 3866 gene locus_tag LOCUS_09630 2874 3866 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 protein_id gnl|my_center|LOCUS_09630 3901 4965 gene locus_tag LOCUS_09640 3901 4965 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence129 1270 104 gene locus_tag LOCUS_09650 1270 104 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_09650 2595 1429 gene locus_tag LOCUS_09660 2595 1429 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_09660 2832 4595 gene locus_tag LOCUS_09670 gene ggt 2832 4595 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence130 <1 1245 gene locus_tag LOCUS_09680 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase 2078 1350 gene locus_tag LOCUS_09690 2078 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3181 2456 gene locus_tag LOCUS_09700 3181 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3608 4561 gene locus_tag LOCUS_09710 3608 4561 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_09710 <5242 4661 gene locus_tag LOCUS_09720 <5242 4661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056823.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein >Feature sequence131 1008 40 gene locus_tag LOCUS_09730 1008 40 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_09730 1233 2420 gene locus_tag LOCUS_09740 1233 2420 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_09740 3627 2611 gene locus_tag LOCUS_09750 3627 2611 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_09750 <5193 3717 gene locus_tag LOCUS_09760 <5193 3717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533595.1:gamma-glutamyltransferase >Feature sequence132 2039 948 gene locus_tag LOCUS_09770 2039 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3757 2090 gene locus_tag LOCUS_09780 3757 2090 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence133 436 690 gene locus_tag LOCUS_09790 436 690 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 protein_id gnl|my_center|LOCUS_09790 1526 738 gene locus_tag LOCUS_09800 1526 738 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225558.1 protein_id gnl|my_center|LOCUS_09800 1932 4349 gene locus_tag LOCUS_09810 1932 4349 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_09810 <5148 4511 gene locus_tag LOCUS_09820 <5148 4511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085046.1:amidohydrolase family protein >Feature sequence134 <1 873 gene locus_tag LOCUS_09830 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393539.1:phosphoribosylamine--glycine ligase 870 1628 gene locus_tag LOCUS_09840 870 1628 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_09840 1625 2953 gene locus_tag LOCUS_09850 gene purB 1625 2953 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_09850 3014 3922 gene locus_tag LOCUS_09860 3014 3922 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_09860 3966 4640 gene locus_tag LOCUS_09870 3966 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4652 4900 gene locus_tag LOCUS_09880 gene purS 4652 4900 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence135 3267 1771 gene locus_tag LOCUS_09890 3267 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4716 3775 gene locus_tag LOCUS_09900 gene panE 4716 3775 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040789.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence136 91 1206 gene locus_tag LOCUS_09910 91 1206 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_09910 1438 1638 gene locus_tag LOCUS_09920 1438 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1858 3138 gene locus_tag LOCUS_09930 1858 3138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_09930 3698 4867 gene locus_tag LOCUS_09940 3698 4867 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence137 1523 438 gene locus_tag LOCUS_09950 gene pimA 1523 438 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413478.1 protein_id gnl|my_center|LOCUS_09950 2791 1646 gene locus_tag LOCUS_09960 2791 1646 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_09960 3945 3007 gene locus_tag LOCUS_09970 3945 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5121 4402 gene locus_tag LOCUS_09980 5121 4402 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence138 599 1774 gene locus_tag LOCUS_09990 599 1774 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_09990 1861 2991 gene locus_tag LOCUS_10000 1861 2991 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_10000 3008 3874 gene locus_tag LOCUS_10010 3008 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 3871 4215 gene locus_tag LOCUS_10020 3871 4215 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_10020 4215 4814 gene locus_tag LOCUS_10030 gene yqeK 4215 4814 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence139 242 961 gene locus_tag LOCUS_10040 242 961 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_10040 1936 3222 gene locus_tag LOCUS_10050 1936 3222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094811.1 protein_id gnl|my_center|LOCUS_10050 3319 4410 gene locus_tag LOCUS_10060 3319 4410 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_10060 4949 4623 gene locus_tag LOCUS_10070 4949 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence140 1256 60 gene locus_tag LOCUS_10080 1256 60 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_10080 1358 2521 gene locus_tag LOCUS_10090 1358 2521 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974705.1 protein_id gnl|my_center|LOCUS_10090 2985 2629 gene locus_tag LOCUS_10100 2985 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3092 3934 gene locus_tag LOCUS_10110 gene rsmI 3092 3934 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257838.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence141 1625 759 gene locus_tag LOCUS_10120 gene panC 1625 759 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_10120 2459 1638 gene locus_tag LOCUS_10130 gene panB 2459 1638 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258071.1 protein_id gnl|my_center|LOCUS_10130 3448 2456 gene locus_tag LOCUS_10140 3448 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 4385 3441 gene locus_tag LOCUS_10150 4385 3441 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence142 2331 1597 gene locus_tag LOCUS_10160 2331 1597 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_10160 3020 2331 gene locus_tag LOCUS_10170 gene cmk 3020 2331 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110867.1 protein_id gnl|my_center|LOCUS_10170 3355 3999 gene locus_tag LOCUS_10180 3355 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4191 4742 gene locus_tag LOCUS_10190 4191 4742 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_10190 5011 4799 gene locus_tag LOCUS_10200 5011 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence143 319 840 gene locus_tag LOCUS_10210 319 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 837 1586 gene locus_tag LOCUS_10220 gene tsaB 837 1586 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_10220 1616 2071 gene locus_tag LOCUS_10230 gene ndk 1616 2071 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_10230 2540 2166 gene locus_tag LOCUS_10240 gene rsfS 2540 2166 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136424.1 protein_id gnl|my_center|LOCUS_10240 2621 3799 gene locus_tag LOCUS_10250 gene mnmA 2621 3799 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_10250 3958 4467 gene locus_tag LOCUS_10260 3958 4467 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085908.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence144 <1 639 gene locus_tag LOCUS_10270 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742099.1:DUF885 domain-containing protein 1074 1988 gene locus_tag LOCUS_10280 1074 1988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_10280 2451 2257 gene locus_tag LOCUS_10290 2451 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2392 2697 gene locus_tag LOCUS_10300 2392 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3036 4589 gene locus_tag LOCUS_10310 3036 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence145 2525 162 gene locus_tag LOCUS_10320 2525 162 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190946.1 protein_id gnl|my_center|LOCUS_10320 2869 3975 gene locus_tag LOCUS_10330 gene menC 2869 3975 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence146 <1 1352 gene locus_tag LOCUS_10340 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein 1655 1918 gene locus_tag LOCUS_10350 1655 1918 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145721278.1 protein_id gnl|my_center|LOCUS_10350 2338 2910 gene locus_tag LOCUS_10360 2338 2910 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181492.1 protein_id gnl|my_center|LOCUS_10360 2968 4581 gene locus_tag LOCUS_10370 2968 4581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_10370 5010 4570 gene locus_tag LOCUS_10380 5010 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence147 115 1377 gene locus_tag LOCUS_10390 115 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1527 2237 gene locus_tag LOCUS_10400 1527 2237 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_10400 3410 2355 gene locus_tag LOCUS_10410 3410 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence148 79 945 gene locus_tag LOCUS_10420 79 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1175 1579 gene locus_tag LOCUS_10430 1175 1579 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088081.1 protein_id gnl|my_center|LOCUS_10430 1590 1955 gene locus_tag LOCUS_10440 1590 1955 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_10440 2003 2944 gene locus_tag LOCUS_10450 2003 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3889 4779 gene locus_tag LOCUS_10460 3889 4779 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245977.