>Feature sequence0001 604 92 gene locus_tag LOCUS_00010 604 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1520 705 gene locus_tag LOCUS_00020 1520 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3060 1513 gene locus_tag LOCUS_00030 3060 1513 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 protein_id gnl|my_center|LOCUS_00030 3787 3239 gene locus_tag LOCUS_00040 3787 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4776 3823 gene locus_tag LOCUS_00050 4776 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6933 4789 gene locus_tag LOCUS_00060 6933 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7115 6963 gene locus_tag LOCUS_00070 7115 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7386 7108 gene locus_tag LOCUS_00080 7386 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8518 7388 gene locus_tag LOCUS_00090 8518 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9137 8541 gene locus_tag LOCUS_00100 9137 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00100 10171 9137 gene locus_tag LOCUS_00110 10171 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00110 10395 10207 gene locus_tag LOCUS_00120 10395 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10779 10588 gene locus_tag LOCUS_00130 10779 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11219 10788 gene locus_tag LOCUS_00140 11219 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11478 11203 gene locus_tag LOCUS_00150 11478 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11678 11481 gene locus_tag LOCUS_00160 11678 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12046 11675 gene locus_tag LOCUS_00170 12046 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12963 12352 gene locus_tag LOCUS_00180 12963 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13183 12944 gene locus_tag LOCUS_00190 13183 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13506 13207 gene locus_tag LOCUS_00200 13506 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14179 13430 gene locus_tag LOCUS_00210 14179 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 14470 14228 gene locus_tag LOCUS_00220 14470 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 14937 14473 gene locus_tag LOCUS_00230 14937 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 15382 14945 gene locus_tag LOCUS_00240 15382 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 15803 15396 gene locus_tag LOCUS_00250 15803 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 16263 15769 gene locus_tag LOCUS_00260 16263 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 16877 16260 gene locus_tag LOCUS_00270 16877 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 17139 16870 gene locus_tag LOCUS_00280 17139 16870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 17617 17111 gene locus_tag LOCUS_00290 17617 17111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 17745 17668 gene locus_tag LOCUS_t00010 17745 17668 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18619 17792 gene locus_tag LOCUS_00300 18619 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 19112 18702 gene locus_tag LOCUS_00310 19112 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 19467 19087 gene locus_tag LOCUS_00320 19467 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 19693 19472 gene locus_tag LOCUS_00330 19693 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 20301 19690 gene locus_tag LOCUS_00340 gene dcd 20301 19690 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604072.1 protein_id gnl|my_center|LOCUS_00340 20638 20327 gene locus_tag LOCUS_00350 20638 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 20837 20628 gene locus_tag LOCUS_00360 20837 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 21340 20864 gene locus_tag LOCUS_00370 21340 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 21657 21325 gene locus_tag LOCUS_00380 21657 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 22007 21639 gene locus_tag LOCUS_00390 22007 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22768 22010 gene locus_tag LOCUS_00400 22768 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 23279 22773 gene locus_tag LOCUS_00410 23279 22773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 23978 23301 gene locus_tag LOCUS_00420 23978 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 24315 23884 gene locus_tag LOCUS_00430 24315 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence0002 380 2527 gene locus_tag LOCUS_00440 380 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2539 3177 gene locus_tag LOCUS_00450 2539 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 3177 4283 gene locus_tag LOCUS_00460 3177 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 4751 7411 gene locus_tag LOCUS_00470 4751 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7411 7761 gene locus_tag LOCUS_00480 7411 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7758 8018 gene locus_tag LOCUS_00490 7758 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 8022 8294 gene locus_tag LOCUS_00500 8022 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 8294 8524 gene locus_tag LOCUS_00510 8294 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8521 9003 gene locus_tag LOCUS_00520 8521 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 9000 9404 gene locus_tag LOCUS_00530 9000 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 9401 9580 gene locus_tag LOCUS_00540 9401 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 9744 9953 gene locus_tag LOCUS_00550 9744 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 9950 10351 gene locus_tag LOCUS_00560 9950 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10988 10302 gene locus_tag LOCUS_00570 10988 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 11438 11947 gene locus_tag LOCUS_00580 11438 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 12377 12631 gene locus_tag LOCUS_00590 12377 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12628 12849 gene locus_tag LOCUS_00600 12628 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 12846 13031 gene locus_tag LOCUS_00610 12846 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 13049 13312 gene locus_tag LOCUS_00620 13049 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 13297 13776 gene locus_tag LOCUS_00630 13297 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13782 14006 gene locus_tag LOCUS_00640 13782 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 14304 14744 gene locus_tag LOCUS_00650 14304 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14741 15580 gene locus_tag LOCUS_00660 14741 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 15577 16233 gene locus_tag LOCUS_00670 15577 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 16298 16570 gene locus_tag LOCUS_00680 16298 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 16687 16947 gene locus_tag LOCUS_00690 16687 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16944 17222 gene locus_tag LOCUS_00700 16944 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17237 18922 gene locus_tag LOCUS_00710 17237 18922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 18952 19251 gene locus_tag LOCUS_00720 18952 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19251 19445 gene locus_tag LOCUS_00730 19251 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 19442 20137 gene locus_tag LOCUS_00740 19442 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 20118 20465 gene locus_tag LOCUS_00750 20118 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 20429 20854 gene locus_tag LOCUS_00760 20429 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence0003 1704 274 gene locus_tag LOCUS_00770 1704 274 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_00770 2381 1701 gene locus_tag LOCUS_00780 2381 1701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_00780 2777 4039 gene locus_tag LOCUS_00790 2777 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4798 5274 gene locus_tag LOCUS_00800 4798 5274 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 5687 5986 gene locus_tag LOCUS_00810 5687 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6095 6319 gene locus_tag LOCUS_00820 6095 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6330 6452 gene locus_tag LOCUS_00830 6330 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6573 9287 gene locus_tag LOCUS_00840 gene bamA 6573 9287 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_00840 9355 9600 gene locus_tag LOCUS_00850 9355 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9616 10194 gene locus_tag LOCUS_00860 9616 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10774 11268 gene locus_tag LOCUS_00870 10774 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 11841 12248 gene locus_tag LOCUS_00880 11841 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 12317 13789 gene locus_tag LOCUS_00890 12317 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 14626 15477 gene locus_tag LOCUS_00900 14626 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 15597 17585 gene locus_tag LOCUS_00910 15597 17585 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence0004 35 304 gene locus_tag LOCUS_00920 35 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 327 2066 gene locus_tag LOCUS_00930 327 2066 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_00930 2499 2104 gene locus_tag LOCUS_00940 2499 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2744 2496 gene locus_tag LOCUS_00950 2744 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 2815 3777 gene locus_tag LOCUS_00960 2815 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4174 5382 gene locus_tag LOCUS_00970 gene nagA 4174 5382 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_00970 5448 6209 gene locus_tag LOCUS_00980 5448 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6308 6685 gene locus_tag LOCUS_00990 6308 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 7071 6868 gene locus_tag LOCUS_01000 7071 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7205 8005 gene locus_tag LOCUS_01010 7205 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 8002 8442 gene locus_tag LOCUS_01020 8002 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 9652 8570 gene locus_tag LOCUS_01030 9652 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 10608 9694 gene locus_tag LOCUS_01040 10608 9694 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939186.1 protein_id gnl|my_center|LOCUS_01040 10638 10859 gene locus_tag LOCUS_01050 10638 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11021 11251 gene locus_tag LOCUS_01060 11021 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 11290 12297 gene locus_tag LOCUS_01070 11290 12297 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_01070 12412 13911 gene locus_tag LOCUS_01080 12412 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15370 14024 gene locus_tag LOCUS_01090 15370 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 15281 15496 gene locus_tag LOCUS_01100 15281 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 16365 15640 gene locus_tag LOCUS_01110 16365 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence0005 1386 43 gene locus_tag LOCUS_01120 gene aroA 1386 43 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392845.1 protein_id gnl|my_center|LOCUS_01120 2143 2535 gene locus_tag LOCUS_01130 2143 2535 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065140.1 protein_id gnl|my_center|LOCUS_01130 2549 2962 gene locus_tag LOCUS_01140 2549 2962 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_01140 4346 3108 gene locus_tag LOCUS_01150 4346 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5984 5382 gene locus_tag LOCUS_01160 5984 5382 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_01160 6504 7850 gene locus_tag LOCUS_01170 6504 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8410 9201 gene locus_tag LOCUS_01180 8410 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 9215 9742 gene locus_tag LOCUS_01190 9215 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 9739 10413 gene locus_tag LOCUS_01200 9739 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 10612 10391 gene locus_tag LOCUS_01210 10612 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 11025 11261 gene locus_tag LOCUS_01220 11025 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01220 11799 11875 gene locus_tag LOCUS_t00020 11799 11875 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13125 11956 gene locus_tag LOCUS_01230 13125 11956 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_01230 13556 13293 gene locus_tag LOCUS_01240 13556 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 15209 14130 gene locus_tag LOCUS_01250 15209 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01250 >Feature sequence0006 1821 955 gene locus_tag LOCUS_01260 1821 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2126 3184 gene locus_tag LOCUS_01270 2126 3184 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_01270 4612 3311 gene locus_tag LOCUS_01280 4612 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6842 4914 gene locus_tag LOCUS_01290 6842 4914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_01290 7101 8363 gene locus_tag LOCUS_01300 7101 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8401 9432 gene locus_tag LOCUS_01310 8401 9432 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_01310 9649 10470 gene locus_tag LOCUS_01320 gene mreC 9649 10470 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_01320 10471 10959 gene locus_tag LOCUS_01330 10471 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 10962 12827 gene locus_tag LOCUS_01340 gene mrdA 10962 12827 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01340 12985 14082 gene locus_tag LOCUS_01350 gene rodA 12985 14082 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence0007 881 1666 gene locus_tag LOCUS_01360 881 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2483 4081 gene locus_tag LOCUS_01370 2483 4081 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_01370 4801 4085 gene locus_tag LOCUS_01380 4801 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5017 5589 gene locus_tag LOCUS_01390 5017 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 5718 6155 gene locus_tag LOCUS_01400 5718 6155 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_01400 6443 7663 gene locus_tag LOCUS_01410 6443 7663 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968655.1 protein_id gnl|my_center|LOCUS_01410 10816 7790 gene locus_tag LOCUS_01420 10816 7790 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_01420 11455 11009 gene locus_tag LOCUS_01430 gene tnpA 11455 11009 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence0008 1410 142 gene locus_tag LOCUS_01440 1410 142 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_01440 2984 1704 gene locus_tag LOCUS_01450 2984 1704 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_01450 4233 3328 gene locus_tag LOCUS_01460 4233 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4455 5564 gene locus_tag LOCUS_01470 gene mqnE 4455 5564 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_01470 6817 5765 gene locus_tag LOCUS_01480 6817 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031363.1 protein_id gnl|my_center|LOCUS_01480 7848 6850 gene locus_tag LOCUS_01490 7848 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027361.1 protein_id gnl|my_center|LOCUS_01490 8682 8200 gene locus_tag LOCUS_01500 8682 8200 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993958.1 protein_id gnl|my_center|LOCUS_01500 8946 9641 gene locus_tag LOCUS_01510 8946 9641 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_01510 10081 9701 gene locus_tag LOCUS_01520 10081 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10180 11097 gene locus_tag LOCUS_01530 10180 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11528 11094 gene locus_tag LOCUS_01540 11528 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11493 11678 gene locus_tag LOCUS_01550 11493 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11689 11856 gene locus_tag LOCUS_01560 11689 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence0009 945 61 gene locus_tag LOCUS_01570 945 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1527 2984 gene locus_tag LOCUS_01580 gene gnd 1527 2984 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 protein_id gnl|my_center|LOCUS_01580 3835 3074 gene locus_tag LOCUS_01590 3835 3074 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_01590 4551 4781 gene locus_tag LOCUS_01600 4551 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 4783 5205 gene locus_tag LOCUS_01610 4783 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5343 5594 gene locus_tag LOCUS_01620 5343 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5603 6055 gene locus_tag LOCUS_01630 5603 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 6764 6207 gene locus_tag LOCUS_01640 6764 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7335 10160 gene locus_tag LOCUS_01650 7335 10160 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_01650 10475 11212 gene locus_tag LOCUS_01660 10475 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence0010 <1 2851 gene locus_tag LOCUS_01670 <1 2851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037353.1:TonB-dependent receptor 3104 3406 gene locus_tag LOCUS_01680 3104 3406 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_01680 3406 4011 gene locus_tag LOCUS_01690 gene recR 3406 4011 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_01690 4507 5187 gene locus_tag LOCUS_01700 4507 5187 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_01700 5603 7165 gene locus_tag LOCUS_01710 gene rny 5603 7165 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_01710 7468 8256 gene locus_tag LOCUS_01720 7468 8256 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_01720 8366 9691 gene locus_tag LOCUS_01730 gene ffh 8366 9691 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_01730 9805 10209 gene locus_tag LOCUS_01740 9805 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 11177 10257 gene locus_tag LOCUS_01750 11177 10257 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263651.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence0011 1444 692 gene locus_tag LOCUS_01760 1444 692 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_01760 1739 2176 gene locus_tag LOCUS_01770 1739 2176 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_01770 2187 3140 gene locus_tag LOCUS_01780 gene cysK 2187 3140 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_01780 3252 4190 gene locus_tag LOCUS_01790 3252 4190 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_01790 4120 4881 gene locus_tag LOCUS_01800 4120 4881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_01800 5382 5059 gene locus_tag LOCUS_01810 5382 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6833 5865 gene locus_tag LOCUS_01820 6833 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 7023 11312 gene locus_tag LOCUS_01830 7023 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence0012 2088 1834 gene locus_tag LOCUS_01840 2088 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 4891 1979 gene locus_tag LOCUS_01850 gene treS 4891 1979 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_01850 5904 4906 gene locus_tag LOCUS_01860 5904 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6323 5904 gene locus_tag LOCUS_01870 6323 5904 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_01870 6940 6587 gene locus_tag LOCUS_01880 6940 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7411 7160 gene locus_tag LOCUS_01890 7411 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8020 7595 gene locus_tag LOCUS_01900 8020 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8462 9805 gene locus_tag LOCUS_01910 8462 9805 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_01910 11157 9898 gene locus_tag LOCUS_01920 11157 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence0013 862 1236 gene locus_tag LOCUS_01930 862 1236 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_01930 2162 1233 gene locus_tag LOCUS_01940 gene murB 2162 1233 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_01940 3046 2540 gene locus_tag LOCUS_01950 3046 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3558 3719 gene locus_tag LOCUS_01960 3558 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3732 4025 gene locus_tag LOCUS_01970 3732 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4040 6919 gene locus_tag LOCUS_01980 4040 6919 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_01980 7006 7233 gene locus_tag LOCUS_01990 7006 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7230 7613 gene locus_tag LOCUS_02000 7230 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 7794 9401 gene locus_tag LOCUS_02010 7794 9401 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_02010 9546 10232 gene locus_tag LOCUS_02020 9546 10232 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_02020 10349 10927 gene locus_tag LOCUS_02030 10349 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 11121 10924 gene locus_tag LOCUS_02040 11121 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence0014 1776 424 gene locus_tag LOCUS_02050 1776 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2797 1901 gene locus_tag LOCUS_02060 2797 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4221 2797 gene locus_tag LOCUS_02070 4221 2797 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_02070 6002 4344 gene locus_tag LOCUS_02080 6002 4344 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_02080 6520 6002 gene locus_tag LOCUS_02090 6520 6002 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_02090 6882 6520 gene locus_tag LOCUS_02100 6882 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7244 7077 gene locus_tag LOCUS_02110 7244 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7756 7475 gene locus_tag LOCUS_02120 7756 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8130 7876 gene locus_tag LOCUS_02130 8130 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 9093 8371 gene locus_tag LOCUS_02140 9093 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 9280 9083 gene locus_tag LOCUS_02150 9280 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 10513 9377 gene locus_tag LOCUS_02160 10513 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02160 11195 10521 gene locus_tag LOCUS_02170 11195 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02170 >Feature sequence0015 2772 2551 gene locus_tag LOCUS_02180 2772 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 2884 3024 gene locus_tag LOCUS_02190 2884 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3984 3211 gene locus_tag LOCUS_02200 3984 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5793 4213 gene locus_tag LOCUS_02210 5793 4213 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933908.1 protein_id gnl|my_center|LOCUS_02210 6719 6291 gene locus_tag LOCUS_02220 6719 6291 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_02220 7295 6780 gene locus_tag LOCUS_02230 7295 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 8298 7309 gene locus_tag LOCUS_02240 8298 7309 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088480.1 protein_id gnl|my_center|LOCUS_02240 9002 8673 gene locus_tag LOCUS_02250 9002 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9043 9267 gene locus_tag LOCUS_02260 9043 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9719 10105 gene locus_tag LOCUS_02270 9719 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 <11313 10767 gene locus_tag LOCUS_02280 <11313 10767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000625631.1:phosphodiesterase YaeI >Feature sequence0016 <1 1920 gene locus_tag LOCUS_02290 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037353.1:TonB-dependent receptor 2080 4167 gene locus_tag LOCUS_02300 2080 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4861 4460 gene locus_tag LOCUS_02310 4861 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5103 6008 gene locus_tag LOCUS_02320 5103 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6339 6587 gene locus_tag LOCUS_02330 6339 6587 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965812.1 protein_id gnl|my_center|LOCUS_02330 6641 6829 gene locus_tag LOCUS_02340 6641 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7676 8014 gene locus_tag LOCUS_02350 7676 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9466 8117 gene locus_tag LOCUS_02360 9466 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11037 9808 gene locus_tag LOCUS_02370 11037 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence0017 108 1034 gene locus_tag LOCUS_02380 108 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1031 1210 gene locus_tag LOCUS_02390 1031 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1557 2402 gene locus_tag LOCUS_02400 1557 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 3603 2458 gene locus_tag LOCUS_02410 3603 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3848 3588 gene locus_tag LOCUS_02420 3848 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4129 3866 gene locus_tag LOCUS_02430 4129 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4374 4222 gene locus_tag LOCUS_02440 4374 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6402 4378 gene locus_tag LOCUS_02450 6402 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7529 6399 gene locus_tag LOCUS_02460 7529 6399 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427735.1 protein_id gnl|my_center|LOCUS_02460 9175 7601 gene locus_tag LOCUS_02470 9175 7601 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 10153 9395 gene locus_tag LOCUS_02480 10153 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 <11085 10210 gene locus_tag LOCUS_02490 <11085 10210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0018 1214 36 gene locus_tag LOCUS_02500 1214 36 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_02500 1843 1568 gene locus_tag LOCUS_02510 1843 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2410 2006 gene locus_tag LOCUS_02520 2410 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2980 2594 gene locus_tag LOCUS_02530 2980 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3340 5730 gene locus_tag LOCUS_02540 3340 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8359 5957 gene locus_tag LOCUS_02550 8359 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8603 9757 gene locus_tag LOCUS_02560 8603 9757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence0019 <1 540 gene locus_tag LOCUS_02570 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942184.1:AAA family ATPase 568 1455 gene locus_tag LOCUS_02580 568 1455 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_02580 1459 2853 gene locus_tag LOCUS_02590 1459 2853 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_02590 2903 4207 gene locus_tag LOCUS_02600 2903 4207 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_02600 4233 4754 gene locus_tag LOCUS_02610 4233 4754 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_02610 5022 7049 gene locus_tag LOCUS_02620 gene asnB 5022 7049 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533124.1 protein_id gnl|my_center|LOCUS_02620 7055 7327 gene locus_tag LOCUS_02630 7055 7327 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_02630 7324 8883 gene locus_tag LOCUS_02640 7324 8883 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171507.1 protein_id gnl|my_center|LOCUS_02640 8918 9268 gene locus_tag LOCUS_02650 8918 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 9265 10263 gene locus_tag LOCUS_02660 gene nadE 9265 10263 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence0020 130 498 gene locus_tag LOCUS_02670 130 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1173 1442 gene locus_tag LOCUS_02680 1173 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 1808 1590 gene locus_tag LOCUS_02690 1808 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 1900 2457 gene locus_tag LOCUS_02700 1900 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_02700 2553 3563 gene locus_tag LOCUS_02710 2553 3563 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724021.1 protein_id gnl|my_center|LOCUS_02710 5568 3775 gene locus_tag LOCUS_02720 5568 3775 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_02720 7323 6169 gene locus_tag LOCUS_02730 7323 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7970 7497 gene locus_tag LOCUS_02740 7970 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 8854 8156 gene locus_tag LOCUS_02750 8854 8156 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_02750 9101 9424 gene locus_tag LOCUS_02760 9101 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 10392 9766 gene locus_tag LOCUS_02770 10392 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence0021 1699 1409 gene locus_tag LOCUS_02780 1699 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2091 1801 gene locus_tag LOCUS_02790 2091 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2471 2100 gene locus_tag LOCUS_02800 2471 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2916 2482 gene locus_tag LOCUS_02810 2916 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3495 2983 gene locus_tag LOCUS_02820 3495 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3927 3508 gene locus_tag LOCUS_02830 3927 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4486 3917 gene locus_tag LOCUS_02840 4486 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4803 4486 gene locus_tag LOCUS_02850 4803 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5217 4804 gene locus_tag LOCUS_02860 5217 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 5530 5234 gene locus_tag LOCUS_02870 5530 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6639 5530 gene locus_tag LOCUS_02880 6639 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7265 6642 gene locus_tag LOCUS_02890 7265 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7655 7287 gene locus_tag LOCUS_02900 7655 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 7863 7666 gene locus_tag LOCUS_02910 7863 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9086 7860 gene locus_tag LOCUS_02920 9086 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9821 9372 gene locus_tag LOCUS_02930 9821 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10460 9855 gene locus_tag LOCUS_02940 10460 9855 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence0022 2421 1099 gene locus_tag LOCUS_02950 2421 1099 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892609.1 protein_id gnl|my_center|LOCUS_02950 5496 2422 gene locus_tag LOCUS_02960 5496 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 <10258 5502 gene locus_tag LOCUS_02970 <10258 5502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence0023 1310 297 gene locus_tag LOCUS_02980 1310 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2580 1594 gene locus_tag LOCUS_02990 2580 1594 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_02990 3105 2647 gene locus_tag LOCUS_03000 3105 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3584 3195 gene locus_tag LOCUS_03010 3584 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 4411 3929 gene locus_tag LOCUS_03020 4411 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5386 4619 gene locus_tag LOCUS_03030 5386 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5907 6503 gene locus_tag LOCUS_03040 5907 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6885 6562 gene locus_tag LOCUS_03050 6885 6562 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_03050 7052 6873 gene locus_tag LOCUS_03060 7052 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7474 7277 gene locus_tag LOCUS_03070 7474 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9393 7606 gene locus_tag LOCUS_03080 9393 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 9604 9281 gene locus_tag LOCUS_03090 9604 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9810 9601 gene locus_tag LOCUS_03100 9810 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 9946 10128 gene locus_tag LOCUS_03110 9946 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0024 <1 710 gene locus_tag LOCUS_03120 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545418.1:glutamate--tRNA ligase 1121 2410 gene locus_tag LOCUS_03130 1121 2410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_03130 2664 2855 gene locus_tag LOCUS_03140 2664 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3293 4864 gene locus_tag LOCUS_03150 3293 4864 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728060.1 protein_id gnl|my_center|LOCUS_03150 5026 5550 gene locus_tag LOCUS_03160 5026 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6303 5773 gene locus_tag LOCUS_03170 6303 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7298 6570 gene locus_tag LOCUS_03180 7298 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 7785 8183 gene locus_tag LOCUS_03190 7785 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 10005 8287 gene locus_tag LOCUS_03200 10005 8287 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence0025 1 519 gene locus_tag LOCUS_03210 1 519 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928633.1 protein_id gnl|my_center|LOCUS_03210 3080 732 gene locus_tag LOCUS_03220 3080 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4331 3240 gene locus_tag LOCUS_03230 4331 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6419 4566 gene locus_tag LOCUS_03240 6419 4566 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088960.1 protein_id gnl|my_center|LOCUS_03240 7520 7029 gene locus_tag LOCUS_03250 7520 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7653 7525 gene locus_tag LOCUS_03260 7653 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7635 8057 gene locus_tag LOCUS_03270 7635 8057 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193467.1 protein_id gnl|my_center|LOCUS_03270 8054 8605 gene locus_tag LOCUS_03280 8054 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8602 9534 gene locus_tag LOCUS_03290 8602 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence0026 119 550 gene locus_tag LOCUS_03300 119 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 547 1527 gene locus_tag LOCUS_03310 547 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1527 1829 gene locus_tag LOCUS_03320 1527 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1829 3604 gene locus_tag LOCUS_03330 1829 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 3608 4441 gene locus_tag LOCUS_03340 3608 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4478 5605 gene locus_tag LOCUS_03350 4478 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5607 5834 gene locus_tag LOCUS_03360 5607 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence0027 1507 299 gene locus_tag LOCUS_03370 1507 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2691 1708 gene locus_tag LOCUS_03380 2691 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3031 2810 gene locus_tag LOCUS_03390 3031 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4420 3050 gene locus_tag LOCUS_03400 4420 3050 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_03400 5626 4598 gene locus_tag LOCUS_03410 5626 4598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_03410 6686 5697 gene locus_tag LOCUS_03420 6686 5697 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_03420 7075 8421 gene locus_tag LOCUS_03430 7075 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 <9816 8895 gene locus_tag LOCUS_03440 <9816 8895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963433.1:aliphatic sulfonate ABC transporter substrate-binding protein >Feature sequence0028 1710 295 gene locus_tag LOCUS_03450 1710 295 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_03450 2149 1904 gene locus_tag LOCUS_03460 2149 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3688 2315 gene locus_tag LOCUS_03470 3688 2315 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_03470 5319 3697 gene locus_tag LOCUS_03480 5319 3697 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_03480 6636 5431 gene locus_tag LOCUS_03490 6636 5431 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03490 7865 6744 gene locus_tag LOCUS_03500 7865 6744 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_03500 9681 7942 gene locus_tag LOCUS_03510 gene pilB 9681 7942 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0029 746 1162 gene locus_tag LOCUS_03520 746 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1182 1631 gene locus_tag LOCUS_03530 1182 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2295 1915 gene locus_tag LOCUS_03540 2295 1915 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_03540 2834 2622 gene locus_tag LOCUS_03550 2834 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3671 2889 gene locus_tag LOCUS_03560 3671 2889 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_03560 5691 3742 gene locus_tag LOCUS_03570 5691 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 8287 6119 gene locus_tag LOCUS_03580 8287 6119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_03580 8897 9127 gene locus_tag LOCUS_03590 8897 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0030 608 772 gene locus_tag LOCUS_03600 608 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2136 1105 gene locus_tag LOCUS_03610 2136 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3458 2148 gene locus_tag LOCUS_03620 3458 2148 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_03620 5037 3466 gene locus_tag LOCUS_03630 5037 3466 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 protein_id gnl|my_center|LOCUS_03630 5317 5048 gene locus_tag LOCUS_03640 5317 5048 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_03640 6421 5387 gene locus_tag LOCUS_03650 6421 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7664 6426 gene locus_tag LOCUS_03660 7664 6426 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_03660 <9700 7661 gene locus_tag LOCUS_03670 <9700 7661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated >Feature sequence0031 204 830 gene locus_tag LOCUS_03680 gene rpoE 204 830 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_03680 857 1654 gene locus_tag LOCUS_03690 857 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1761 2699 gene locus_tag LOCUS_03700 1761 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3222 3902 gene locus_tag LOCUS_03710 3222 3902 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_03710 4087 8073 gene locus_tag LOCUS_03720 4087 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8176 9378 gene locus_tag LOCUS_03730 8176 9378 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0032 2169 1867 gene locus_tag LOCUS_03740 gene nuoK 2169 1867 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_03740 2682 2176 gene locus_tag LOCUS_03750 2682 2176 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_03750 3191 2718 gene locus_tag LOCUS_03760 3191 2718 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017383.1 protein_id gnl|my_center|LOCUS_03760 3612 4493 gene locus_tag LOCUS_03770 3612 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4498 4719 gene locus_tag LOCUS_03780 gene thiS 4498 4719 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_03780 6350 4755 gene locus_tag LOCUS_03790 gene murJ 6350 4755 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_03790 7406 6375 gene locus_tag LOCUS_03800 gene lpxD 7406 6375 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142009.1 protein_id gnl|my_center|LOCUS_03800 7659 8543 gene locus_tag LOCUS_03810 gene xerD 7659 8543 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_03810 9688 8540 gene locus_tag LOCUS_03820 9688 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence0033 58 255 gene locus_tag LOCUS_03830 58 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 598 239 gene locus_tag LOCUS_03840 598 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 2375 618 gene locus_tag LOCUS_03850 2375 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3267 2596 gene locus_tag LOCUS_03860 3267 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6728 3429 gene locus_tag LOCUS_03870 6728 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7504 6776 gene locus_tag LOCUS_03880 7504 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 8276 8043 gene locus_tag LOCUS_03890 8276 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 8956 8312 gene locus_tag LOCUS_03900 8956 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence0034 1274 126 gene locus_tag LOCUS_03910 1274 126 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_03910 1520 3202 gene locus_tag LOCUS_03920 gene ilvD 1520 3202 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_03920 3480 4001 gene locus_tag LOCUS_03930 3480 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 4459 4046 gene locus_tag LOCUS_03940 4459 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5529 4600 gene locus_tag LOCUS_03950 gene mdh 5529 4600 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_03950 6958 5714 gene locus_tag LOCUS_03960 gene icd 6958 5714 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_03960 7569 7195 gene locus_tag LOCUS_03970 7569 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7898 9235 gene locus_tag LOCUS_03980 gene tssK 7898 9235 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521949.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence0035 496 711 gene locus_tag LOCUS_03990 496 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2060 756 gene locus_tag LOCUS_04000 2060 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3986 2421 gene locus_tag LOCUS_04010 3986 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4316 4564 gene locus_tag LOCUS_04020 4316 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4730 6337 gene locus_tag LOCUS_04030 4730 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6423 7448 gene locus_tag LOCUS_04040 6423 7448 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_04040 7455 8057 gene locus_tag LOCUS_04050 7455 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8054 9364 gene locus_tag LOCUS_04060 8054 9364 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence0036 162 1175 gene locus_tag LOCUS_04070 162 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1172 1735 gene locus_tag LOCUS_04080 1172 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2430 1870 gene locus_tag LOCUS_04090 2430 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3381 3061 gene locus_tag LOCUS_04100 3381 3061 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 protein_id gnl|my_center|LOCUS_04100 3412 3570 gene locus_tag LOCUS_04110 3412 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5233 3599 gene locus_tag LOCUS_04120 5233 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5426 5701 gene locus_tag LOCUS_04130 5426 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9189 5815 gene locus_tag LOCUS_04140 9189 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence0037 669 160 gene locus_tag LOCUS_04150 669 160 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942971.1 protein_id gnl|my_center|LOCUS_04150 849 1946 gene locus_tag LOCUS_04160 849 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 1915 2139 gene locus_tag LOCUS_04170 1915 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 <9179 2347 gene locus_tag LOCUS_04180 <9179 2347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994041.1:glucoamylase family protein >Feature sequence0038 1054 464 gene locus_tag LOCUS_04190 1054 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3257 1227 gene locus_tag LOCUS_04200 3257 1227 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_04200 3685 3951 gene locus_tag LOCUS_04210 3685 3951 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_04210 6521 4071 gene locus_tag LOCUS_04220 gene priA 6521 4071 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_04220 6772 7218 gene locus_tag LOCUS_04230 6772 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 7540 7268 gene locus_tag LOCUS_04240 7540 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7848 7549 gene locus_tag LOCUS_04250 7848 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence0039 420 1289 gene locus_tag LOCUS_04260 420 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1664 1323 gene locus_tag LOCUS_04270 1664 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2037 1681 gene locus_tag LOCUS_04280 2037 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3235 2402 gene locus_tag LOCUS_04290 3235 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4018 3320 gene locus_tag LOCUS_04300 4018 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4782 4180 gene locus_tag LOCUS_04310 4782 4180 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_04310 5654 4794 gene locus_tag LOCUS_04320 5654 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6348 5686 gene locus_tag LOCUS_04330 6348 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7064 6462 gene locus_tag LOCUS_04340 7064 6462 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_04340 8678 7278 gene locus_tag LOCUS_04350 8678 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence0040 1221 151 gene locus_tag LOCUS_04360 1221 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1326 1655 gene locus_tag LOCUS_04370 1326 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1802 2083 gene locus_tag LOCUS_04380 1802 2083 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_04380 3242 2481 gene locus_tag LOCUS_04390 3242 2481 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525670.1 protein_id gnl|my_center|LOCUS_04390 4051 3314 gene locus_tag LOCUS_04400 4051 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4304 4110 gene locus_tag LOCUS_04410 4304 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5382 4669 gene locus_tag LOCUS_04420 5382 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5320 5538 gene locus_tag LOCUS_04430 5320 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6947 5544 gene locus_tag LOCUS_04440 6947 5544 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_04440 8892 7042 gene locus_tag LOCUS_04450 8892 7042 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_04450 9118 8948 gene locus_tag LOCUS_04460 9118 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence0041 1074 1985 gene locus_tag LOCUS_04470 1074 1985 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_04470 2681 2815 gene locus_tag LOCUS_04480 2681 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2979 2812 gene locus_tag LOCUS_04490 2979 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3149 2955 gene locus_tag LOCUS_04500 3149 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3218 3568 gene locus_tag LOCUS_04510 3218 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4547 3978 gene locus_tag LOCUS_04520 4547 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5620 4724 gene locus_tag LOCUS_04530 5620 4724 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_04530 6082 6336 gene locus_tag LOCUS_04540 6082 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7248 8537 gene locus_tag LOCUS_04550 7248 8537 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence0042 1580 312 gene locus_tag LOCUS_04560 1580 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2123 3970 gene locus_tag LOCUS_04570 2123 3970 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_04570 5735 4326 gene locus_tag LOCUS_04580 gene atoC 5735 4326 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_04580 6927 5767 gene locus_tag LOCUS_04590 6927 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7527 7144 gene locus_tag LOCUS_04600 7527 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7906 8454 gene locus_tag LOCUS_04610 7906 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 8451 8945 gene locus_tag LOCUS_04620 8451 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence0043 207 1241 gene locus_tag LOCUS_04630 207 1241 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_04630 1249 2148 gene locus_tag LOCUS_04640 gene murQ 1249 2148 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704387.1 protein_id gnl|my_center|LOCUS_04640 2337 3509 gene locus_tag LOCUS_04650 gene nagA 2337 3509 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298321.1 protein_id gnl|my_center|LOCUS_04650 3547 4812 gene locus_tag LOCUS_04660 gene murA 3547 4812 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 protein_id gnl|my_center|LOCUS_04660 4887 6101 gene locus_tag LOCUS_04670 gene wecB 4887 6101 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_04670 8406 6163 gene locus_tag LOCUS_04680 8406 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence0044 361 570 gene locus_tag LOCUS_04690 361 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 642 1415 gene locus_tag LOCUS_04700 642 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1556 1813 gene locus_tag LOCUS_04710 1556 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1810 3234 gene locus_tag LOCUS_04720 1810 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4271 6970 gene locus_tag LOCUS_04730 4271 6970 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_04730 7132 7368 gene locus_tag LOCUS_04740 7132 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence0045 2 772 gene locus_tag LOCUS_04750 2 772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_04750 762 1586 gene locus_tag LOCUS_04760 762 1586 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_04760 1586 2536 gene locus_tag LOCUS_04770 1586 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2579 2806 gene locus_tag LOCUS_04780 2579 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2837 3139 gene locus_tag LOCUS_04790 2837 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3223 4944 gene locus_tag LOCUS_04800 3223 4944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_04800 5167 4988 gene locus_tag LOCUS_04810 5167 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5174 5419 gene locus_tag LOCUS_04820 5174 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 5575 5874 gene locus_tag LOCUS_04830 5575 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5855 6247 gene locus_tag LOCUS_04840 5855 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7349 6300 gene locus_tag LOCUS_04850 7349 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 8584 7778 gene locus_tag LOCUS_04860 8584 7778 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence0046 6 1196 gene locus_tag LOCUS_04870 6 1196 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_04870 3004 1637 gene locus_tag LOCUS_04880 3004 1637 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462141.1 protein_id gnl|my_center|LOCUS_04880 5182 3089 gene locus_tag LOCUS_04890 5182 3089 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04890 7643 5538 gene locus_tag LOCUS_04900 gene fusA 7643 5538 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_04900 7929 8315 gene locus_tag LOCUS_04910 7929 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence0047 257 778 gene locus_tag LOCUS_04920 gene cobO 257 778 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972580.1 protein_id gnl|my_center|LOCUS_04920 1497 3725 gene locus_tag LOCUS_04930 1497 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3722 5305 gene locus_tag LOCUS_04940 3722 5305 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_04940 5302 6252 gene locus_tag LOCUS_04950 gene cbiB 5302 6252 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_04950 6413 7519 gene locus_tag LOCUS_04960 gene cobD 6413 7519 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_04960 7516 8433 gene locus_tag LOCUS_04970 7516 8433 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870248.