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence149 <1 548 gene locus_tag LOCUS_10470 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973149.1:response regulator 1601 585 gene locus_tag LOCUS_10480 1601 585 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_10480 2105 1683 gene locus_tag LOCUS_10490 2105 1683 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230834.1 protein_id gnl|my_center|LOCUS_10490 2835 2161 gene locus_tag LOCUS_10500 2835 2161 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_10500 3614 3411 gene locus_tag LOCUS_10510 3614 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4351 3611 gene locus_tag LOCUS_10520 4351 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 <4999 4391 gene locus_tag LOCUS_10530 <4999 4391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055920.1:thiazole synthase >Feature sequence150 <1 763 gene locus_tag LOCUS_10540 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035409.1:2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD 946 1149 gene locus_tag LOCUS_10550 946 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1394 1146 gene locus_tag LOCUS_10560 1394 1146 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258553.1 protein_id gnl|my_center|LOCUS_10560 2242 1391 gene locus_tag LOCUS_10570 gene proC 2242 1391 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_10570 3377 2367 gene locus_tag LOCUS_10580 gene pdxA 3377 2367 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224213.1 protein_id gnl|my_center|LOCUS_10580 4031 4680 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgaacgggtcgaagttggcgaactg >Feature sequence151 1937 768 gene locus_tag LOCUS_10590 1937 768 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_10590 3282 2065 gene locus_tag LOCUS_10600 3282 2065 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_10600 4564 3386 gene locus_tag LOCUS_10610 4564 3386 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence152 1168 299 gene locus_tag LOCUS_10620 1168 299 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_10620 3552 1171 gene locus_tag LOCUS_10630 3552 1171 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_10630 4022 3555 gene locus_tag LOCUS_10640 4022 3555 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_10640 4224 4688 gene locus_tag LOCUS_10650 4224 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence153 <1 1005 gene locus_tag LOCUS_10660 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728063.1:tartrate dehydrogenase 1069 2079 gene locus_tag LOCUS_10670 1069 2079 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_10670 2758 2231 gene locus_tag LOCUS_10680 gene uraD 2758 2231 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_10680 3417 2755 gene locus_tag LOCUS_10690 3417 2755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_10690 <4859 3760 gene locus_tag LOCUS_10700 <4859 3760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039575.1:L-arabinonate dehydratase >Feature sequence154 244 1233 gene locus_tag LOCUS_10710 244 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1321 4122 gene locus_tag LOCUS_10720 gene fdhF 1321 4122 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061084.1 protein_id gnl|my_center|LOCUS_10720 4252 4578 gene locus_tag LOCUS_10730 gene trxA 4252 4578 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_10730 4713 4810 gene locus_tag LOCUS_t00130 4713 4810 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence155 1669 584 gene locus_tag LOCUS_10740 gene araD 1669 584 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_10740 1920 1738 gene locus_tag LOCUS_10750 1920 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3445 2507 gene locus_tag LOCUS_10760 3445 2507 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_10760 3985 3470 gene locus_tag LOCUS_10770 3985 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4068 4760 gene locus_tag LOCUS_10780 4068 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence156 1216 428 gene locus_tag LOCUS_10790 1216 428 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10790 2822 1290 gene locus_tag LOCUS_10800 2822 1290 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_10800 3220 2819 gene locus_tag LOCUS_10810 3220 2819 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_10810 3616 4446 gene locus_tag LOCUS_10820 3616 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence157 2046 436 gene locus_tag LOCUS_10830 2046 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2198 2043 gene locus_tag LOCUS_10840 2198 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4076 2292 gene locus_tag LOCUS_10850 4076 2292 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165899772.1 protein_id gnl|my_center|LOCUS_10850 4615 4175 gene locus_tag LOCUS_10860 4615 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence158 1169 981 gene locus_tag LOCUS_10870 1169 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2043 1294 gene locus_tag LOCUS_10880 2043 1294 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_10880 3224 2190 gene locus_tag LOCUS_10890 3224 2190 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_10890 3920 3258 gene locus_tag LOCUS_10900 3920 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 <4678 4004 gene locus_tag LOCUS_10910 <4678 4004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943552.1:homocysteine S-methyltransferase family protein >Feature sequence159 53 1051 gene locus_tag LOCUS_10920 53 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1167 2231 gene locus_tag LOCUS_10930 1167 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2405 3190 gene locus_tag LOCUS_10940 2405 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3306 4109 gene locus_tag LOCUS_10950 3306 4109 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence160 414 1115 gene locus_tag LOCUS_10960 414 1115 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 protein_id gnl|my_center|LOCUS_10960 1840 1142 gene locus_tag LOCUS_10970 1840 1142 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_10970 2465 1905 gene locus_tag LOCUS_10980 2465 1905 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_10980 2821 2462 gene locus_tag LOCUS_10990 2821 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2772 3974 gene locus_tag LOCUS_11000 2772 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence161 259 1632 gene locus_tag LOCUS_11010 259 1632 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_11010 1761 2555 gene locus_tag LOCUS_11020 1761 2555 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_11020 3195 2683 gene locus_tag LOCUS_11030 3195 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence162 >Feature sequence163 2222 978 gene locus_tag LOCUS_11040 gene fabF 2222 978 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_11040 2546 3982 gene locus_tag LOCUS_11050 gene mtaB 2546 3982 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_11050 <4604 4082 gene locus_tag LOCUS_11060 <4604 4082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479789.1:MBL fold metallo-hydrolase >Feature sequence164 289 1221 gene locus_tag LOCUS_11070 289 1221 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_11070 1218 1706 gene locus_tag LOCUS_11080 1218 1706 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_11080 3229 1850 gene locus_tag LOCUS_11090 3229 1850 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_11090 3245 4102 gene locus_tag LOCUS_11100 gene paaG 3245 4102 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence165 <1 1782 gene locus_tag LOCUS_11110 <1 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103704.1:molybdopterin guanine dinucleotide-containing S/N-oxide reductase 2029 3114 gene locus_tag LOCUS_11120 gene pgl 2029 3114 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_11120 4188 3271 gene locus_tag LOCUS_11130 4188 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence166 707 372 gene locus_tag LOCUS_11140 707 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1216 2208 gene locus_tag LOCUS_11150 gene speB 1216 2208 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_11150 2609 4102 gene locus_tag LOCUS_11160 gene tcuA 2609 4102 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence167 385 1839 gene locus_tag LOCUS_11170 385 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2213 3484 gene locus_tag LOCUS_11180 2213 3484 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_11180 3601 3975 gene locus_tag LOCUS_11190 3601 3975 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140691.1 protein_id gnl|my_center|LOCUS_11190 4201 4277 gene locus_tag LOCUS_t00140 4201 4277 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4303 4389 gene locus_tag LOCUS_t00150 4303 4389 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence168 350 1336 gene locus_tag LOCUS_11200 gene nudC 350 1336 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_11200 2365 1532 gene locus_tag LOCUS_11210 2365 1532 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_11210 3795 2506 gene locus_tag LOCUS_11220 gene hemW 3795 2506 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence169 1157 1339 gene locus_tag LOCUS_11230 gene rpmB 1157 1339 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_11230 2194 1502 gene locus_tag LOCUS_11240 gene rpe 2194 1502 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_11240 3591 2191 gene locus_tag LOCUS_11250 gene argH 3591 2191 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_11250 3858 4232 gene locus_tag LOCUS_11260 3858 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence170 1365 226 gene locus_tag LOCUS_11270 1365 226 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_11270 2679 3458 gene locus_tag LOCUS_11280 2679 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 <4447 3485 gene locus_tag LOCUS_11290 <4447 3485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804077.1:zinc-dependent alcohol dehydrogenase family protein >Feature sequence171 709 422 gene locus_tag LOCUS_11300 709 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1144 860 gene locus_tag LOCUS_11310 1144 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2334 1168 gene locus_tag LOCUS_11320 gene dgoD 2334 1168 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_11320 3070 2483 gene locus_tag LOCUS_11330 3070 2483 