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence0048 619 248 gene locus_tag LOCUS_04980 619 248 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935065.1 protein_id gnl|my_center|LOCUS_04980 794 657 gene locus_tag LOCUS_04990 794 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1477 791 gene locus_tag LOCUS_05000 gene ccsA 1477 791 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_05000 2365 1688 gene locus_tag LOCUS_05010 gene ccmB 2365 1688 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104640.1 protein_id gnl|my_center|LOCUS_05010 3092 2352 gene locus_tag LOCUS_05020 3092 2352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_05020 4260 3208 gene locus_tag LOCUS_05030 4260 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4731 4375 gene locus_tag LOCUS_05040 4731 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5373 4900 gene locus_tag LOCUS_05050 5373 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7495 5462 gene locus_tag LOCUS_05060 7495 5462 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_05060 8034 7621 gene locus_tag LOCUS_05070 8034 7621 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021980.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence0049 3326 2166 gene locus_tag LOCUS_05080 3326 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4188 3466 gene locus_tag LOCUS_05090 4188 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4498 4298 gene locus_tag LOCUS_05100 4498 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4657 5394 gene locus_tag LOCUS_05110 4657 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6563 5466 gene locus_tag LOCUS_05120 6563 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7644 6763 gene locus_tag LOCUS_05130 7644 6763 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 protein_id gnl|my_center|LOCUS_05130 <8476 7842 gene locus_tag LOCUS_05140 <8476 7842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000625424.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence0050 905 1054 gene locus_tag LOCUS_05150 905 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1235 1663 gene locus_tag LOCUS_05160 1235 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1731 2156 gene locus_tag LOCUS_05170 1731 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2634 2335 gene locus_tag LOCUS_05180 2634 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3452 2631 gene locus_tag LOCUS_05190 3452 2631 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110268.1 protein_id gnl|my_center|LOCUS_05190 5083 3503 gene locus_tag LOCUS_05200 5083 3503 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402863.1 protein_id gnl|my_center|LOCUS_05200 5234 5031 gene locus_tag LOCUS_05210 5234 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6988 5606 gene locus_tag LOCUS_05220 6988 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 <8342 7048 gene locus_tag LOCUS_05230 <8342 7048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922609.1:sulfatase-like hydrolase/transferase >Feature sequence0051 847 3549 gene locus_tag LOCUS_05240 847 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3738 3490 gene locus_tag LOCUS_05250 3738 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3664 4923 gene locus_tag LOCUS_05260 3664 4923 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948915.1 protein_id gnl|my_center|LOCUS_05260 4933 5238 gene locus_tag LOCUS_05270 4933 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5235 5642 gene locus_tag LOCUS_05280 5235 5642 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_05280 5682 6560 gene locus_tag LOCUS_05290 5682 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7554 6712 gene locus_tag LOCUS_05300 7554 6712 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence0052 313 53 gene locus_tag LOCUS_05310 313 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 412 1521 gene locus_tag LOCUS_05320 412 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1538 2539 gene locus_tag LOCUS_05330 1538 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2502 2813 gene locus_tag LOCUS_05340 2502 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2806 3531 gene locus_tag LOCUS_05350 2806 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3531 3779 gene locus_tag LOCUS_05360 3531 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4045 4410 gene locus_tag LOCUS_05370 4045 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4418 4603 gene locus_tag LOCUS_05380 4418 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4662 4862 gene locus_tag LOCUS_05390 4662 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4932 5453 gene locus_tag LOCUS_05400 4932 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5467 6318 gene locus_tag LOCUS_05410 5467 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6345 6953 gene locus_tag LOCUS_05420 6345 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6962 7765 gene locus_tag LOCUS_05430 6962 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence0053 358 1065 gene locus_tag LOCUS_05440 358 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1365 3455 gene locus_tag LOCUS_05450 1365 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3524 6661 gene locus_tag LOCUS_05460 3524 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7680 6910 gene locus_tag LOCUS_05470 7680 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence0054 936 229 gene locus_tag LOCUS_05480 936 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1346 1131 gene locus_tag LOCUS_05490 1346 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2339 1350 gene locus_tag LOCUS_05500 2339 1350 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_05500 3469 2336 gene locus_tag LOCUS_05510 3469 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4506 3490 gene locus_tag LOCUS_05520 4506 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05520 5137 4499 gene locus_tag LOCUS_05530 5137 4499 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267644.1 protein_id gnl|my_center|LOCUS_05530 5629 6312 gene locus_tag LOCUS_05540 gene phoU 5629 6312 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_05540 6305 7030 gene locus_tag LOCUS_05550 6305 7030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_05550 <8102 7144 gene locus_tag LOCUS_05560 <8102 7144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:SpoIIE family protein phosphatase >Feature sequence0055 1423 1112 gene locus_tag LOCUS_05570 1423 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2114 2887 gene locus_tag LOCUS_05580 2114 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2884 4305 gene locus_tag LOCUS_05590 2884 4305 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 protein_id gnl|my_center|LOCUS_05590 4548 5546 gene locus_tag LOCUS_05600 4548 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5733 5969 gene locus_tag LOCUS_05610 5733 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6302 7981 gene locus_tag LOCUS_05620 6302 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence0056 650 1141 gene locus_tag LOCUS_05630 650 1141 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_05630 2961 1312 gene locus_tag LOCUS_05640 2961 1312 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_05640 4140 3397 gene locus_tag LOCUS_05650 4140 3397 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_05650 4441 6540 gene locus_tag LOCUS_05660 4441 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6595 7629 gene locus_tag LOCUS_05670 6595 7629 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168520.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence0057 1217 2533 gene locus_tag LOCUS_05680 1217 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2852 3760 gene locus_tag LOCUS_05690 2852 3760 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840062.1 protein_id gnl|my_center|LOCUS_05690 4260 5369 gene locus_tag LOCUS_05700 4260 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 5417 5632 gene locus_tag LOCUS_05710 5417 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6514 5546 gene locus_tag LOCUS_05720 6514 5546 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_05720 6830 7753 gene locus_tag LOCUS_05730 6830 7753 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence0058 1251 3320 gene locus_tag LOCUS_05740 1251 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4695 3526 gene locus_tag LOCUS_05750 4695 3526 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_05750 5685 4837 gene locus_tag LOCUS_05760 gene rsmI 5685 4837 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_05760 6031 6849 gene locus_tag LOCUS_05770 6031 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7700 6912 gene locus_tag LOCUS_05780 7700 6912 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence0059 <1 1237 gene locus_tag LOCUS_05790 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257643.1:carbamoyl-phosphate synthase large subunit 1906 1670 gene locus_tag LOCUS_05800 1906 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2085 3917 gene locus_tag LOCUS_05810 gene msbA 2085 3917 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_05810 3921 4817 gene locus_tag LOCUS_05820 3921 4817 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_05820 4864 5487 gene locus_tag LOCUS_05830 gene gmk 4864 5487 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005016672.1 protein_id gnl|my_center|LOCUS_05830 5489 5722 gene locus_tag LOCUS_05840 5489 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5828 7033 gene locus_tag LOCUS_05850 gene coaBC 5828 7033 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_05850 7026 7802 gene locus_tag LOCUS_05860 7026 7802 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence0060 2898 2125 gene locus_tag LOCUS_05870 2898 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3464 2895 gene locus_tag LOCUS_05880 3464 2895 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 protein_id gnl|my_center|LOCUS_05880 3724 4602 gene locus_tag LOCUS_05890 3724 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6975 4699 gene locus_tag LOCUS_05900 gene selD 6975 4699 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891662.1 protein_id gnl|my_center|LOCUS_05900 7176 7385 gene locus_tag LOCUS_05910 7176 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7628 7996 gene locus_tag LOCUS_05920 7628 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence0061 703 149 gene locus_tag LOCUS_05930 703 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1356 913 gene locus_tag LOCUS_05940 1356 913 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392516.1 protein_id gnl|my_center|LOCUS_05940 1743 1504 gene locus_tag LOCUS_05950 1743 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2629 1967 gene locus_tag LOCUS_05960 2629 1967 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_05960 3029 2619 gene locus_tag LOCUS_05970 3029 2619 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_05970 4005 3238 gene locus_tag LOCUS_05980 4005 3238 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_05980 4937 4002 gene locus_tag LOCUS_05990 4937 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5967 5176 gene locus_tag LOCUS_06000 5967 5176 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_06000 6950 5964 gene locus_tag LOCUS_06010 gene trpS 6950 5964 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_06010 7281 7520 gene locus_tag LOCUS_06020 7281 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence0062 <1 1146 gene locus_tag LOCUS_06030 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000085739.1:ATP-binding protein 1715 3034 gene locus_tag LOCUS_06040 1715 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3357 3073 gene locus_tag LOCUS_06050 3357 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4226 3528 gene locus_tag LOCUS_06060 4226 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5062 4250 gene locus_tag LOCUS_06070 5062 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5021 5233 gene locus_tag LOCUS_06080 5021 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6094 6672 gene locus_tag LOCUS_06090 6094 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 <8010 6711 gene locus_tag LOCUS_06100 <8010 6711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479079.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence0063 227 1336 gene locus_tag LOCUS_06110 227 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1320 2825 gene locus_tag LOCUS_06120 1320 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3289 2897 gene locus_tag LOCUS_06130 3289 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4635 3286 gene locus_tag LOCUS_06140 4635 3286 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_06140 6102 4756 gene locus_tag LOCUS_06150 6102 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6631 6284 gene locus_tag LOCUS_06160 6631 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7830 6892 gene locus_tag LOCUS_06170 7830 6892 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_06170 7980 7846 gene locus_tag LOCUS_06180 7980 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0064 <1 825 gene locus_tag LOCUS_06190 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:efflux RND transporter periplasmic adaptor subunit 947 1666 gene locus_tag LOCUS_06200 947 1666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_06200 1667 2308 gene locus_tag LOCUS_06210 1667 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2911 2576 gene locus_tag LOCUS_06220 2911 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3982 3266 gene locus_tag LOCUS_06230 gene pyrF 3982 3266 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_06230 5168 4221 gene locus_tag LOCUS_06240 5168 4221 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_06240 5572 7869 gene locus_tag LOCUS_06250 5572 7869 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence0065 473 1216 gene locus_tag LOCUS_06260 473 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1315 3231 gene locus_tag LOCUS_06270 1315 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3653 5011 gene locus_tag LOCUS_06280 3653 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5089 6096 gene locus_tag LOCUS_06290 5089 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 <7918 6335 gene locus_tag LOCUS_06300 <7918 6335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence0066 1002 1463 gene locus_tag LOCUS_06310 1002 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2485 3429 gene locus_tag LOCUS_06320 2485 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3967 3806 gene locus_tag LOCUS_06330 3967 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4157 3981 gene locus_tag LOCUS_06340 4157 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6459 4264 gene locus_tag LOCUS_06350 6459 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7135 6449 gene locus_tag LOCUS_06360 7135 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7832 7197 gene locus_tag LOCUS_06370 7832 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence0067 1540 1274 gene locus_tag LOCUS_06380 1540 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1757 2761 gene locus_tag LOCUS_06390 1757 2761 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_06390 2982 5702 gene locus_tag LOCUS_06400 2982 5702 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_06400 5755 6723 gene locus_tag LOCUS_06410 gene corA 5755 6723 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_06410 6714 6920 gene locus_tag LOCUS_06420 6714 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 7434 7700 gene locus_tag LOCUS_06430 7434 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence0068 1710 1345 gene locus_tag LOCUS_06440 1710 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2537 2025 gene locus_tag LOCUS_06450 2537 2025 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_06450 2648 3547 gene locus_tag LOCUS_06460 2648 3547 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 protein_id gnl|my_center|LOCUS_06460 5534 4056 gene locus_tag LOCUS_06470 5534 4056 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_06470 <7822 5531 gene locus_tag LOCUS_06480 <7822 5531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein >Feature sequence0069 506 1615 gene locus_tag LOCUS_06490 506 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1823 2203 gene locus_tag LOCUS_06500 1823 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2610 3773 gene locus_tag LOCUS_06510 2610 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5671 4262 gene locus_tag LOCUS_06520 5671 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 7271 5868 gene locus_tag LOCUS_06530 7271 5868 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0070 752 2245 gene locus_tag LOCUS_06540 752 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2885 2811 gene locus_tag LOCUS_t00030 2885 2811 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3019 3969 gene locus_tag LOCUS_06550 3019 3969 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_06550 4011 5339 gene locus_tag LOCUS_06560 4011 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5423 7603 gene locus_tag LOCUS_06570 5423 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence0071 291 1523 gene locus_tag LOCUS_06580 291 1523 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06580 1526 2746 gene locus_tag LOCUS_06590 1526 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2739 5177 gene locus_tag LOCUS_06600 2739 5177 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence0072 4070 3159 gene locus_tag LOCUS_06610 4070 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4593 4396 gene locus_tag LOCUS_06620 4593 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5304 4723 gene locus_tag LOCUS_06630 5304 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5966 7678 gene locus_tag LOCUS_06640 5966 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0073 397 675 gene locus_tag LOCUS_06650 397 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 672 1160 gene locus_tag LOCUS_06660 672 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2100 1162 gene locus_tag LOCUS_06670 2100 1162 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_06670 2392 3966 gene locus_tag LOCUS_06680 2392 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4769 6145 gene locus_tag LOCUS_06690 4769 6145 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_06690 7020 6334 gene locus_tag LOCUS_06700 7020 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0074 <1 1461 gene locus_tag LOCUS_06710 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087474.1:cytochrome D1 domain-containing protein 1767 5099 gene locus_tag LOCUS_06720 1767 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5265 5891 gene locus_tag LOCUS_06730 5265 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5996 6472 gene locus_tag LOCUS_06740 gene fabZ 5996 6472 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_06740 6473 7249 gene locus_tag LOCUS_06750 gene lpxA 6473 7249 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence0075 287 964 gene locus_tag LOCUS_06760 287 964 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085032.1 protein_id gnl|my_center|LOCUS_06760 1019 2281 gene locus_tag LOCUS_06770 1019 2281 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_06770 2525 3883 gene locus_tag LOCUS_06780 2525 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5682 3955 gene locus_tag LOCUS_06790 gene aceB 5682 3955 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107325.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence0076 399 1463 gene locus_tag LOCUS_06800 399 1463 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_06800 1652 2077 gene locus_tag LOCUS_06810 1652 2077 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_06810 2064 2312 gene locus_tag LOCUS_06820 2064 2312 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 protein_id gnl|my_center|LOCUS_06820 3018 3194 gene locus_tag LOCUS_06830 3018 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3653 3324 gene locus_tag LOCUS_06840 3653 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4002 3658 gene locus_tag LOCUS_06850 4002 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4934 5254 gene locus_tag LOCUS_06860 4934 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5259 5948 gene locus_tag LOCUS_06870 5259 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6288 6842 gene locus_tag LOCUS_06880 6288 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 7585 6914 gene locus_tag LOCUS_06890 7585 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0077 3714 535 gene locus_tag LOCUS_06900 3714 535 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_06900 7459 3896 gene locus_tag LOCUS_06910 7459 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence0078 417 1598 gene locus_tag LOCUS_06920 gene lpxB 417 1598 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_06920 1537 1755 gene locus_tag LOCUS_06930 1537 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1796 3964 gene locus_tag LOCUS_06940 1796 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4971 7364 gene locus_tag LOCUS_06950 4971 7364 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0079 2021 1509 gene locus_tag LOCUS_06960 2021 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2252 2025 gene locus_tag LOCUS_06970 2252 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2493 2278 gene locus_tag LOCUS_06980 2493 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2613 2801 gene locus_tag LOCUS_06990 2613 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2827 2994 gene locus_tag LOCUS_07000 2827 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3099 4427 gene locus_tag LOCUS_07010 gene thrC 3099 4427 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_07010 4647 4880 gene locus_tag LOCUS_07020 gene rpsP 4647 4880 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_07020 4949 5179 gene locus_tag LOCUS_07030 4949 5179 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_07030 5187 5705 gene locus_tag LOCUS_07040 gene rimM 5187 5705 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_07040 5717 6496 gene locus_tag LOCUS_07050 gene trmD 5717 6496 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_07050 6534 6881 gene locus_tag LOCUS_07060 gene rplS 6534 6881 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence0080 <1 863 gene locus_tag LOCUS_07070 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228538.1:dihydroxy-acid dehydratase 1059 2633 gene locus_tag LOCUS_07080 1059 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2707 3741 gene locus_tag LOCUS_07090 2707 3741 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733054.1 protein_id gnl|my_center|LOCUS_07090 3987 4952 gene locus_tag LOCUS_07100 3987 4952 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_07100 5146 6243 gene locus_tag LOCUS_07110 5146 6243 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_07110 6265 7305 gene locus_tag LOCUS_07120 6265 7305 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931313.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0081 3744 142 gene locus_tag LOCUS_07130 3744 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4179 4628 gene locus_tag LOCUS_07140 gene tnpA 4179 4628 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence0082 238 1431 gene locus_tag LOCUS_07150 238 1431 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_07150 1709 3670 gene locus_tag LOCUS_07160 1709 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3891 4637 gene locus_tag LOCUS_07170 3891 4637 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_07170 5103 6935 gene locus_tag LOCUS_07180 5103 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence0083 <1 1683 gene locus_tag LOCUS_07190 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000868463.1:S9 family peptidase 1836 2333 gene locus_tag LOCUS_07200 1836 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3520 2447 gene locus_tag LOCUS_07210 3520 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7225 3950 gene locus_tag LOCUS_07220 7225 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence0084 234 1025 gene locus_tag LOCUS_07230 gene map 234 1025 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_07230 1046 2011 gene locus_tag LOCUS_07240 1046 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3052 2180 gene locus_tag LOCUS_07250 gene htpX 3052 2180 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_07250 3754 4767 gene locus_tag LOCUS_07260 3754 4767 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_07260 4964 6094 gene locus_tag LOCUS_07270 4964 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6158 6961 gene locus_tag LOCUS_07280 gene amrB 6158 6961 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942474.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence0085 2843 1509 gene locus_tag LOCUS_07290 2843 1509 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_07290 3781 3572 gene locus_tag LOCUS_07300 3781 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3785 4054 gene locus_tag LOCUS_07310 3785 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5624 4233 gene locus_tag LOCUS_07320 5624 4233 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_07320 6817 5669 gene locus_tag LOCUS_07330 gene gnfL 6817 5669 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence0086 455 138 gene locus_tag LOCUS_07340 455 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1652 654 gene locus_tag LOCUS_07350 1652 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2481 2323 gene locus_tag LOCUS_07360 2481 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2731 4536 gene locus_tag LOCUS_07370 2731 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4740 5222 gene locus_tag LOCUS_07380 4740 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5383 6951 gene locus_tag LOCUS_07390 5383 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0087 3152 4153 gene locus_tag LOCUS_07400 gene dusB 3152 4153 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_07400 4308 5483 gene locus_tag LOCUS_07410 4308 5483 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909458.1 protein_id gnl|my_center|LOCUS_07410 5525 6088 gene locus_tag LOCUS_07420 5525 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6410 6177 gene locus_tag LOCUS_07430 6410 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0088 <1 1482 gene locus_tag LOCUS_07440 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141306.1:1,4-alpha-glucan branching protein GlgB 1734 1979 gene locus_tag LOCUS_07450 1734 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1966 2301 gene locus_tag LOCUS_07460 1966 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2322 3920 gene locus_tag LOCUS_07470 2322 3920 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144137.1 protein_id gnl|my_center|LOCUS_07470 4066 3991 gene locus_tag LOCUS_t00040 4066 3991 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5256 4072 gene locus_tag LOCUS_07480 5256 4072 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_07480 5430 5257 gene locus_tag LOCUS_07490 5430 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5816 5649 gene locus_tag LOCUS_07500 5816 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7079 6351 gene locus_tag LOCUS_07510 7079 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence0089 865 320 gene locus_tag LOCUS_07520 865 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1520 4135 gene locus_tag LOCUS_07530 1520 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4467 4721 gene locus_tag LOCUS_07540 4467 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5804 6235 gene locus_tag LOCUS_07550 5804 6235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7027 6875 gene locus_tag LOCUS_07560 7027 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0090 534 785 gene locus_tag LOCUS_07570 534 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 782 1375 gene locus_tag LOCUS_07580 782 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1793 2035 gene locus_tag LOCUS_07590 1793 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2146 3687 gene locus_tag LOCUS_07600 2146 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120360.1 protein_id gnl|my_center|LOCUS_07600 4391 5902 gene locus_tag LOCUS_07610 4391 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6505 6417 gene locus_tag LOCUS_t00050 6505 6417 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0091 665 216 gene locus_tag LOCUS_07620 665 216 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_07620 1914 748 gene locus_tag LOCUS_07630 1914 748 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_07630 1950 3038 gene locus_tag LOCUS_07640 gene queA 1950 3038 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_07640 3066 3596 gene locus_tag LOCUS_07650 3066 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3771 6932 gene locus_tag LOCUS_07660 3771 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0092 1225 281 gene locus_tag LOCUS_07670 1225 281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_07670 2031 1222 gene locus_tag LOCUS_07680 2031 1222 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_07680 3188 2034 gene locus_tag LOCUS_07690 3188 2034 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_07690 4278 3283 gene locus_tag LOCUS_07700 4278 3283 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_07700 6437 4542 gene locus_tag LOCUS_07710 gene asnB 6437 4542 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence0093 1627 1256 gene locus_tag LOCUS_07720 1627 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4290 1783 gene locus_tag LOCUS_07730 4290 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4832 5512 gene locus_tag LOCUS_07740 4832 5512 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence0094 538 987 gene locus_tag LOCUS_07750 gene dtd 538 987 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_07750 1269 1063 gene locus_tag LOCUS_07760 1269 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2228 1464 gene locus_tag LOCUS_07770 2228 1464 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_07770 2404 2225 gene locus_tag LOCUS_07780 2404 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 2640 2425 gene locus_tag LOCUS_07790 2640 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07790 3682 2669 gene locus_tag LOCUS_07800 3682 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5210 3798 gene locus_tag LOCUS_07810 5210 3798 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259740.1 protein_id gnl|my_center|LOCUS_07810 6172 5207 gene locus_tag LOCUS_07820 6172 5207 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence0095 550 2046 gene locus_tag LOCUS_07830 550 2046 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143676.1 protein_id gnl|my_center|LOCUS_07830 2932 2033 gene locus_tag LOCUS_07840 2932 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3953 3060 gene locus_tag LOCUS_07850 3953 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4331 4020 gene locus_tag LOCUS_07860 4331 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5270 4500 gene locus_tag LOCUS_07870 5270 4500 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880556.1 protein_id gnl|my_center|LOCUS_07870 5665 5276 gene locus_tag LOCUS_07880 5665 5276 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_07880 6779 5679 gene locus_tag LOCUS_07890 gene dnaJ 6779 5679 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_07890 7178 6915 gene locus_tag LOCUS_07900 7178 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence0096 3302 288 gene locus_tag LOCUS_07910 3302 288 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_07910 4026 4976 gene locus_tag LOCUS_07920 4026 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5516 6079 gene locus_tag LOCUS_07930 5516 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0097 3 137 gene locus_tag LOCUS_07940 3 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1817 324 gene locus_tag LOCUS_07950 1817 324 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_07950 3514 1964 gene locus_tag LOCUS_07960 gene amt 3514 1964 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_07960 4012 3674 gene locus_tag LOCUS_07970 4012 3674 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_07970 6763 4211 gene locus_tag LOCUS_07980 gene glnD 6763 4211 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0098 557 1147 gene locus_tag LOCUS_07990 557 1147 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_07990 1246 3123 gene locus_tag LOCUS_08000 1246 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3417 4760 gene locus_tag LOCUS_08010 3417 4760 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_08010 4760 5383 gene locus_tag LOCUS_08020 gene pgsA 4760 5383 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_08020 5367 5933 gene locus_tag LOCUS_08030 gene amrA 5367 5933 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_08030 <7123 6021 gene locus_tag LOCUS_08040 <7123 6021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208133.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence0099 333 836 gene locus_tag LOCUS_08050 333 836 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_08050 1823 942 gene locus_tag LOCUS_08060 1823 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2567 1989 gene locus_tag LOCUS_08070 2567 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3772 2897 gene locus_tag LOCUS_08080 gene prmA 3772 2897 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_08080 4875 3769 gene locus_tag LOCUS_08090 gene dnaJ 4875 3769 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_08090 6792 4897 gene locus_tag LOCUS_08100 gene dnaK 6792 4897 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence0100 968 561 gene locus_tag LOCUS_08110 968 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3191 1311 gene locus_tag LOCUS_08120 3191 1311 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_08120 3700 3341 gene locus_tag LOCUS_08130 3700 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4016 3789 gene locus_tag LOCUS_08140 4016 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4375 4557 gene locus_tag LOCUS_08150 4375 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4956 4666 gene locus_tag LOCUS_08160 4956 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6891 5305 gene locus_tag LOCUS_08170 6891 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence0101 1521 58 gene locus_tag LOCUS_08180 1521 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_08180 1790 1527 gene locus_tag LOCUS_08190 1790 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1783 2178 gene locus_tag LOCUS_08200 1783 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265600.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 2186 2512 gene locus_tag LOCUS_08210 2186 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2949 2632 gene locus_tag LOCUS_08220 2949 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3117 4481 gene locus_tag LOCUS_08230 3117 4481 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_08230 4613 5500 gene locus_tag LOCUS_08240 4613 5500 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_08240 5812 6861 gene locus_tag LOCUS_08250 5812 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence0102 146 1153 gene locus_tag LOCUS_08260 146 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1254 1087 gene locus_tag LOCUS_08270 1254 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1303 2541 gene locus_tag LOCUS_08280 1303 2541 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_08280 2658 3257 gene locus_tag LOCUS_08290 gene plsY 2658 3257 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_08290 3254 4252 gene locus_tag LOCUS_08300 3254 4252 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_08300 4423 5298 gene locus_tag LOCUS_08310 4423 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5291 5974 gene locus_tag LOCUS_08320 5291 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6502 6056 gene locus_tag LOCUS_08330 6502 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 <7056 6502 gene locus_tag LOCUS_08340 <7056 6502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259304.1:xanthine dehydrogenase family protein subunit M >Feature sequence0103 <1 1209 gene locus_tag LOCUS_08350 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein 1408 2412 gene locus_tag LOCUS_08360 1408 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2553 3380 gene locus_tag LOCUS_08370 2553 3380 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_08370 3388 4707 gene locus_tag LOCUS_08380 3388 4707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_08380 5059 5904 gene locus_tag LOCUS_08390 5059 5904 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392083.1 protein_id gnl|my_center|LOCUS_08390 6084 7052 gene locus_tag LOCUS_08400 6084 7052 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819165.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0104 917 1495 gene locus_tag LOCUS_08410 gene dps 917 1495 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_08410 1557 1745 gene locus_tag LOCUS_08420 1557 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1771 1974 gene locus_tag LOCUS_08430 1771 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1998 2357 gene locus_tag LOCUS_08440 1998 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2913 2536 gene locus_tag LOCUS_08450 2913 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3666 2962 gene locus_tag LOCUS_08460 3666 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5294 3888 gene locus_tag LOCUS_08470 5294 3888 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_08470 6257 5334 gene locus_tag LOCUS_08480 6257 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 6513 6352 gene locus_tag LOCUS_08490 6513 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence0105 2311 224 gene locus_tag LOCUS_08500 2311 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2362 2583 gene locus_tag LOCUS_08510 2362 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3260 3448 gene locus_tag LOCUS_08520 3260 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4048 3617 gene locus_tag LOCUS_08530 4048 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4269 4069 gene locus_tag LOCUS_08540 4269 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4601 5542 gene locus_tag LOCUS_08550 4601 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6422 5766 gene locus_tag LOCUS_08560 6422 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0106 503 105 gene locus_tag LOCUS_08570 503 105 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_08570 733 500 gene locus_tag LOCUS_08580 733 500 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943111.1 protein_id gnl|my_center|LOCUS_08580 3891 1438 gene locus_tag LOCUS_08590 3891 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4430 4993 gene locus_tag LOCUS_08600 4430 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6478 5471 gene locus_tag LOCUS_08610 6478 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0107 3572 87 gene locus_tag LOCUS_08620 3572 87 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388876.1 protein_id gnl|my_center|LOCUS_08620 5728 3887 gene locus_tag LOCUS_08630 5728 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence0108 27 638 gene locus_tag LOCUS_08640 27 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 796 1986 gene locus_tag LOCUS_08650 gene bioF 796 1986 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_08650 2341 2114 gene locus_tag LOCUS_08660 2341 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2597 3331 gene locus_tag LOCUS_08670 gene bioD 2597 3331 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_08670 4534 3386 gene locus_tag LOCUS_08680 4534 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 <6943 4963 gene locus_tag LOCUS_08690 <6943 4963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942466.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence0109 1936 650 gene locus_tag LOCUS_08700 1936 650 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275477.1 protein_id gnl|my_center|LOCUS_08700 2289 2957 gene locus_tag LOCUS_08710 2289 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3124 3582 gene locus_tag LOCUS_08720 3124 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3909 3640 gene locus_tag LOCUS_08730 3909 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4402 3986 gene locus_tag LOCUS_08740 4402 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4852 4577 gene locus_tag LOCUS_08750 4852 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5174 4995 gene locus_tag LOCUS_08760 5174 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5626 5186 gene locus_tag LOCUS_08770 5626 5186 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_08770 6480 6139 gene locus_tag LOCUS_08780 6480 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 6859 6374 gene locus_tag LOCUS_08790 6859 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 >Feature sequence0110 4046 2685 gene locus_tag LOCUS_08800 4046 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4944 5522 gene locus_tag LOCUS_08810 4944 5522 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence0111 1025 201 gene locus_tag LOCUS_08820 1025 201 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 protein_id gnl|my_center|LOCUS_08820 1366 1022 gene locus_tag LOCUS_08830 1366 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2144 1455 gene locus_tag LOCUS_08840 2144 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2812 3495 gene locus_tag LOCUS_08850 2812 3495 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973901.1 protein_id gnl|my_center|LOCUS_08850 6421 3923 gene locus_tag LOCUS_08860 6421 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0112 <1 1164 gene locus_tag LOCUS_08870 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948144.1:sodium:solute symporter family protein 1323 1931 gene locus_tag LOCUS_08880 1323 1931 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_08880 1945 3708 gene locus_tag LOCUS_08890 1945 3708 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_08890 4002 4922 gene locus_tag LOCUS_08900 4002 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5177 4830 gene locus_tag LOCUS_08910 5177 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5346 6410 gene locus_tag LOCUS_08920 5346 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence0113 1374 808 gene locus_tag LOCUS_08930 1374 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2557 1367 gene locus_tag LOCUS_08940 2557 1367 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_08940 4464 2875 gene locus_tag LOCUS_08950 4464 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5615 4482 gene locus_tag LOCUS_08960 5615 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6409 5723 gene locus_tag LOCUS_08970 6409 5723 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0114 601 239 gene locus_tag LOCUS_08980 601 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 831 598 gene locus_tag LOCUS_08990 831 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1756 1920 gene locus_tag LOCUS_09000 1756 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3261 1924 gene locus_tag LOCUS_09010 3261 1924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_09010 3649 6042 gene locus_tag LOCUS_09020 3649 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_09020 6230 6736 gene locus_tag LOCUS_09030 6230 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence0115 4501 1505 gene locus_tag LOCUS_09040 4501 1505 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039201.1 protein_id gnl|my_center|LOCUS_09040 5265 6683 gene locus_tag LOCUS_09050 gene glnA 5265 6683 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence0116 201 884 gene locus_tag LOCUS_09060 201 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 890 2536 gene locus_tag LOCUS_09070 890 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2511 3614 gene locus_tag LOCUS_09080 2511 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3929 5476 gene locus_tag LOCUS_09090 gene argH 3929 5476 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257217.1 protein_id gnl|my_center|LOCUS_09090 5493 6575 gene locus_tag LOCUS_09100 5493 6575 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218916593.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0117 324 716 gene locus_tag LOCUS_09110 324 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 897 2594 gene locus_tag LOCUS_09120 gene yidC 897 2594 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_09120 2619 3053 gene locus_tag LOCUS_09130 2619 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3055 4419 gene locus_tag LOCUS_09140 gene mnmE 3055 4419 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_09140 4441 6294 gene locus_tag LOCUS_09150 gene mnmG 4441 6294 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0118 2689 773 gene locus_tag LOCUS_09160 2689 773 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_09160 3750 2824 gene locus_tag LOCUS_09170 3750 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4099 4830 gene locus_tag LOCUS_09180 4099 4830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 protein_id gnl|my_center|LOCUS_09180 <6756 5367 gene locus_tag LOCUS_09190 <6756 5367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529751.1:penicillin acylase family protein >Feature sequence0119 8 433 gene locus_tag LOCUS_09200 8 433 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_09200 663 1151 gene locus_tag LOCUS_09210 663 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1264 1449 gene locus_tag LOCUS_09220 1264 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1454 2398 gene locus_tag LOCUS_09230 1454 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3067 3375 gene locus_tag LOCUS_09240 3067 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3402 4841 gene locus_tag LOCUS_09250 3402 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5217 5011 gene locus_tag LOCUS_09260 5217 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5402 6451 gene locus_tag LOCUS_09270 5402 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence0120 329 1813 gene locus_tag LOCUS_09280 329 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3731 1740 gene locus_tag LOCUS_09290 3731 1740 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_09290 4165 5703 gene locus_tag LOCUS_09300 gene zwf 4165 5703 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_09300 5672 6448 gene locus_tag LOCUS_09310 gene pgl 5672 6448 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence0121 257 1174 gene locus_tag LOCUS_09320 257 1174 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387968.1 protein_id gnl|my_center|LOCUS_09320 1430 2773 gene locus_tag LOCUS_09330 1430 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3350 4522 gene locus_tag LOCUS_09340 3350 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0122 1125 529 gene locus_tag LOCUS_09350 1125 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1517 1140 gene locus_tag LOCUS_09360 1517 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1933 1529 gene locus_tag LOCUS_09370 1933 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2455 1943 gene locus_tag LOCUS_09380 2455 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3563 2676 gene locus_tag LOCUS_09390 3563 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3894 3652 gene locus_tag LOCUS_09400 3894 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4484 3912 gene locus_tag LOCUS_09410 4484 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6058 4481 gene locus_tag LOCUS_09420 6058 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0123 349 1362 gene locus_tag LOCUS_09430 349 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1542 1258 gene locus_tag LOCUS_09440 1542 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4873 1664 gene locus_tag LOCUS_09450 4873 1664 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_09450 <6667 5576 gene locus_tag LOCUS_09460 <6667 5576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484168.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0124 48 1466 gene locus_tag LOCUS_09470 48 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1756 3963 gene locus_tag LOCUS_09480 1756 3963 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_09480 4104 5270 gene locus_tag LOCUS_09490 4104 5270 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence0125 3087 694 gene locus_tag LOCUS_09500 gene lon 3087 694 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_09500 3551 3102 gene locus_tag LOCUS_09510 3551 3102 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_09510 4045 3590 gene locus_tag LOCUS_09520 gene nrdR 4045 3590 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_09520 4491 5090 gene locus_tag LOCUS_09530 4491 5090 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_09530 5214 5906 gene locus_tag LOCUS_09540 5214 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 6202 6528 gene locus_tag LOCUS_09550 6202 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence0126 1958 690 gene locus_tag LOCUS_09560 1958 690 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_09560 3448 1955 gene locus_tag LOCUS_09570 3448 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5530 3770 gene locus_tag LOCUS_09580 5530 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6192 5563 gene locus_tag LOCUS_09590 6192 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence0127 1042 788 gene locus_tag LOCUS_09600 1042 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1010 2173 gene locus_tag LOCUS_09610 1010 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2773 2375 gene locus_tag LOCUS_09620 2773 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3395 2919 gene locus_tag LOCUS_09630 3395 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3384 3605 gene locus_tag LOCUS_09640 3384 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4470 3760 gene locus_tag LOCUS_09650 gene ubiE 4470 3760 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_09650 5551 4457 gene locus_tag LOCUS_09660 gene aroB 5551 4457 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence0128 2208 916 gene locus_tag LOCUS_09670 2208 916 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_09670 3503 2205 gene locus_tag LOCUS_09680 3503 2205 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_09680 5004 3742 gene locus_tag LOCUS_09690 5004 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6332 5001 gene locus_tag LOCUS_09700 6332 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence0129 346 741 gene locus_tag LOCUS_09710 346 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 3945 961 gene locus_tag LOCUS_09720 3945 961 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_09720 5384 4830 gene locus_tag LOCUS_09730 5384 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 <6541 5645 gene locus_tag LOCUS_09740 <6541 5645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266726.1:glycosyltransferase family 1 protein >Feature sequence0130 <1 539 gene locus_tag LOCUS_09750 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288805.1:ParA family protein 527 838 gene locus_tag LOCUS_09760 527 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 973 1066 gene locus_tag LOCUS_t00060 973 1066 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1200 1394 gene locus_tag LOCUS_09770 1200 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1427 1642 gene locus_tag LOCUS_09780 1427 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1667 2146 gene locus_tag LOCUS_09790 1667 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2210 2410 gene locus_tag LOCUS_09800 2210 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2637 2470 gene locus_tag LOCUS_09810 2637 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2837 3121 gene locus_tag LOCUS_09820 2837 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3885 3208 gene locus_tag LOCUS_09830 3885 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3847 4104 gene locus_tag LOCUS_09840 3847 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4257 4538 gene locus_tag LOCUS_09850 4257 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4535 4822 gene locus_tag LOCUS_09860 4535 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5183 4782 gene locus_tag LOCUS_09870 5183 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 5784 5302 gene locus_tag LOCUS_09880 5784 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6164 6319 gene locus_tag LOCUS_09890 6164 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence0131 154 732 gene locus_tag LOCUS_09900 154 732 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_09900 3472 1097 gene locus_tag LOCUS_09910 3472 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5293 3854 gene locus_tag LOCUS_09920 5293 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 <6523 5542 gene locus_tag LOCUS_09930 <6523 5542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein >Feature sequence0132 604 86 gene locus_tag LOCUS_09940 604 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1062 622 gene locus_tag LOCUS_09950 1062 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1843 1055 gene locus_tag LOCUS_09960 1843 1055 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_09960 2071 1862 gene locus_tag LOCUS_09970 2071 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3021 2188 gene locus_tag LOCUS_09980 3021 2188 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_09980 3769 3014 gene locus_tag LOCUS_09990 3769 3014 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462327.1 protein_id gnl|my_center|LOCUS_09990 4354 3869 gene locus_tag LOCUS_10000 4354 3869 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_10000 4805 6379 gene locus_tag LOCUS_10010 4805 6379 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169153932.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence0133 1727 1203 gene locus_tag LOCUS_10020 1727 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2341 1727 gene locus_tag LOCUS_10030 2341 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3202 2615 gene locus_tag LOCUS_10040 gene rpoE 3202 2615 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_10040 4574 3324 gene locus_tag LOCUS_10050 4574 3324 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_10050 5516 6133 gene locus_tag LOCUS_10060 5516 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence0134 1631 1389 gene locus_tag LOCUS_10070 1631 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2509 1628 gene locus_tag LOCUS_10080 2509 1628 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893532.1 protein_id gnl|my_center|LOCUS_10080 3363 2497 gene locus_tag LOCUS_10090 3363 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4103 3360 gene locus_tag LOCUS_10100 4103 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4256 5749 gene locus_tag LOCUS_10110 4256 5749 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence0135 387 932 gene locus_tag LOCUS_10120 387 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 942 1106 gene locus_tag LOCUS_10130 942 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1911 1168 gene locus_tag LOCUS_10140 1911 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3210 3629 gene locus_tag LOCUS_10150 3210 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4366 3860 gene locus_tag LOCUS_10160 4366 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4713 4516 gene locus_tag LOCUS_10170 4713 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6233 6027 gene locus_tag LOCUS_10180 6233 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence0136 687 1238 gene locus_tag LOCUS_10190 687 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1262 5038 gene locus_tag LOCUS_10200 1262 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 6060 5254 gene locus_tag LOCUS_10210 6060 5254 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence0137 2010 244 gene locus_tag LOCUS_10220 gene araD 2010 244 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037429073.1 protein_id gnl|my_center|LOCUS_10220 2521 3810 gene locus_tag LOCUS_10230 2521 3810 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_10230 4095 3907 gene locus_tag LOCUS_10240 4095 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4043 5137 gene locus_tag LOCUS_10250 4043 5137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_10250 5829 5158 gene locus_tag LOCUS_10260 5829 5158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_10260 5954 6163 gene locus_tag LOCUS_10270 5954 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0138 350 916 gene locus_tag LOCUS_10280 350 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10280 892 2103 gene locus_tag LOCUS_10290 892 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 2057 2266 gene locus_tag LOCUS_10300 2057 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2995 5343 gene locus_tag LOCUS_10310 2995 5343 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence0139 916 1767 gene locus_tag LOCUS_10320 916 1767 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_10320 2153 3715 gene locus_tag LOCUS_10330 2153 3715 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_10330 4818 3955 gene locus_tag LOCUS_10340 4818 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 5129 4818 gene locus_tag LOCUS_10350 5129 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <6380 5235 gene locus_tag LOCUS_10360 <6380 5235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933494.1:citrate synthase >Feature sequence0140 445 726 gene locus_tag LOCUS_10370 445 726 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_10370 984 1997 gene locus_tag LOCUS_10380 984 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1990 2934 gene locus_tag LOCUS_10390 1990 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2962 4251 gene locus_tag LOCUS_10400 2962 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6024 4444 gene locus_tag LOCUS_10410 6024 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0141 302 850 gene locus_tag LOCUS_10420 302 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1007 2431 gene locus_tag LOCUS_10430 gene bioA 1007 2431 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_10430 3332 2475 gene locus_tag LOCUS_10440 3332 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4750 3785 gene locus_tag LOCUS_10450 4750 3785 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_10450 5980 4901 gene locus_tag LOCUS_10460 5980 4901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence0142 1015 404 gene locus_tag LOCUS_10470 1015 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2107 1412 gene locus_tag LOCUS_10480 2107 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2471 2133 gene locus_tag LOCUS_10490 2471 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2703 2545 gene locus_tag LOCUS_10500 2703 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3896 3462 gene locus_tag LOCUS_10510 3896 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4377 3898 gene locus_tag LOCUS_10520 4377 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4677 4390 gene locus_tag LOCUS_10530 4677 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4972 4658 gene locus_tag LOCUS_10540 4972 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6183 5293 gene locus_tag LOCUS_10550 gene mutM 6183 5293 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence0143 486 737 gene locus_tag LOCUS_10560 486 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 739 1374 gene locus_tag LOCUS_10570 gene thiE 739 1374 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_10570 3112 1781 gene locus_tag LOCUS_10580 3112 1781 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_10580 3458 4741 gene locus_tag LOCUS_10590 gene eno 3458 4741 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_10590 5133 6161 gene locus_tag LOCUS_10600 5133 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0144 1770 808 gene locus_tag LOCUS_10610 1770 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3176 1791 gene locus_tag LOCUS_10620 3176 1791 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813514.1 protein_id gnl|my_center|LOCUS_10620 4911 3313 gene locus_tag LOCUS_10630 4911 3313 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966914.1 protein_id gnl|my_center|LOCUS_10630 <6331 5463 gene locus_tag LOCUS_10640 <6331 5463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994211.1:MFS transporter >Feature sequence0145 1272 157 gene locus_tag LOCUS_10650 gene cax 1272 157 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_10650 1813 2736 gene locus_tag LOCUS_10660 1813 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3275 2934 gene locus_tag LOCUS_10670 3275 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3745 4923 gene locus_tag LOCUS_10680 3745 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5974 5003 gene locus_tag LOCUS_10690 gene bioB 5974 5003 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_10690 6078 6003 gene locus_tag LOCUS_t00070 6078 6003 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0146 <1 522 gene locus_tag LOCUS_10700 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940706.1:protein TolQ 522 944 gene locus_tag LOCUS_10710 gene tolR 522 944 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_10710 1543 1370 gene locus_tag LOCUS_10720 1543 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3542 1896 gene locus_tag LOCUS_10730 3542 1896 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_10730 4318 3539 gene locus_tag LOCUS_10740 4318 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5099 4554 gene locus_tag LOCUS_10750 5099 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6117 5074 gene locus_tag LOCUS_10760 6117 5074 CDS product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0147 1546 4077 gene locus_tag LOCUS_10770 1546 4077 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_10770 4194 4436 gene locus_tag LOCUS_10780 4194 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4433 4675 gene locus_tag LOCUS_10790 4433 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4745 6196 gene locus_tag LOCUS_10800 4745 6196 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0148 1768 236 gene locus_tag LOCUS_10810 1768 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3157 2174 gene locus_tag LOCUS_10820 3157 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3282 3599 gene locus_tag LOCUS_10830 3282 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0149 132 902 gene locus_tag LOCUS_10840 132 902 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_10840 1139 1432 gene locus_tag LOCUS_10850 1139 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1401 1766 gene locus_tag LOCUS_10860 1401 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1807 5022 gene locus_tag LOCUS_10870 1807 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0150 191 694 gene locus_tag LOCUS_10880 191 694 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_10880 813 3104 gene locus_tag LOCUS_10890 813 3104 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391988.1 protein_id gnl|my_center|LOCUS_10890 3297 3983 gene locus_tag LOCUS_10900 3297 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4136 5458 gene locus_tag LOCUS_10910 gene nrfD 4136 5458 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_10910 5607 6113 gene locus_tag LOCUS_10920 5607 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0151 1437 910 gene locus_tag LOCUS_10930 gene tpx 1437 910 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941020.1 protein_id gnl|my_center|LOCUS_10930 1769 1539 gene locus_tag LOCUS_10940 1769 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2029 1766 gene locus_tag LOCUS_10950 2029 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4061 2106 gene locus_tag LOCUS_10960 gene acs 4061 2106 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_10960 4763 4212 gene locus_tag LOCUS_10970 4763 4212 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_10970 6178 4865 gene locus_tag LOCUS_10980 gene xylA 6178 4865 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence0152 1941 817 gene locus_tag LOCUS_10990 1941 817 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_10990 4175 1938 gene locus_tag LOCUS_11000 4175 1938 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0153 226 801 gene locus_tag LOCUS_11010 226 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 798 1592 gene locus_tag LOCUS_11020 798 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1856 2209 gene locus_tag LOCUS_11030 1856 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2259 4157 gene locus_tag LOCUS_11040 2259 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4299 5483 gene locus_tag LOCUS_11050 4299 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 6092 5499 gene locus_tag LOCUS_11060 6092 5499 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence0154 <1 1908 gene locus_tag LOCUS_11070 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase 2046 2378 gene locus_tag LOCUS_11080 2046 2378 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218119.1 protein_id gnl|my_center|LOCUS_11080 2544 2951 gene locus_tag LOCUS_11090 2544 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3194 3688 gene locus_tag LOCUS_11100 3194 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3678 5384 gene locus_tag LOCUS_11110 3678 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 <6243 5501 gene locus_tag LOCUS_11120 <6243 5501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785475.1:MFS transporter >Feature sequence0155 593 2461 gene locus_tag LOCUS_11130 593 2461 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_11130 2475 2759 gene locus_tag LOCUS_11140 2475 2759 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_11140 2740 3045 gene locus_tag LOCUS_11150 2740 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3051 4421 gene locus_tag LOCUS_11160 3051 4421 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_11160 4723 5622 gene locus_tag LOCUS_11170 gene yghX 4723 5622 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0156 2156 1050 gene locus_tag LOCUS_11180 2156 1050 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_11180 4243 2165 gene locus_tag LOCUS_11190 4243 2165 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_11190 5828 4620 gene locus_tag LOCUS_11200 5828 4620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_11200 6047 5829 gene locus_tag LOCUS_11210 6047 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence0157 1502 1326 gene locus_tag LOCUS_11220 1502 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1783 2625 gene locus_tag LOCUS_11230 1783 2625 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389972.1 protein_id gnl|my_center|LOCUS_11230 2713 4548 gene locus_tag LOCUS_11240 2713 4548 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530026.1 protein_id gnl|my_center|LOCUS_11240 4943 4629 gene locus_tag LOCUS_11250 4943 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence0158 4507 3167 gene locus_tag LOCUS_11260 4507 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence0159 1795 311 gene locus_tag LOCUS_11270 1795 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2619 4844 gene locus_tag LOCUS_11280 2619 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5221 5979 gene locus_tag LOCUS_11290 5221 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence0160 1087 188 gene locus_tag LOCUS_11300 1087 188 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 protein_id gnl|my_center|LOCUS_11300 1367 2281 gene locus_tag LOCUS_11310 1367 2281 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726730.1 protein_id gnl|my_center|LOCUS_11310 2695 3663 gene locus_tag LOCUS_11320 2695 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3593 5968 gene locus_tag LOCUS_11330 3593 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence0161 582 190 gene locus_tag LOCUS_11340 582 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3171 760 gene locus_tag LOCUS_11350 3171 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3430 3768 gene locus_tag LOCUS_11360 3430 3768 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_11360 3777 4691 gene locus_tag LOCUS_11370 3777 4691 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921577.1 protein_id gnl|my_center|LOCUS_11370 5568 5990 gene locus_tag LOCUS_11380 5568 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence0162 479 291 gene locus_tag LOCUS_11390 479 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2326 986 gene locus_tag LOCUS_11400 2326 986 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_11400 5807 2469 gene locus_tag LOCUS_11410 5807 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence0163 202 693 gene locus_tag LOCUS_11420 202 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 669 917 gene locus_tag LOCUS_11430 669 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1266 3716 gene locus_tag LOCUS_11440 gene nasD 1266 3716 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_11440 3870 4217 gene locus_tag LOCUS_11450 3870 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4534 4932 gene locus_tag LOCUS_11460 4534 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5650 5186 gene locus_tag LOCUS_11470 5650 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5862 6092 gene locus_tag LOCUS_11480 5862 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence0164 149 613 gene locus_tag LOCUS_11490 149 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 890 1540 gene locus_tag LOCUS_11500 890 1540 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_11500 1537 4554 gene locus_tag LOCUS_11510 1537 4554 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence0165 2507 1320 gene locus_tag LOCUS_11520 2507 1320 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_11520 4066 3008 gene locus_tag LOCUS_11530 4066 3008 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122861.1 protein_id gnl|my_center|LOCUS_11530 4460 4642 gene locus_tag LOCUS_11540 4460 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 6046 4730 gene locus_tag LOCUS_11550 6046 4730 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764140.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0166 1551 559 gene locus_tag LOCUS_11560 1551 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2749 3072 gene locus_tag LOCUS_11570 2749 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3074 3619 gene locus_tag LOCUS_11580 3074 3619 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082901.1 protein_id gnl|my_center|LOCUS_11580 3760 4401 gene locus_tag LOCUS_11590 3760 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4683 4850 gene locus_tag LOCUS_11600 4683 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4847 5050 gene locus_tag LOCUS_11610 4847 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5105 5629 gene locus_tag LOCUS_11620 5105 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064477.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence0167 1 1269 gene locus_tag LOCUS_11630 gene gatB 1 1269 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_11630 1280 1555 gene locus_tag LOCUS_11640 1280 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1748 2836 gene locus_tag LOCUS_11650 gene gcvT 1748 2836 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126000.1 protein_id gnl|my_center|LOCUS_11650 2889 3305 gene locus_tag LOCUS_11660 2889 3305 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_11660 3342 4643 gene locus_tag LOCUS_11670 3342 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5757 4837 gene locus_tag LOCUS_11680 5757 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence0168 1545 520 gene locus_tag LOCUS_11690 1545 520 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814616.1 protein_id gnl|my_center|LOCUS_11690 3234 2044 gene locus_tag LOCUS_11700 3234 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3823 4029 gene locus_tag LOCUS_11710 3823 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4219 4833 gene locus_tag LOCUS_11720 4219 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5915 4998 gene locus_tag LOCUS_11730 5915 4998 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275323.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0169 2612 1425 gene locus_tag LOCUS_11740 2612 1425 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085739.1 protein_id gnl|my_center|LOCUS_11740 5167 2615 gene locus_tag LOCUS_11750 5167 2615 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195918.1 protein_id gnl|my_center|LOCUS_11750 5489 5803 gene locus_tag LOCUS_11760 5489 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0170 739 89 gene locus_tag LOCUS_11770 739 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2200 980 gene locus_tag LOCUS_11780 2200 980 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_11780 3402 2197 gene locus_tag LOCUS_11790 3402 2197 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218312883.1 protein_id gnl|my_center|LOCUS_11790 5345 3399 gene locus_tag LOCUS_11800 gene asnB 5345 3399 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0171 <1 1278 gene locus_tag LOCUS_11810 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640527.1:pitrilysin family protein 1666 2226 gene locus_tag LOCUS_11820 1666 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2378 3016 gene locus_tag LOCUS_11830 2378 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3147 4046 gene locus_tag LOCUS_11840 3147 4046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325399.1 protein_id gnl|my_center|LOCUS_11840 <6017 4230 gene locus_tag LOCUS_11850 <6017 4230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225895010.1:PAS domain-containing sensor histidine kinase >Feature sequence0172 493 2823 gene locus_tag LOCUS_11860 493 2823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_11860 2946 3518 gene locus_tag LOCUS_11870 2946 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3663 4895 gene locus_tag LOCUS_11880 3663 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence0173 <1 2932 gene locus_tag LOCUS_11890 <1 2932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813379.1:HEAT repeat domain-containing protein 3093 3332 gene locus_tag LOCUS_11900 3093 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3314 3514 gene locus_tag LOCUS_11910 3314 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3739 3431 gene locus_tag LOCUS_11920 3739 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4990 4772 gene locus_tag LOCUS_11930 4990 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence0174 462 1619 gene locus_tag LOCUS_11940 462 1619 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_11940 1908 3128 gene locus_tag LOCUS_11950 1908 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3802 3455 gene locus_tag LOCUS_11960 3802 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4774 3953 gene locus_tag LOCUS_11970 4774 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4974 5570 gene locus_tag LOCUS_11980 4974 5570 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0175 1786 554 gene locus_tag LOCUS_11990 1786 554 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_11990 2047 3630 gene locus_tag LOCUS_12000 2047 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence0176 462 139 gene locus_tag LOCUS_12010 462 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1557 631 gene locus_tag LOCUS_12020 1557 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2133 2744 gene locus_tag LOCUS_12030 2133 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2741 3961 gene locus_tag LOCUS_12040 2741 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4095 4673 gene locus_tag LOCUS_12050 4095 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4676 5638 gene locus_tag LOCUS_12060 4676 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5620 5895 gene locus_tag LOCUS_12070 5620 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence0177 1345 326 gene locus_tag LOCUS_12080 1345 326 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 protein_id gnl|my_center|LOCUS_12080 1855 2088 gene locus_tag LOCUS_12090 1855 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2386 4212 gene locus_tag LOCUS_12100 2386 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615361.1 protein_id gnl|my_center|LOCUS_12100 4303 4779 gene locus_tag LOCUS_12110 gene bcp 4303 4779 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_12110 4867 5454 gene locus_tag LOCUS_12120 4867 5454 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210965.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0178 180 1058 gene locus_tag LOCUS_12130 180 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1076 1939 gene locus_tag LOCUS_12140 gene metF 1076 1939 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_12140 2074 4602 gene locus_tag LOCUS_12150 2074 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0179 1625 240 gene locus_tag LOCUS_12160 1625 240 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_12160 2153 1665 gene locus_tag LOCUS_12170 2153 1665 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_12170 2287 2550 gene locus_tag LOCUS_12180 2287 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2534 2968 gene locus_tag LOCUS_12190 2534 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3363 3082 gene locus_tag LOCUS_12200 3363 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3443 4654 gene locus_tag LOCUS_12210 3443 4654 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_12210 4812 5189 gene locus_tag LOCUS_12220 4812 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 5281 5084 gene locus_tag LOCUS_12230 5281 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5956 5675 gene locus_tag LOCUS_12240 5956 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0180 <1 584 gene locus_tag LOCUS_12250 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000949103.1:mannosyl-3-phosphoglycerate phosphatase-related protein 581 2899 gene locus_tag LOCUS_12260 581 2899 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence0181 <1 1076 gene locus_tag LOCUS_12270 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927081.1:TonB-dependent receptor 1251 3314 gene locus_tag LOCUS_12280 1251 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4003 3788 gene locus_tag LOCUS_12290 4003 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4071 4517 gene locus_tag LOCUS_12300 gene merR 4071 4517 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_12300 4514 5356 gene locus_tag LOCUS_12310 4514 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5518 5802 gene locus_tag LOCUS_12320 5518 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence0182 1132 113 gene locus_tag LOCUS_12330 1132 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2792 1677 gene locus_tag LOCUS_12340 2792 1677 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_12340 3259 4023 gene locus_tag LOCUS_12350 3259 4023 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_12350 4227 5864 gene locus_tag LOCUS_12360 4227 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence0183 2319 790 gene locus_tag LOCUS_12370 gene fumA 2319 790 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_12370 2549 3136 gene locus_tag LOCUS_12380 2549 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4615 3536 gene locus_tag LOCUS_12390 4615 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 5819 4974 gene locus_tag LOCUS_12400 5819 4974 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969929.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0184 553 2295 gene locus_tag LOCUS_12410 gene rpoD 553 2295 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_12410 2579 2878 gene locus_tag LOCUS_12420 2579 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2875 3435 gene locus_tag LOCUS_12430 2875 3435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_12430 3836 3912 gene locus_tag LOCUS_t00080 3836 3912 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3937 4665 gene locus_tag LOCUS_12440 3937 4665 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872628.1 protein_id gnl|my_center|LOCUS_12440 4869 5444 gene locus_tag LOCUS_12450 4869 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence0185 436 1962 gene locus_tag LOCUS_12460 436 1962 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_12460 1959 3407 gene locus_tag LOCUS_12470 1959 3407 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530104.1 protein_id gnl|my_center|LOCUS_12470 3450 4202 gene locus_tag LOCUS_12480 3450 4202 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 protein_id gnl|my_center|LOCUS_12480 4325 4113 gene locus_tag LOCUS_12490 4325 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4621 5601 gene locus_tag LOCUS_12500 4621 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence0186 3026 2661 gene locus_tag LOCUS_12510 3026 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4296 3151 gene locus_tag LOCUS_12520 4296 3151 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_12520 5409 4486 gene locus_tag LOCUS_12530 5409 4486 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence0187 629 2056 gene locus_tag LOCUS_12540 629 2056 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_12540 2210 2698 gene locus_tag LOCUS_12550 2210 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3601 2816 gene locus_tag LOCUS_12560 3601 2816 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_12560 4209 3598 gene locus_tag LOCUS_12570 gene yihX 4209 3598 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314324.1 protein_id gnl|my_center|LOCUS_12570 5890 4385 gene locus_tag LOCUS_12580 5890 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5325 5411 gene locus_tag LOCUS_t00090 5325 5411 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0188 772 215 gene locus_tag LOCUS_12590 gene frr 772 215 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_12590 1494 778 gene locus_tag LOCUS_12600 gene pyrH 1494 778 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_12600 2152 1505 gene locus_tag LOCUS_12610 gene tsf 2152 1505 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_12610 3247 2345 gene locus_tag LOCUS_12620 gene rpsB 3247 2345 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_12620 3715 3320 gene locus_tag LOCUS_12630 gene rpsI 3715 3320 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_12630 4173 3742 gene locus_tag LOCUS_12640 gene rplM 4173 3742 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_12640 4935 5684 gene locus_tag LOCUS_12650 4935 5684 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0189 1263 169 gene locus_tag LOCUS_12660 1263 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1550 3007 gene locus_tag LOCUS_12670 1550 3007 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_12670 4857 3094 gene locus_tag LOCUS_12680 4857 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5013 5297 gene locus_tag LOCUS_12690 5013 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5560 5381 gene locus_tag LOCUS_12700 5560 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence0190 <1 794 gene locus_tag LOCUS_12710 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein 798 2279 gene locus_tag LOCUS_12720 798 2279 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_12720 2282 2632 gene locus_tag LOCUS_12730 2282 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2879 4369 gene locus_tag LOCUS_12740 2879 4369 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_12740 4483 5748 gene locus_tag LOCUS_12750 4483 5748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence0191 2343 478 gene locus_tag LOCUS_12760 2343 478 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_12760 3220 2351 gene locus_tag LOCUS_12770 3220 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4904 3180 gene locus_tag LOCUS_12780 4904 3180 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_12780 5840 4914 gene locus_tag LOCUS_12790 5840 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0192 490 678 gene locus_tag LOCUS_12800 490 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 656 1036 gene locus_tag LOCUS_12810 656 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1379 1606 gene locus_tag LOCUS_12820 1379 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1603 1902 gene locus_tag LOCUS_12830 1603 1902 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_12830 3707 1965 gene locus_tag LOCUS_12840 3707 1965 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 protein_id gnl|my_center|LOCUS_12840 3962 4168 gene locus_tag LOCUS_12850 3962 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4155 4469 gene locus_tag LOCUS_12860 4155 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 5211 5762 gene locus_tag LOCUS_12870 5211 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence0193 126 2231 gene locus_tag LOCUS_12880 gene glgX 126 2231 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence0194 34 2199 gene locus_tag LOCUS_12890 34 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2171 3703 gene locus_tag LOCUS_12900 2171 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 3725 4327 gene locus_tag LOCUS_12910 3725 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4538 4720 gene locus_tag LOCUS_12920 4538 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4931 4713 gene locus_tag LOCUS_12930 4931 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4893 5402 gene locus_tag LOCUS_12940 4893 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0195 3924 130 gene locus_tag LOCUS_12950 3924 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5308 4040 gene locus_tag LOCUS_12960 5308 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence0196 <1 2281 gene locus_tag LOCUS_12970 <1 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase 2313 2909 gene locus_tag LOCUS_12980 2313 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3134 5674 gene locus_tag LOCUS_12990 3134 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0197 2059 1709 gene locus_tag LOCUS_13000 2059 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3478 2192 gene locus_tag LOCUS_13010 3478 2192 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_13010 <5820 4024 gene locus_tag LOCUS_13020 <5820 4024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039201.1:TonB-dependent receptor >Feature sequence0198 3870 526 gene locus_tag LOCUS_13030 3870 526 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_13030 5505 3931 gene locus_tag LOCUS_13040 5505 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence0199 <1 721 gene locus_tag LOCUS_13050 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258675.1:phosphoglycerate kinase 827 1576 gene locus_tag LOCUS_13060 gene tpiA 827 1576 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_13060 1852 2226 gene locus_tag LOCUS_13070 1852 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2358 2442 gene locus_tag LOCUS_t00100 2358 2442 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2915 3388 gene locus_tag LOCUS_13080 gene tnpA 2915 3388 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_13080 5212 3524 gene locus_tag LOCUS_13090 5212 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5462 5298 gene locus_tag LOCUS_13100 5462 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence0200 <1 2249 gene locus_tag LOCUS_13110 <1 2249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002228111.1:LPS assembly protein LptD 2488 3606 gene locus_tag LOCUS_13120 2488 3606 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_13120 4676 3846 gene locus_tag LOCUS_13130 4676 3846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_13130 5702 4812 gene locus_tag LOCUS_13140 5702 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence0201 5724 4870 gene locus_tag LOCUS_13150 5724 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0202 1789 5223 gene locus_tag LOCUS_13160 1789 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence0203 355 158 gene locus_tag LOCUS_13170 355 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 376 1137 gene locus_tag LOCUS_13180 376 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1471 2898 gene locus_tag LOCUS_13190 1471 2898 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence0204 <1 1002 gene locus_tag LOCUS_13200 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391781.1:transketolase family protein 1253 4750 gene locus_tag LOCUS_13210 1253 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0205 1373 177 gene locus_tag LOCUS_13220 gene metK 1373 177 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_13220 2919 1636 gene locus_tag LOCUS_13230 2919 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4063 3062 gene locus_tag LOCUS_13240 4063 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4942 4169 gene locus_tag LOCUS_13250 4942 4169 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_13250 5562 4939 gene locus_tag LOCUS_13260 5562 4939 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0206 <1 2331 gene locus_tag LOCUS_13270 <1 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813379.1:HEAT repeat domain-containing protein 2840 2613 gene locus_tag LOCUS_13280 2840 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0207 310 1674 gene locus_tag LOCUS_13290 310 1674 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613955.1 protein_id gnl|my_center|LOCUS_13290 1961 2539 gene locus_tag LOCUS_13300 1961 2539 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401930.1 protein_id gnl|my_center|LOCUS_13300 2532 4610 gene locus_tag LOCUS_13310 2532 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence0208 363 223 gene locus_tag LOCUS_13320 363 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 751 3084 gene locus_tag LOCUS_13330 751 3084 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_13330 3395 3655 gene locus_tag LOCUS_13340 3395 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3691 5034 gene locus_tag LOCUS_13350 3691 5034 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence0209 1693 422 gene locus_tag LOCUS_13360 1693 422 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_13360 1882 3018 gene locus_tag LOCUS_13370 1882 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3506 5566 gene locus_tag LOCUS_13380 3506 5566 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044972.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence0210 <1 1364 gene locus_tag LOCUS_13390 <1 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 1454 2884 gene locus_tag LOCUS_13400 1454 2884 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_13400 2923 3702 gene locus_tag LOCUS_13410 2923 3702 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929513.1 protein_id gnl|my_center|LOCUS_13410 3827 4999 gene locus_tag LOCUS_13420 3827 4999 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0211 2270 780 gene locus_tag LOCUS_13430 2270 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4260 2704 gene locus_tag LOCUS_13440 4260 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4806 5111 gene locus_tag LOCUS_13450 4806 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5108 5518 gene locus_tag LOCUS_13460 5108 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0212 605 766 gene locus_tag LOCUS_13470 605 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 763 1011 gene locus_tag LOCUS_13480 763 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 1206 1979 gene locus_tag LOCUS_13490 1206 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1976 3505 gene locus_tag LOCUS_13500 1976 3505 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089230.1 protein_id gnl|my_center|LOCUS_13500 3596 4867 gene locus_tag LOCUS_13510 gene egtB 3596 4867 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence0213 651 1253 gene locus_tag LOCUS_13520 651 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1513 1307 gene locus_tag LOCUS_13530 1513 1307 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_13530 1690 1526 gene locus_tag LOCUS_13540 1690 1526 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_13540 3745 2780 gene locus_tag LOCUS_13550 3745 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4741 4025 gene locus_tag LOCUS_13560 4741 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5124 4885 gene locus_tag LOCUS_13570 5124 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5388 5131 gene locus_tag LOCUS_13580 5388 5131 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence0214 994 425 gene locus_tag LOCUS_13590 994 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1989 994 gene locus_tag LOCUS_13600 gene pilM 1989 994 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942426.1 protein_id gnl|my_center|LOCUS_13600 3748 2102 gene locus_tag LOCUS_13610 3748 2102 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_13610 3918 3745 gene locus_tag LOCUS_13620 3918 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5191 3980 gene locus_tag LOCUS_13630 5191 3980 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence0215 68 934 gene locus_tag LOCUS_13640 gene fepC 68 934 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140646.1 protein_id gnl|my_center|LOCUS_13640 1196 2047 gene locus_tag LOCUS_13650 gene hisJ 1196 2047 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 protein_id gnl|my_center|LOCUS_13650 2483 2070 gene locus_tag LOCUS_13660 2483 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 3574 2480 gene locus_tag LOCUS_13670 gene apbC 3574 2480 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_13670 3756 4577 gene locus_tag LOCUS_13680 gene proC 3756 4577 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_13680 5606 4977 gene locus_tag LOCUS_13690 5606 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0216 707 513 gene locus_tag LOCUS_13700 707 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 973 809 gene locus_tag LOCUS_13710 973 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1287 1628 gene locus_tag LOCUS_13720 1287 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2386 1625 gene locus_tag LOCUS_13730 2386 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2473 2886 gene locus_tag LOCUS_13740 2473 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2923 3075 gene locus_tag LOCUS_13750 2923 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007609497.1 protein_id gnl|my_center|LOCUS_13750 3098 3496 gene locus_tag LOCUS_13760 3098 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3531 4202 gene locus_tag LOCUS_13770 3531 4202 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_13770 4469 5449 gene locus_tag LOCUS_13780 4469 5449 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022590.