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398204.1 protein_id gnl|my_center|LOCUS_11330 3296 3093 gene locus_tag LOCUS_11340 3296 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence172 473 712 gene locus_tag LOCUS_11350 473 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1811 756 gene locus_tag LOCUS_11360 1811 756 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411622.1 protein_id gnl|my_center|LOCUS_11360 2106 3095 gene locus_tag LOCUS_11370 2106 3095 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_11370 3171 3389 gene locus_tag LOCUS_11380 3171 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 3438 3935 gene locus_tag LOCUS_11390 3438 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 >Feature sequence173 194 361 gene locus_tag LOCUS_11400 194 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2803 1247 gene locus_tag LOCUS_11410 2803 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3075 3761 gene locus_tag LOCUS_11420 3075 3761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence174 2214 1861 gene locus_tag LOCUS_11430 gene rplS 2214 1861 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_11430 3209 2433 gene locus_tag LOCUS_11440 3209 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3979 3206 gene locus_tag LOCUS_11450 gene trmD 3979 3206 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence175 905 534 gene locus_tag LOCUS_11460 905 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1865 981 gene locus_tag LOCUS_11470 1865 981 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_11470 2491 1952 gene locus_tag LOCUS_11480 2491 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2549 4273 gene locus_tag LOCUS_11490 2549 4273 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921874.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence176 1918 671 gene locus_tag LOCUS_11500 gene rho 1918 671 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_11500 4208 2517 gene locus_tag LOCUS_11510 4208 2517 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence177 1806 2288 gene locus_tag LOCUS_11520 1806 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence178 <1 991 gene locus_tag LOCUS_11530 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018013007.1:formate--tetrahydrofolate ligase 1058 3949 gene locus_tag LOCUS_11540 gene fdhF 1058 3949 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:2285..2287,aa:Sec) note codon on position 410 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11540 >Feature sequence179 588 2051 gene locus_tag LOCUS_11550 588 2051 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877125.1 protein_id gnl|my_center|LOCUS_11550 2579 2361 gene locus_tag LOCUS_11560 2579 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3473 2787 gene locus_tag LOCUS_11570 3473 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence180 1385 2170 gene locus_tag LOCUS_11580 1385 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2355 3563 gene locus_tag LOCUS_11590 2355 3563 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence181 651 824 gene locus_tag LOCUS_11600 651 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1843 821 gene locus_tag LOCUS_11610 1843 821 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_11610 2190 2564 gene locus_tag LOCUS_11620 2190 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 2631 3053 gene locus_tag LOCUS_11630 2631 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3320 3607 gene locus_tag LOCUS_11640 3320 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence182 21 248 gene locus_tag LOCUS_11650 21 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 689 315 gene locus_tag LOCUS_11660 689 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2282 798 gene locus_tag LOCUS_11670 2282 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2621 3811 gene locus_tag LOCUS_11680 2621 3811 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_11680 4150 3872 gene locus_tag LOCUS_11690 4150 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence183 838 1098 gene locus_tag LOCUS_11700 838 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1196 2275 gene locus_tag LOCUS_11710 gene pheS 1196 2275 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence184 1338 718 gene locus_tag LOCUS_11720 1338 718 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727024.1 protein_id gnl|my_center|LOCUS_11720 1820 1413 gene locus_tag LOCUS_11730 1820 1413 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_11730 2323 3102 gene locus_tag LOCUS_11740 gene hyi 2323 3102 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531398.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence185 254 15 gene locus_tag LOCUS_11750 254 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 383 688 gene locus_tag LOCUS_11760 383 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1092 1583 gene locus_tag LOCUS_11770 1092 1583 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_11770 1580 3634 gene locus_tag LOCUS_11780 1580 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence186 1308 490 gene locus_tag LOCUS_11790 1308 490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_11790 2765 1524 gene locus_tag LOCUS_11800 2765 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3311 2820 gene locus_tag LOCUS_11810 3311 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence187 17 871 gene locus_tag LOCUS_11820 17 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 923 2293 gene locus_tag LOCUS_11830 gene cysS 923 2293 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_11830 3315 2506 gene locus_tag LOCUS_11840 3315 2506 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_11840 3807 3589 gene locus_tag LOCUS_11850 3807 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4173 3910 gene locus_tag LOCUS_11860 4173 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence188 1634 1338 gene locus_tag LOCUS_11870 1634 1338 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530150.1 protein_id gnl|my_center|LOCUS_11870 3006 1828 gene locus_tag LOCUS_11880 3006 1828 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039542.1 protein_id gnl|my_center|LOCUS_11880 3109 3417 gene locus_tag LOCUS_11890 3109 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3382 3391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence189 316 975 gene locus_tag LOCUS_11900 316 975 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_11900 1110 2810 gene locus_tag LOCUS_11910 1110 2810 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808165.1 protein_id gnl|my_center|LOCUS_11910 2961 3998 gene locus_tag LOCUS_11920 2961 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence190 670 595 gene locus_tag LOCUS_t00160 670 595 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3118 872 gene locus_tag LOCUS_11930 3118 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence191 1351 2259 gene locus_tag LOCUS_11940 1351 2259 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815555.1 protein_id gnl|my_center|LOCUS_11940 2409 2606 gene locus_tag LOCUS_11950 2409 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3344 3664 gene locus_tag LOCUS_11960 3344 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence192 2601 2215 gene locus_tag LOCUS_11970 2601 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2533 2916 gene locus_tag LOCUS_11980 2533 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 3820 2975 gene locus_tag LOCUS_11990 3820 2975 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030032.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence193 <4081 800 gene locus_tag LOCUS_12000 <4081 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392401.1:carbamoyl-phosphate synthase large subunit >Feature sequence194 737 2782 gene locus_tag LOCUS_12010 737 2782 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence195 644 258 gene locus_tag LOCUS_12020 gene rpsK 644 258 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_12020 1133 753 gene locus_tag LOCUS_12030 gene rpsM 1133 753 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088133.1 protein_id gnl|my_center|LOCUS_12030 1568 1350 gene locus_tag LOCUS_12040 gene infA 1568 1350 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_12040 2367 1594 gene locus_tag LOCUS_12050 gene map 2367 1594 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_12050 3096 2458 gene locus_tag LOCUS_12060 3096 2458 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_12060 <4074 3129 gene locus_tag LOCUS_12070 <4074 3129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258251.1:preprotein translocase subunit SecY >Feature sequence196 888 963 gene locus_tag LOCUS_t00170 888 963 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2606 1446 gene locus_tag LOCUS_12080 2606 1446 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804986.1 protein_id gnl|my_center|LOCUS_12080 2906 3319 gene locus_tag LOCUS_12090 2906 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3815 3426 gene locus_tag LOCUS_12100 3815 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence197 1240 38 gene locus_tag LOCUS_12110 gene sucC 1240 38 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941719.1 protein_id gnl|my_center|LOCUS_12110 1711 1307 gene locus_tag LOCUS_12120 1711 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2794 2000 gene locus_tag LOCUS_12130 2794 2000 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088574.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence198 <1 2358 gene locus_tag LOCUS_12140 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 2661 3530 gene locus_tag LOCUS_12150 2661 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence199 479 1243 gene locus_tag LOCUS_12160 479 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1152 2597 gene locus_tag LOCUS_12170 1152 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2598 3317 gene locus_tag LOCUS_12180 2598 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence200 931 164 gene locus_tag LOCUS_12190 931 164 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_12190 991 2628 gene locus_tag LOCUS_12200 991 2628 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970054.1 protein_id gnl|my_center|LOCUS_12200 3654 2638 gene locus_tag LOCUS_12210 gene sds 3654 2638 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence201 1522 695 gene locus_tag LOCUS_12220 1522 695 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869148.1 protein_id gnl|my_center|LOCUS_12220 1860 3074 gene locus_tag LOCUS_12230 gene lhgO 1860 3074 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_12230 3584 3105 gene locus_tag LOCUS_12240 3584 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence202 <1 930 gene locus_tag LOCUS_12250 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356558.1:F0F1 ATP synthase subunit beta 978 1436 gene locus_tag LOCUS_12260 978 1436 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_12260 2379 1687 gene locus_tag LOCUS_12270 2379 1687 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_12270 2542 2835 gene locus_tag LOCUS_12280 2542 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3109 2945 gene locus_tag LOCUS_12290 3109 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3452 3856 gene locus_tag LOCUS_12300 3452 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence203 181 900 gene locus_tag LOCUS_12310 gene alaXM 181 900 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_12310 1023 2231 gene locus_tag LOCUS_12320 1023 2231 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_12320 2506 3714 gene locus_tag LOCUS_12330 2506 3714 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence204 3065 2382 gene locus_tag LOCUS_12340 3065 2382 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_12340 3503 3207 gene locus_tag LOCUS_12350 3503 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence205 385 741 gene locus_tag LOCUS_12360 385 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 788 1459 gene locus_tag LOCUS_12370 gene merB 788 1459 CDS product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 protein_id gnl|my_center|LOCUS_12370 1504 1677 gene locus_tag LOCUS_12380 1504 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1674 1913 gene locus_tag LOCUS_12390 1674 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2058 2216 gene locus_tag LOCUS_12400 2058 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2286 2441 gene locus_tag LOCUS_12410 2286 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2460 2963 gene locus_tag LOCUS_12420 2460 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 <3946 3343 gene locus_tag LOCUS_12430 <3946 3343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546137.1:amidohydrolase family protein >Feature sequence206 <1 526 gene locus_tag LOCUS_12440 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013534.1:SDR family oxidoreductase 579 1520 gene locus_tag LOCUS_12450 579 1520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_12450 2365 1724 gene locus_tag LOCUS_12460 2365 1724 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_12460 2780 2385 gene locus_tag LOCUS_12470 2780 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence207 537 620 gene locus_tag LOCUS_t00180 537 620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 730 1209 gene locus_tag LOCUS_12480 730 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1449 2654 gene locus_tag LOCUS_12490 1449 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence208 <1 707 gene locus_tag LOCUS_12500 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023175504.1:amidohydrolase family protein 938 2176 gene locus_tag LOCUS_12510 938 2176 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_12510 2252 3397 gene locus_tag LOCUS_12520 2252 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence209 1280 72 gene locus_tag LOCUS_12530 1280 72 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_12530 1993 1277 gene locus_tag LOCUS_12540 1993 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2156 2380 gene locus_tag LOCUS_12550 2156 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 2589 2918 gene locus_tag LOCUS_12560 2589 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence210 1369 452 gene locus_tag LOCUS_12570 1369 452 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_12570 1530 2864 gene locus_tag LOCUS_12580 1530 2864 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_12580 2964 3464 gene locus_tag LOCUS_12590 2964 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence211 358 1167 gene locus_tag LOCUS_12600 358 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1312 2067 gene locus_tag LOCUS_12610 1312 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12610 2077 2610 gene locus_tag LOCUS_12620 2077 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2960 3274 gene locus_tag LOCUS_12630 2960 3274 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence212 397 2097 gene locus_tag LOCUS_12640 gene recJ 397 2097 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_12640 3033 2113 gene locus_tag LOCUS_12650 gene lgt 3033 2113 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence213 451 26 gene locus_tag LOCUS_12660 451 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2118 739 gene locus_tag LOCUS_12670 2118 739 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972090.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence214 1589 183 gene locus_tag LOCUS_12680 1589 183 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839029.1 protein_id gnl|my_center|LOCUS_12680 2108 3310 gene locus_tag LOCUS_12690 2108 3310 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence215 <1 1011 gene locus_tag LOCUS_12700 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704202.1:DgaE family pyridoxal phosphate-dependent ammonia lyase 1232 2278 gene locus_tag LOCUS_12710 gene hisG 1232 2278 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257147.1 protein_id gnl|my_center|LOCUS_12710 2275 3549 gene locus_tag LOCUS_12720 gene hisD 2275 3549 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence216 1685 1146 gene locus_tag LOCUS_12730 1685 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2519 1842 gene locus_tag LOCUS_12740 2519 1842 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_12740 2825 3259 gene locus_tag LOCUS_12750 2825 3259 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence217 >Feature sequence218 2 595 gene locus_tag LOCUS_12760 2 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 724 1302 gene locus_tag LOCUS_12770 724 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1336 1686 gene locus_tag LOCUS_12780 1336 1686 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_12780 1925 2185 gene locus_tag LOCUS_12790 1925 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3422 2223 gene locus_tag LOCUS_12800 3422 2223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence219 713 949 gene locus_tag LOCUS_12810 713 949 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256580.1 protein_id gnl|my_center|LOCUS_12810 983 1525 gene locus_tag LOCUS_12820 983 1525 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_12820 2481 1555 gene locus_tag LOCUS_12830 2481 1555 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence220 1420 383 gene locus_tag LOCUS_12840 gene ltaE 1420 383 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258446.1 protein_id gnl|my_center|LOCUS_12840 1650 2303 gene locus_tag LOCUS_12850 gene coxH3 1650 2303 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_12850 2443 3255 gene locus_tag LOCUS_12860 2443 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence221 <1 617 gene locus_tag LOCUS_12870 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966707.1:mandelate racemase/muconate lactonizing enzyme family protein 633 1799 gene locus_tag LOCUS_12880 633 1799 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_12880 1992 3569 gene locus_tag LOCUS_12890 1992 3569 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence222 1362 700 gene locus_tag LOCUS_12900 1362 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1580 3295 gene locus_tag LOCUS_12910 gene guaA 1580 3295 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence223 1248 310 gene locus_tag LOCUS_12920 1248 310 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_12920 1449 2243 gene locus_tag LOCUS_12930 1449 2243 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626396.1 protein_id gnl|my_center|LOCUS_12930 2249 3601 gene locus_tag LOCUS_12940 2249 3601 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040096.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence224 302 550 gene locus_tag LOCUS_12950 302 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 526 535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 622 1578 gene locus_tag LOCUS_12960 622 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1701 2048 gene locus_tag LOCUS_12970 1701 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2059 2400 gene locus_tag LOCUS_12980 gene glnB 2059 2400 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211554.1 protein_id gnl|my_center|LOCUS_12980 2709 3170 gene locus_tag LOCUS_12990 2709 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence225 221 535 gene locus_tag LOCUS_13000 221 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1068 1313 gene locus_tag LOCUS_13010 1068 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 1445 1639 gene locus_tag LOCUS_13020 1445 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2523 1765 gene locus_tag LOCUS_13030 gene tatC 2523 1765 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_13030 2915 2526 gene locus_tag LOCUS_13040 2915 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3595 2912 gene locus_tag LOCUS_13050 3595 2912 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence226 1082 1756 gene locus_tag LOCUS_13060 1082 1756 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_13060 2147 1881 gene locus_tag LOCUS_13070 2147 1881 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_13070 2373 3335 gene locus_tag LOCUS_13080 gene galE1 2373 3335 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104180.