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence0217 693 43 gene locus_tag LOCUS_13790 693 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1697 873 gene locus_tag LOCUS_13800 1697 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5249 1884 gene locus_tag LOCUS_13810 5249 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5509 5246 gene locus_tag LOCUS_13820 5509 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence0218 1757 807 gene locus_tag LOCUS_13830 1757 807 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_13830 3008 1956 gene locus_tag LOCUS_13840 gene nadA 3008 1956 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_13840 3350 3105 gene locus_tag LOCUS_13850 3350 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 3734 3354 gene locus_tag LOCUS_13860 3734 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5350 3926 gene locus_tag LOCUS_13870 5350 3926 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence0219 3212 1971 gene locus_tag LOCUS_13880 3212 1971 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_13880 5121 3502 gene locus_tag LOCUS_13890 5121 3502 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0220 1501 473 gene locus_tag LOCUS_13900 gene aroF 1501 473 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_13900 2506 1580 gene locus_tag LOCUS_13910 2506 1580 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_13910 2896 4614 gene locus_tag LOCUS_13920 2896 4614 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_13920 4974 4819 gene locus_tag LOCUS_13930 4974 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0221 3768 514 gene locus_tag LOCUS_13940 3768 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence0222 864 535 gene locus_tag LOCUS_13950 864 535 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_13950 1094 861 gene locus_tag LOCUS_13960 1094 861 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_13960 1534 1244 gene locus_tag LOCUS_13970 1534 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1983 1516 gene locus_tag LOCUS_13980 1983 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2592 2152 gene locus_tag LOCUS_13990 2592 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 <5509 2690 gene locus_tag LOCUS_14000 <5509 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065383.1:BREX system P-loop protein BrxC >Feature sequence0223 1636 11 gene locus_tag LOCUS_14010 1636 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2972 1899 gene locus_tag LOCUS_14020 gene recA 2972 1899 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_14020 4306 3077 gene locus_tag LOCUS_14030 4306 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5219 4317 gene locus_tag LOCUS_14040 5219 4317 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230294.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence0224 1177 347 gene locus_tag LOCUS_14050 1177 347 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_14050 2773 4101 gene locus_tag LOCUS_14060 2773 4101 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_14060 4132 5022 gene locus_tag LOCUS_14070 4132 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121407.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence0225 751 1761 gene locus_tag LOCUS_14080 751 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1776 3011 gene locus_tag LOCUS_14090 1776 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3900 3157 gene locus_tag LOCUS_14100 3900 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4228 3971 gene locus_tag LOCUS_14110 4228 3971 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence0226 3918 3475 gene locus_tag LOCUS_14120 3918 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4237 3887 gene locus_tag LOCUS_14130 4237 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence0227 <1 889 gene locus_tag LOCUS_14140 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039201.1:TonB-dependent receptor 886 3144 gene locus_tag LOCUS_14150 886 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3212 5251 gene locus_tag LOCUS_14160 3212 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0228 391 1587 gene locus_tag LOCUS_14170 gene anmK 391 1587 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_14170 2176 1733 gene locus_tag LOCUS_14180 2176 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2069 3421 gene locus_tag LOCUS_14190 2069 3421 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_14190 3672 3394 gene locus_tag LOCUS_14200 3672 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0229 634 1032 gene locus_tag LOCUS_14210 634 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14210 1071 2126 gene locus_tag LOCUS_14220 1071 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2400 2621 gene locus_tag LOCUS_14230 2400 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3033 3305 gene locus_tag LOCUS_14240 3033 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3513 4433 gene locus_tag LOCUS_14250 3513 4433 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence0230 <1 3393 gene locus_tag LOCUS_14260 <1 3393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein 4259 3768 gene locus_tag LOCUS_14270 4259 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0231 3130 1019 gene locus_tag LOCUS_14280 3130 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940971.1 protein_id gnl|my_center|LOCUS_14280 3962 3117 gene locus_tag LOCUS_14290 3962 3117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943921.1 protein_id gnl|my_center|LOCUS_14290 4204 5205 gene locus_tag LOCUS_14300 4204 5205 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence0232 89 460 gene locus_tag LOCUS_14310 89 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 506 2158 gene locus_tag LOCUS_14320 506 2158 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_14320 2228 2620 gene locus_tag LOCUS_14330 2228 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2624 3421 gene locus_tag LOCUS_14340 2624 3421 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_14340 3715 4434 gene locus_tag LOCUS_14350 3715 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 <5415 4662 gene locus_tag LOCUS_14360 <5415 4662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942640.1:DUF512 domain-containing protein >Feature sequence0233 19 2895 gene locus_tag LOCUS_14370 19 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2927 3310 gene locus_tag LOCUS_14380 2927 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3318 3704 gene locus_tag LOCUS_14390 3318 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3704 4396 gene locus_tag LOCUS_14400 3704 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4299 4826 gene locus_tag LOCUS_14410 4299 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4890 5342 gene locus_tag LOCUS_14420 4890 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence0234 275 3787 gene locus_tag LOCUS_14430 275 3787 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_14430 4102 3770 gene locus_tag LOCUS_14440 4102 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4086 5261 gene locus_tag LOCUS_14450 4086 5261 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256338.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence0235 1160 84 gene locus_tag LOCUS_14460 1160 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5188 1598 gene locus_tag LOCUS_14470 5188 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence0236 249 2027 gene locus_tag LOCUS_14480 249 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 2114 4339 gene locus_tag LOCUS_14490 2114 4339 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence0237 833 153 gene locus_tag LOCUS_14500 gene modA 833 153 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258350.1 protein_id gnl|my_center|LOCUS_14500 3022 1391 gene locus_tag LOCUS_14510 3022 1391 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0238 472 969 gene locus_tag LOCUS_14520 472 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 1014 1274 gene locus_tag LOCUS_14530 1014 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1462 2868 gene locus_tag LOCUS_14540 gene fumC 1462 2868 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_14540 3106 5112 gene locus_tag LOCUS_14550 3106 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence0239 154 1035 gene locus_tag LOCUS_14560 154 1035 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994093.1 protein_id gnl|my_center|LOCUS_14560 1148 2209 gene locus_tag LOCUS_14570 1148 2209 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_14570 3951 2701 gene locus_tag LOCUS_14580 3951 2701 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121116.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence0240 <1 541 gene locus_tag LOCUS_14590 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943698.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 762 1904 gene locus_tag LOCUS_14600 gene mraY 762 1904 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_14600 2071 3438 gene locus_tag LOCUS_14610 gene murD 2071 3438 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_14610 4075 5172 gene locus_tag LOCUS_14620 gene ftsW 4075 5172 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence0241 172 1155 gene locus_tag LOCUS_14630 172 1155 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_14630 1621 1334 gene locus_tag LOCUS_14640 1621 1334 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_14640 1832 1972 gene locus_tag LOCUS_14650 1832 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2292 5162 gene locus_tag LOCUS_14660 2292 5162 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524115.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence0242 4110 886 gene locus_tag LOCUS_14670 gene carB 4110 886 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_14670 5183 4107 gene locus_tag LOCUS_14680 gene carA 5183 4107 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0243 <1 1067 gene locus_tag LOCUS_14690 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257936.1:Glu/Leu/Phe/Val dehydrogenase 1251 1706 gene locus_tag LOCUS_14700 1251 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1982 2317 gene locus_tag LOCUS_14710 1982 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2913 2572 gene locus_tag LOCUS_14720 2913 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4141 3050 gene locus_tag LOCUS_14730 4141 3050 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_14730 4481 4819 gene locus_tag LOCUS_14740 4481 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 4824 5066 gene locus_tag LOCUS_14750 4824 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 >Feature sequence0244 1015 827 gene locus_tag LOCUS_14760 1015 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1235 1017 gene locus_tag LOCUS_14770 1235 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2631 1291 gene locus_tag LOCUS_14780 2631 1291 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_14780 3017 4759 gene locus_tag LOCUS_14790 gene frdA 3017 4759 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence0245 <1 3151 gene locus_tag LOCUS_14800 <1 3151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144184.1:SBBP repeat-containing protein 3439 3266 gene locus_tag LOCUS_14810 3439 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3631 4134 gene locus_tag LOCUS_14820 3631 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4917 4204 gene locus_tag LOCUS_14830 4917 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence0246 857 117 gene locus_tag LOCUS_14840 857 117 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_14840 1499 4771 gene locus_tag LOCUS_14850 1499 4771 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057863007.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0247 549 16 gene locus_tag LOCUS_14860 549 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2112 4043 gene locus_tag LOCUS_14870 2112 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence0248 215 511 gene locus_tag LOCUS_14880 215 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1215 739 gene locus_tag LOCUS_14890 1215 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1901 2458 gene locus_tag LOCUS_14900 1901 2458 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_14900 3311 2532 gene locus_tag LOCUS_14910 3311 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3465 5102 gene locus_tag LOCUS_14920 gene ipdC 3465 5102 CDS product indolepyruvate/phenylpyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390529.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0249 1532 837 gene locus_tag LOCUS_14930 1532 837 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_14930 1950 2588 gene locus_tag LOCUS_14940 1950 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2646 3554 gene locus_tag LOCUS_14950 2646 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3752 4687 gene locus_tag LOCUS_14960 3752 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4696 4917 gene locus_tag LOCUS_14970 4696 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0250 <1 1958 gene locus_tag LOCUS_14980 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein 2829 2083 gene locus_tag LOCUS_14990 gene larB 2829 2083 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_14990 3087 3704 gene locus_tag LOCUS_15000 3087 3704 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521981.1 protein_id gnl|my_center|LOCUS_15000 3662 4672 gene locus_tag LOCUS_15010 gene ubiA 3662 4672 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0251 327 800 gene locus_tag LOCUS_15020 327 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2323 1073 gene locus_tag LOCUS_15030 2323 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3468 2320 gene locus_tag LOCUS_15040 3468 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4542 3736 gene locus_tag LOCUS_15050 4542 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0252 2272 158 gene locus_tag LOCUS_15060 gene pnp 2272 158 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_15060 2726 2457 gene locus_tag LOCUS_15070 gene rpsO 2726 2457 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_15070 3227 3003 gene locus_tag LOCUS_15080 3227 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3470 4996 gene locus_tag LOCUS_15090 gene hemY 3470 4996 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence0253 1052 474 gene locus_tag LOCUS_15100 1052 474 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_15100 1216 1815 gene locus_tag LOCUS_15110 1216 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1898 3895 gene locus_tag LOCUS_15120 1898 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence0254 962 129 gene locus_tag LOCUS_15130 962 129 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_15130 2197 1301 gene locus_tag LOCUS_15140 gene dapA 2197 1301 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_15140 3142 2384 gene locus_tag LOCUS_15150 gene dapB 3142 2384 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838584.1 protein_id gnl|my_center|LOCUS_15150 3444 4208 gene locus_tag LOCUS_15160 3444 4208 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_15160 5062 4301 gene locus_tag LOCUS_15170 5062 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0255 725 1132 gene locus_tag LOCUS_15180 725 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 1920 3791 gene locus_tag LOCUS_15190 1920 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence0256 4081 284 gene locus_tag LOCUS_15200 4081 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5155 5078 gene locus_tag LOCUS_t00110 5155 5078 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0257 121 741 gene locus_tag LOCUS_15210 gene wrbA 121 741 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021213.1 protein_id gnl|my_center|LOCUS_15210 2050 830 gene locus_tag LOCUS_15220 2050 830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_15220 3009 2248 gene locus_tag LOCUS_15230 3009 2248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_15230 4763 3012 gene locus_tag LOCUS_15240 4763 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence0258 262 969 gene locus_tag LOCUS_15250 262 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1206 1391 gene locus_tag LOCUS_15260 1206 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3381 1489 gene locus_tag LOCUS_15270 3381 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4272 3424 gene locus_tag LOCUS_15280 4272 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 4994 4437 gene locus_tag LOCUS_15290 4994 4437 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15290 >Feature sequence0259 1461 16 gene locus_tag LOCUS_15300 1461 16 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_15300 2672 1698 gene locus_tag LOCUS_15310 2672 1698 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_15310 2899 4875 gene locus_tag LOCUS_15320 2899 4875 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021139.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence0260 812 48 gene locus_tag LOCUS_15330 812 48 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881293.1 protein_id gnl|my_center|LOCUS_15330 1147 944 gene locus_tag LOCUS_15340 1147 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2845 1508 gene locus_tag LOCUS_15350 2845 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence0261 496 1929 gene locus_tag LOCUS_15360 496 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_15360 2503 2315 gene locus_tag LOCUS_15370 2503 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 2408 2899 gene locus_tag LOCUS_15380 2408 2899 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_15380 3279 4970 gene locus_tag LOCUS_15390 3279 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence0262 216 28 gene locus_tag LOCUS_15400 216 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 947 249 gene locus_tag LOCUS_15410 947 249 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_15410 1964 1023 gene locus_tag LOCUS_15420 1964 1023 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_15420 2127 2053 gene locus_tag LOCUS_t00120 2127 2053 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3038 2133 gene locus_tag LOCUS_15430 gene ispE 3038 2133 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_15430 3511 3176 gene locus_tag LOCUS_15440 3511 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3687 3902 gene locus_tag LOCUS_15450 3687 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 <5149 4104 gene locus_tag LOCUS_15460 <5149 4104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924857.1:tetratricopeptide repeat protein >Feature sequence0263 2969 1593 gene locus_tag LOCUS_15470 2969 1593 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_15470 3580 3260 gene locus_tag LOCUS_15480 3580 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0264 154 285 gene locus_tag LOCUS_15490 154 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 807 2183 gene locus_tag LOCUS_15500 807 2183 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_15500 2320 4878 gene locus_tag LOCUS_15510 2320 4878 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120349.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0265 2227 638 gene locus_tag LOCUS_15520 2227 638 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_15520 5012 2622 gene locus_tag LOCUS_15530 5012 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence0266 264 1454 gene locus_tag LOCUS_15540 264 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1665 3152 gene locus_tag LOCUS_15550 1665 3152 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 4522 3158 gene locus_tag LOCUS_15560 4522 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence0267 848 1621 gene locus_tag LOCUS_15570 848 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3047 1857 gene locus_tag LOCUS_15580 3047 1857 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_15580 3351 3275 gene locus_tag LOCUS_t00130 3351 3275 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4972 3611 gene locus_tag LOCUS_15590 4972 3611 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0268 490 1293 gene locus_tag LOCUS_15600 490 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1290 1595 gene locus_tag LOCUS_15610 1290 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1570 2217 gene locus_tag LOCUS_15620 1570 2217 CDS product HrpE/YscL family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883463.1 protein_id gnl|my_center|LOCUS_15620 2513 3220 gene locus_tag LOCUS_15630 2513 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3284 4927 gene locus_tag LOCUS_15640 3284 4927 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0269 353 1459 gene locus_tag LOCUS_15650 gene rlmN 353 1459 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_15650 1719 3008 gene locus_tag LOCUS_15660 1719 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3400 3852 gene locus_tag LOCUS_15670 3400 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0270 2017 3309 gene locus_tag LOCUS_15680 2017 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4092 3439 gene locus_tag LOCUS_15690 4092 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence0271 3263 387 gene locus_tag LOCUS_15700 3263 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3453 3725 gene locus_tag LOCUS_15710 3453 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3685 4185 gene locus_tag LOCUS_15720 3685 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence0272 <1 1095 gene locus_tag LOCUS_15730 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887889.1:Xaa-Pro peptidase family protein 1301 1005 gene locus_tag LOCUS_15740 1301 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1466 2308 gene locus_tag LOCUS_15750 1466 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2441 3304 gene locus_tag LOCUS_15760 2441 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3489 4046 gene locus_tag LOCUS_15770 3489 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4111 4482 gene locus_tag LOCUS_15780 4111 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0273 1503 694 gene locus_tag LOCUS_15790 1503 694 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_15790 3283 1781 gene locus_tag LOCUS_15800 3283 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4723 3335 gene locus_tag LOCUS_15810 4723 3335 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence0274 1167 1544 gene locus_tag LOCUS_15820 1167 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1788 2531 gene locus_tag LOCUS_15830 1788 2531 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_15830 2807 3361 gene locus_tag LOCUS_15840 2807 3361 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_15840 3662 4408 gene locus_tag LOCUS_15850 3662 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0275 164 91 gene locus_tag LOCUS_t00140 164 91 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 642 1289 gene locus_tag LOCUS_15860 642 1289 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_15860 1331 2026 gene locus_tag LOCUS_15870 1331 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2151 2465 gene locus_tag LOCUS_15880 gene rplU 2151 2465 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_15880 2490 2750 gene locus_tag LOCUS_15890 gene rpmA 2490 2750 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_15890 3097 4182 gene locus_tag LOCUS_15900 gene obgE 3097 4182 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_15900 4255 4902 gene locus_tag LOCUS_15910 gene nadD 4255 4902 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence0276 3243 2164 gene locus_tag LOCUS_15920 3243 2164 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_15920 <4979 3585 gene locus_tag LOCUS_15930 <4979 3585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943934.1:phosphoglucomutase/phosphomannomutase family protein >Feature sequence0277 4559 3633 gene locus_tag LOCUS_15940 4559 3633 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_15940 4965 4690 gene locus_tag LOCUS_15950 4965 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0278 <1 1376 gene locus_tag LOCUS_15960 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731465.1:glutamine synthetase family protein 1753 2622 gene locus_tag LOCUS_15970 1753 2622 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_15970 2610 3467 gene locus_tag LOCUS_15980 2610 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0279 519 782 gene locus_tag LOCUS_15990 519 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 890 1237 gene locus_tag LOCUS_16000 890 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1295 3466 gene locus_tag LOCUS_16010 1295 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 <4960 3804 gene locus_tag LOCUS_16020 <4960 3804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065734.1:tetratricopeptide repeat protein >Feature sequence0280 449 865 gene locus_tag LOCUS_16030 449 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1053 1313 gene locus_tag LOCUS_16040 1053 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1316 2596 gene locus_tag LOCUS_16050 gene hflX 1316 2596 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_16050 3767 3039 gene locus_tag LOCUS_16060 3767 3039 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491603.1 protein_id gnl|my_center|LOCUS_16060 4431 3775 gene locus_tag LOCUS_16070 4431 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0281 406 1500 gene locus_tag LOCUS_16080 406 1500 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_16080 1597 1845 gene locus_tag LOCUS_16090 1597 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16090 1823 2104 gene locus_tag LOCUS_16100 1823 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 2184 3293 gene locus_tag LOCUS_16110 gene menC 2184 3293 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_16110 3346 4245 gene locus_tag LOCUS_16120 3346 4245 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765594.1 protein_id gnl|my_center|LOCUS_16120 <4938 4278 gene locus_tag LOCUS_16130 <4938 4278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943259.1:SpoIID/LytB domain-containing protein >Feature sequence0282 319 1383 gene locus_tag LOCUS_16140 319 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1539 3500 gene locus_tag LOCUS_16150 1539 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence0283 1254 127 gene locus_tag LOCUS_16160 1254 127 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_16160 1648 1184 gene locus_tag LOCUS_16170 1648 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2895 1747 gene locus_tag LOCUS_16180 2895 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3357 3013 gene locus_tag LOCUS_16190 3357 3013 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_16190 4228 3377 gene locus_tag LOCUS_16200 gene prmC 4228 3377 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_16200 <4920 4297 gene locus_tag LOCUS_16210 <4920 4297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140144.1:exodeoxyribonuclease III >Feature sequence0284 108 1658 gene locus_tag LOCUS_16220 108 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1756 2196 gene locus_tag LOCUS_16230 1756 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3443 2364 gene locus_tag LOCUS_16240 gene bpsA 3443 2364 CDS product type III polyketide synthase BpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230750.1 protein_id gnl|my_center|LOCUS_16240 4488 3670 gene locus_tag LOCUS_16250 4488 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4771 4908 gene locus_tag LOCUS_16260 4771 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence0285 3613 104 gene locus_tag LOCUS_16270 3613 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0286 1292 1110 gene locus_tag LOCUS_16280 1292 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1604 1389 gene locus_tag LOCUS_16290 1604 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2825 1650 gene locus_tag LOCUS_16300 2825 1650 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_16300 3182 3634 gene locus_tag LOCUS_16310 3182 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3653 4768 gene locus_tag LOCUS_16320 3653 4768 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122599.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence0287 <1 773 gene locus_tag LOCUS_16330 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421374.1:cytidine/deoxycytidylate deaminase family protein 1162 1629 gene locus_tag LOCUS_16340 1162 1629 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_16340 1733 2575 gene locus_tag LOCUS_16350 1733 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2619 3548 gene locus_tag LOCUS_16360 2619 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence0288 <1 523 gene locus_tag LOCUS_16370 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189303094.1:YbhB/YbcL family Raf kinase inhibitor-like protein 634 1056 gene locus_tag LOCUS_16380 634 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1625 1966 gene locus_tag LOCUS_16390 1625 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2865 2197 gene locus_tag LOCUS_16400 2865 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3516 4328 gene locus_tag LOCUS_16410 3516 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4441 4758 gene locus_tag LOCUS_16420 4441 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0289 <1 1469 gene locus_tag LOCUS_16430 <1 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein 1491 2600 gene locus_tag LOCUS_16440 1491 2600 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_16440 2705 4084 gene locus_tag LOCUS_16450 2705 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence0290 <1 2920 gene locus_tag LOCUS_16460 <1 2920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121300.1:DUF1553 domain-containing protein 3278 4726 gene locus_tag LOCUS_16470 3278 4726 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0291 1813 830 gene locus_tag LOCUS_16480 1813 830 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088662.1 protein_id gnl|my_center|LOCUS_16480 3265 2273 gene locus_tag LOCUS_16490 3265 2273 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_16490 4584 3400 gene locus_tag LOCUS_16500 4584 3400 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence0292 1400 2764 gene locus_tag LOCUS_16510 1400 2764 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_16510 2742 4577 gene locus_tag LOCUS_16520 2742 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0293 <1 2245 gene locus_tag LOCUS_16530 <1 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071046.1:TonB-dependent receptor 3407 2487 gene locus_tag LOCUS_16540 3407 2487 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_16540 3967 3551 gene locus_tag LOCUS_16550 gene mscL 3967 3551 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369434.1 protein_id gnl|my_center|LOCUS_16550 4870 4232 gene locus_tag LOCUS_16560 4870 4232 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence0294 2537 912 gene locus_tag LOCUS_16570 2537 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 3998 2583 gene locus_tag LOCUS_16580 gene nuoF 3998 2583 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_16580 <4853 3995 gene locus_tag LOCUS_16590 <4853 3995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880324.1:NADH-quinone oxidoreductase subunit D >Feature sequence0295 648 1400 gene locus_tag LOCUS_16600 648 1400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_16600 1451 1603 gene locus_tag LOCUS_16610 1451 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1943 1695 gene locus_tag LOCUS_16620 1943 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2437 2051 gene locus_tag LOCUS_16630 2437 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 3926 3135 gene locus_tag LOCUS_16640 3926 3135 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_16640 <4848 3917 gene locus_tag LOCUS_16650 <4848 3917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839725.1:histidine kinase >Feature sequence0296 156 359 gene locus_tag LOCUS_16660 156 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1756 713 gene locus_tag LOCUS_16670 1756 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2677 2850 gene locus_tag LOCUS_16680 2677 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2847 3614 gene locus_tag LOCUS_16690 2847 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence0297 372 1481 gene locus_tag LOCUS_16700 gene speY 372 1481 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_16700 1576 3063 gene locus_tag LOCUS_16710 1576 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3223 3408 gene locus_tag LOCUS_16720 3223 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3393 3683 gene locus_tag LOCUS_16730 3393 3683 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_16730 4529 3717 gene locus_tag LOCUS_16740 4529 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0298 384 644 gene locus_tag LOCUS_16750 384 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 709 1101 gene locus_tag LOCUS_16760 709 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2992 4623 gene locus_tag LOCUS_16770 2992 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence0299 684 854 gene locus_tag LOCUS_16780 684 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1089 1343 gene locus_tag LOCUS_16790 1089 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1340 1753 gene locus_tag LOCUS_16800 1340 1753 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_16800 1756 2649 gene locus_tag LOCUS_16810 1756 2649 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_16810 2745 4025 gene locus_tag LOCUS_16820 2745 4025 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_16820 4249 4683 gene locus_tag LOCUS_16830 gene tadA 4249 4683 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771930.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence0300 89 511 gene locus_tag LOCUS_16840 89 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1508 1840 gene locus_tag LOCUS_16850 1508 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1984 2985 gene locus_tag LOCUS_16860 1984 2985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_16860 4673 3192 gene locus_tag LOCUS_16870 4673 3192 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence0301 1376 57 gene locus_tag LOCUS_16880 1376 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0302 900 754 gene locus_tag LOCUS_16890 900 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2037 997 gene locus_tag LOCUS_16900 2037 997 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937849.1 protein_id gnl|my_center|LOCUS_16900 2378 2160 gene locus_tag LOCUS_16910 2378 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3819 2644 gene locus_tag LOCUS_16920 3819 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0303 78 1517 gene locus_tag LOCUS_16930 78 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1896 1582 gene locus_tag LOCUS_16940 1896 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3063 2332 gene locus_tag LOCUS_16950 3063 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4208 3060 gene locus_tag LOCUS_16960 4208 3060 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_16960 <4791 4208 gene locus_tag LOCUS_16970 <4791 4208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257444.1:glycosyltransferase family 2 protein >Feature sequence0304 1849 1442 gene locus_tag LOCUS_16980 1849 1442 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903937.1 protein_id gnl|my_center|LOCUS_16980 2520 2068 gene locus_tag LOCUS_16990 2520 2068 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_16990 3788 2520 gene locus_tag LOCUS_17000 3788 2520 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_17000 <4787 3799 gene locus_tag LOCUS_17010 <4787 3799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928762.1:Fe-S cluster assembly protein SufD >Feature sequence0305 <1 713 gene locus_tag LOCUS_17020 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870226.1:acetylornithine transaminase 717 1682 gene locus_tag LOCUS_17030 gene argF 717 1682 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_17030 1946 3142 gene locus_tag LOCUS_17040 1946 3142 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_17040 3240 4634 gene locus_tag LOCUS_17050 gene argH 3240 4634 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence0306 1493 330 gene locus_tag LOCUS_17060 1493 330 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_17060 2452 1940 gene locus_tag LOCUS_17070 2452 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3229 2519 gene locus_tag LOCUS_17080 3229 2519 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_17080 3825 3211 gene locus_tag LOCUS_17090 gene coaE 3825 3211 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_17090 <4768 3834 gene locus_tag LOCUS_17100 <4768 3834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393025.1:bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD >Feature sequence0307 63 482 gene locus_tag LOCUS_17110 63 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 645 1100 gene locus_tag LOCUS_17120 645 1100 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615575.1 protein_id gnl|my_center|LOCUS_17120 1129 1479 gene locus_tag LOCUS_17130 1129 1479 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251233.1 protein_id gnl|my_center|LOCUS_17130 1769 2413 gene locus_tag LOCUS_17140 1769 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2523 2999 gene locus_tag LOCUS_17150 gene sixA 2523 2999 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_17150 4151 3222 gene locus_tag LOCUS_17160 4151 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4267 4136 gene locus_tag LOCUS_17170 4267 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 4637 4488 gene locus_tag LOCUS_17180 4637 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0308 369 2423 gene locus_tag LOCUS_17190 369 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2435 3823 gene locus_tag LOCUS_17200 2435 3823 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_17200 <4764 4188 gene locus_tag LOCUS_17210 <4764 4188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392350.1:radical SAM protein >Feature sequence0309 876 1571 gene locus_tag LOCUS_17220 876 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1558 4617 gene locus_tag LOCUS_17230 1558 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0310 3 164 gene locus_tag LOCUS_17240 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 459 701 gene locus_tag LOCUS_17250 459 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 698 2425 gene locus_tag LOCUS_17260 698 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2538 3470 gene locus_tag LOCUS_17270 2538 3470 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_17270 3603 4310 gene locus_tag LOCUS_17280 3603 4310 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0311 <1 2573 gene locus_tag LOCUS_17290 <1 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076003404.1:LuxR C-terminal-related transcriptional regulator 2773 2973 gene locus_tag LOCUS_17300 2773 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3022 4401 gene locus_tag LOCUS_17310 3022 4401 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_17310 4428 4733 gene locus_tag LOCUS_17320 4428 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence0312 285 1481 gene locus_tag LOCUS_17330 gene mnmA 285 1481 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_17330 1659 2687 gene locus_tag LOCUS_17340 1659 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3833 2778 gene locus_tag LOCUS_17350 3833 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0313 1434 46 gene locus_tag LOCUS_17360 1434 46 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_17360 1835 2827 gene locus_tag LOCUS_17370 1835 2827 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723878.1 protein_id gnl|my_center|LOCUS_17370 2875 3114 gene locus_tag LOCUS_17380 2875 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3189 3824 gene locus_tag LOCUS_17390 3189 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence0314 <1 1347 gene locus_tag LOCUS_17400 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259616.1:glycosyltransferase 1344 2126 gene locus_tag LOCUS_17410 1344 2126 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_17410 2185 2427 gene locus_tag LOCUS_17420 2185 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2429 2836 gene locus_tag LOCUS_17430 2429 2836 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_17430 2856 4262 gene locus_tag LOCUS_17440 gene sthA 2856 4262 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence0315 55 924 gene locus_tag LOCUS_17450 55 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1618 992 gene locus_tag LOCUS_17460 gene hflD 1618 992 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090440.1 protein_id gnl|my_center|LOCUS_17460 <4734 1915 gene locus_tag LOCUS_17470 <4734 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225480.1:IgA-specific serine endopeptidase autotransporter >Feature sequence0316 1594 614 gene locus_tag LOCUS_17480 1594 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1976 1581 gene locus_tag LOCUS_17490 1976 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2623 2087 gene locus_tag LOCUS_17500 2623 2087 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_17500 4175 2739 gene locus_tag LOCUS_17510 gene pyk 4175 2739 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258979.1 protein_id gnl|my_center|LOCUS_17510 <4734 4185 gene locus_tag LOCUS_17520 <4734 4185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081919.1:radical SAM protein >Feature sequence0317 27 788 gene locus_tag LOCUS_17530 27 788 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085429.1 protein_id gnl|my_center|LOCUS_17530 1783 2988 gene locus_tag LOCUS_17540 1783 2988 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_17540 4499 3039 gene locus_tag LOCUS_17550 4499 3039 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence0318 897 2588 gene locus_tag LOCUS_17560 897 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2491 3648 gene locus_tag LOCUS_17570 2491 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4444 3728 gene locus_tag LOCUS_17580 4444 3728 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545973.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0319 <1 3479 gene locus_tag LOCUS_17590 <1 3479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase <4726 3716 gene locus_tag LOCUS_17600 <4726 3716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895174.1:PQQ-dependent methanol/ethanol family dehydrogenase >Feature sequence0320 >Feature sequence0321 633 1790 gene locus_tag LOCUS_17610 633 1790 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_17610 1787 3109 gene locus_tag LOCUS_17620 gene dgoD 1787 3109 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_17620 3234 3401 gene locus_tag LOCUS_17630 3234 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0322 1490 801 gene locus_tag LOCUS_17640 1490 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3114 1573 gene locus_tag LOCUS_17650 3114 1573 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 protein_id gnl|my_center|LOCUS_17650 4219 3200 gene locus_tag LOCUS_17660 4219 3200 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence0323 63 3260 gene locus_tag LOCUS_17670 63 3260 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_17670 3492 4607 gene locus_tag LOCUS_17680 3492 4607 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0324 290 733 gene locus_tag LOCUS_17690 290 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 816 1403 gene locus_tag LOCUS_17700 816 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1931 3028 gene locus_tag LOCUS_17710 gene modC 1931 3028 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 protein_id gnl|my_center|LOCUS_17710 3483 3070 gene locus_tag LOCUS_17720 3483 3070 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680926.1 protein_id gnl|my_center|LOCUS_17720 4518 3652 gene locus_tag LOCUS_17730 4518 3652 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence0325 32 1132 gene locus_tag LOCUS_17740 32 1132 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 protein_id gnl|my_center|LOCUS_17740 1152 2135 gene locus_tag LOCUS_17750 1152 2135 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_17750 2132 3160 gene locus_tag LOCUS_17760 2132 3160 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_17760 3164 3919 gene locus_tag LOCUS_17770 3164 3919 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811075.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence0326 450 1541 gene locus_tag LOCUS_17780 450 1541 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_17780 1824 3077 gene locus_tag LOCUS_17790 1824 3077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_17790 3254 4519 gene locus_tag LOCUS_17800 3254 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence0327 155 2152 gene locus_tag LOCUS_17810 gene hemE 155 2152 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121588.1 protein_id gnl|my_center|LOCUS_17810 2262 2444 gene locus_tag LOCUS_17820 2262 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2801 3511 gene locus_tag LOCUS_17830 2801 3511 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_17830 3526 4557 gene locus_tag LOCUS_17840 3526 4557 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence0328 498 2000 gene locus_tag LOCUS_17850 498 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2538 2116 gene locus_tag LOCUS_17860 2538 2116 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_17860 3960 2818 gene locus_tag LOCUS_17870 3960 2818 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704357.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence0329 407 2527 gene locus_tag LOCUS_17880 407 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975232.1 protein_id gnl|my_center|LOCUS_17880 2550 3617 gene locus_tag LOCUS_17890 2550 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0330 451 167 gene locus_tag LOCUS_17900 451 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 898 605 gene locus_tag LOCUS_17910 898 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1335 943 gene locus_tag LOCUS_17920 1335 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2492 1449 gene locus_tag LOCUS_17930 2492 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 <4664 2526 gene locus_tag LOCUS_17940 <4664 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839612.1:TonB-dependent receptor >Feature sequence0331 580 819 gene locus_tag LOCUS_17950 580 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 828 1271 gene locus_tag LOCUS_17960 gene fabZ 828 1271 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080862.1 protein_id gnl|my_center|LOCUS_17960 1279 2067 gene locus_tag LOCUS_17970 gene fabL 1279 2067 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_17970 2190 2939 gene locus_tag LOCUS_17980 2190 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3283 4302 gene locus_tag LOCUS_17990 3283 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0332 1143 451 gene locus_tag LOCUS_18000 1143 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1307 1140 gene locus_tag LOCUS_18010 1307 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2532 1501 gene locus_tag LOCUS_18020 2532 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2707 2988 gene locus_tag LOCUS_18030 2707 2988 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_18030 3386 3129 gene locus_tag LOCUS_18040 3386 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 3901 3449 gene locus_tag LOCUS_18050 3901 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 <4660 3965 gene locus_tag LOCUS_18060 <4660 3965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705014.1:YqaJ viral recombinase family protein >Feature sequence0333 399 938 gene locus_tag LOCUS_18070 399 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1735 1154 gene locus_tag LOCUS_18080 1735 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2133 2369 gene locus_tag LOCUS_18090 2133 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2730 3722 gene locus_tag LOCUS_18100 2730 3722 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228360.1 protein_id gnl|my_center|LOCUS_18100 4513 3776 gene locus_tag LOCUS_18110 gene pdxJ 4513 3776 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence0334 304 379 gene locus_tag LOCUS_t00150 304 379 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 981 394 gene locus_tag LOCUS_18120 gene leuD 981 394 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802156.1 protein_id gnl|my_center|LOCUS_18120 2550 1147 gene locus_tag LOCUS_18130 gene leuC 2550 1147 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_18130 3216 2764 gene locus_tag LOCUS_18140 3216 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4371 3355 gene locus_tag LOCUS_18150 gene gap 4371 3355 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0335 1702 3906 gene locus_tag LOCUS_18160 1702 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence0336 646 380 gene locus_tag LOCUS_18170 646 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2839 911 gene locus_tag LOCUS_18180 2839 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3626 4153 gene locus_tag LOCUS_18190 3626 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence0337 4510 3278 gene locus_tag LOCUS_18200 4510 3278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267368.