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence227 2354 711 gene locus_tag LOCUS_13090 2354 711 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_13090 2787 3440 gene locus_tag LOCUS_13100 2787 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence228 545 2263 gene locus_tag LOCUS_13110 545 2263 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_13110 2405 3334 gene locus_tag LOCUS_13120 2405 3334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393119.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence229 1306 1665 gene locus_tag LOCUS_13130 gene rplU 1306 1665 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564642.1 protein_id gnl|my_center|LOCUS_13130 1669 1938 gene locus_tag LOCUS_13140 gene rpmA 1669 1938 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_13140 1978 2406 gene locus_tag LOCUS_13150 1978 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2506 3465 gene locus_tag LOCUS_13160 2506 3465 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence230 <1 1182 gene locus_tag LOCUS_13170 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727481.1:D-aminoacylase 1364 2248 gene locus_tag LOCUS_13180 1364 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence231 1486 1968 gene locus_tag LOCUS_13190 1486 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2041 2523 gene locus_tag LOCUS_13200 2041 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2564 3388 gene locus_tag LOCUS_13210 2564 3388 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727392.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence232 775 71 gene locus_tag LOCUS_13220 775 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1365 772 gene locus_tag LOCUS_13230 gene tsaE 1365 772 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257860.1 protein_id gnl|my_center|LOCUS_13230 2509 1358 gene locus_tag LOCUS_13240 gene thiL 2509 1358 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_13240 2701 3429 gene locus_tag LOCUS_13250 2701 3429 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence233 <1 590 gene locus_tag LOCUS_13260 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000450540.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 1494 607 gene locus_tag LOCUS_13270 1494 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2250 1627 gene locus_tag LOCUS_13280 2250 1627 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_13280 3066 2302 gene locus_tag LOCUS_13290 3066 2302 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090884.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence234 1506 193 gene locus_tag LOCUS_13300 1506 193 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_13300 1743 3278 gene locus_tag LOCUS_13310 1743 3278 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence235 <1 797 gene locus_tag LOCUS_13320 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546632.1:diaminopimelate epimerase 1127 2305 gene locus_tag LOCUS_13330 1127 2305 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence236 1717 695 gene locus_tag LOCUS_13340 gene gap 1717 695 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_13340 3126 1822 gene locus_tag LOCUS_13350 gene eno 3126 1822 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence237 743 2044 gene locus_tag LOCUS_13360 743 2044 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_13360 2228 3175 gene locus_tag LOCUS_13370 gene trxB 2228 3175 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_13370 3428 3237 gene locus_tag LOCUS_13380 3428 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence238 2726 405 gene locus_tag LOCUS_13390 gene pnp 2726 405 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_13390 3178 2915 gene locus_tag LOCUS_13400 gene rpsO 3178 2915 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence239 653 57 gene locus_tag LOCUS_13410 653 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 920 1147 gene locus_tag LOCUS_13420 920 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1330 2427 gene locus_tag LOCUS_13430 1330 2427 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_13430 2583 3041 gene locus_tag LOCUS_13440 2583 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3043 3408 gene locus_tag LOCUS_13450 3043 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence240 657 1421 gene locus_tag LOCUS_13460 657 1421 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_13460 1817 2518 gene locus_tag LOCUS_13470 1817 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2652 3047 gene locus_tag LOCUS_13480 2652 3047 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence241 397 110 gene locus_tag LOCUS_13490 397 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1601 429 gene locus_tag LOCUS_13500 1601 429 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226914.1 protein_id gnl|my_center|LOCUS_13500 2594 1641 gene locus_tag LOCUS_13510 gene dapA 2594 1641 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_13510 2935 3009 gene locus_tag LOCUS_t00190 2935 3009 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence242 1231 2001 gene locus_tag LOCUS_13520 1231 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2015 3094 gene locus_tag LOCUS_13530 2015 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence243 204 52 gene locus_tag LOCUS_13540 204 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1466 204 gene locus_tag LOCUS_13550 gene nuoH 1466 204 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_13550 2572 1466 gene locus_tag LOCUS_13560 2572 1466 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_13560 3077 2631 gene locus_tag LOCUS_13570 3077 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence244 480 555 gene locus_tag LOCUS_t00200 480 555 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 693 1889 gene locus_tag LOCUS_13580 693 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1983 2058 gene locus_tag LOCUS_t00210 1983 2058 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3103 2813 gene locus_tag LOCUS_13590 3103 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence245 996 550 gene locus_tag LOCUS_13600 996 550 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256759.1 protein_id gnl|my_center|LOCUS_13600 1364 999 gene locus_tag LOCUS_13610 gene rpsF 1364 999 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 protein_id gnl|my_center|LOCUS_13610 2713 1463 gene locus_tag LOCUS_13620 2713 1463 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938499.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence246 73 1173 gene locus_tag LOCUS_13630 73 1173 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869460.1 protein_id gnl|my_center|LOCUS_13630 1366 1692 gene locus_tag LOCUS_13640 1366 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1689 2126 gene locus_tag LOCUS_13650 1689 2126 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence247 622 1323 gene locus_tag LOCUS_13660 gene phoU 622 1323 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868847.1 protein_id gnl|my_center|LOCUS_13660 1824 1384 gene locus_tag LOCUS_13670 1824 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2566 1934 gene locus_tag LOCUS_13680 2566 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence248 <1 722 gene locus_tag LOCUS_13690 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973151.1:ABC transporter ATP-binding protein 792 1580 gene locus_tag LOCUS_13700 gene menH 792 1580 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103366.1 protein_id gnl|my_center|LOCUS_13700 1612 2295 gene locus_tag LOCUS_13710 1612 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence249 228 986 gene locus_tag LOCUS_13720 228 986 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_13720 1027 1827 gene locus_tag LOCUS_13730 1027 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1824 2969 gene locus_tag LOCUS_13740 gene dxr 1824 2969 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence250 22 2268 gene locus_tag LOCUS_13750 22 2268 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258408.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence251 2083 2349 gene locus_tag LOCUS_13760 2083 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2564 2788 gene locus_tag LOCUS_13770 2564 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence252 1020 739 gene locus_tag LOCUS_13780 1020 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1629 1021 gene locus_tag LOCUS_13790 1629 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1876 1652 gene locus_tag LOCUS_13800 1876 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 2506 2033 gene locus_tag LOCUS_13810 2506 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence253 1530 145 gene locus_tag LOCUS_13820 1530 145 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_13820 2487 1564 gene locus_tag LOCUS_13830 2487 1564 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence254 1604 2644 gene locus_tag LOCUS_13840 1604 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2734 3057 gene locus_tag LOCUS_13850 2734 3057 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence255 613 1920 gene locus_tag LOCUS_13860 613 1920 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392745.1 protein_id gnl|my_center|LOCUS_13860 1917 2783 gene locus_tag LOCUS_13870 1917 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence256 <1 984 gene locus_tag LOCUS_13880 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044964.1:MFS transporter 1164 2897 gene locus_tag LOCUS_13890 1164 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence257 1065 124 gene locus_tag LOCUS_13900 1065 124 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_13900 1183 2427 gene locus_tag LOCUS_13910 1183 2427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence258 1266 637 gene locus_tag LOCUS_13920 1266 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2450 1287 gene locus_tag LOCUS_13930 2450 1287 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence259 441 196 gene locus_tag LOCUS_13940 441 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 592 1551 gene locus_tag LOCUS_13950 gene argC 592 1551 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_13950 2322 2822 gene locus_tag LOCUS_13960 2322 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence260 2982 46 gene locus_tag LOCUS_13970 2982 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence261 405 1010 gene locus_tag LOCUS_13980 gene thiE 405 1010 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_13980 1412 1738 gene locus_tag LOCUS_13990 1412 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence262 1473 577 gene locus_tag LOCUS_14000 1473 577 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_14000 1616 2578 gene locus_tag LOCUS_14010 1616 2578 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence263 1566 574 gene locus_tag LOCUS_14020 1566 574 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_14020 2815 1598 gene locus_tag LOCUS_14030 gene acoC 2815 1598 CDS product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence264 129 740 gene locus_tag LOCUS_14040 129 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14040 902 1903 gene locus_tag LOCUS_14050 gene trxB 902 1903 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_14050 2104 2028 gene locus_tag LOCUS_t00220 2104 2028 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <3038 2240 gene locus_tag LOCUS_14060 <3038 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864382.1:histidinol-phosphate transaminase >Feature sequence265 574 1413 gene locus_tag LOCUS_14070 574 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence266 1763 936 gene locus_tag LOCUS_14080 1763 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1945 2160 gene locus_tag LOCUS_14090 1945 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence267 2035 365 gene locus_tag LOCUS_14100 2035 365 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence268 <1 807 gene locus_tag LOCUS_14110 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289099.1:NAD-dependent glucose-6-phosphate dehydrogenase Azf 1393 836 gene locus_tag LOCUS_14120 1393 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1635 2615 gene locus_tag LOCUS_14130 1635 2615 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence269 <1 718 gene locus_tag LOCUS_14140 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258185.1:penicillin acylase family protein 1752 1171 gene locus_tag LOCUS_14150 1752 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 <3016 1890 gene locus_tag LOCUS_14160 <3016 1890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028331.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence270 570 1520 gene locus_tag LOCUS_14170 570 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1569 2798 gene locus_tag LOCUS_14180 1569 2798 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126863657.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence271 <1 630 gene locus_tag LOCUS_14190 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966707.1:mandelate racemase/muconate lactonizing enzyme family protein 782 2416 gene locus_tag LOCUS_14200 782 2416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_14200 2963 2733 gene locus_tag LOCUS_14210 2963 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence272 546 1097 gene locus_tag LOCUS_14220 gene nrdR 546 1097 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence273 1455 1285 gene locus_tag LOCUS_14230 1455 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1943 1512 gene locus_tag LOCUS_14240 1943 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2426 2037 gene locus_tag LOCUS_14250 2426 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence274 358 1506 gene locus_tag LOCUS_14260 358 1506 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_14260 1536 2564 gene locus_tag LOCUS_14270 1536 2564 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence275 2070 247 gene locus_tag LOCUS_14280 2070 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2594 2520 gene locus_tag LOCUS_t00230 2594 2520 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2689 2763 gene locus_tag LOCUS_t00240 2689 2763 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence276 203 712 gene locus_tag LOCUS_14290 203 712 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208442.1 protein_id gnl|my_center|LOCUS_14290 1328 2449 gene locus_tag LOCUS_14300 1328 2449 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence277 697 611 gene locus_tag LOCUS_t00250 697 611 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 986 1300 gene locus_tag LOCUS_14310 986 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1900 1448 gene locus_tag LOCUS_14320 1900 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 <2898 2071 gene locus_tag LOCUS_14330 <2898 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359187.1:protein-glutamate O-methyltransferase CheR >Feature sequence278 1207 341 gene locus_tag LOCUS_14340 1207 341 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_14340 1392 2000 gene locus_tag LOCUS_14350 1392 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2474 2151 gene locus_tag LOCUS_14360 2474 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence279 <1 631 gene locus_tag LOCUS_14370 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003536422.1:4-hydroxy-2-oxoheptanedioate aldolase 1082 1852 gene locus_tag LOCUS_14380 1082 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1980 2504 gene locus_tag LOCUS_14390 1980 2504 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329360.1 protein_id gnl|my_center|LOCUS_14390 2608 2787 gene locus_tag LOCUS_14400 2608 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence280 <1 762 gene locus_tag LOCUS_14410 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228145.1:histidinol dehydrogenase 866 1954 gene locus_tag LOCUS_14420 gene hisC 866 1954 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_14420 2118 2717 gene locus_tag LOCUS_14430 gene hisB 2118 2717 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257804.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence281 2313 823 gene locus_tag LOCUS_14440 gene gatA 2313 823 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257583.1 protein_id gnl|my_center|LOCUS_14440 2599 2306 gene locus_tag LOCUS_14450 gene gatC 2599 2306 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_14450 2686 2775 gene locus_tag LOCUS_t00260 2686 2775 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence282 1663 476 gene locus_tag LOCUS_14460 gene ahbC 1663 476 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_14460 <2834 2079 gene locus_tag LOCUS_14470 <2834 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186939.1:choline-sulfatase >Feature sequence283 721 646 gene locus_tag LOCUS_t00270 721 646 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1375 896 gene locus_tag LOCUS_14480 1375 896 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_14480 1562 1377 gene locus_tag LOCUS_14490 1562 1377 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117401.1 protein_id gnl|my_center|LOCUS_14490 2522 1794 gene locus_tag LOCUS_14500 2522 1794 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence284 <1 1340 gene locus_tag LOCUS_14510 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387765.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1977 1402 gene locus_tag LOCUS_14520 gene pyrE 1977 1402 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547500.1 protein_id gnl|my_center|LOCUS_14520 2640 1978 gene locus_tag LOCUS_14530 gene nadD 2640 1978 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence285 1002 2030 gene locus_tag LOCUS_14540 1002 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:1725..1727,aa:Sec) note codon on position 242 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14540 2187 2765 gene locus_tag LOCUS_14550 2187 2765 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence286 1552 1235 gene locus_tag LOCUS_14560 1552 1235 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967421.1 protein_id gnl|my_center|LOCUS_14560 2789 1743 gene locus_tag LOCUS_14570 2789 1743 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence287 1029 1 gene locus_tag LOCUS_14580 1029 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2287 1178 gene locus_tag LOCUS_14590 2287 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2586 2510 gene locus_tag LOCUS_t00280 2586 2510 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 1336 572 gene locus_tag LOCUS_14600 1336 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence289 1925 1092 gene locus_tag LOCUS_14610 gene fabG 1925 1092 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_14610 2146 1922 gene locus_tag LOCUS_14620 2146 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence290 1220 96 gene locus_tag LOCUS_14630 1220 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1637 1371 gene locus_tag LOCUS_14640 1637 1371 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence291 <1 1082 gene locus_tag LOCUS_14650 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062075126.1:C-terminal binding protein 1378 1079 gene locus_tag LOCUS_14660 1378 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <2760 1605 gene locus_tag LOCUS_14670 <2760 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228054.1:DUF3488 and transglutaminase-like domain-containing protein 1646 1655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence292 719 2221 gene locus_tag LOCUS_14680 719 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence293 336 713 gene locus_tag LOCUS_14690 336 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 714 944 gene locus_tag LOCUS_14700 714 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 946 2574 gene locus_tag LOCUS_14710 946 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence294 289 1506 gene locus_tag LOCUS_14720 289 1506 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_14720 1690 2460 gene locus_tag LOCUS_14730 1690 2460 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence295 252 1364 gene locus_tag LOCUS_14740 gene leuB 252 1364 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_14740 1515 2126 gene locus_tag LOCUS_14750 1515 2126 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140415.