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence0338 257 2284 gene locus_tag LOCUS_18210 257 2284 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_18210 2650 3537 gene locus_tag LOCUS_18220 2650 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3534 4556 gene locus_tag LOCUS_18230 3534 4556 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256636.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence0339 <1 841 gene locus_tag LOCUS_18240 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039201.1:TonB-dependent receptor 929 3172 gene locus_tag LOCUS_18250 929 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3409 4449 gene locus_tag LOCUS_18260 3409 4449 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence0340 1229 216 gene locus_tag LOCUS_18270 1229 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 2709 1531 gene locus_tag LOCUS_18280 2709 1531 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038779.1 protein_id gnl|my_center|LOCUS_18280 3842 2958 gene locus_tag LOCUS_18290 3842 2958 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869093.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence0341 2046 886 gene locus_tag LOCUS_18300 2046 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3703 2147 gene locus_tag LOCUS_18310 3703 2147 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_18310 4014 3727 gene locus_tag LOCUS_18320 4014 3727 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869618.1 protein_id gnl|my_center|LOCUS_18320 4366 4052 gene locus_tag LOCUS_18330 4366 4052 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0342 741 616 gene locus_tag LOCUS_18340 741 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1273 914 gene locus_tag LOCUS_18350 1273 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2301 1531 gene locus_tag LOCUS_18360 2301 1531 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459462.1 protein_id gnl|my_center|LOCUS_18360 4584 2437 gene locus_tag LOCUS_18370 4584 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence0343 127 1200 gene locus_tag LOCUS_18380 127 1200 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_18380 2188 1181 gene locus_tag LOCUS_18390 2188 1181 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_18390 4482 2245 gene locus_tag LOCUS_18400 4482 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence0344 2357 84 gene locus_tag LOCUS_18410 2357 84 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_18410 2838 2359 gene locus_tag LOCUS_18420 2838 2359 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_18420 3715 2828 gene locus_tag LOCUS_18430 3715 2828 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0345 2975 2526 gene locus_tag LOCUS_18440 2975 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3132 2920 gene locus_tag LOCUS_18450 3132 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3710 3303 gene locus_tag LOCUS_18460 3710 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0346 603 3830 gene locus_tag LOCUS_18470 603 3830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence0347 143 1492 gene locus_tag LOCUS_18480 143 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1489 2475 gene locus_tag LOCUS_18490 1489 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence0348 1272 529 gene locus_tag LOCUS_18500 1272 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2229 1291 gene locus_tag LOCUS_18510 2229 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18510 2905 2516 gene locus_tag LOCUS_18520 2905 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3979 3437 gene locus_tag LOCUS_18530 3979 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4545 4417 gene locus_tag LOCUS_18540 4545 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence0349 607 691 gene locus_tag LOCUS_t00160 607 691 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 772 2073 gene locus_tag LOCUS_18550 gene tig 772 2073 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_18550 2113 2700 gene locus_tag LOCUS_18560 gene clpP 2113 2700 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_18560 2805 4040 gene locus_tag LOCUS_18570 gene clpX 2805 4040 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence0350 63 1892 gene locus_tag LOCUS_18580 63 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence0351 299 625 gene locus_tag LOCUS_18590 gene rpsJ 299 625 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_18590 731 1360 gene locus_tag LOCUS_18600 gene rplC 731 1360 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_18600 1403 2029 gene locus_tag LOCUS_18610 gene rplD 1403 2029 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_18610 2026 2319 gene locus_tag LOCUS_18620 2026 2319 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_18620 2321 3142 gene locus_tag LOCUS_18630 gene rplB 2321 3142 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_18630 3187 3495 gene locus_tag LOCUS_18640 gene rpsS 3187 3495 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_18640 3523 3858 gene locus_tag LOCUS_18650 gene rplV 3523 3858 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_18650 3870 4532 gene locus_tag LOCUS_18660 gene rpsC 3870 4532 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938604.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence0352 975 220 gene locus_tag LOCUS_18670 975 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2186 1119 gene locus_tag LOCUS_18680 2186 1119 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_18680 3132 2407 gene locus_tag LOCUS_18690 3132 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_18690 4299 3292 gene locus_tag LOCUS_18700 gene iolX 4299 3292 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence0353 <1 3311 gene locus_tag LOCUS_18710 <1 3311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190626.1:squalene--hopene cyclase 3769 4404 gene locus_tag LOCUS_18720 3769 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence0354 142 1308 gene locus_tag LOCUS_18730 142 1308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_18730 1412 2797 gene locus_tag LOCUS_18740 1412 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2863 3564 gene locus_tag LOCUS_18750 2863 3564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_18750 3752 4483 gene locus_tag LOCUS_18760 gene trmJ 3752 4483 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940021.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence0355 1098 2921 gene locus_tag LOCUS_18770 1098 2921 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_18770 2922 4199 gene locus_tag LOCUS_18780 2922 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence0356 <1 692 gene locus_tag LOCUS_18790 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389634.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha 689 1672 gene locus_tag LOCUS_18800 689 1672 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404705.1 protein_id gnl|my_center|LOCUS_18800 1751 3043 gene locus_tag LOCUS_18810 1751 3043 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_18810 3097 3360 gene locus_tag LOCUS_18820 3097 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3357 3752 gene locus_tag LOCUS_18830 3357 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence0357 2600 1371 gene locus_tag LOCUS_18840 gene ftsA 2600 1371 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_18840 3861 2986 gene locus_tag LOCUS_18850 3861 2986 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948311.1 protein_id gnl|my_center|LOCUS_18850 4235 3987 gene locus_tag LOCUS_18860 4235 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence0358 1550 273 gene locus_tag LOCUS_18870 1550 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2828 1881 gene locus_tag LOCUS_18880 2828 1881 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928937.1 protein_id gnl|my_center|LOCUS_18880 3902 4303 gene locus_tag LOCUS_18890 3902 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence0359 1148 2134 gene locus_tag LOCUS_18900 gene rbsK 1148 2134 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 protein_id gnl|my_center|LOCUS_18900 2138 3133 gene locus_tag LOCUS_18910 2138 3133 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence0360 603 824 gene locus_tag LOCUS_18920 603 824 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_18920 2108 975 gene locus_tag LOCUS_18930 2108 975 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_18930 3533 2184 gene locus_tag LOCUS_18940 3533 2184 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0361 1811 1993 gene locus_tag LOCUS_18950 1811 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2183 2317 gene locus_tag LOCUS_18960 2183 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence0362 3578 2772 gene locus_tag LOCUS_18970 3578 2772 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_18970 4435 3656 gene locus_tag LOCUS_18980 4435 3656 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence0363 <1 1852 gene locus_tag LOCUS_18990 <1 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161536185.1:response regulator 1988 4063 gene locus_tag LOCUS_19000 1988 4063 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119257.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence0364 2415 3305 gene locus_tag LOCUS_19010 2415 3305 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence0365 774 2090 gene locus_tag LOCUS_19020 774 2090 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_19020 2251 3624 gene locus_tag LOCUS_19030 2251 3624 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_19030 3640 4083 gene locus_tag LOCUS_19040 3640 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence0366 282 491 gene locus_tag LOCUS_19050 282 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 545 832 gene locus_tag LOCUS_19060 545 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1069 2745 gene locus_tag LOCUS_19070 1069 2745 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_19070 3165 2851 gene locus_tag LOCUS_19080 3165 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3349 3158 gene locus_tag LOCUS_19090 3349 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4054 3470 gene locus_tag LOCUS_19100 4054 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence0367 1175 93 gene locus_tag LOCUS_19110 1175 93 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_19110 1264 1467 gene locus_tag LOCUS_19120 1264 1467 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_19120 1461 1991 gene locus_tag LOCUS_19130 1461 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2735 1998 gene locus_tag LOCUS_19140 gene rlmB 2735 1998 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_19140 4290 2785 gene locus_tag LOCUS_19150 gene gltX 4290 2785 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence0368 1170 841 gene locus_tag LOCUS_19160 1170 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1156 1323 gene locus_tag LOCUS_19170 1156 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1397 3889 gene locus_tag LOCUS_19180 1397 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 <4458 3933 gene locus_tag LOCUS_19190 <4458 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187683.1:histidine kinase >Feature sequence0369 88 1812 gene locus_tag LOCUS_19200 88 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence0370 1370 111 gene locus_tag LOCUS_19210 gene hemW 1370 111 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_19210 2552 1575 gene locus_tag LOCUS_19220 2552 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4263 2782 gene locus_tag LOCUS_19230 4263 2782 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0371 501 1367 gene locus_tag LOCUS_19240 501 1367 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_19240 1925 3547 gene locus_tag LOCUS_19250 1925 3547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_19250 3916 4239 gene locus_tag LOCUS_19260 3916 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence0372 1531 68 gene locus_tag LOCUS_19270 gene guaB 1531 68 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_19270 <4428 1575 gene locus_tag LOCUS_19280 <4428 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence0373 <1 653 gene locus_tag LOCUS_19290 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971569.1:glycoside hydrolase family 16 protein 763 2316 gene locus_tag LOCUS_19300 763 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259626.1 protein_id gnl|my_center|LOCUS_19300 2390 3313 gene locus_tag LOCUS_19310 2390 3313 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_19310 4170 3592 gene locus_tag LOCUS_19320 4170 3592 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence0374 259 945 gene locus_tag LOCUS_19330 259 945 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973665.1 protein_id gnl|my_center|LOCUS_19330 1034 2059 gene locus_tag LOCUS_19340 1034 2059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_19340 2400 3476 gene locus_tag LOCUS_19350 2400 3476 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_19350 3473 4228 gene locus_tag LOCUS_19360 3473 4228 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence0375 1275 148 gene locus_tag LOCUS_19370 gene hppD 1275 148 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_19370 2360 1263 gene locus_tag LOCUS_19380 gene hisC 2360 1263 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_19380 3529 2621 gene locus_tag LOCUS_19390 3529 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0376 589 338 gene locus_tag LOCUS_19400 589 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2022 586 gene locus_tag LOCUS_19410 2022 586 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982280.1 protein_id gnl|my_center|LOCUS_19410 2039 2191 gene locus_tag LOCUS_19420 2039 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence0377 2599 1253 gene locus_tag LOCUS_19430 2599 1253 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_19430 3590 2901 gene locus_tag LOCUS_19440 3590 2901 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_19440 4288 3593 gene locus_tag LOCUS_19450 4288 3593 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence0378 1252 350 gene locus_tag LOCUS_19460 1252 350 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_19460 1923 1582 gene locus_tag LOCUS_19470 1923 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2711 3421 gene locus_tag LOCUS_19480 2711 3421 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_19480 3501 3629 gene locus_tag LOCUS_19490 3501 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence0379 1593 124 gene locus_tag LOCUS_19500 1593 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3080 1842 gene locus_tag LOCUS_19510 3080 1842 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_19510 4026 3211 gene locus_tag LOCUS_19520 4026 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence0380 377 57 gene locus_tag LOCUS_19530 377 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4151 606 gene locus_tag LOCUS_19540 4151 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence0381 1128 595 gene locus_tag LOCUS_19550 1128 595 CDS product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227068.1 protein_id gnl|my_center|LOCUS_19550 1584 1757 gene locus_tag LOCUS_19560 1584 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1768 2472 gene locus_tag LOCUS_19570 1768 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2647 4239 gene locus_tag LOCUS_19580 2647 4239 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0382 331 1557 gene locus_tag LOCUS_19590 331 1557 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_19590 1722 2153 gene locus_tag LOCUS_19600 1722 2153 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_19600 2365 2538 gene locus_tag LOCUS_19610 2365 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4314 2551 gene locus_tag LOCUS_19620 4314 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence0383 1617 136 gene locus_tag LOCUS_19630 gene gcvPB 1617 136 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_19630 2488 1955 gene locus_tag LOCUS_19640 2488 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 3101 4144 gene locus_tag LOCUS_19650 3101 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence0384 1684 731 gene locus_tag LOCUS_19660 1684 731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19660 2828 1992 gene locus_tag LOCUS_19670 2828 1992 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_19670 4037 3000 gene locus_tag LOCUS_19680 4037 3000 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942515.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0385 1504 485 gene locus_tag LOCUS_19690 1504 485 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_19690 4237 2120 gene locus_tag LOCUS_19700 4237 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0386 <1 727 gene locus_tag LOCUS_19710 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942869.1:dTMP kinase 1022 2047 gene locus_tag LOCUS_19720 gene holB 1022 2047 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_19720 2569 2877 gene locus_tag LOCUS_19730 2569 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2985 4160 gene locus_tag LOCUS_19740 2985 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0387 830 2248 gene locus_tag LOCUS_19750 830 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2408 2545 gene locus_tag LOCUS_19760 2408 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2535 2849 gene locus_tag LOCUS_19770 2535 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19770 3548 3135 gene locus_tag LOCUS_19780 3548 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4327 3545 gene locus_tag LOCUS_19790 4327 3545 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence0388 721 2502 gene locus_tag LOCUS_19800 721 2502 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_19800 3064 2615 gene locus_tag LOCUS_19810 3064 2615 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_19810 3574 4344 gene locus_tag LOCUS_19820 3574 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence0389 591 1238 gene locus_tag LOCUS_19830 591 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1344 1802 gene locus_tag LOCUS_19840 1344 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2022 2279 gene locus_tag LOCUS_19850 2022 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3974 2172 gene locus_tag LOCUS_19860 3974 2172 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence0390 <1 579 gene locus_tag LOCUS_19870 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057610.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase 576 779 gene locus_tag LOCUS_19880 576 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1224 1736 gene locus_tag LOCUS_19890 1224 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1745 2803 gene locus_tag LOCUS_19900 gene waaC 1745 2803 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_19900 3099 3299 gene locus_tag LOCUS_19910 3099 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence0391 919 188 gene locus_tag LOCUS_19920 919 188 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_19920 2360 1005 gene locus_tag LOCUS_19930 2360 1005 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_19930 3262 2420 gene locus_tag LOCUS_19940 gene accD 3262 2420 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_19940 3900 4037 gene locus_tag LOCUS_19950 3900 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence0392 390 641 gene locus_tag LOCUS_19960 390 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 638 1930 gene locus_tag LOCUS_19970 638 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2156 2025 gene locus_tag LOCUS_19980 2156 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2368 2156 gene locus_tag LOCUS_19990 2368 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3202 2486 gene locus_tag LOCUS_20000 3202 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3140 3541 gene locus_tag LOCUS_20010 3140 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3551 4024 gene locus_tag LOCUS_20020 3551 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0393 458 634 gene locus_tag LOCUS_20030 458 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1608 922 gene locus_tag LOCUS_20040 1608 922 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_20040 1937 2086 gene locus_tag LOCUS_20050 1937 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2083 3474 gene locus_tag LOCUS_20060 gene atoC 2083 3474 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence0394 1965 1810 gene locus_tag LOCUS_20070 1965 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2628 1996 gene locus_tag LOCUS_20080 2628 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4029 2800 gene locus_tag LOCUS_20090 4029 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0395 633 1841 gene locus_tag LOCUS_20100 633 1841 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_20100 3024 2080 gene locus_tag LOCUS_20110 gene miaA 3024 2080 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_20110 3368 3213 gene locus_tag LOCUS_20120 3368 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3520 3359 gene locus_tag LOCUS_20130 3520 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20130 4082 3558 gene locus_tag LOCUS_20140 4082 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence0396 821 2542 gene locus_tag LOCUS_20150 821 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2577 2855 gene locus_tag LOCUS_20160 2577 2855 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_20160 2852 3211 gene locus_tag LOCUS_20170 gene rbfA 2852 3211 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967251.1 protein_id gnl|my_center|LOCUS_20170 3391 4260 gene locus_tag LOCUS_20180 gene truB 3391 4260 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence0397 >Feature sequence0398 153 926 gene locus_tag LOCUS_20190 gene hisF 153 926 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_20190 938 1621 gene locus_tag LOCUS_20200 gene hisIE 938 1621 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_20200 1769 3247 gene locus_tag LOCUS_20210 gene trpE 1769 3247 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_20210 3408 3974 gene locus_tag LOCUS_20220 3408 3974 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence0399 <1 3009 gene locus_tag LOCUS_20230 <1 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence0400 2076 244 gene locus_tag LOCUS_20240 2076 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2115 2411 gene locus_tag LOCUS_20250 2115 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3820 2735 gene locus_tag LOCUS_20260 3820 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence0401 153 917 gene locus_tag LOCUS_20270 gene kduD 153 917 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_20270 1116 1409 gene locus_tag LOCUS_20280 1116 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1711 1890 gene locus_tag LOCUS_20290 1711 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2008 2505 gene locus_tag LOCUS_20300 2008 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4124 2673 gene locus_tag LOCUS_20310 4124 2673 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence0402 3 1079 gene locus_tag LOCUS_20320 3 1079 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185271872.1 protein_id gnl|my_center|LOCUS_20320 1229 2335 gene locus_tag LOCUS_20330 1229 2335 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048420.1 protein_id gnl|my_center|LOCUS_20330 2368 2601 gene locus_tag LOCUS_20340 2368 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2553 3059 gene locus_tag LOCUS_20350 2553 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3067 4014 gene locus_tag LOCUS_20360 3067 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence0403 364 603 gene locus_tag LOCUS_20370 364 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 567 1508 gene locus_tag LOCUS_20380 567 1508 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142860.1 protein_id gnl|my_center|LOCUS_20380 1523 1837 gene locus_tag LOCUS_20390 1523 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2135 2284 gene locus_tag LOCUS_20400 2135 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2659 3357 gene locus_tag LOCUS_20410 2659 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3627 4088 gene locus_tag LOCUS_20420 3627 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence0404 297 1733 gene locus_tag LOCUS_20430 297 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1955 2764 gene locus_tag LOCUS_20440 1955 2764 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_20440 3055 3198 gene locus_tag LOCUS_20450 3055 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 3233 4180 gene locus_tag LOCUS_20460 3233 4180 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533429.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence0405 2274 1261 gene locus_tag LOCUS_20470 2274 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_20470 2329 2526 gene locus_tag LOCUS_20480 2329 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2868 2500 gene locus_tag LOCUS_20490 2868 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0406 4095 2281 gene locus_tag LOCUS_20500 4095 2281 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0407 1565 672 gene locus_tag LOCUS_20510 1565 672 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_20510 2600 1947 gene locus_tag LOCUS_20520 2600 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 <4240 2633 gene locus_tag LOCUS_20530 <4240 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037353.1:TonB-dependent receptor >Feature sequence0408 1143 850 gene locus_tag LOCUS_20540 1143 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 1323 1192 gene locus_tag LOCUS_20550 1323 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4112 2157 gene locus_tag LOCUS_20560 4112 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence0409 1741 182 gene locus_tag LOCUS_20570 1741 182 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015077.1 protein_id gnl|my_center|LOCUS_20570 2660 1752 gene locus_tag LOCUS_20580 2660 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4039 2822 gene locus_tag LOCUS_20590 4039 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence0410 1354 476 gene locus_tag LOCUS_20600 1354 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2438 1479 gene locus_tag LOCUS_20610 2438 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2830 4008 gene locus_tag LOCUS_20620 2830 4008 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence0411 871 3714 gene locus_tag LOCUS_20630 871 3714 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118036.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence0412 3518 180 gene locus_tag LOCUS_20640 3518 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence0413 3073 476 gene locus_tag LOCUS_20650 3073 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0414 <1 514 gene locus_tag LOCUS_20660 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391496.1:AAA family ATPase 2519 1221 gene locus_tag LOCUS_20670 2519 1221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_20670 3916 2876 gene locus_tag LOCUS_20680 3916 2876 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922462.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence0415 487 353 gene locus_tag LOCUS_20690 487 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 686 474 gene locus_tag LOCUS_20700 686 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2034 1078 gene locus_tag LOCUS_20710 2034 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2880 2533 gene locus_tag LOCUS_20720 2880 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4112 2931 gene locus_tag LOCUS_20730 4112 2931 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence0416 16 1062 gene locus_tag LOCUS_20740 gene cmr4 16 1062 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_20740 1071 1502 gene locus_tag LOCUS_20750 1071 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1504 4068 gene locus_tag LOCUS_20760 1504 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0417 <1 1344 gene locus_tag LOCUS_20770 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861665.1:single-stranded-DNA-specific exonuclease RecJ 1356 3671 gene locus_tag LOCUS_20780 1356 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence0418 1064 387 gene locus_tag LOCUS_20790 1064 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3033 1258 gene locus_tag LOCUS_20800 3033 1258 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_20800 3875 3084 gene locus_tag LOCUS_20810 3875 3084 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136496851.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence0419 1772 144 gene locus_tag LOCUS_20820 1772 144 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_20820 3430 1886 gene locus_tag LOCUS_20830 3430 1886 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_20830 3683 3465 gene locus_tag LOCUS_20840 3683 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 4061 3891 gene locus_tag LOCUS_20850 4061 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0420 250 113 gene locus_tag LOCUS_20860 250 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 276 1622 gene locus_tag LOCUS_20870 276 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2467 1649 gene locus_tag LOCUS_20880 2467 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2919 2518 gene locus_tag LOCUS_20890 2919 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3348 2935 gene locus_tag LOCUS_20900 3348 2935 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269427.1 protein_id gnl|my_center|LOCUS_20900 4137 3445 gene locus_tag LOCUS_20910 4137 3445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence0421 1526 3 gene locus_tag LOCUS_20920 1526 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1839 1681 gene locus_tag LOCUS_20930 1839 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2301 2891 gene locus_tag LOCUS_20940 2301 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3357 3686 gene locus_tag LOCUS_20950 3357 3686 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_20950 3689 4093 gene locus_tag LOCUS_20960 3689 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20960 >Feature sequence0422 3670 665 gene locus_tag LOCUS_20970 3670 665 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence0423 <1 1377 gene locus_tag LOCUS_20980 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025814212.1:BatD family protein 1696 2475 gene locus_tag LOCUS_20990 1696 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3596 2472 gene locus_tag LOCUS_21000 3596 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3843 3918 gene locus_tag LOCUS_t00170 3843 3918 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0424 643 1737 gene locus_tag LOCUS_21010 gene mltG 643 1737 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880471.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence0425 <1 940 gene locus_tag LOCUS_21020 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_178940705.1:site-specific integrase 1109 1033 gene locus_tag LOCUS_t00180 1109 1033 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2316 1297 gene locus_tag LOCUS_21030 2316 1297 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_21030 3995 2676 gene locus_tag LOCUS_21040 3995 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 >Feature sequence0426 <1 1030 gene locus_tag LOCUS_21050 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930740.1:histidinol dehydrogenase 1060 1887 gene locus_tag LOCUS_21060 1060 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1878 2087 gene locus_tag LOCUS_21070 1878 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2072 2260 gene locus_tag LOCUS_21080 2072 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence0427 237 3392 gene locus_tag LOCUS_21090 237 3392 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839612.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence0428 3531 151 gene locus_tag LOCUS_21100 3531 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4063 3650 gene locus_tag LOCUS_21110 4063 3650 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence0429 181 609 gene locus_tag LOCUS_21120 181 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 727 1737 gene locus_tag LOCUS_21130 727 1737 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_21130 1738 2331 gene locus_tag LOCUS_21140 1738 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2403 3062 gene locus_tag LOCUS_21150 2403 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence0430 1244 2266 gene locus_tag LOCUS_21160 1244 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2710 3204 gene locus_tag LOCUS_21170 2710 3204 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_21170 3239 3466 gene locus_tag LOCUS_21180 3239 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence0431 1004 456 gene locus_tag LOCUS_21190 1004 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2725 1424 gene locus_tag LOCUS_21200 gene eno 2725 1424 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_21200 3759 2749 gene locus_tag LOCUS_21210 3759 2749 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence0432 1413 58 gene locus_tag LOCUS_21220 1413 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1709 1479 gene locus_tag LOCUS_21230 1709 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2201 3496 gene locus_tag LOCUS_21240 2201 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0433 830 2371 gene locus_tag LOCUS_21250 830 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2763 4037 gene locus_tag LOCUS_21260 gene ahcY 2763 4037 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence0434 782 501 gene locus_tag LOCUS_21270 782 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3577 953 gene locus_tag LOCUS_21280 gene ligD 3577 953 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105374724.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence0435 2090 366 gene locus_tag LOCUS_21290 2090 366 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_21290 3551 2601 gene locus_tag LOCUS_21300 3551 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0436 <1 1331 gene locus_tag LOCUS_21310 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122544.1:ThuA domain-containing protein 1374 1775 gene locus_tag LOCUS_21320 1374 1775 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_21320 3980 1845 gene locus_tag LOCUS_21330 3980 1845 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence0437 1622 102 gene locus_tag LOCUS_21340 gene atpA 1622 102 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_21340 2186 1650 gene locus_tag LOCUS_21350 gene atpH 2186 1650 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_21350 2842 2255 gene locus_tag LOCUS_21360 2842 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 3482 3003 gene locus_tag LOCUS_21370 3482 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3813 4118 gene locus_tag LOCUS_21380 3813 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0438 605 255 gene locus_tag LOCUS_21390 605 255 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_21390 2209 632 gene locus_tag LOCUS_21400 2209 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3074 2346 gene locus_tag LOCUS_21410 3074 2346 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403918.1 protein_id gnl|my_center|LOCUS_21410 3923 3213 gene locus_tag LOCUS_21420 3923 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence0439 3893 183 gene locus_tag LOCUS_21430 3893 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 >Feature sequence0440 1075 2094 gene locus_tag LOCUS_21440 gene aroF 1075 2094 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943764.1 protein_id gnl|my_center|LOCUS_21440 2558 2238 gene locus_tag LOCUS_21450 2558 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3488 2655 gene locus_tag LOCUS_21460 3488 2655 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence0441 2286 475 gene locus_tag LOCUS_21470 2286 475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_21470 3188 2319 gene locus_tag LOCUS_21480 3188 2319 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228806.1 protein_id gnl|my_center|LOCUS_21480 3899 3321 gene locus_tag LOCUS_21490 3899 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0442 1246 431 gene locus_tag LOCUS_21500 gene uppP 1246 431 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_21500 2992 1322 gene locus_tag LOCUS_21510 2992 1322 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_21510 3898 3086 gene locus_tag LOCUS_21520 gene rsmA 3898 3086 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942509.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence0443 >Feature sequence0444 1467 157 gene locus_tag LOCUS_21530 1467 157 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_21530 2634 1612 gene locus_tag LOCUS_21540 2634 1612 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_21540 3578 2754 gene locus_tag LOCUS_21550 3578 2754 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence0445 2918 78 gene locus_tag LOCUS_21560 2918 78 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_21560 3554 4048 gene locus_tag LOCUS_21570 3554 4048 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0446 1851 451 gene locus_tag LOCUS_21580 1851 451 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_21580 <4054 1853 gene locus_tag LOCUS_21590 <4054 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532875.1:multidrug efflux RND transporter permease subunit >Feature sequence0447 256 843 gene locus_tag LOCUS_21600 gene thpR 256 843 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_21600 2920 920 gene locus_tag LOCUS_21610 2920 920 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_21610 3151 3924 gene locus_tag LOCUS_21620 3151 3924 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence0448 1243 914 gene locus_tag LOCUS_21630 1243 914 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_21630 1426 2838 gene locus_tag LOCUS_21640 1426 2838 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_21640 2901 3182 gene locus_tag LOCUS_21650 2901 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3315 3196 gene locus_tag LOCUS_21660 3315 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 4021 3524 gene locus_tag LOCUS_21670 4021 3524 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence0449 1020 502 gene locus_tag LOCUS_21680 1020 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2411 1377 gene locus_tag LOCUS_21690 2411 1377 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_21690 2770 3234 gene locus_tag LOCUS_21700 2770 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3861 3376 gene locus_tag LOCUS_21710 3861 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence0450 476 303 gene locus_tag LOCUS_21720 476 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1001 549 gene locus_tag LOCUS_21730 1001 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2112 967 gene locus_tag LOCUS_21740 2112 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2413 2291 gene locus_tag LOCUS_21750 2413 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 <4036 2893 gene locus_tag LOCUS_21760 <4036 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141168.1:glucosidase >Feature sequence0451 540 1181 gene locus_tag LOCUS_21770 540 1181 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159676.1 protein_id gnl|my_center|LOCUS_21770 1157 1525 gene locus_tag LOCUS_21780 1157 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1501 2124 gene locus_tag LOCUS_21790 1501 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2869 2159 gene locus_tag LOCUS_21800 2869 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 <4034 2875 gene locus_tag LOCUS_21810 <4034 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015051728.1:D-aminoacylase >Feature sequence0452 153 1670 gene locus_tag LOCUS_21820 153 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3967 1808 gene locus_tag LOCUS_21830 3967 1808 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence0453 479 180 gene locus_tag LOCUS_21840 479 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 788 1678 gene locus_tag LOCUS_21850 788 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1593 3842 gene locus_tag LOCUS_21860 1593 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence0454 1622 243 gene locus_tag LOCUS_21870 1622 243 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_21870 1983 2897 gene locus_tag LOCUS_21880 1983 2897 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520529.1 protein_id gnl|my_center|LOCUS_21880 3024 2869 gene locus_tag LOCUS_21890 3024 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence0455 1469 3070 gene locus_tag LOCUS_21900 1469 3070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence0456 914 138 gene locus_tag LOCUS_21910 914 138 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121332.1 protein_id gnl|my_center|LOCUS_21910 2432 930 gene locus_tag LOCUS_21920 2432 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3563 2742 gene locus_tag LOCUS_21930 3563 2742 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527984.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0457 2035 788 gene locus_tag LOCUS_21940 2035 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3315 2038 gene locus_tag LOCUS_21950 3315 2038 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0458 2883 976 gene locus_tag LOCUS_21960 2883 976 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942806.1 protein_id gnl|my_center|LOCUS_21960 2930 3157 gene locus_tag LOCUS_21970 2930 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence0459 935 675 gene locus_tag LOCUS_21980 935 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1225 932 gene locus_tag LOCUS_21990 1225 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2352 1300 gene locus_tag LOCUS_22000 2352 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3269 2364 gene locus_tag LOCUS_22010 3269 2364 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_22010 3545 3895 gene locus_tag LOCUS_22020 3545 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence0460 1544 711 gene locus_tag LOCUS_22030 1544 711 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 protein_id gnl|my_center|LOCUS_22030 1829 2068 gene locus_tag LOCUS_22040 1829 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2619 2197 gene locus_tag LOCUS_22050 2619 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence0461 66 911 gene locus_tag LOCUS_22060 66 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1383 3536 gene locus_tag LOCUS_22070 1383 3536 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_22070 3901 3710 gene locus_tag LOCUS_22080 gene rpmB 3901 3710 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence0462 931 65 gene locus_tag LOCUS_22090 931 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2134 965 gene locus_tag LOCUS_22100 gene alaC 2134 965 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_22100 3244 2291 gene locus_tag LOCUS_22110 3244 2291 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644304.1 protein_id gnl|my_center|LOCUS_22110 <3981 3351 gene locus_tag LOCUS_22120 <3981 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170324985.1:xylulokinase >Feature sequence0463 <1 510 gene locus_tag LOCUS_22130 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973318.1:glutamate synthase large subunit 711 2147 gene locus_tag LOCUS_22140 711 2147 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_22140 2444 3238 gene locus_tag LOCUS_22150 gene fdnH 2444 3238 CDS product formate dehydrogenase N subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240582.1 protein_id gnl|my_center|LOCUS_22150 3225 3845 gene locus_tag LOCUS_22160 3225 3845 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence0464 1135 1287 gene locus_tag LOCUS_22170 1135 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1268 1492 gene locus_tag LOCUS_22180 1268 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2313 3272 gene locus_tag LOCUS_22190 2313 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence0465 1230 481 gene locus_tag LOCUS_22200 1230 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3957 1315 gene locus_tag LOCUS_22210 3957 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence0466 1603 299 gene locus_tag LOCUS_22220 1603 299 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_22220 2035 1709 gene locus_tag LOCUS_22230 gene trxA 2035 1709 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_22230 2180 2061 gene locus_tag LOCUS_22240 2180 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3825 2398 gene locus_tag LOCUS_22250 gene glgA 3825 2398 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence0467 411 2729 gene locus_tag LOCUS_22260 411 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2741 3877 gene locus_tag LOCUS_22270 2741 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence0468 2337 3560 gene locus_tag LOCUS_22280 2337 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence0469 785 75 gene locus_tag LOCUS_22290 785 75 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_22290 1570 785 gene locus_tag LOCUS_22300 1570 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_22300 1827 2495 gene locus_tag LOCUS_22310 gene mtnX 1827 2495 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence0470 316 675 gene locus_tag LOCUS_22320 316 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 824 2770 gene locus_tag LOCUS_22330 824 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3025 2903 gene locus_tag LOCUS_22340 3025 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3811 3302 gene locus_tag LOCUS_22350 3811 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0471 124 408 gene locus_tag LOCUS_22360 124 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 435 932 gene locus_tag LOCUS_22370 435 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1124 2110 gene locus_tag LOCUS_22380 1124 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3202 2711 gene locus_tag LOCUS_22390 3202 2711 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_22390 3465 3199 gene locus_tag LOCUS_22400 3465 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence0472 2634 133 gene locus_tag LOCUS_22410 2634 133 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_22410 <3927 2880 gene locus_tag LOCUS_22420 <3927 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937745.1:efflux RND transporter permease subunit >Feature sequence0473 955 779 gene locus_tag LOCUS_22430 955 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2406 1417 gene locus_tag LOCUS_22440 2406 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3611 2703 gene locus_tag LOCUS_22450 3611 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0474 641 868 gene locus_tag LOCUS_22460 641 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3473 846 gene locus_tag LOCUS_22470 3473 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence0475 3869 102 gene locus_tag LOCUS_22480 3869 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0476 997 1158 gene locus_tag LOCUS_22490 997 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2363 1335 gene locus_tag LOCUS_22500 2363 1335 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873294.1 protein_id gnl|my_center|LOCUS_22500 2623 3438 gene locus_tag LOCUS_22510 2623 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0477 256 1071 gene locus_tag LOCUS_22520 256 1071 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_22520 2068 2952 gene locus_tag LOCUS_22530 2068 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence0478 408 1655 gene locus_tag LOCUS_22540 gene lysA 408 1655 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_22540 1785 3260 gene locus_tag LOCUS_22550 1785 3260 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_22550 3727 3278 gene locus_tag LOCUS_22560 3727 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence0479 1020 154 gene locus_tag LOCUS_22570 1020 154 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_22570 1250 1474 gene locus_tag LOCUS_22580 1250 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 1917 1507 gene locus_tag LOCUS_22590 1917 1507 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_22590 2173 1898 gene locus_tag LOCUS_22600 2173 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2400 2254 gene locus_tag LOCUS_22610 2400 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3772 2474 gene locus_tag LOCUS_22620 3772 2474 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence0480 3859 2957 gene locus_tag LOCUS_22630 3859 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence0481 233 2521 gene locus_tag LOCUS_22640 233 2521 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0482 2343 94 gene locus_tag LOCUS_22650 2343 94 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence0483 264 1163 gene locus_tag LOCUS_22660 264 1163 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_22660 1346 2422 gene locus_tag LOCUS_22670 1346 2422 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_22670 3075 2446 gene locus_tag LOCUS_22680 gene gpmB 3075 2446 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209230.1 protein_id gnl|my_center|LOCUS_22680 3899 3267 gene locus_tag LOCUS_22690 3899 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence0484 157 846 gene locus_tag LOCUS_22700 157 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 875 1501 gene locus_tag LOCUS_22710 875 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1513 2433 gene locus_tag LOCUS_22720 1513 2433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_22720 2430 3284 gene locus_tag LOCUS_22730 2430 3284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_22730 <3892 3273 gene locus_tag LOCUS_22740 <3892 3273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249310.1:ABC transporter ATP-binding protein >Feature sequence0485 1329 802 gene locus_tag LOCUS_22750 1329 802 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_22750 2485 1445 gene locus_tag LOCUS_22760 2485 1445 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_22760 3288 2563 gene locus_tag LOCUS_22770 3288 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0486 108 2852 gene locus_tag LOCUS_22780 108 2852 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942671.1 protein_id gnl|my_center|LOCUS_22780 3124 3483 gene locus_tag LOCUS_22790 3124 3483 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_22790 3728 3540 gene locus_tag LOCUS_22800 3728 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence0487 273 740 gene locus_tag LOCUS_22810 273 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 795 2642 gene locus_tag LOCUS_22820 795 2642 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_22820 2786 3829 gene locus_tag LOCUS_22830 2786 3829 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence0488 1495 827 gene locus_tag LOCUS_22840 1495 827 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_22840 3374 1650 gene locus_tag LOCUS_22850 3374 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence0489 <1 932 gene locus_tag LOCUS_22860 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926821.1:glycosyltransferase 1065 913 gene locus_tag LOCUS_22870 1065 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1161 1901 gene locus_tag LOCUS_22880 1161 1901 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583389.1 protein_id gnl|my_center|LOCUS_22880 2013 3311 gene locus_tag LOCUS_22890 2013 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0490 1039 464 gene locus_tag LOCUS_22900 1039 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3436 1169 gene locus_tag LOCUS_22910 3436 1169 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0491 1168 2733 gene locus_tag LOCUS_22920 1168 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3205 3540 gene locus_tag LOCUS_22930 3205 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence0492 2308 1865 gene locus_tag LOCUS_22940 2308 1865 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412970.1 protein_id gnl|my_center|LOCUS_22940 2520 2305 gene locus_tag LOCUS_22950 2520 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3861 2710 gene locus_tag LOCUS_22960 3861 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence0493 737 1486 gene locus_tag LOCUS_22970 gene fabG 737 1486 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_22970 1483 2658 gene locus_tag LOCUS_22980 gene dgoD 1483 2658 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence0494 >Feature sequence0495 3796 2057 gene locus_tag LOCUS_22990 3796 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence0496 1640 678 gene locus_tag LOCUS_23000 1640 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2412 1666 gene locus_tag LOCUS_23010 2412 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2919 2503 gene locus_tag LOCUS_23020 2919 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3454 2903 gene locus_tag LOCUS_23030 3454 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence0497 >Feature sequence0498 <1 1156 gene locus_tag LOCUS_23040 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088779.1:MFS transporter 1420 2256 gene locus_tag LOCUS_23050 1420 2256 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461125.1 protein_id gnl|my_center|LOCUS_23050 2275 3033 gene locus_tag LOCUS_23060 2275 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814087.1 protein_id gnl|my_center|LOCUS_23060 3034 3282 gene locus_tag LOCUS_23070 3034 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3230 3679 gene locus_tag LOCUS_23080 3230 3679 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence0499 99 1340 gene locus_tag LOCUS_23090 gene hemA 99 1340 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_23090 1514 2446 gene locus_tag LOCUS_23100 gene hemC 1514 2446 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_23100 2560 3600 gene locus_tag LOCUS_23110 2560 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence0500 486 163 gene locus_tag LOCUS_23120 486 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2672 510 gene locus_tag LOCUS_23130 gene bcrD 2672 510 CDS product SctV family type III secretion system export apparatus subunit BcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930831.1 protein_id gnl|my_center|LOCUS_23130 3135 2749 gene locus_tag LOCUS_23140 3135 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3622 3164 gene locus_tag LOCUS_23150 3622 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0501 1246 497 gene locus_tag LOCUS_23160 1246 497 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530348.1 protein_id gnl|my_center|LOCUS_23160 1409 1284 gene locus_tag LOCUS_23170 1409 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2273 1446 gene locus_tag LOCUS_23180 2273 1446 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_23180 3530 2337 gene locus_tag LOCUS_23190 3530 2337 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence0502 3484 182 gene locus_tag LOCUS_23200 3484 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence0503 207 461 gene locus_tag LOCUS_23210 207 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2249 2524 gene locus_tag LOCUS_23220 2249 2524 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_23220 2487 2774 gene locus_tag LOCUS_23230 2487 2774 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_23230 3106 3273 gene locus_tag LOCUS_23240 3106 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence0504 679 233 gene locus_tag LOCUS_23250 679 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1115 669 gene locus_tag LOCUS_23260 1115 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 <3801 1349 gene locus_tag LOCUS_23270 <3801 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765900.1:carboxypeptidase regulatory-like domain-containing protein >Feature sequence0505 44 487 gene locus_tag LOCUS_23280 44 487 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_23280 504 2054 gene locus_tag LOCUS_23290 504 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0506 297 1031 gene locus_tag LOCUS_23300 297 1031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_23300 1258 3765 gene locus_tag LOCUS_23310 1258 3765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence0507 221 880 gene locus_tag LOCUS_23320 221 880 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_23320 941 1549 gene locus_tag LOCUS_23330 gene lexA 941 1549 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_23330 1652 2059 gene locus_tag LOCUS_23340 1652 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2141 2407 gene locus_tag LOCUS_23350 2141 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 <3786 2554 gene locus_tag LOCUS_23360 <3786 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403544.1:S41 family peptidase >Feature sequence0508 98 313 gene locus_tag LOCUS_23370 98 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1974 529 gene locus_tag LOCUS_23380 1974 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3453 2080 gene locus_tag LOCUS_23390 3453 2080 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence0509 699 2543 gene locus_tag LOCUS_23400 699 2543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_23400 3744 2845 gene locus_tag LOCUS_23410 3744 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence0510 991 305 gene locus_tag LOCUS_23420 991 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0511 49 420 gene locus_tag LOCUS_23430 49 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 411 487 gene locus_tag LOCUS_t00190 411 487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1004 567 gene locus_tag LOCUS_23440 1004 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1539 2405 gene locus_tag LOCUS_23450 1539 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2477 3427 gene locus_tag LOCUS_23460 2477 3427 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393090.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence0512 1979 954 gene locus_tag LOCUS_23470 1979 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2680 2009 gene locus_tag LOCUS_23480 2680 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence0513 160 966 gene locus_tag LOCUS_23490 160 966 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 protein_id gnl|my_center|LOCUS_23490 1106 2224 gene locus_tag LOCUS_23500 1106 2224 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_23500 3525 2608 gene locus_tag LOCUS_23510 3525 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence0514 1520 474 gene locus_tag LOCUS_23520 1520 474 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_23520 3355 1616 gene locus_tag LOCUS_23530 3355 1616 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence0515 1175 1660 gene locus_tag LOCUS_23540 1175 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1697 3457 gene locus_tag LOCUS_23550 1697 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23550 >Feature sequence0516 123 1400 gene locus_tag LOCUS_23560 123 1400 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_23560 1397 2734 gene locus_tag LOCUS_23570 1397 2734 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_23570 3492 2806 gene locus_tag LOCUS_23580 3492 2806 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142952.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence0517 369 2255 gene locus_tag LOCUS_23590 369 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 2245 3126 gene locus_tag LOCUS_23600 2245 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence0518 1362 397 gene locus_tag LOCUS_23610 gene thyX 1362 397 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597389.1 protein_id gnl|my_center|LOCUS_23610 2909 1569 gene locus_tag LOCUS_23620 2909 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 <3751 3059 gene locus_tag LOCUS_23630 <3751 3059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054949791.1:DUF2339 domain-containing protein >Feature sequence0519 576 217 gene locus_tag LOCUS_23640 576 217 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_23640 2666 573 gene locus_tag LOCUS_23650 2666 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3446 2958 gene locus_tag LOCUS_23660 3446 2958 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0520 <3739 2487 gene locus_tag LOCUS_23670 <3739 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804130.1:iron ABC transporter permease >Feature sequence0521 1017 511 gene locus_tag LOCUS_23680 1017 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1549 1046 gene locus_tag LOCUS_23690 1549 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1956 1528 gene locus_tag LOCUS_23700 1956 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2339 1962 gene locus_tag LOCUS_23710 2339 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2702 2394 gene locus_tag LOCUS_23720 2702 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3030 3179 gene locus_tag LOCUS_23730 3030 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 3276 3674 gene locus_tag LOCUS_23740 3276 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0522 526 149 gene locus_tag LOCUS_23750 gene folB 526 149 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262834.1 protein_id gnl|my_center|LOCUS_23750 1091 579 gene locus_tag LOCUS_23760 1091 579 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_23760 1553 1095 gene locus_tag LOCUS_23770 1553 1095 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_23770 2475 3044 gene locus_tag LOCUS_23780 2475 3044 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986716.1 protein_id gnl|my_center|LOCUS_23780 3117 3533 gene locus_tag LOCUS_23790 3117 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence0523 3563 15 gene locus_tag LOCUS_23800 3563 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence0524 1078 3486 gene locus_tag LOCUS_23810 1078 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 >Feature sequence0525 1742 63 gene locus_tag LOCUS_23820 1742 63 CDS product acyl--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479594.1 protein_id gnl|my_center|LOCUS_23820 2250 3653 gene locus_tag LOCUS_23830 2250 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence0526 <1 812 gene locus_tag LOCUS_23840 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966153.1:adenylate/guanylate cyclase domain-containing protein 1313 966 gene locus_tag LOCUS_23850 1313 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2994 1717 gene locus_tag LOCUS_23860 2994 1717 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence0527 718 122 gene locus_tag LOCUS_23870 718 122 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0528 841 158 gene locus_tag LOCUS_23880 841 158 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100797.1 protein_id gnl|my_center|LOCUS_23880 2456 834 gene locus_tag LOCUS_23890 gene ctaD 2456 834 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_23890 3454 2453 gene locus_tag LOCUS_23900 gene coxB 3454 2453 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence0529 503 114 gene locus_tag LOCUS_23910 gene rplL 503 114 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_23910 1077 553 gene locus_tag LOCUS_23920 gene rplJ 1077 553 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_23920 1936 1244 gene locus_tag LOCUS_23930 gene rplA 1936 1244 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_23930 2377 1946 gene locus_tag LOCUS_23940 gene rplK 2377 1946 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943497.1 protein_id gnl|my_center|LOCUS_23940 2970 2440 gene locus_tag LOCUS_23950 gene nusG 2970 2440 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_23950 3209 3003 gene locus_tag LOCUS_23960 3209 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3346 3270 gene locus_tag LOCUS_t00200 3346 3270 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0530 2 373 gene locus_tag LOCUS_23970 2 373 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_23970 943 3585 gene locus_tag LOCUS_23980 943 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence0531 1231 896 gene locus_tag LOCUS_23990 1231 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2048 1320 gene locus_tag LOCUS_24000 2048 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 <3703 3113 gene locus_tag LOCUS_24010 <3703 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940735.1:CRISPR-associated endonuclease Cas1 >Feature sequence0532 2536 731 gene locus_tag LOCUS_24020 2536 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 <3702 2533 gene locus_tag LOCUS_24030 <3702 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083813.1:ABC transporter substrate-binding protein >Feature sequence0533 2796 1525 gene locus_tag LOCUS_24040 gene hisS 2796 1525 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_24040 3566 3051 gene locus_tag LOCUS_24050 3566 3051 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence0534 192 2945 gene locus_tag LOCUS_24060 192 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence0535 1039 2097 gene locus_tag LOCUS_24070 1039 2097 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_24070 2191 2508 gene locus_tag LOCUS_24080 2191 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2629 3540 gene locus_tag LOCUS_24090 2629 3540 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence0536 343 41 gene locus_tag LOCUS_24100 343 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 753 2279 gene locus_tag LOCUS_24110 753 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2594 3616 gene locus_tag LOCUS_24120 2594 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence0537 454 14 gene locus_tag LOCUS_24130 454 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1056 980 gene locus_tag LOCUS_t00210 1056 980 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2919 1444 gene locus_tag LOCUS_24140 2919 1444 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0538 >Feature sequence0539 74 1438 gene locus_tag LOCUS_24150 74 1438 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_24150 1532 1957 gene locus_tag LOCUS_24160 1532 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 <3688 2140 gene locus_tag LOCUS_24170 <3688 2140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048163.1:2-hydroxyacyl-CoA dehydratase >Feature sequence0540 2800 230 gene locus_tag LOCUS_24180 2800 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 3684 2797 gene locus_tag LOCUS_24190 3684 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0541 243 2951 gene locus_tag LOCUS_24200 243 2951 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence0542 1098 13 gene locus_tag LOCUS_24210 gene mqnC 1098 13 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_24210 3306 1471 gene locus_tag LOCUS_24220 3306 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence0543 >Feature sequence0544 950 360 gene locus_tag LOCUS_24230 950 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2765 1419 gene locus_tag LOCUS_24240 gene ltrA 2765 1419 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence0545 1986 574 gene locus_tag LOCUS_24250 gene mtaB 1986 574 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_24250 3243 2200 gene locus_tag LOCUS_24260 3243 2200 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048382.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence0546 1953 1423 gene locus_tag LOCUS_24270 gene tssB 1953 1423 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973761.1 protein_id gnl|my_center|LOCUS_24270 3110 2019 gene locus_tag LOCUS_24280 gene tssA 3110 2019 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence0547 686 519 gene locus_tag LOCUS_24290 686 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1590 2585 gene locus_tag LOCUS_24300 1590 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2891 3079 gene locus_tag LOCUS_24310 2891 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3079 3378 gene locus_tag LOCUS_24320 3079 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence0548 983 243 gene locus_tag LOCUS_24330 983 243 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868936.1 protein_id gnl|my_center|LOCUS_24330 1203 2126 gene locus_tag LOCUS_24340 1203 2126 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_24340 2231 3229 gene locus_tag LOCUS_24350 2231 3229 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence0549 1632 604 gene locus_tag LOCUS_24360 1632 604 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_24360 2074 1664 gene locus_tag LOCUS_24370 2074 1664 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_24370 2454 2197 gene locus_tag LOCUS_24380 2454 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 <3647 2755 gene locus_tag LOCUS_24390 <3647 2755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403955.1:sigma-54 dependent transcriptional regulator >Feature sequence0550 2021 675 gene locus_tag LOCUS_24400 2021 675 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_24400 2417 2082 gene locus_tag LOCUS_24410 2417 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2644 2417 gene locus_tag LOCUS_24420 2644 2417 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096582717.1 protein_id gnl|my_center|LOCUS_24420 <3642 2731 gene locus_tag LOCUS_24430 <3642 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869759.1:cysteine--tRNA ligase >Feature sequence0551 411 761 gene locus_tag LOCUS_24440 411 761 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 protein_id gnl|my_center|LOCUS_24440 1679 918 gene locus_tag LOCUS_24450 1679 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1833 1663 gene locus_tag LOCUS_24460 1833 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 <3638 1960 gene locus_tag LOCUS_24470 <3638 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811674.1:rhomboid family intramembrane serine protease >Feature sequence0552 177 959 gene locus_tag LOCUS_24480 177 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1338 1772 gene locus_tag LOCUS_24490 1338 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1851 2018 gene locus_tag LOCUS_24500 1851 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2501 2133 gene locus_tag LOCUS_24510 2501 2133 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_24510 <3637 2638 gene locus_tag LOCUS_24520 <3637 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037676.1:NAD(P)-binding domain-containing protein >Feature sequence0553 <3636 1413 gene locus_tag LOCUS_24530 <3636 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229541.1:endonuclease MutS2 >Feature sequence0554 108 338 gene locus_tag LOCUS_24540 108 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 335 871 gene locus_tag LOCUS_24550 335 871 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_24550 868 3342 gene locus_tag LOCUS_24560 868 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence0555 392 99 gene locus_tag LOCUS_24570 392 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1115 1429 gene locus_tag LOCUS_24580 1115 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1430 2314 gene locus_tag LOCUS_24590 1430 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2429 2761 gene locus_tag LOCUS_24600 2429 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence0556 283 107 gene locus_tag LOCUS_24610 283 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 898 305 gene locus_tag LOCUS_24620 898 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 1322 912 gene locus_tag LOCUS_24630 1322 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24630 2288 1584 gene locus_tag LOCUS_24640 2288 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2966 2814 gene locus_tag LOCUS_24650 2966 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence0557 662 240 gene locus_tag LOCUS_24660 662 240 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_24660 892 659 gene locus_tag LOCUS_24670 892 659 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_24670 857 1111 gene locus_tag LOCUS_24680 857 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1217 1429 gene locus_tag LOCUS_24690 1217 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1945 1382 gene locus_tag LOCUS_24700 1945 1382 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_24700 3504 1993 gene locus_tag LOCUS_24710 3504 1993 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009958659.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence0558 186 884 gene locus_tag LOCUS_24720 186 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 881 1399 gene locus_tag LOCUS_24730 gene casB 881 1399 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_24730 1396 2556 gene locus_tag LOCUS_24740 gene cas7e 1396 2556 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_24740 2560 3258 gene locus_tag LOCUS_24750 gene cas5e 2560 3258 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence0559 236 535 gene locus_tag LOCUS_24760 236 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 620 2581 gene locus_tag LOCUS_24770 gene dxs 620 2581 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_24770 2578 3387 gene locus_tag LOCUS_24780 2578 3387 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence0560 <1 1923 gene locus_tag LOCUS_24790 <1 1923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902151.1:alkaline phosphatase family protein 2039 2236 gene locus_tag LOCUS_24800 2039 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 3055 2441 gene locus_tag LOCUS_24810 3055 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3510 3340 gene locus_tag LOCUS_24820 3510 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence0561 650 342 gene locus_tag LOCUS_24830 650 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3421 830 gene locus_tag LOCUS_24840 3421 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence0562 1045 98 gene locus_tag LOCUS_24850 1045 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 <3610 1065 gene locus_tag LOCUS_24860 <3610 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244431.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence0563 12 239 gene locus_tag LOCUS_24870 12 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1023 361 gene locus_tag LOCUS_24880 1023 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 <3610 1724 gene locus_tag LOCUS_24890 <3610 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:class I SAM-dependent DNA methyltransferase >Feature sequence0564 225 1466 gene locus_tag LOCUS_24900 gene fabF 225 1466 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_24900 1469 2416 gene locus_tag LOCUS_24910 1469 2416 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_24910 2735 2451 gene locus_tag LOCUS_24920 2735 2451 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_24920 >Feature sequence0565 <1 2093 gene locus_tag LOCUS_24930 <1 2093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933260.1:alpha-glucan family phosphorylase <3597 2301 gene locus_tag LOCUS_24940 <3597 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393799.1:ATP-binding protein >Feature sequence0566 1 333 gene locus_tag LOCUS_24950 1 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 330 653 gene locus_tag LOCUS_24960 330 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 655 1578 gene locus_tag LOCUS_24970 655 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1475 2575 gene locus_tag LOCUS_24980 1475 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence0567 362 1153 gene locus_tag LOCUS_24990 362 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 1219 1503 gene locus_tag LOCUS_25000 1219 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 2236 3444 gene locus_tag LOCUS_25010 2236 3444 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence0568 169 456 gene locus_tag LOCUS_25020 169 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 983 489 gene locus_tag LOCUS_25030 983 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1464 910 gene locus_tag LOCUS_25040 1464 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence0569 <1 1925 gene locus_tag LOCUS_25050 <1 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:TonB-dependent receptor 2085 2432 gene locus_tag LOCUS_25060 2085 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence0570 1133 360 gene locus_tag LOCUS_25070 1133 360 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_25070 2171 1194 gene locus_tag LOCUS_25080 2171 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3297 2173 gene locus_tag LOCUS_25090 3297 2173 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence0571 1079 357 gene locus_tag LOCUS_25100 1079 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1622 1128 gene locus_tag LOCUS_25110 1622 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2159 1890 gene locus_tag LOCUS_25120 2159 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2384 2238 gene locus_tag LOCUS_25130 2384 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2957 2715 gene locus_tag LOCUS_25140 2957 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence0572 2436 163 gene locus_tag LOCUS_25150 2436 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 <3565 2747 gene locus_tag LOCUS_25160 <3565 2747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000148531.1:sigma-54-dependent response regulator transcription factor ZraR >Feature sequence0573 383 808 gene locus_tag LOCUS_25170 383 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1132 2130 gene locus_tag LOCUS_25180 1132 2130 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_25180 2179 3294 gene locus_tag LOCUS_25190 2179 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence0574 1357 1608 gene locus_tag LOCUS_25200 1357 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2089 2334 gene locus_tag LOCUS_25210 2089 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2331 2642 gene locus_tag LOCUS_25220 2331 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2639 3199 gene locus_tag LOCUS_25230 2639 3199 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence0575 2054 246 gene locus_tag LOCUS_25240 2054 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 2278 2051 gene locus_tag LOCUS_25250 2278 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2655 2437 gene locus_tag LOCUS_25260 2655 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 3353 2655 gene locus_tag LOCUS_25270 3353 2655 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0576 275 78 gene locus_tag LOCUS_25280 275 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3142 557 gene locus_tag LOCUS_25290 3142 557 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence0577 1321 125 gene locus_tag LOCUS_25300 1321 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25300 1844 1311 gene locus_tag LOCUS_25310 1844 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25310 2323 1937 gene locus_tag LOCUS_25320 2323 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3347 2328 gene locus_tag LOCUS_25330 3347 2328 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence0578 327 539 gene locus_tag LOCUS_25340 327 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2038 632 gene locus_tag LOCUS_25350 2038 632 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_25350 3141 2035 gene locus_tag LOCUS_25360 3141 2035 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence0579 790 71 gene locus_tag LOCUS_25370 790 71 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_25370 1161 1880 gene locus_tag LOCUS_25380 1161 1880 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_25380 2041 3447 gene locus_tag LOCUS_25390 gene lutB 2041 3447 CDS product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence0580 799 1833 gene locus_tag LOCUS_25400 799 1833 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_25400 2007 2297 gene locus_tag LOCUS_25410 2007 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3427 2423 gene locus_tag LOCUS_25420 3427 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence0581 1543 512 gene locus_tag LOCUS_25430 1543 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1901 3133 gene locus_tag LOCUS_25440 gene gltS 1901 3133 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence0582 1370 309 gene locus_tag LOCUS_25450 gene hrcA 1370 309 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_25450 2397 1552 gene locus_tag LOCUS_25460 gene lipM 2397 1552 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_25460 3519 2407 gene locus_tag LOCUS_25470 gene ald 3519 2407 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence0583 254 1504 gene locus_tag LOCUS_25480 254 1504 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_25480 1576 2391 gene locus_tag LOCUS_25490 1576 2391 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_25490 2388 3326 gene locus_tag LOCUS_25500 2388 3326 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence0584 75 1943 gene locus_tag LOCUS_25510 75 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0585 1050 103 gene locus_tag LOCUS_25520 1050 103 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_25520 2696 1299 gene locus_tag LOCUS_25530 2696 1299 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009982187.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence0586 1128 112 gene locus_tag LOCUS_25540 1128 112 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_25540 1451 2335 gene locus_tag LOCUS_25550 gene truA 1451 2335 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528473.1 protein_id gnl|my_center|LOCUS_25550 3376 2498 gene locus_tag LOCUS_25560 gene garR 3376 2498 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence0587 971 72 gene locus_tag LOCUS_25570 971 72 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_25570 2658 1063 gene locus_tag LOCUS_25580 gene malQ 2658 1063 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_25580 3263 2655 gene locus_tag LOCUS_25590 3263 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3485 3282 gene locus_tag LOCUS_25600 3485 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0588 315 686 gene locus_tag LOCUS_25610 315 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 941 1029 gene locus_tag LOCUS_t00220 941 1029 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1738 3201 gene locus_tag LOCUS_25620 1738 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence0589 50 442 gene locus_tag LOCUS_25630 50 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 533 2029 gene locus_tag LOCUS_25640 533 2029 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_25640 2373 3419 gene locus_tag LOCUS_25650 2373 3419 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence0590 155 1405 gene locus_tag LOCUS_25660 155 1405 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165034430.1 protein_id gnl|my_center|LOCUS_25660 1402 2403 gene locus_tag LOCUS_25670 1402 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2400 3413 gene locus_tag LOCUS_25680 2400 3413 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128948541.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence0591 279 2147 gene locus_tag LOCUS_25690 279 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2678 2373 gene locus_tag LOCUS_25700 2678 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 3070 2945 gene locus_tag LOCUS_25710 3070 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 3179 3039 gene locus_tag LOCUS_25720 3179 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25720 >Feature sequence0592 >Feature sequence0593 3285 805 gene locus_tag LOCUS_25730 gene gyrB 3285 805 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence0594 <1 1289 gene locus_tag LOCUS_25740 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003289.1:S41 family peptidase 1352 3181 gene locus_tag LOCUS_25750 1352 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence0595 1100 1231 gene locus_tag LOCUS_25760 1100 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 1678 2892 gene locus_tag LOCUS_25770 gene der 1678 2892 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_25770 2909 3304 gene locus_tag LOCUS_25780 2909 3304 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_25780 3320 3396 gene locus_tag LOCUS_t00230 3320 3396 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0596 438 148 gene locus_tag LOCUS_25790 438 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 829 467 gene locus_tag LOCUS_25800 829 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 824 1372 gene locus_tag LOCUS_25810 824 1372 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966726.1 protein_id gnl|my_center|LOCUS_25810 1401 3245 gene locus_tag LOCUS_25820 gene ftsH 1401 3245 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence0597 417 590 gene locus_tag LOCUS_25830 417 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1034 1348 gene locus_tag LOCUS_25840 1034 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1736 2914 gene locus_tag LOCUS_25850 gene thiO 1736 2914 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_25850 3195 3013 gene locus_tag LOCUS_25860 3195 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence0598 74 1144 gene locus_tag LOCUS_25870 gene asd 74 1144 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_25870 1159 1521 gene locus_tag LOCUS_25880 1159 1521 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_25880 2543 1899 gene locus_tag LOCUS_25890 2543 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence0599 1040 282 gene locus_tag LOCUS_25900 1040 282 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_25900 1599 1414 gene locus_tag LOCUS_25910 1599 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2164 1778 gene locus_tag LOCUS_25920 2164 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2906 3226 gene locus_tag LOCUS_25930 2906 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence0600 1130 282 gene locus_tag LOCUS_25940 gene murI 1130 282 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768855.1 protein_id gnl|my_center|LOCUS_25940 1283 2536 gene locus_tag LOCUS_25950 gene nusA 1283 2536 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence0601 1666 617 gene locus_tag LOCUS_25960 1666 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3003 1885 gene locus_tag LOCUS_25970 3003 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence0602 1026 268 gene locus_tag LOCUS_25980 1026 268 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_25980 3248 1101 gene locus_tag LOCUS_25990 3248 1101 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence0603 3158 498 gene locus_tag LOCUS_26000 3158 498 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence0604 2169 664 gene locus_tag LOCUS_26010 2169 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2854 3207 gene locus_tag LOCUS_26020 2854 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943106.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence0605 589 750 gene locus_tag LOCUS_26030 589 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 936 2834 gene locus_tag LOCUS_26040 936 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 >Feature sequence0606 <1 1104 gene locus_tag LOCUS_26050 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001249680.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB 1418 1969 gene locus_tag LOCUS_26060 1418 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence0607 225 560 gene locus_tag LOCUS_26070 225 560 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 protein_id gnl|my_center|LOCUS_26070 564 1439 gene locus_tag LOCUS_26080 564 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1421 1711 gene locus_tag LOCUS_26090 1421 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 2396 1995 gene locus_tag LOCUS_26100 2396 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 2749 2396 gene locus_tag LOCUS_26110 2749 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2976 2746 gene locus_tag LOCUS_26120 2976 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3260 3051 gene locus_tag LOCUS_26130 3260 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 >Feature sequence0608 185 1225 gene locus_tag LOCUS_26140 gene tdh 185 1225 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646019.1 protein_id gnl|my_center|LOCUS_26140 2426 1344 gene locus_tag LOCUS_26150 2426 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3044 2433 gene locus_tag LOCUS_26160 3044 2433 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence0609 121 1626 gene locus_tag LOCUS_26170 121 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence0610 13 507 gene locus_tag LOCUS_26180 13 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence0611 546 319 gene locus_tag LOCUS_26190 546 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 929 681 gene locus_tag LOCUS_26200 929 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1639 941 gene locus_tag LOCUS_26210 gene purQ 1639 941 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_26210 2250 1990 gene locus_tag LOCUS_26220 gene purS 2250 1990 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_26220 <3423 2275 gene locus_tag LOCUS_26230 <3423 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817240.1:adenylosuccinate lyase >Feature sequence0612 >Feature sequence0613 >Feature sequence0614 <1 1386 gene locus_tag LOCUS_26240 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003120048.1:ATP-binding protein >Feature sequence0615 1249 548 gene locus_tag LOCUS_26250 1249 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1869 1255 gene locus_tag LOCUS_26260 gene udg 1869 1255 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_26260 3008 2466 gene locus_tag LOCUS_26270 3008 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence0616 1278 217 gene locus_tag LOCUS_26280 1278 217 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942690.1 protein_id gnl|my_center|LOCUS_26280 2896 1937 gene locus_tag LOCUS_26290 2896 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 <3407 2893 gene locus_tag LOCUS_26300 <3407 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256806.1:class I SAM-dependent methyltransferase >Feature sequence0617 208 77 gene locus_tag LOCUS_26310 208 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 426 337 gene locus_tag LOCUS_t00240 426 337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1079 762 gene locus_tag LOCUS_26320 1079 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2276 1170 gene locus_tag LOCUS_26330 2276 1170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence0618 842 66 gene locus_tag LOCUS_26340 842 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1068 829 gene locus_tag LOCUS_26350 1068 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1592 1224 gene locus_tag LOCUS_26360 1592 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2352 1606 gene locus_tag LOCUS_26370 2352 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence0619 <1 881 gene locus_tag LOCUS_26380 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880834.1:homoserine kinase 1162 2136 gene locus_tag LOCUS_26390 gene hisZ 1162 2136 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_26390 2407 3051 gene locus_tag LOCUS_26400 gene hisG 2407 3051 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0620 500 360 gene locus_tag LOCUS_26410 500 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1631 624 gene locus_tag LOCUS_26420 1631 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1970 1704 gene locus_tag LOCUS_26430 1970 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3374 2088 gene locus_tag LOCUS_26440 gene rhmD 3374 2088 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence0621 948 1157 gene locus_tag LOCUS_26450 948 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1528 2193 gene locus_tag LOCUS_26460 1528 2193 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_26460 2321 3259 gene locus_tag LOCUS_26470 2321 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence0622 120 1049 gene locus_tag LOCUS_26480 gene xerC 120 1049 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941160.1 protein_id gnl|my_center|LOCUS_26480 1052 1471 gene locus_tag LOCUS_26490 1052 1471 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_26490 1654 2832 gene locus_tag LOCUS_26500 gene queG 1654 2832 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388032.1 protein_id gnl|my_center|LOCUS_26500 2843 3250 gene locus_tag LOCUS_26510 2843 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065260.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence0623 <1 2246 gene locus_tag LOCUS_26520 <1 2246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein 2422 3117 gene locus_tag LOCUS_26530 2422 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence0624 514 110 gene locus_tag LOCUS_26540 514 110 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_26540 2503 902 gene locus_tag LOCUS_26550 2503 902 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 protein_id gnl|my_center|LOCUS_26550 2841 2506 gene locus_tag LOCUS_26560 2841 2506 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942988.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence0625 431 225 gene locus_tag LOCUS_26570 431 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1001 657 gene locus_tag LOCUS_26580 1001 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1555 2568 gene locus_tag LOCUS_26590 1555 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2520 3110 gene locus_tag LOCUS_26600 2520 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence0626 1740 610 gene locus_tag LOCUS_26610 1740 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2745 2083 gene locus_tag LOCUS_26620 2745 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0627 376 146 gene locus_tag LOCUS_26630 376 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 428 1525 gene locus_tag LOCUS_26640 428 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0628 522 1835 gene locus_tag LOCUS_26650 522 1835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_26650 3251 2226 gene locus_tag LOCUS_26660 3251 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence0629 >Feature sequence0630 208 372 gene locus_tag LOCUS_26670 208 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 369 599 gene locus_tag LOCUS_26680 369 599 CDS product DUF6429 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105375144.1 protein_id gnl|my_center|LOCUS_26680 749 2158 gene locus_tag LOCUS_26690 gene lpdA 749 2158 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence0631 1980 634 gene locus_tag LOCUS_26700 1980 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence0632 >Feature sequence0633 1896 487 gene locus_tag LOCUS_26710 1896 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3029 1893 gene locus_tag LOCUS_26720 3029 1893 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204501.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0634 2257 209 gene locus_tag LOCUS_26730 2257 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2843 2250 gene locus_tag LOCUS_26740 2843 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence0635 913 2040 gene locus_tag LOCUS_26750 gene lysS 913 2040 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173924.