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence296 156 773 gene locus_tag LOCUS_14760 156 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 770 1123 gene locus_tag LOCUS_14770 gene nuoK 770 1123 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813222.1 protein_id gnl|my_center|LOCUS_14770 1212 1406 gene locus_tag LOCUS_14780 1212 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence297 2040 193 gene locus_tag LOCUS_14790 2040 193 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence298 301 1137 gene locus_tag LOCUS_14800 301 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1654 1229 gene locus_tag LOCUS_14810 gene sodN 1654 1229 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_14810 1811 2287 gene locus_tag LOCUS_14820 1811 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence299 303 917 gene locus_tag LOCUS_14830 gene plsY 303 917 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_14830 1010 1714 gene locus_tag LOCUS_14840 1010 1714 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_14840 1759 2277 gene locus_tag LOCUS_14850 1759 2277 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence300 1685 1110 gene locus_tag LOCUS_14860 1685 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 <2682 1849 gene locus_tag LOCUS_14870 <2682 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887350.1:endo alpha-1,4 polygalactosaminidase >Feature sequence301 <1 516 gene locus_tag LOCUS_14880 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026898.1:nicotinate phosphoribosyltransferase 819 631 gene locus_tag LOCUS_14890 819 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1044 835 gene locus_tag LOCUS_14900 1044 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2227 1025 gene locus_tag LOCUS_14910 2227 1025 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040674.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence302 1277 1849 gene locus_tag LOCUS_14920 gene rsmD 1277 1849 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_14920 1978 2373 gene locus_tag LOCUS_14930 gene coaD 1978 2373 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence303 1045 407 gene locus_tag LOCUS_14940 1045 407 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_14940 1911 1120 gene locus_tag LOCUS_14950 1911 1120 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031903.1 protein_id gnl|my_center|LOCUS_14950 2446 1997 gene locus_tag LOCUS_14960 2446 1997 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967034.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence304 >Feature sequence305 857 42 gene locus_tag LOCUS_14970 857 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1165 1938 gene locus_tag LOCUS_14980 1165 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 <2652 2024 gene locus_tag LOCUS_14990 <2652 2024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093456948.1:trypsin-like peptidase domain-containing protein >Feature sequence306 <2633 93 gene locus_tag LOCUS_15000 <2633 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' >Feature sequence307 1040 159 gene locus_tag LOCUS_15010 gene azf 1040 159 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence308 680 1255 gene locus_tag LOCUS_15020 680 1255 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_15020 1255 2265 gene locus_tag LOCUS_15030 1255 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence309 >Feature sequence310 1752 847 gene locus_tag LOCUS_15040 gene parJ 1752 847 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_15040 1907 2299 gene locus_tag LOCUS_15050 1907 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2362 2535 gene locus_tag LOCUS_15060 2362 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence311 318 503 gene locus_tag LOCUS_15070 318 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 603 2387 gene locus_tag LOCUS_15080 603 2387 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_15080 2384 2539 gene locus_tag LOCUS_15090 2384 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence312 1205 825 gene locus_tag LOCUS_15100 gene gcvH 1205 825 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_15100 1890 1261 gene locus_tag LOCUS_15110 1890 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence313 1658 60 gene locus_tag LOCUS_15120 1658 60 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence314 403 1167 gene locus_tag LOCUS_15130 gene modA 403 1167 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_15130 1516 2202 gene locus_tag LOCUS_15140 gene modB 1516 2202 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence315 >Feature sequence316 868 602 gene locus_tag LOCUS_15150 868 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2107 908 gene locus_tag LOCUS_15160 gene coaBC 2107 908 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259488.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence317 <2527 1833 gene locus_tag LOCUS_15170 <2527 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha >Feature sequence318 698 1531 gene locus_tag LOCUS_15180 698 1531 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_15180 2335 1583 gene locus_tag LOCUS_15190 gene fabG 2335 1583 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence319 1171 2151 gene locus_tag LOCUS_15200 1171 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence320 628 855 gene locus_tag LOCUS_15210 628 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 881 2104 gene locus_tag LOCUS_15220 881 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence321 885 469 gene locus_tag LOCUS_15230 885 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1122 1469 gene locus_tag LOCUS_15240 1122 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence322 1803 1012 gene locus_tag LOCUS_15250 1803 1012 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_15250 2030 1821 gene locus_tag LOCUS_15260 2030 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence323 8 520 gene locus_tag LOCUS_15270 8 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 599 1327 gene locus_tag LOCUS_15280 gene hpaI 599 1327 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 protein_id gnl|my_center|LOCUS_15280 1344 2327 gene locus_tag LOCUS_15290 1344 2327 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528548.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence324 3 152 gene locus_tag LOCUS_15300 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1485 238 gene locus_tag LOCUS_15310 1485 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1718 2335 gene locus_tag LOCUS_15320 1718 2335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence325 >Feature sequence326 <1 600 gene locus_tag LOCUS_15330 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393223.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 597 1367 gene locus_tag LOCUS_15340 gene cobS 597 1367 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence327 >Feature sequence328 <1 1908 gene locus_tag LOCUS_15350 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244540.1:DNA topoisomerase (ATP-hydrolyzing) subunit A >Feature sequence329 1516 743 gene locus_tag LOCUS_15360 gene fabG 1516 743 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence330 2023 1070 gene locus_tag LOCUS_15370 gene fmt 2023 1070 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255944.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence331 2028 466 gene locus_tag LOCUS_15380 2028 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence332 <1 1370 gene locus_tag LOCUS_15390 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228654.1:cytochrome c-type biogenesis CcmF C-terminal domain-containing protein 1363 1797 gene locus_tag LOCUS_15400 1363 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence333 59 256 gene locus_tag LOCUS_15410 59 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 957 370 gene locus_tag LOCUS_15420 957 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1572 1054 gene locus_tag LOCUS_15430 1572 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2270 1845 gene locus_tag LOCUS_15440 2270 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence334 637 2073 gene locus_tag LOCUS_15450 637 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence335 804 481 gene locus_tag LOCUS_15460 804 481 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_15460 1128 2183 gene locus_tag LOCUS_15470 1128 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence336 <1 518 gene locus_tag LOCUS_15480 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257969.1:3-dehydroquinate synthase 554 838 gene locus_tag LOCUS_15490 554 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1087 854 gene locus_tag LOCUS_15500 1087 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1631 1353 gene locus_tag LOCUS_15510 1631 1353 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_15510 2098 1799 gene locus_tag LOCUS_15520 2098 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence337 1199 135 gene locus_tag LOCUS_15530 1199 135 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057409.1 protein_id gnl|my_center|LOCUS_15530 2024 1656 gene locus_tag LOCUS_15540 gene aroH 2024 1656 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence338 <1 764 gene locus_tag LOCUS_15550 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878898.1:ABC transporter ATP-binding protein 761 1324 gene locus_tag LOCUS_15560 gene cobO 761 1324 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_15560 1327 1881 gene locus_tag LOCUS_15570 gene cobO 1327 1881 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence339 >Feature sequence340 1146 943 gene locus_tag LOCUS_15580 1146 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1991 1440 gene locus_tag LOCUS_15590 1991 1440 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence341 964 389 gene locus_tag LOCUS_15600 964 389 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_15600 1193 1939 gene locus_tag LOCUS_15610 1193 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence342 610 254 gene locus_tag LOCUS_15620 gene cheY 610 254 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_15620 1121 624 gene locus_tag LOCUS_15630 1121 624 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_15630 1768 1118 gene locus_tag LOCUS_15640 1768 1118 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_15640 <2336 1769 gene locus_tag LOCUS_15650 <2336 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940968.1:chemotaxis protein CheA >Feature sequence343 347 1219 gene locus_tag LOCUS_15660 347 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1219 1830 gene locus_tag LOCUS_15670 1219 1830 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence344 459 881 gene locus_tag LOCUS_15680 459 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1036 1884 gene locus_tag LOCUS_15690 1036 1884 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence345 <1 733 gene locus_tag LOCUS_15700 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813511.1:FAD-dependent tricarballylate dehydrogenase TcuA 1168 812 gene locus_tag LOCUS_15710 1168 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2003 1197 gene locus_tag LOCUS_15720 2003 1197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878170.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence346 2182 44 gene locus_tag LOCUS_15730 2182 44 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461054.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence347 <2309 1698 gene locus_tag LOCUS_15740 <2309 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003222549.1:ketol-acid reductoisomerase >Feature sequence348 <1 1843 gene locus_tag LOCUS_15750 <1 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101675310.1:carboxyl transferase domain-containing protein >Feature sequence349 840 466 gene locus_tag LOCUS_15760 840 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1343 1074 gene locus_tag LOCUS_15770 1343 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 <2297 1449 gene locus_tag LOCUS_15780 <2297 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP diphosphokinase >Feature sequence350 >Feature sequence351 1022 12 gene locus_tag LOCUS_15790 1022 12 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927833.1 protein_id gnl|my_center|LOCUS_15790 2125 1112 gene locus_tag LOCUS_15800 2125 1112 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence352 <1 777 gene locus_tag LOCUS_15810 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256332.1:ABC transporter permease 860 1864 gene locus_tag LOCUS_15820 860 1864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670421.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence353 <1 623 gene locus_tag LOCUS_15830 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530646.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence354 541 1965 gene locus_tag LOCUS_15840 gene hydA 541 1965 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086079.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence355 >Feature sequence356 <1 933 gene locus_tag LOCUS_15850 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056381.1:adenylosuccinate synthase 1935 1033 gene locus_tag LOCUS_15860 gene dapA 1935 1033 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_15860 2253 2020 gene locus_tag LOCUS_15870 2253 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence357 1129 437 gene locus_tag LOCUS_15880 1129 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1591 2112 gene locus_tag LOCUS_15890 1591 2112 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence358 250 507 gene locus_tag LOCUS_15900 250 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1238 444 gene locus_tag LOCUS_15910 1238 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2081 1293 gene locus_tag LOCUS_15920 2081 1293 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040426.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence359 1827 460 gene locus_tag LOCUS_15930 1827 460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730698.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence360 636 409 gene locus_tag LOCUS_15940 636 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1444 1289 gene locus_tag LOCUS_15950 1444 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1651 1860 gene locus_tag LOCUS_15960 1651 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence361 737 33 gene locus_tag LOCUS_15970 737 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence362 792 2120 gene locus_tag LOCUS_15980 792 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence363 >Feature sequence364 1164 469 gene locus_tag LOCUS_15990 1164 469 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467005.1 protein_id gnl|my_center|LOCUS_15990 <2219 1257 gene locus_tag LOCUS_16000 <2219 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator >Feature sequence365 597 115 gene locus_tag LOCUS_16010 597 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1363 1896 gene locus_tag LOCUS_16020 1363 1896 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561904.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence366 577 242 gene locus_tag LOCUS_16030 577 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence367 1566 601 gene locus_tag LOCUS_16040 1566 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence368 >Feature sequence369 1518 1066 gene locus_tag LOCUS_16050 gene purE 1518 1066 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769750.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence370 >Feature sequence371 259 984 gene locus_tag LOCUS_16060 259 984 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence372 >Feature sequence373 643 1638 gene locus_tag LOCUS_16070 gene pdxS 643 1638 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence374 <1 988 gene locus_tag LOCUS_16080 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113318.1:sensor histidine kinase 1104 937 gene locus_tag LOCUS_16090 1104 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1177 1683 gene locus_tag LOCUS_16100 1177 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence375 224 1723 gene locus_tag LOCUS_16110 224 1723 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419032.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence376 1153 746 gene locus_tag LOCUS_16120 1153 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <2143 1183 gene locus_tag LOCUS_16130 <2143 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023022.1:archaellar assembly protein FlaJ >Feature sequence377 959 2059 gene locus_tag LOCUS_16140 959 2059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207945133.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence378 1797 784 gene locus_tag LOCUS_16150 1797 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence379 <1 728 gene locus_tag LOCUS_16160 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727690.1:LLM class flavin-dependent oxidoreductase 775 1752 gene locus_tag LOCUS_16170 775 1752 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066950.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence380 921 2036 gene locus_tag LOCUS_16180 921 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence381 1305 1778 gene locus_tag LOCUS_16190 1305 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence382 268 513 gene locus_tag LOCUS_16200 268 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 516 698 gene locus_tag LOCUS_16210 516 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 <2108 876 gene locus_tag LOCUS_16220 <2108 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016819.1:ABC transporter substrate-binding protein >Feature sequence383 2064 16 gene locus_tag LOCUS_16230 2064 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence384 1068 16 gene locus_tag LOCUS_16240 1068 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1318 1644 gene locus_tag LOCUS_16250 1318 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence385 299 1420 gene locus_tag LOCUS_16260 299 1420 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence386 1923 241 gene locus_tag LOCUS_16270 1923 241 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence387 1707 691 gene locus_tag LOCUS_16280 1707 691 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence388 377 1576 gene locus_tag LOCUS_16290 377 1576 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence389 <1 1090 gene locus_tag LOCUS_16300 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258873.1:adenosylhomocysteinase 1202 1648 gene locus_tag LOCUS_16310 1202 1648 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence390 1869 439 gene locus_tag LOCUS_16320 1869 439 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence391 <1 539 gene locus_tag LOCUS_16330 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976186.1:SDR family oxidoreductase 604 1347 gene locus_tag LOCUS_16340 604 1347 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence392 >Feature sequence393 335 54 gene locus_tag LOCUS_16350 335 54 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_16350 1269 508 gene locus_tag LOCUS_16360 1269 508 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence394 <2009 751 gene locus_tag LOCUS_16370 <2009 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789215.1:DUF4876 domain-containing protein >Feature sequence395 <2003 916 gene locus_tag LOCUS_16380 <2003 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966707.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence396 631 77 gene locus_tag LOCUS_16390 631 77 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_16390 <2001 908 gene locus_tag LOCUS_16400 <2001 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900904.1:FAD/NAD(P)-binding oxidoreductase