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence0636 2002 1379 gene locus_tag LOCUS_26760 2002 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence0637 525 178 gene locus_tag LOCUS_26770 525 178 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376591.1 protein_id gnl|my_center|LOCUS_26770 793 2508 gene locus_tag LOCUS_26780 793 2508 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_26780 2501 3217 gene locus_tag LOCUS_26790 2501 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence0638 <1 1329 gene locus_tag LOCUS_26800 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942181.1:exodeoxyribonuclease V subunit beta 1595 1774 gene locus_tag LOCUS_26810 1595 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0639 756 226 gene locus_tag LOCUS_26820 756 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1491 949 gene locus_tag LOCUS_26830 1491 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2772 1864 gene locus_tag LOCUS_26840 2772 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0640 1643 921 gene locus_tag LOCUS_26850 1643 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1895 2374 gene locus_tag LOCUS_26860 1895 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26860 2371 2523 gene locus_tag LOCUS_26870 2371 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2615 2541 gene locus_tag LOCUS_t00250 2615 2541 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2834 3115 gene locus_tag LOCUS_26880 gene rpsT 2834 3115 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence0641 >Feature sequence0642 76 300 gene locus_tag LOCUS_26890 76 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 466 1221 gene locus_tag LOCUS_26900 466 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1388 2287 gene locus_tag LOCUS_26910 1388 2287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_26910 2284 3129 gene locus_tag LOCUS_26920 2284 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence0643 37 2115 gene locus_tag LOCUS_26930 37 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence0644 420 184 gene locus_tag LOCUS_26940 420 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 657 872 gene locus_tag LOCUS_26950 657 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 869 1111 gene locus_tag LOCUS_26960 869 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2788 1148 gene locus_tag LOCUS_26970 2788 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3310 3098 gene locus_tag LOCUS_26980 3310 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence0645 1416 625 gene locus_tag LOCUS_26990 1416 625 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence0646 968 603 gene locus_tag LOCUS_27000 968 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1510 977 gene locus_tag LOCUS_27010 1510 977 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence0647 2772 2317 gene locus_tag LOCUS_27020 2772 2317 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_27020 <3308 2741 gene locus_tag LOCUS_27030 <3308 2741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000837658.1:response regulator >Feature sequence0648 139 510 gene locus_tag LOCUS_27040 gene rpsL 139 510 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_27040 593 1063 gene locus_tag LOCUS_27050 gene rpsG 593 1063 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_27050 1099 3183 gene locus_tag LOCUS_27060 gene fusA 1099 3183 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence0649 446 1309 gene locus_tag LOCUS_27070 446 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1418 3133 gene locus_tag LOCUS_27080 1418 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0650 352 1470 gene locus_tag LOCUS_27090 352 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2925 1597 gene locus_tag LOCUS_27100 2925 1597 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence0651 580 807 gene locus_tag LOCUS_27110 580 807 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_27110 906 1802 gene locus_tag LOCUS_27120 906 1802 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792442.1 protein_id gnl|my_center|LOCUS_27120 1944 3185 gene locus_tag LOCUS_27130 1944 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0652 245 802 gene locus_tag LOCUS_27140 245 802 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_27140 941 2305 gene locus_tag LOCUS_27150 941 2305 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_27150 2424 3185 gene locus_tag LOCUS_27160 2424 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence0653 <1 671 gene locus_tag LOCUS_27170 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064478.1:SNF2-related protein note possible pseudo, frameshifted 559 1770 gene locus_tag LOCUS_27180 559 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 1913 2185 gene locus_tag LOCUS_27190 1913 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2462 2824 gene locus_tag LOCUS_27200 2462 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2915 3034 gene locus_tag LOCUS_27210 2915 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence0654 1034 90 gene locus_tag LOCUS_27220 1034 90 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_27220 1985 1179 gene locus_tag LOCUS_27230 gene lgt 1985 1179 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_27230 2650 2144 gene locus_tag LOCUS_27240 gene lspA 2650 2144 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_27240 3039 2914 gene locus_tag LOCUS_27250 3039 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence0655 2136 1021 gene locus_tag LOCUS_27260 2136 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence0656 209 1330 gene locus_tag LOCUS_27270 gene tssA 209 1330 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343647.1 protein_id gnl|my_center|LOCUS_27270 1440 1985 gene locus_tag LOCUS_27280 gene tssB 1440 1985 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318241.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence0657 69 770 gene locus_tag LOCUS_27290 69 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 862 1350 gene locus_tag LOCUS_27300 862 1350 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_27300 1815 2468 gene locus_tag LOCUS_27310 1815 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 2628 3044 gene locus_tag LOCUS_27320 gene rnk 2628 3044 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815299.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0658 387 55 gene locus_tag LOCUS_27330 387 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 373 2181 gene locus_tag LOCUS_27340 373 2181 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_27340 2193 3065 gene locus_tag LOCUS_27350 2193 3065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence0659 <1 1265 gene locus_tag LOCUS_27360 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:DEAD/DEAH box helicase 2239 1448 gene locus_tag LOCUS_27370 2239 1448 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690058.1 protein_id gnl|my_center|LOCUS_27370 3068 2388 gene locus_tag LOCUS_27380 3068 2388 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence0660 <1 890 gene locus_tag LOCUS_27390 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943450.1:ABC transporter ATP-binding protein 1097 2044 gene locus_tag LOCUS_27400 1097 2044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_27400 2041 3174 gene locus_tag LOCUS_27410 2041 3174 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence0661 493 2220 gene locus_tag LOCUS_27420 gene sppA 493 2220 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence0662 1403 1164 gene locus_tag LOCUS_27430 1403 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1543 1400 gene locus_tag LOCUS_27440 1543 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3087 1585 gene locus_tag LOCUS_27450 3087 1585 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence0663 425 1996 gene locus_tag LOCUS_27460 425 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence0664 <1 1307 gene locus_tag LOCUS_27470 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942393.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence0665 19 1695 gene locus_tag LOCUS_27480 19 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2360 1827 gene locus_tag LOCUS_27490 2360 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 3010 2585 gene locus_tag LOCUS_27500 3010 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence0666 81 1643 gene locus_tag LOCUS_27510 81 1643 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_27510 1799 2869 gene locus_tag LOCUS_27520 gene leuB 1799 2869 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence0667 1689 346 gene locus_tag LOCUS_27530 1689 346 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_27530 1846 1625 gene locus_tag LOCUS_27540 1846 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2419 1895 gene locus_tag LOCUS_27550 2419 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 <3249 2416 gene locus_tag LOCUS_27560 <3249 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123135.1:VTT domain-containing protein >Feature sequence0668 781 92 gene locus_tag LOCUS_27570 781 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1327 866 gene locus_tag LOCUS_27580 1327 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3071 1443 gene locus_tag LOCUS_27590 gene groL 3071 1443 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence0669 1459 2844 gene locus_tag LOCUS_27600 1459 2844 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767112.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence0670 1056 532 gene locus_tag LOCUS_27610 1056 532 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_27610 1437 1129 gene locus_tag LOCUS_27620 1437 1129 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_27620 2293 1925 gene locus_tag LOCUS_27630 2293 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence0671 185 916 gene locus_tag LOCUS_27640 185 916 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_27640 1015 2781 gene locus_tag LOCUS_27650 1015 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence0672 3012 127 gene locus_tag LOCUS_27660 3012 127 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403151.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence0673 544 948 gene locus_tag LOCUS_27670 544 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 959 1516 gene locus_tag LOCUS_27680 959 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1477 3198 gene locus_tag LOCUS_27690 1477 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence0674 2128 173 gene locus_tag LOCUS_27700 2128 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 <3227 2170 gene locus_tag LOCUS_27710 <3227 2170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140588.1:serine/threonine-protein kinase >Feature sequence0675 627 103 gene locus_tag LOCUS_27720 627 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1834 794 gene locus_tag LOCUS_27730 1834 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2179 3129 gene locus_tag LOCUS_27740 2179 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence0676 899 60 gene locus_tag LOCUS_27750 899 60 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_27750 1111 2808 gene locus_tag LOCUS_27760 1111 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0677 167 691 gene locus_tag LOCUS_27770 167 691 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926060.1 protein_id gnl|my_center|LOCUS_27770 889 2589 gene locus_tag LOCUS_27780 889 2589 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0678 1406 135 gene locus_tag LOCUS_27790 1406 135 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275377.1 protein_id gnl|my_center|LOCUS_27790 2048 1818 gene locus_tag LOCUS_27800 2048 1818 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_27800 2777 2226 gene locus_tag LOCUS_27810 2777 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence0679 1581 235 gene locus_tag LOCUS_27820 1581 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2418 1702 gene locus_tag LOCUS_27830 2418 1702 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_27830 <3216 2665 gene locus_tag LOCUS_27840 <3216 2665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048235.1:electron transfer flavoprotein subunit alpha >Feature sequence0680 >Feature sequence0681 2 379 gene locus_tag LOCUS_27850 2 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 445 1149 gene locus_tag LOCUS_27860 445 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 1484 1984 gene locus_tag LOCUS_27870 1484 1984 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_27870 2151 3125 gene locus_tag LOCUS_27880 2151 3125 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence0682 394 912 gene locus_tag LOCUS_27890 394 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 969 3002 gene locus_tag LOCUS_27900 969 3002 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0683 114 1181 gene locus_tag LOCUS_27910 114 1181 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_27910 1183 1431 gene locus_tag LOCUS_27920 1183 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence0684 585 1565 gene locus_tag LOCUS_27930 585 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1824 3203 gene locus_tag LOCUS_27940 1824 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence0685 1868 78 gene locus_tag LOCUS_27950 1868 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2428 1865 gene locus_tag LOCUS_27960 2428 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0686 509 1279 gene locus_tag LOCUS_27970 gene ntrB 509 1279 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_27970 1675 2538 gene locus_tag LOCUS_27980 1675 2538 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141569.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence0687 164 3154 gene locus_tag LOCUS_27990 164 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence0688 2865 2029 gene locus_tag LOCUS_28000 2865 2029 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0689 559 843 gene locus_tag LOCUS_28010 gene eutM 559 843 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_28010 867 1133 gene locus_tag LOCUS_28020 867 1133 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_28020 1398 1664 gene locus_tag LOCUS_28030 1398 1664 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_28030 1668 1940 gene locus_tag LOCUS_28040 1668 1940 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_28040 1937 2248 gene locus_tag LOCUS_28050 1937 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2261 2863 gene locus_tag LOCUS_28060 gene ruvA 2261 2863 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence0690 1109 288 gene locus_tag LOCUS_28070 1109 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1925 1221 gene locus_tag LOCUS_28080 1925 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2843 1938 gene locus_tag LOCUS_28090 2843 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence0691 718 1668 gene locus_tag LOCUS_28100 gene pta 718 1668 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_28100 1918 1724 gene locus_tag LOCUS_28110 1918 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 2312 2115 gene locus_tag LOCUS_28120 gene rpsU 2312 2115 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055893.1 protein_id gnl|my_center|LOCUS_28120 >Feature sequence0692 611 84 gene locus_tag LOCUS_28130 611 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 747 1226 gene locus_tag LOCUS_28140 747 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1765 1277 gene locus_tag LOCUS_28150 1765 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2534 2031 gene locus_tag LOCUS_28160 2534 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence0693 1252 2427 gene locus_tag LOCUS_28170 1252 2427 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0694 440 234 gene locus_tag LOCUS_28180 440 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 464 844 gene locus_tag LOCUS_28190 464 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2963 969 gene locus_tag LOCUS_28200 2963 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence0695 148 873 gene locus_tag LOCUS_28210 gene ric 148 873 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_28210 873 1370 gene locus_tag LOCUS_28220 873 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1681 2268 gene locus_tag LOCUS_28230 1681 2268 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220565.1 protein_id gnl|my_center|LOCUS_28230 2545 3033 gene locus_tag LOCUS_28240 gene grpE 2545 3033 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546170.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence0696 2740 512 gene locus_tag LOCUS_28250 2740 512 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388079.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence0697 480 1283 gene locus_tag LOCUS_28260 480 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1280 1543 gene locus_tag LOCUS_28270 1280 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1610 2377 gene locus_tag LOCUS_28280 1610 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2818 2390 gene locus_tag LOCUS_28290 2818 2390 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868283.1 protein_id gnl|my_center|LOCUS_28290 3066 2818 gene locus_tag LOCUS_28300 3066 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0698 <1 565 gene locus_tag LOCUS_28310 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942245.1:phosphate acyltransferase PlsX 566 1510 gene locus_tag LOCUS_28320 gene fabD 566 1510 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_28320 1688 2428 gene locus_tag LOCUS_28330 gene fabG 1688 2428 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_28330 2658 2536 gene locus_tag LOCUS_28340 2658 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2859 3098 gene locus_tag LOCUS_28350 gene acpP 2859 3098 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence0699 62 1087 gene locus_tag LOCUS_28360 62 1087 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_28360 1183 2268 gene locus_tag LOCUS_28370 gene ychF 1183 2268 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0700 1980 214 gene locus_tag LOCUS_28380 1980 214 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871433.1 protein_id gnl|my_center|LOCUS_28380 <3154 2238 gene locus_tag LOCUS_28390 <3154 2238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966109.1:dihydrodipicolinate synthase family protein >Feature sequence0701 195 46 gene locus_tag LOCUS_28400 195 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 315 1634 gene locus_tag LOCUS_28410 315 1634 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_28410 1732 2628 gene locus_tag LOCUS_28420 1732 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence0702 409 612 gene locus_tag LOCUS_28430 409 612 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_28430 710 1051 gene locus_tag LOCUS_28440 710 1051 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817077.1 protein_id gnl|my_center|LOCUS_28440 1125 1976 gene locus_tag LOCUS_28450 1125 1976 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_28450 1983 2981 gene locus_tag LOCUS_28460 1983 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0703 1636 680 gene locus_tag LOCUS_28470 1636 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2338 1736 gene locus_tag LOCUS_28480 2338 1736 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_28480 2557 2676 gene locus_tag LOCUS_28490 2557 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence0704 1710 160 gene locus_tag LOCUS_28500 1710 160 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_28500 2546 1704 gene locus_tag LOCUS_28510 2546 1704 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence0705 3062 2259 gene locus_tag LOCUS_28520 3062 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0706 1 1413 gene locus_tag LOCUS_28530 1 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1669 2949 gene locus_tag LOCUS_28540 1669 2949 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence0707 <1 1652 gene locus_tag LOCUS_28550 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein 1667 3094 gene locus_tag LOCUS_28560 1667 3094 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0708 >Feature sequence0709 1588 1746 gene locus_tag LOCUS_28570 1588 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2021 3127 gene locus_tag LOCUS_28580 2021 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence0710 <1 1861 gene locus_tag LOCUS_28590 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein 1907 2308 gene locus_tag LOCUS_28600 1907 2308 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence0711 738 1148 gene locus_tag LOCUS_28610 738 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2533 1544 gene locus_tag LOCUS_28620 2533 1544 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence0712 >Feature sequence0713 >Feature sequence0714 160 978 gene locus_tag LOCUS_28630 160 978 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035676.1 protein_id gnl|my_center|LOCUS_28630 1065 1361 gene locus_tag LOCUS_28640 1065 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28640 1754 2719 gene locus_tag LOCUS_28650 1754 2719 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence0715 >Feature sequence0716 106 1386 gene locus_tag LOCUS_28660 106 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0717 2185 89 gene locus_tag LOCUS_28670 2185 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 2762 2358 gene locus_tag LOCUS_28680 2762 2358 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_28680 2989 2759 gene locus_tag LOCUS_28690 2989 2759 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence0718 948 196 gene locus_tag LOCUS_28700 948 196 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_28700 2844 1087 gene locus_tag LOCUS_28710 2844 1087 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_28710 3103 2924 gene locus_tag LOCUS_28720 3103 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence0719 830 1903 gene locus_tag LOCUS_28730 830 1903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966039.1 protein_id gnl|my_center|LOCUS_28730 2089 2970 gene locus_tag LOCUS_28740 2089 2970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence0720 330 644 gene locus_tag LOCUS_28750 330 644 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_28750 828 950 gene locus_tag LOCUS_28760 828 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 960 1478 gene locus_tag LOCUS_28770 960 1478 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_28770 1475 1696 gene locus_tag LOCUS_28780 1475 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1710 2156 gene locus_tag LOCUS_28790 1710 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2169 2291 gene locus_tag LOCUS_28800 2169 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 2270 2698 gene locus_tag LOCUS_28810 2270 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0721 2177 1308 gene locus_tag LOCUS_28820 2177 1308 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence0722 36 911 gene locus_tag LOCUS_28830 gene panB 36 911 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_28830 898 1746 gene locus_tag LOCUS_28840 gene panC 898 1746 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_28840 1966 2565 gene locus_tag LOCUS_28850 1966 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence0723 <1 1339 gene locus_tag LOCUS_28860 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036651.1:S8 family serine peptidase 1535 2533 gene locus_tag LOCUS_28870 1535 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence0724 221 1000 gene locus_tag LOCUS_28880 221 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1022 1549 gene locus_tag LOCUS_28890 gene hslV 1022 1549 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence0725 <1 783 gene locus_tag LOCUS_28900 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086741.1:D-TA family PLP-dependent enzyme 925 1068 gene locus_tag LOCUS_28910 925 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1209 2915 gene locus_tag LOCUS_28920 1209 2915 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence0726 643 344 gene locus_tag LOCUS_28930 643 344 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_28930 1416 883 gene locus_tag LOCUS_28940 1416 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1957 2727 gene locus_tag LOCUS_28950 1957 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence0727 392 2125 gene locus_tag LOCUS_28960 392 2125 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence0728 1032 1613 gene locus_tag LOCUS_28970 gene lacC 1032 1613 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence0729 192 1490 gene locus_tag LOCUS_28980 192 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 2247 1642 gene locus_tag LOCUS_28990 2247 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28990 2618 2232 gene locus_tag LOCUS_29000 2618 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29000 >Feature sequence0730 450 1601 gene locus_tag LOCUS_29010 450 1601 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_29010 1987 2214 gene locus_tag LOCUS_29020 1987 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2453 2265 gene locus_tag LOCUS_29030 2453 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence0731 1 693 gene locus_tag LOCUS_29040 1 693 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence0732 96 1403 gene locus_tag LOCUS_29050 96 1403 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_29050 1528 2880 gene locus_tag LOCUS_29060 gene rseP 1528 2880 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence0733 867 493 gene locus_tag LOCUS_29070 867 493 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525347.1 protein_id gnl|my_center|LOCUS_29070 2288 864 gene locus_tag LOCUS_29080 gene mpl 2288 864 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_29080 <3069 2281 gene locus_tag LOCUS_29090 <3069 2281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392232.1:LD-carboxypeptidase >Feature sequence0734 1009 86 gene locus_tag LOCUS_29100 1009 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 966 1223 gene locus_tag LOCUS_29110 966 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 1374 1449 gene locus_tag LOCUS_t00260 1374 1449 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1469 1545 gene locus_tag LOCUS_t00270 1469 1545 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1562 1840 gene locus_tag LOCUS_29120 1562 1840 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_29120 1843 2112 gene locus_tag LOCUS_29130 1843 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 <3068 2187 gene locus_tag LOCUS_29140 <3068 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942084.1:M48 family metallopeptidase >Feature sequence0735 610 320 gene locus_tag LOCUS_29150 610 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 2321 693 gene locus_tag LOCUS_29160 gene bshC 2321 693 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_29160 3050 2445 gene locus_tag LOCUS_29170 3050 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 >Feature sequence0736 685 1356 gene locus_tag LOCUS_29180 685 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2358 2822 gene locus_tag LOCUS_29190 2358 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0737 1101 145 gene locus_tag LOCUS_29200 gene rbsC 1101 145 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_29200 2060 1098 gene locus_tag LOCUS_29210 gene rbsC 2060 1098 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_29210 2963 2214 gene locus_tag LOCUS_29220 2963 2214 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0738 77 1948 gene locus_tag LOCUS_29230 77 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2490 2918 gene locus_tag LOCUS_29240 2490 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence0739 >Feature sequence0740 163 1221 gene locus_tag LOCUS_29250 163 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2024 1548 gene locus_tag LOCUS_29260 2024 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2209 2021 gene locus_tag LOCUS_29270 2209 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 2953 2402 gene locus_tag LOCUS_29280 2953 2402 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence0741 1762 587 gene locus_tag LOCUS_29290 gene cas7e 1762 587 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_29290 2307 1759 gene locus_tag LOCUS_29300 gene casB 2307 1759 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence0742 192 680 gene locus_tag LOCUS_29310 192 680 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921747.1 protein_id gnl|my_center|LOCUS_29310 677 1438 gene locus_tag LOCUS_29320 677 1438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_29320 1444 2208 gene locus_tag LOCUS_29330 1444 2208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence0743 <1 2676 gene locus_tag LOCUS_29340 <1 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986847.1:excinuclease ABC subunit UvrA >Feature sequence0744 <1 1477 gene locus_tag LOCUS_29350 <1 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118122.1:PSD1 and planctomycete cytochrome C domain-containing protein <3035 1558 gene locus_tag LOCUS_29360 <3035 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257050.1:malto-oligosyltrehalose synthase >Feature sequence0745 <1 554 gene locus_tag LOCUS_29370 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941774.1:PfkB family carbohydrate kinase 631 1494 gene locus_tag LOCUS_29380 gene dapF 631 1494 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_29380 2811 1624 gene locus_tag LOCUS_29390 2811 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence0746 <1 1253 gene locus_tag LOCUS_29400 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016545.1:translational GTPase TypA 1465 2589 gene locus_tag LOCUS_29410 gene ogl 1465 2589 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210841.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence0747 64 741 gene locus_tag LOCUS_29420 64 741 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_29420 1219 1491 gene locus_tag LOCUS_29430 1219 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1691 2614 gene locus_tag LOCUS_29440 gene frlC 1691 2614 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence0748 1727 768 gene locus_tag LOCUS_29450 1727 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 <3019 1949 gene locus_tag LOCUS_29460 <3019 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036001.1:nucleoside transporter >Feature sequence0749 <1 1185 gene locus_tag LOCUS_29470 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232504.1:sporulation two-component system sensor histidine kinase KinE 1222 2610 gene locus_tag LOCUS_29480 1222 2610 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0750 96 2933 gene locus_tag LOCUS_29490 96 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0751 2656 2096 gene locus_tag LOCUS_29500 2656 2096 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence0752 >Feature sequence0753 >Feature sequence0754 1558 2121 gene locus_tag LOCUS_29510 1558 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 2352 2516 gene locus_tag LOCUS_29520 2352 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2516 2701 gene locus_tag LOCUS_29530 2516 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence0755 244 432 gene locus_tag LOCUS_29540 244 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 436 783 gene locus_tag LOCUS_29550 436 783 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_29550 1153 902 gene locus_tag LOCUS_29560 1153 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 <2995 1184 gene locus_tag LOCUS_29570 <2995 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839612.1:TonB-dependent receptor >Feature sequence0756 711 100 gene locus_tag LOCUS_29580 gene fixJ 711 100 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_29580 2713 701 gene locus_tag LOCUS_29590 2713 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence0757 1443 160 gene locus_tag LOCUS_29600 gene dgoD 1443 160 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_29600 1778 2035 gene locus_tag LOCUS_29610 1778 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 2745 1987 gene locus_tag LOCUS_29620 2745 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence0758 1995 160 gene locus_tag LOCUS_29630 1995 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0759 1776 160 gene locus_tag LOCUS_29640 1776 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2824 1982 gene locus_tag LOCUS_29650 2824 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0760 <1 893 gene locus_tag LOCUS_29660 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921296.1:NAD(P)/FAD-dependent oxidoreductase 1006 1467 gene locus_tag LOCUS_29670 1006 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 2774 1596 gene locus_tag LOCUS_29680 2774 1596 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence0761 <1 540 gene locus_tag LOCUS_29690 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256856.1:SpoVR family protein 598 1530 gene locus_tag LOCUS_29700 598 1530 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_29700 1715 1790 gene locus_tag LOCUS_t00280 1715 1790 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2660 1833 gene locus_tag LOCUS_29710 2660 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0762 944 1381 gene locus_tag LOCUS_29720 944 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2082 1906 gene locus_tag LOCUS_29730 2082 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2235 2675 gene locus_tag LOCUS_29740 2235 2675 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419785.1 protein_id gnl|my_center|LOCUS_29740 2851 2705 gene locus_tag LOCUS_29750 2851 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0763 311 874 gene locus_tag LOCUS_29760 311 874 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_29760 867 2924 gene locus_tag LOCUS_29770 867 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence0764 >Feature sequence0765 905 747 gene locus_tag LOCUS_29780 905 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 1433 1053 gene locus_tag LOCUS_29790 1433 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2898 1735 gene locus_tag LOCUS_29800 2898 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence0766 1463 120 gene locus_tag LOCUS_29810 1463 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1986 1447 gene locus_tag LOCUS_29820 gene sigX 1986 1447 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814412.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence0767 2237 2890 gene locus_tag LOCUS_29830 2237 2890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_29830 >Feature sequence0768 <1 1405 gene locus_tag LOCUS_29840 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:efflux RND transporter permease subunit 1402 2616 gene locus_tag LOCUS_29850 1402 2616 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence0769 2699 2445 gene locus_tag LOCUS_29860 2699 2445 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267521.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence0770 1940 762 gene locus_tag LOCUS_29870 1940 762 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_29870 <2940 2101 gene locus_tag LOCUS_29880 <2940 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267156.1:aspartate-semialdehyde dehydrogenase >Feature sequence0771 <1 825 gene locus_tag LOCUS_29890 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203446.1:dipeptidase <2939 889 gene locus_tag LOCUS_29900 <2939 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487177.1:[protein-PII] uridylyltransferase >Feature sequence0772 2538 1708 gene locus_tag LOCUS_29910 2538 1708 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence0773 1219 320 gene locus_tag LOCUS_29920 1219 320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385705.1 protein_id gnl|my_center|LOCUS_29920 2793 1225 gene locus_tag LOCUS_29930 2793 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence0774 112 1617 gene locus_tag LOCUS_29940 112 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1718 2131 gene locus_tag LOCUS_29950 1718 2131 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence0775 91 666 gene locus_tag LOCUS_29960 91 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 858 1016 gene locus_tag LOCUS_29970 858 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1013 2257 gene locus_tag LOCUS_29980 1013 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence0776 550 200 gene locus_tag LOCUS_29990 550 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 880 1209 gene locus_tag LOCUS_30000 880 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence0777 1362 571 gene locus_tag LOCUS_30010 1362 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2052 1462 gene locus_tag LOCUS_30020 2052 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 <2913 2153 gene locus_tag LOCUS_30030 <2913 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941738.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence0778 <1 858 gene locus_tag LOCUS_30040 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020271.1:Xaa-Pro peptidase family protein 1928 987 gene locus_tag LOCUS_30050 1928 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 2018 2314 gene locus_tag LOCUS_30060 2018 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2778 2473 gene locus_tag LOCUS_30070 2778 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence0779 <1 1447 gene locus_tag LOCUS_30080 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator note possible pseudo, internal stop codon, frameshifted 1463 2860 gene locus_tag LOCUS_30090 1463 2860 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence0780 322 1293 gene locus_tag LOCUS_30100 322 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0781 <1 1920 gene locus_tag LOCUS_30110 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411855.1:molecular chaperone HtpG >Feature sequence0782 1036 872 gene locus_tag LOCUS_30120 1036 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1267 2811 gene locus_tag LOCUS_30130 1267 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence0783 1223 93 gene locus_tag LOCUS_30140 1223 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1891 1289 gene locus_tag LOCUS_30150 1891 1289 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_30150 2748 2131 gene locus_tag LOCUS_30160 2748 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0784 214 1197 gene locus_tag LOCUS_30170 214 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1329 2525 gene locus_tag LOCUS_30180 1329 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence0785 2451 325 gene locus_tag LOCUS_30190 2451 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence0786 1746 1534 gene locus_tag LOCUS_30200 1746 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 1990 2196 gene locus_tag LOCUS_30210 1990 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 2548 2799 gene locus_tag LOCUS_30220 2548 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence0787 345 1769 gene locus_tag LOCUS_30230 345 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence0788 621 1082 gene locus_tag LOCUS_30240 621 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1194 1658 gene locus_tag LOCUS_30250 1194 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1710 2108 gene locus_tag LOCUS_30260 1710 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence0789 48 674 gene locus_tag LOCUS_30270 48 674 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879988.1 protein_id gnl|my_center|LOCUS_30270 821 1900 gene locus_tag LOCUS_30280 821 1900 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_30280 2404 2057 gene locus_tag LOCUS_30290 2404 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence0790 549 58 gene locus_tag LOCUS_30300 549 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 719 1273 gene locus_tag LOCUS_30310 719 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1312 1584 gene locus_tag LOCUS_30320 gene rpmA 1312 1584 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228914.1 protein_id gnl|my_center|LOCUS_30320 2410 1685 gene locus_tag LOCUS_30330 2410 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2516 2713 gene locus_tag LOCUS_30340 2516 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0791 2837 1581 gene locus_tag LOCUS_30350 2837 1581 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence0792 2185 407 gene locus_tag LOCUS_30360 2185 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence0793 411 869 gene locus_tag LOCUS_30370 411 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 853 1176 gene locus_tag LOCUS_30380 853 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence0794 176 601 gene locus_tag LOCUS_30390 176 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 671 2734 gene locus_tag LOCUS_30400 671 2734 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0795 337 1521 gene locus_tag LOCUS_30410 gene nagA 337 1521 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_30410 1771 2769 gene locus_tag LOCUS_30420 1771 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence0796 1210 2373 gene locus_tag LOCUS_30430 1210 2373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence0797 997 350 gene locus_tag LOCUS_30440 997 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 2388 1177 gene locus_tag LOCUS_30450 2388 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence0798 <1 644 gene locus_tag LOCUS_30460 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142200.1:Gfo/Idh/MocA family oxidoreductase 674 1438 gene locus_tag LOCUS_30470 674 1438 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_30470 1463 2104 gene locus_tag LOCUS_30480 1463 2104 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence0799 140 328 gene locus_tag LOCUS_30490 140 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1692 568 gene locus_tag LOCUS_30500 1692 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2806 1745 gene locus_tag LOCUS_30510 2806 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0800 >Feature sequence0801 202 80 gene locus_tag LOCUS_30520 202 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 269 1375 gene locus_tag LOCUS_30530 269 1375 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_30530 1767 2396 gene locus_tag LOCUS_30540 1767 2396 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921301.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0802 1038 76 gene locus_tag LOCUS_30550 1038 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 2652 1126 gene locus_tag LOCUS_30560 2652 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 2855 2649 gene locus_tag LOCUS_30570 2855 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 >Feature sequence0803 130 1011 gene locus_tag LOCUS_30580 130 1011 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_30580 1071 2111 gene locus_tag LOCUS_30590 gene hflK 1071 2111 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_30590 2136 2621 gene locus_tag LOCUS_30600 2136 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence0804 275 1018 gene locus_tag LOCUS_30610 gene truA 275 1018 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_30610 1039 1839 gene locus_tag LOCUS_30620 1039 1839 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_30620 1836 2654 gene locus_tag LOCUS_30630 1836 2654 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545594.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence0805 <1 987 gene locus_tag LOCUS_30640 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037397899.1:mannonate dehydratase 1274 1026 gene locus_tag LOCUS_30650 1274 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1158 1682 gene locus_tag LOCUS_30660 1158 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 >Feature sequence0806 669 493 gene locus_tag LOCUS_30670 669 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1099 674 gene locus_tag LOCUS_30680 1099 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1327 1130 gene locus_tag LOCUS_30690 1327 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2405 1689 gene locus_tag LOCUS_30700 2405 1689 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0807 240 458 gene locus_tag LOCUS_30710 240 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 653 2116 gene locus_tag LOCUS_30720 653 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0808 152 1441 gene locus_tag LOCUS_30730 152 1441 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_30730 2502 1489 gene locus_tag LOCUS_30740 2502 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0809 1566 499 gene locus_tag LOCUS_30750 1566 499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965492.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence0810 2222 930 gene locus_tag LOCUS_30760 2222 930 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0811 2578 1544 gene locus_tag LOCUS_30770 2578 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence0812 46 1611 gene locus_tag LOCUS_30780 gene purH 46 1611 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393540.1 protein_id gnl|my_center|LOCUS_30780 2008 2292 gene locus_tag LOCUS_30790 2008 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0813 1199 2059 gene locus_tag LOCUS_30800 1199 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2062 2283 gene locus_tag LOCUS_30810 2062 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 >Feature sequence0814 <1 518 gene locus_tag LOCUS_30820 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024768457.1:VCBS repeat-containing protein 1294 563 gene locus_tag LOCUS_30830 1294 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2343 1276 gene locus_tag LOCUS_30840 2343 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0815 >Feature sequence0816 1450 1106 gene locus_tag LOCUS_30850 1450 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 1768 1493 gene locus_tag LOCUS_30860 1768 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence0817 773 2674 gene locus_tag LOCUS_30870 773 2674 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0818 838 1452 gene locus_tag LOCUS_30880 838 1452 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405125.1 protein_id gnl|my_center|LOCUS_30880 1469 2608 gene locus_tag LOCUS_30890 1469 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence0819 <1 829 gene locus_tag LOCUS_30900 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase 1253 909 gene locus_tag LOCUS_30910 1253 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 2639 1656 gene locus_tag LOCUS_30920 2639 1656 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495856.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0820 102 1400 gene locus_tag LOCUS_30930 102 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1405 1995 gene locus_tag LOCUS_30940 1405 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence0821 526 756 gene locus_tag LOCUS_30950 526 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 815 1177 gene locus_tag LOCUS_30960 815 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1143 1394 gene locus_tag LOCUS_30970 1143 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 1500 1709 gene locus_tag LOCUS_30980 1500 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 2635 1970 gene locus_tag LOCUS_30990 2635 1970 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence0822 472 1338 gene locus_tag LOCUS_31000 472 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1571 2695 gene locus_tag LOCUS_31010 gene citZ 1571 2695 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence0823 2307 1552 gene locus_tag LOCUS_31020 2307 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 2659 2447 gene locus_tag LOCUS_31030 2659 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0824 393 887 gene locus_tag LOCUS_31040 393 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1075 2409 gene locus_tag LOCUS_31050 gene accC 1075 2409 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence0825 371 296 gene locus_tag LOCUS_t00290 371 296 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1749 652 gene locus_tag LOCUS_31060 1749 652 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776854.1 protein_id gnl|my_center|LOCUS_31060 2712 1978 gene locus_tag LOCUS_31070 2712 1978 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0826 3 1061 gene locus_tag LOCUS_31080 3 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 1261 1887 gene locus_tag LOCUS_31090 1261 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2341 1922 gene locus_tag LOCUS_31100 2341 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2562 2350 gene locus_tag LOCUS_31110 2562 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence0827 128 799 gene locus_tag LOCUS_31120 128 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 <2801 899 gene locus_tag LOCUS_31130 <2801 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:efflux RND transporter permease subunit >Feature sequence0828 14 658 gene locus_tag LOCUS_31140 14 658 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_31140 821 1537 gene locus_tag LOCUS_31150 gene rph 821 1537 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_31150 2038 2646 gene locus_tag LOCUS_31160 2038 2646 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence0829 >Feature sequence0830 995 270 gene locus_tag LOCUS_31170 995 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 <2798 1916 gene locus_tag LOCUS_31180 <2798 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence0831 >Feature sequence0832 291 626 gene locus_tag LOCUS_31190 291 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence0833 568 287 gene locus_tag LOCUS_31200 568 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 551 1003 gene locus_tag LOCUS_31210 551 1003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942074.1 protein_id gnl|my_center|LOCUS_31210 1065 1406 gene locus_tag LOCUS_31220 1065 1406 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_31220 1740 1543 gene locus_tag LOCUS_31230 1740 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 1797 2747 gene locus_tag LOCUS_31240 1797 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence0834 1267 299 gene locus_tag LOCUS_31250 1267 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2570 1539 gene locus_tag LOCUS_31260 2570 1539 CDS product IS630-like element ISDra3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480514.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence0835 521 880 gene locus_tag LOCUS_31270 521 880 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_31270 <2787 895 gene locus_tag LOCUS_31280 <2787 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003698476.1:DNA mismatch repair endonuclease MutL >Feature sequence0836 421 756 gene locus_tag LOCUS_31290 421 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 759 1112 gene locus_tag LOCUS_31300 759 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1335 1985 gene locus_tag LOCUS_31310 gene eda 1335 1985 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_31310 2608 2168 gene locus_tag LOCUS_31320 2608 2168 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence0837 692 1468 gene locus_tag LOCUS_31330 692 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1455 2447 gene locus_tag LOCUS_31340 1455 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence0838 1095 607 gene locus_tag LOCUS_31350 1095 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1836 1111 gene locus_tag LOCUS_31360 1836 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2166 1951 gene locus_tag LOCUS_31370 2166 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence0839 152 1762 gene locus_tag LOCUS_31380 152 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2364 2013 gene locus_tag LOCUS_tm00010 2364 2013 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0840 429 689 gene locus_tag LOCUS_31390 429 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2665 686 gene locus_tag LOCUS_31400 2665 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence0841 675 1766 gene locus_tag LOCUS_31410 gene rffG 675 1766 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226597.1 protein_id gnl|my_center|LOCUS_31410 1766 2641 gene locus_tag LOCUS_31420 gene rfbA 1766 2641 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence0842 1273 314 gene locus_tag LOCUS_31430 1273 314 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_31430 1739 1443 gene locus_tag LOCUS_31440 1739 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence0843 712 86 gene locus_tag LOCUS_31450 712 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1547 1332 gene locus_tag LOCUS_31460 1547 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1762 1532 gene locus_tag LOCUS_31470 1762 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence0844 685 2217 gene locus_tag LOCUS_31480 685 2217 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence0845 815 324 gene locus_tag LOCUS_31490 815 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1837 2490 gene locus_tag LOCUS_31500 1837 2490 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064926.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence0846 >Feature sequence0847 117 1070 gene locus_tag LOCUS_31510 117 1070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141728.1 protein_id gnl|my_center|LOCUS_31510 1067 1825 gene locus_tag LOCUS_31520 1067 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0848 288 2141 gene locus_tag LOCUS_31530 gene lon 288 2141 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence0849 1122 4 gene locus_tag LOCUS_31540 1122 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1821 1138 gene locus_tag LOCUS_31550 gene rpe 1821 1138 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_31550 2550 1828 gene locus_tag LOCUS_31560 2550 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0850 2453 975 gene locus_tag LOCUS_31570 2453 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence0851 1362 1796 gene locus_tag LOCUS_31580 1362 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 2001 2144 gene locus_tag LOCUS_31590 2001 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2468 2169 gene locus_tag LOCUS_31600 2468 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence0852 1 1503 gene locus_tag LOCUS_31610 1 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence0853 1597 1274 gene locus_tag LOCUS_31620 1597 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2049 1645 gene locus_tag LOCUS_31630 2049 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2384 2055 gene locus_tag LOCUS_31640 2384 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence0854 861 2258 gene locus_tag LOCUS_31650 861 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 >Feature sequence0855 319 2637 gene locus_tag LOCUS_31660 319 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence0856 1780 383 gene locus_tag LOCUS_31670 1780 383 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943437.1 protein_id gnl|my_center|LOCUS_31670 2529 1777 gene locus_tag LOCUS_31680 2529 1777 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530111.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence0857 1499 261 gene locus_tag LOCUS_31690 gene tyrS 1499 261 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_31690 2439 1834 gene locus_tag LOCUS_31700 gene purN 2439 1834 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence0858 256 2709 gene locus_tag LOCUS_31710 256 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 >Feature sequence0859 416 595 gene locus_tag LOCUS_31720 416 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 592 1974 gene locus_tag LOCUS_31730 592 1974 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_31730 2248 2643 gene locus_tag LOCUS_31740 2248 2643 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088362.1 protein_id gnl|my_center|LOCUS_31740 >Feature sequence0860 1466 1146 gene locus_tag LOCUS_31750 1466 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1709 2338 gene locus_tag LOCUS_31760 1709 2338 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence0861 246 1358 gene locus_tag LOCUS_31770 246 1358 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936075.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence0862 <2722 1427 gene locus_tag LOCUS_31780 <2722 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256904.1:DNA polymerase III subunit alpha >Feature sequence0863 288 1643 gene locus_tag LOCUS_31790 288 1643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_31790 2457 1882 gene locus_tag LOCUS_31800 2457 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence0864 <1 659 gene locus_tag LOCUS_31810 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928597.1:M14 family metallopeptidase 1978 848 gene locus_tag LOCUS_31820 gene cytR 1978 848 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216730.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence0865 930 163 gene locus_tag LOCUS_31830 930 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 1594 1061 gene locus_tag LOCUS_31840 1594 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1986 1687 gene locus_tag LOCUS_31850 1986 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2493 2164 gene locus_tag LOCUS_31860 2493 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence0866 <1 2522 gene locus_tag LOCUS_31870 <1 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0867 78 2591 gene locus_tag LOCUS_31880 78 2591 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118036.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence0868 32 739 gene locus_tag LOCUS_31890 32 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 752 1315 gene locus_tag LOCUS_31900 752 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 1511 1918 gene locus_tag LOCUS_31910 1511 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 2184 2624 gene locus_tag LOCUS_31920 2184 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence0869 >Feature sequence0870 439 1935 gene locus_tag LOCUS_31930 439 1935 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_31930 <2701 1994 gene locus_tag LOCUS_31940 <2701 1994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218129451.1:RraA family protein >Feature sequence0871 328 1938 gene locus_tag LOCUS_31950 328 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 2168 2650 gene locus_tag LOCUS_31960 2168 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence0872 884 135 gene locus_tag LOCUS_31970 884 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 214 288 gene locus_tag LOCUS_t00300 214 288 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1489 881 gene locus_tag LOCUS_31980 1489 881 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_31980 1923 1651 gene locus_tag LOCUS_31990 1923 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2402 1929 gene locus_tag LOCUS_32000 2402 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0873 7 2409 gene locus_tag LOCUS_32010 7 2409 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence0874 2135 174 gene locus_tag LOCUS_32020 2135 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827609.1 protein_id gnl|my_center|LOCUS_32020 >Feature sequence0875 1938 943 gene locus_tag LOCUS_32030 1938 943 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence0876 <1 1117 gene locus_tag LOCUS_32040 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925700.1:S9 family peptidase 1174 2643 gene locus_tag LOCUS_32050 1174 2643 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence0877 19 1596 gene locus_tag LOCUS_32060 gene thrS 19 1596 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_32060 1606 2151 gene locus_tag LOCUS_32070 gene infC 1606 2151 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008036.1 protein_id gnl|my_center|LOCUS_32070 2276 2473 gene locus_tag LOCUS_32080 gene rpmI 2276 2473 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence0878 <1 1652 gene locus_tag LOCUS_32090 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705583.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 1819 2250 gene locus_tag LOCUS_32100 1819 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence0879 2028 649 gene locus_tag LOCUS_32110 gene atoC 2028 649 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_32110 >Feature sequence0880 2592 127 gene locus_tag LOCUS_32120 2592 127 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence0881 798 1859 gene locus_tag LOCUS_32130 gene holA 798 1859 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947076.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence0882 533 195 gene locus_tag LOCUS_32140 gene rplT 533 195 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_32140 732 535 gene locus_tag LOCUS_32150 732 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1261 635 gene locus_tag LOCUS_32160 1261 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1651 1322 gene locus_tag LOCUS_32170 1651 1322 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_32170 2652 1687 gene locus_tag LOCUS_32180 2652 1687 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence0883 1065 1313 gene locus_tag LOCUS_32190 1065 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 1310 2053 gene locus_tag LOCUS_32200 1310 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence0884 175 1338 gene locus_tag LOCUS_32210 175 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0885 1880 2515 gene locus_tag LOCUS_32220 1880 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence0886 276 202 gene locus_tag LOCUS_t00310 276 202 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 694 308 gene locus_tag LOCUS_32230 694 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 877 722 gene locus_tag LOCUS_32240 877 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 1695 895 gene locus_tag LOCUS_32250 1695 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 2218 1685 gene locus_tag LOCUS_32260 2218 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence0887 1099 596 gene locus_tag LOCUS_32270 gene sixA 1099 596 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_32270 <2662 1318 gene locus_tag LOCUS_32280 <2662 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966553.1:leucine-rich repeat domain-containing protein >Feature sequence0888 221 1744 gene locus_tag LOCUS_32290 gene istA 221 1744 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_32290 1755 2504 gene locus_tag LOCUS_32300 gene istB 1755 2504 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence0889 <1 2031 gene locus_tag LOCUS_32310 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926964.1:sodium-translocating pyrophosphatase >Feature sequence0890 252 764 gene locus_tag LOCUS_32320 252 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 851 1033 gene locus_tag LOCUS_32330 851 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1156 2442 gene locus_tag LOCUS_32340 1156 2442 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence0891 175 1050 gene locus_tag LOCUS_32350 gene era 175 1050 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_32350 1282 1917 gene locus_tag LOCUS_32360 gene queE 1282 1917 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_32360 2185 2319 gene locus_tag LOCUS_32370 2185 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence0892 86 670 gene locus_tag LOCUS_32380 86 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 1185 856 gene locus_tag LOCUS_32390 1185 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1677 2333 gene locus_tag LOCUS_32400 1677 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence0893 207 13 gene locus_tag LOCUS_32410 207 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 546 376 gene locus_tag LOCUS_32420 546 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 782 612 gene locus_tag LOCUS_32430 782 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 966 835 gene locus_tag LOCUS_32440 966 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 1291 977 gene locus_tag LOCUS_32450 1291 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1339 1485 gene locus_tag LOCUS_32460 1339 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1581 1790 gene locus_tag LOCUS_32470 1581 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence0894 264 2462 gene locus_tag LOCUS_32480 264 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0895 923 1108 gene locus_tag LOCUS_32490 923 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 1151 2311 gene locus_tag LOCUS_32500 1151 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0896 33 293 gene locus_tag LOCUS_32510 33 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 300 773 gene locus_tag LOCUS_32520 gene rplI 300 773 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_32520 886 2235 gene locus_tag LOCUS_32530 gene dnaB 886 2235 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_32530 2571 2263 gene locus_tag LOCUS_32540 2571 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0897 1032 256 gene locus_tag LOCUS_32550 1032 256 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_32550 2574 1252 gene locus_tag LOCUS_32560 2574 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence0898 1040 375 gene locus_tag LOCUS_32570 1040 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 1684 1172 gene locus_tag LOCUS_32580 1684 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2427 1699 gene locus_tag LOCUS_32590 2427 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0899 810 1397 gene locus_tag LOCUS_32600 810 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1394 2092 gene locus_tag LOCUS_32610 1394 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence0900 438 1703 gene locus_tag LOCUS_32620 438 1703 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence0901 336 2375 gene locus_tag LOCUS_32630 336 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence0902 <1 1307 gene locus_tag LOCUS_32640 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582791.1:glycoside hydrolase family 140 protein 1523 2533 gene locus_tag LOCUS_32650 1523 2533 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence0903 1300 134 gene locus_tag LOCUS_32660 1300 134 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_32660 2375 1662 gene locus_tag LOCUS_32670 2375 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence0904 451 843 gene locus_tag LOCUS_32680 451 843 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927170.1 protein_id gnl|my_center|LOCUS_32680 969 2345 gene locus_tag LOCUS_32690 969 2345 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence0905 77 586 gene locus_tag LOCUS_32700 77 586 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_32700 682 1098 gene locus_tag LOCUS_32710 682 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 <2647 1420 gene locus_tag LOCUS_32720 <2647 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0906 670 404 gene locus_tag LOCUS_32730 670 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 784 2307 gene locus_tag LOCUS_32740 784 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence0907 1110 385 gene locus_tag LOCUS_32750 gene hisA 1110 385 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_32750 2198 1533 gene locus_tag LOCUS_32760 2198 1533 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142340.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence0908 115 696 gene locus_tag LOCUS_32770 115 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1157 852 gene locus_tag LOCUS_32780 gene nirD 1157 852 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327329.1 protein_id gnl|my_center|LOCUS_32780 1982 1176 gene locus_tag LOCUS_32790 1982 1176 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384819.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0909 881 66 gene locus_tag LOCUS_32800 gene cdaA 881 66 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_32800 1747 893 gene locus_tag LOCUS_32810 gene folP 1747 893 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_32810 2633 1893 gene locus_tag LOCUS_32820 2633 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence0910 174 55 gene locus_tag LOCUS_32830 174 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 2009 255 gene locus_tag LOCUS_32840 2009 255 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence0911 58 1122 gene locus_tag LOCUS_32850 58 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1131 1685 gene locus_tag LOCUS_32860 1131 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1687 1896 gene locus_tag LOCUS_32870 1687 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 2391 2077 gene locus_tag LOCUS_32880 2391 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0912 1158 883 gene locus_tag LOCUS_32890 gene pqqD 1158 883 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229607.1 protein_id gnl|my_center|LOCUS_32890 1939 1151 gene locus_tag LOCUS_32900 gene pqqC 1939 1151 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038061.1 protein_id gnl|my_center|LOCUS_32900 <2633 1992 gene locus_tag LOCUS_32910 <2633 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532075.1:pyrroloquinoline quinone biosynthesis protein PqqB >Feature sequence0913 <1 1979 gene locus_tag LOCUS_32920 <1 1979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0914 <1 871 gene locus_tag LOCUS_32930 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein 922 2112 gene locus_tag LOCUS_32940 922 2112 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193083.1 protein_id gnl|my_center|LOCUS_32940 >Feature sequence0915 855 460 gene locus_tag LOCUS_32950 855 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence0916 >Feature sequence0917 <1 2163 gene locus_tag LOCUS_32960 <1 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229117.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence0918 1563 160 gene locus_tag LOCUS_32970 1563 160 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099715.1 protein_id gnl|my_center|LOCUS_32970 2516 1743 gene locus_tag LOCUS_32980 gene fabG 2516 1743 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence0919 <1 1689 gene locus_tag LOCUS_32990 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978867.1:radical SAM protein 2074 1793 gene locus_tag LOCUS_33000 2074 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 2009 2296 gene locus_tag LOCUS_33010 2009 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence0920 1179 2492 gene locus_tag LOCUS_33020 1179 2492 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence0921 <1 2055 gene locus_tag LOCUS_33030 <1 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768344.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0922 >Feature sequence0923 <1 1370 gene locus_tag LOCUS_33040 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189933.1:tetratricopeptide repeat protein >Feature sequence0924 365 556 gene locus_tag LOCUS_33050 365 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 858 1334 gene locus_tag LOCUS_33060 858 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence0925 217 2280 gene locus_tag LOCUS_33070 217 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence0926 195 1826 gene locus_tag LOCUS_33080 195 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence0927 375 1016 gene locus_tag LOCUS_33090 375 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1825 1196 gene locus_tag LOCUS_33100 1825 1196 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200392305.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence0928 1277 1023 gene locus_tag LOCUS_33110 1277 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 1446 1288 gene locus_tag LOCUS_33120 1446 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 1677 1456 gene locus_tag LOCUS_33130 gene rpmE 1677 1456 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence0929 1823 807 gene locus_tag LOCUS_33140 1823 807 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence0930 1271 516 gene locus_tag LOCUS_33150 gene mtgA 1271 516 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_33150 <2596 1322 gene locus_tag LOCUS_33160 <2596 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941272.1:phosphoribosylamine--glycine ligase >Feature sequence0931 114 2408 gene locus_tag LOCUS_33170 114 2408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537646.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence0932 196 780 gene locus_tag LOCUS_33180 196 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 746 1060 gene locus_tag LOCUS_33190 746 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1084 2370 gene locus_tag LOCUS_33200 1084 2370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence0933 1933 77 gene locus_tag LOCUS_33210 1933 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 <2588 1930 gene locus_tag LOCUS_33220 <2588 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962745.1:ABC transporter ATP-binding protein >Feature sequence0934 1486 1668 gene locus_tag LOCUS_33230 1486 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 1672 1797 gene locus_tag LOCUS_33240 1672 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1800 1988 gene locus_tag LOCUS_33250 1800 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 1993 2376 gene locus_tag LOCUS_33260 1993 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence0935 70 2391 gene locus_tag LOCUS_33270 70 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 2372 2569 gene locus_tag LOCUS_33280 2372 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence0936 2417 816 gene locus_tag LOCUS_33290 2417 816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957831.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence0937 846 58 gene locus_tag LOCUS_33300 gene argB 846 58 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310227.1 protein_id gnl|my_center|LOCUS_33300 2045 1008 gene locus_tag LOCUS_33310 gene argC 2045 1008 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence0938 479 1381 gene locus_tag LOCUS_33320 gene dapA 479 1381 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172098.1 protein_id gnl|my_center|LOCUS_33320 1406 2152 gene locus_tag LOCUS_33330 1406 2152 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence0939 1564 2313 gene locus_tag LOCUS_33340 1564 2313 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence0940 1136 336 gene locus_tag LOCUS_33350 1136 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 2533 1133 gene locus_tag LOCUS_33360 2533 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence0941 2515 1388 gene locus_tag LOCUS_33370 gene murG 2515 1388 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence0942 >Feature sequence0943 552 962 gene locus_tag LOCUS_33380 552 962 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_33380 2117 1248 gene locus_tag LOCUS_33390 gene trxA 2117 1248 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence0944 <1 936 gene locus_tag LOCUS_33400 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085385.1:HAMP domain-containing protein >Feature sequence0945 62 229 gene locus_tag LOCUS_33410 62 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 1202 318 gene locus_tag LOCUS_33420 1202 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2162 1251 gene locus_tag LOCUS_33430 2162 1251 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence0946 1825 1091 gene locus_tag LOCUS_33440 1825 1091 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_33440 1979 1836 gene locus_tag LOCUS_33450 1979 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2562 2116 gene locus_tag LOCUS_33460 2562 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence0947 <1 927 gene locus_tag LOCUS_33470 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880679.1:tetratricopeptide repeat-containing sulfotransferase family protein 1075 1284 gene locus_tag LOCUS_33480 1075 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 1626 2213 gene locus_tag LOCUS_33490 1626 2213 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence0948 369 2354 gene locus_tag LOCUS_33500 369 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence0949 <1 1333 gene locus_tag LOCUS_33510 <1 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259409.1:family 78 glycoside hydrolase catalytic domain >Feature sequence0950 3 1238 gene locus_tag LOCUS_33520 3 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 1381 1953 gene locus_tag LOCUS_33530 gene folE 1381 1953 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_33530 >Feature sequence0951 <1 1345 gene locus_tag LOCUS_33540 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931831.1:DUF1015 domain-containing protein 1417 2265 gene locus_tag LOCUS_33550 1417 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 18 227 gene locus_tag LOCUS_33560 18 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1483 317 gene locus_tag LOCUS_33570 1483 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 2059 1490 gene locus_tag LOCUS_33580 2059 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence0956 1379 924 gene locus_tag LOCUS_33590 1379 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 1842 1651 gene locus_tag LOCUS_33600 1842 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence0957 >Feature sequence0958 145 1326 gene locus_tag LOCUS_33610 145 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence0959 <2512 1942 gene locus_tag LOCUS_33620 <2512 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943755.1:PBP1A family penicillin-binding protein >Feature sequence0960 >Feature sequence0961 1318 107 gene locus_tag LOCUS_33630 1318 107 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_33630 <2509 1352 gene locus_tag LOCUS_33640 <2509 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003124441.1:ATP-binding protein >Feature sequence0962 414 1379 gene locus_tag LOCUS_33650 414 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 <2509 2003 gene locus_tag LOCUS_33660 <2509 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888357.1:Uma2 family endonuclease >Feature sequence0963 1064 114 gene locus_tag LOCUS_33670 1064 114 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_33670 2317 1061 gene locus_tag LOCUS_33680 2317 1061 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764772.1 protein_id gnl|my_center|LOCUS_33680 >Feature sequence0964 1145 63 gene locus_tag LOCUS_33690 gene cobT 1145 63 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_33690 2161 1145 gene locus_tag LOCUS_33700 2161 1145 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence0965 >Feature sequence0966 1054 470 gene locus_tag LOCUS_33710 1054 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence0967 2 781 gene locus_tag LOCUS_33720 2 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 937 2172 gene locus_tag LOCUS_33730 937 2172 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence0968 382 224 gene locus_tag LOCUS_33740 382 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 412 624 gene locus_tag LOCUS_33750 412 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 702 1811 gene locus_tag LOCUS_33760 gene gcvT 702 1811 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_33760 1947 2339 gene locus_tag LOCUS_33770 gene gcvH 1947 2339 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence0969 161 406 gene locus_tag LOCUS_33780 161 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 403 798 gene locus_tag LOCUS_33790 403 798 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_33790 980 801 gene locus_tag LOCUS_33800 980 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1046 2050 gene locus_tag LOCUS_33810 1046 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence0970 1305 28 gene locus_tag LOCUS_33820 1305 28 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_33820 2322 1417 gene locus_tag LOCUS_33830 2322 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence0971 953 735 gene locus_tag LOCUS_33840 953 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33840 2009 1140 gene locus_tag LOCUS_33850 2009 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence0972 1572 250 gene locus_tag LOCUS_33860 gene ltrA 1572 250 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence0973 1977 553 gene locus_tag LOCUS_33870 1977 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence0974 484 245 gene locus_tag LOCUS_33880 484 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 368 1819 gene locus_tag LOCUS_33890 368 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 >Feature sequence0975 2083 41 gene locus_tag LOCUS_33900 2083 41 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256956.1 protein_id gnl|my_center|LOCUS_33900 >Feature sequence0976 1014 193 gene locus_tag LOCUS_33910 1014 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 1704 1081 gene locus_tag LOCUS_33920 1704 1081 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_33920 <2469 1797 gene locus_tag LOCUS_33930 <2469 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939333.1:methionine--tRNA ligase >Feature sequence0977 1152 295 gene locus_tag LOCUS_33940 1152 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1496 1816 gene locus_tag LOCUS_33950 1496 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 1829 2122 gene locus_tag LOCUS_33960 1829 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence0978 2302 398 gene locus_tag LOCUS_33970 2302 398 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence0979 1012 1275 gene locus_tag LOCUS_33980 1012 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1443 2135 gene locus_tag LOCUS_33990 1443 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence0980 379 2178 gene locus_tag LOCUS_34000 379 2178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence0981 1678 47 gene locus_tag LOCUS_34010 1678 47 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence0982 <2462 702 gene locus_tag LOCUS_34020 <2462 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:TonB-dependent receptor >Feature sequence0983 1020 214 gene locus_tag LOCUS_34030 1020 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1883 1017 gene locus_tag LOCUS_34040 1883 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2282 2064 gene locus_tag LOCUS_34050 2282 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence0984 <1 1253 gene locus_tag LOCUS_34060 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000356440.1:ectonucleotide pyrophosphatase/phosphodiesterase 1679 2353 gene locus_tag LOCUS_34070 1679 2353 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence0985 1229 93 gene locus_tag LOCUS_34080 1229 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 1683 1231 gene locus_tag LOCUS_34090 1683 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence0986 22 768 gene locus_tag LOCUS_34100 22 768 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929490.1 protein_id gnl|my_center|LOCUS_34100 758 1489 gene locus_tag LOCUS_34110 758 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 1501 2013 gene locus_tag LOCUS_34120 1501 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2298 2110 gene locus_tag LOCUS_34130 2298 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence0987 <2455 560 gene locus_tag LOCUS_34140 <2455 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044008002.1:AIPR family protein >Feature sequence0988 1746 1961 gene locus_tag LOCUS_34150 1746 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence0989 <2446 426 gene locus_tag LOCUS_34160 <2446 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967162.1:tetratricopeptide repeat protein >Feature sequence0990 1247 690 gene locus_tag LOCUS_34170 1247 690 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence0991 983 1408 gene locus_tag LOCUS_34180 983 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 1431 2171 gene locus_tag LOCUS_34190 gene ubiE 1431 2171 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence0992 >Feature sequence0993 >Feature sequence0994 1335 943 gene locus_tag LOCUS_34200 1335 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 1773 1919 gene locus_tag LOCUS_34210 1773 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 2000 2194 gene locus_tag LOCUS_34220 2000 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence0995 >Feature sequence0996 1794 1240 gene locus_tag LOCUS_34230 1794 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 1978 2196 gene locus_tag LOCUS_34240 1978 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence0997 1458 1021 gene locus_tag LOCUS_34250 1458 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence0998 497 285 gene locus_tag LOCUS_34260 497 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 787 533 gene locus_tag LOCUS_34270 787 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 710 2056 gene locus_tag LOCUS_34280 710 2056 CDS product ISNCY-like element ISMomu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062282354.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence0999 1449 1655 gene locus_tag LOCUS_34290 1449 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence1000 <1 637 gene locus_tag LOCUS_34300 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729502.1:GntR family transcriptional regulator 788 2326 gene locus_tag LOCUS_34310 gene hutH 788 2326 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_34310 >Feature sequence1001 <1 1566 gene locus_tag LOCUS_34320 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940909.1:Tex family protein >Feature sequence1002 241 915 gene locus_tag LOCUS_34330 241 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 923 1987 gene locus_tag LOCUS_34340 923 1987 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957839.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence1003 1019 546 gene locus_tag LOCUS_34350 1019 546 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_34350 1713 1057 gene locus_tag LOCUS_34360 1713 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence1004 1765 128 gene locus_tag LOCUS_34370 1765 128 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_34370 <2415 1843 gene locus_tag LOCUS_34380 <2415 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838531.1:sulfurtransferase >Feature sequence1005 <2411 231 gene locus_tag LOCUS_34390 <2411 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease >Feature sequence1006 719 2020 gene locus_tag LOCUS_34400 719 2020 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_34400 2046 2297 gene locus_tag LOCUS_34410 2046 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence1007 >Feature sequence1008 1138 881 gene locus_tag LOCUS_34420 1138 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 <2401 1572 gene locus_tag LOCUS_34430 <2401 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119960.1:TolC family protein >Feature sequence1009 393 1157 gene locus_tag LOCUS_34440 393 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 1461 2279 gene locus_tag LOCUS_34450 gene ybgF 1461 2279 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545231.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence1010 418 1296 gene locus_tag LOCUS_34460 418 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 1380 1895 gene locus_tag LOCUS_34470 1380 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence1011 653 3 gene locus_tag LOCUS_34480 653 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 958 758 gene locus_tag LOCUS_34490 958 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 1073 2065 gene locus_tag LOCUS_34500 1073 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence1012 180 1040 gene locus_tag LOCUS_34510 180 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence1013 116 1105 gene locus_tag LOCUS_34520 116 1105 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193758.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence1014 2168 1590 gene locus_tag LOCUS_34530 2168 1590 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence1015 1742 198 gene locus_tag LOCUS_34540 gene istA 1742 198 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_34540 >Feature sequence1016 1080 10 gene locus_tag LOCUS_34550 1080 10 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_34550 1985 1113 gene locus_tag LOCUS_34560 1985 1113 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084962.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence1017 147 1265 gene locus_tag LOCUS_34570 147 1265 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_34570 1825 1517 gene locus_tag LOCUS_34580 1825 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 2287 1913 gene locus_tag LOCUS_34590 2287 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence1018 236 1732 gene locus_tag LOCUS_34600 236 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence1019 >Feature sequence1020 1073 828 gene locus_tag LOCUS_34610 1073 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 <2371 1279 gene locus_tag LOCUS_34620 <2371 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104349.1:sigma 54-interacting transcriptional regulator >Feature sequence1021 207 13 gene locus_tag LOCUS_34630 207 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 737 1618 gene locus_tag LOCUS_34640 737 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1814 2119 gene locus_tag LOCUS_34650 1814 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975314.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence1022 165 1157 gene locus_tag LOCUS_34660 165 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1564 1986 gene locus_tag LOCUS_34670 1564 1986 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338337.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence1023 >Feature sequence1024 2179 461 gene locus_tag LOCUS_34680 2179 461 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence1025 >Feature sequence1026 1619 594 gene locus_tag LOCUS_34690 1619 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 2287 1919 gene locus_tag LOCUS_34700 2287 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence1027 >Feature sequence1028 636 139 gene locus_tag LOCUS_34710 636 139 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_34710 2349 730 gene locus_tag LOCUS_34720 gene ggt 2349 730 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_34720 >Feature sequence1029 67 1170 gene locus_tag LOCUS_34730 67 1170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_34730 1503 2222 gene locus_tag LOCUS_34740 1503 2222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence1030 223 1116 gene locus_tag LOCUS_34750 223 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 1579 2268 gene locus_tag LOCUS_34760 1579 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence1031 2259 1714 gene locus_tag LOCUS_34770 2259 1714 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_34770 >Feature sequence1032 3 1544 gene locus_tag LOCUS_34780 3 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence1033 289 1542 gene locus_tag LOCUS_34790 gene hemL 289 1542 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence1034 <1 1101 gene locus_tag LOCUS_34800 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966475.1:tRNA dihydrouridine synthase DusB >Feature sequence1035 37 321 gene locus_tag LOCUS_34810 37 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 570 2048 gene locus_tag LOCUS_34820 570 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence1036 364 1584 gene locus_tag LOCUS_34830 364 1584 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_34830 >Feature sequence1037 835 341 gene locus_tag LOCUS_34840 835 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34840 2165 939 gene locus_tag LOCUS_34850 2165 939 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence1038 1450 1091 gene locus_tag LOCUS_34860 gene arsC 1450 1091 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675012.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence1039 1728 418 gene locus_tag LOCUS_34870 1728 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence1040 688 1941 gene locus_tag LOCUS_34880 688 1941 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence1041 2099 663 gene locus_tag LOCUS_34890 2099 663 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence1042 <1 1605 gene locus_tag LOCUS_34900 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase 1616 2014 gene locus_tag LOCUS_34910 1616 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 2032 2184 gene locus_tag LOCUS_34920 2032 2184 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence1043 >Feature sequence1044 2 295 gene locus_tag LOCUS_34930 2 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 408 617 gene locus_tag LOCUS_34940 408 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 711 989 gene locus_tag LOCUS_34950 711 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 >Feature sequence1045 >Feature sequence1046 1816 1037 gene locus_tag LOCUS_34960 1816 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence1047 311 1087 gene locus_tag LOCUS_34970 311 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 2160 1291 gene locus_tag LOCUS_34980 2160 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence1048 >Feature sequence1049 1192 92 gene locus_tag LOCUS_34990 1192 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1959 1261 gene locus_tag LOCUS_35000 gene queC 1959 1261 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_35000 >Feature sequence1050 256 2277 gene locus_tag LOCUS_35010 256 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence1051 84 500 gene locus_tag LOCUS_35020 gene rplP 84 500 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_35020 505 708 gene locus_tag LOCUS_35030 gene rpmC 505 708 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_35030 1017 1310 gene locus_tag LOCUS_35040 gene rpsQ 1017 1310 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_35040 1343 1711 gene locus_tag LOCUS_35050 gene rplN 1343 1711 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 protein_id gnl|my_center|LOCUS_35050 1712 2047 gene locus_tag LOCUS_35060 gene rplX 1712 2047 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence1052 696 568 gene locus_tag LOCUS_35070 696 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence1053 2171 69 gene locus_tag LOCUS_35080 gene polA 2171 69 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence1054 2136 37 gene locus_tag LOCUS_35090 2136 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence1055 <2294 1676 gene locus_tag LOCUS_35100 <2294 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_210190849.1:FG-GAP-like repeat-containing protein >Feature sequence1056 2122 287 gene locus_tag LOCUS_35110 2122 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 >Feature sequence1057 <1 1186 gene locus_tag LOCUS_35120 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041608957.1:transposase 1700 1347 gene locus_tag LOCUS_35130 1700 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence1058 1081 20 gene locus_tag LOCUS_35140 1081 20 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232375.1 protein_id gnl|my_center|LOCUS_35140 <2289 1174 gene locus_tag LOCUS_35150 <2289 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142060.1:threonine synthase >Feature sequence1059 207 533 gene locus_tag LOCUS_35160 207 533 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_35160 536 1048 gene locus_tag LOCUS_35170 536 1048 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_35170 1766 1236 gene locus_tag LOCUS_35180 1766 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2071 1799 gene locus_tag LOCUS_35190 2071 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence1060 >Feature sequence1061 1051 200 gene locus_tag LOCUS_35200 1051 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2139 1048 gene locus_tag LOCUS_35210 2139 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence1062 1694 111 gene locus_tag LOCUS_35220 1694 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence1063 1822 119 gene locus_tag LOCUS_35230 1822 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence1064 492 262 gene locus_tag LOCUS_35240 492 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 522 2006 gene locus_tag LOCUS_35250 522 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence1065 >Feature sequence1066 1286 264 gene locus_tag LOCUS_35260 1286 264 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256958.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence1067 76 3 gene locus_tag LOCUS_t00320 76 3 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 163 88 gene locus_tag LOCUS_t00330 163 88 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 247 167 gene locus_tag LOCUS_t00340 247 167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 335 258 gene locus_tag LOCUS_t00350 335 258 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 432 348 gene locus_tag LOCUS_t00360 432 348 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 688 599 gene locus_tag LOCUS_t00370 688 599 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 779 705 gene locus_tag LOCUS_t00380 779 705 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 881 797 gene locus_tag LOCUS_t00390 881 797 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2099 1548 gene locus_tag LOCUS_35270 2099 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence1068 654 1190 gene locus_tag LOCUS_35280 654 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 1373 1816 gene locus_tag LOCUS_35290 1373 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1813 2004 gene locus_tag LOCUS_35300 1813 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 >Feature sequence1069 >Feature sequence1070 1583 234 gene locus_tag LOCUS_35310 1583 234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_35310 1825 1580 gene locus_tag LOCUS_35320 1825 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence1071 182 1936 gene locus_tag LOCUS_35330 182 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence1072 2037 430 gene locus_tag LOCUS_35340 gene gguA 2037 430 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_35340 >Feature sequence1073 202 609 gene locus_tag LOCUS_35350 202 609 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 protein_id gnl|my_center|LOCUS_35350 651 2114 gene locus_tag LOCUS_35360 651 2114 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_35360 >Feature sequence1074 2192 1581 gene locus_tag LOCUS_35370 2192 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence1075 672 890 gene locus_tag LOCUS_35380 672 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 890 1225 gene locus_tag LOCUS_35390 gene mazF9 890 1225 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_35390 2194 1268 gene locus_tag LOCUS_35400 2194 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence1076 <1 2211 gene locus_tag LOCUS_35410 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890485.1:class I SAM-dependent DNA methyltransferase >Feature sequence1077 >Feature sequence1078 1 1395 gene locus_tag LOCUS_35420 1 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 <2257 1633 gene locus_tag LOCUS_35430 <2257 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000371.1:PQQ-dependent methanol/ethanol family dehydrogenase >Feature sequence1079 <1 2130 gene locus_tag LOCUS_35440 <1 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:TonB-dependent receptor >Feature sequence1080 <2255 1491 gene locus_tag LOCUS_35450 <2255 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226829.1:MoxR family ATPase >Feature sequence1081 3 254 gene locus_tag LOCUS_35460 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 1380 439 gene locus_tag LOCUS_35470 1380 439 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_35470 1825 1406 gene locus_tag LOCUS_35480 1825 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence1082 318 647 gene locus_tag LOCUS_35490 318 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 1078 1947 gene locus_tag LOCUS_35500 1078 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence1083 >Feature sequence1084 429 2000 gene locus_tag LOCUS_35510 gene hutU 429 2000 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence1085 176 2059 gene locus_tag LOCUS_35520 176 2059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_35520 >Feature sequence1086 1357 260 gene locus_tag LOCUS_35530 1357 260 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976288.1 protein_id gnl|my_center|LOCUS_35530 2244 1402 gene locus_tag LOCUS_35540 2244 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence1087 >Feature sequence1088 791 129 gene locus_tag LOCUS_35550 791 129 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165548.1 protein_id gnl|my_center|LOCUS_35550 2048 1182 gene locus_tag LOCUS_35560 2048 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence1089 267 1664 gene locus_tag LOCUS_35570 gene cysS 267 1664 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_35570 1745 2086 gene locus_tag LOCUS_35580 1745 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 2232 2083 gene locus_tag LOCUS_35590 2232 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence1090 >Feature sequence1091 1936 218 gene locus_tag LOCUS_35600 1936 218 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence1092 105 797 gene locus_tag LOCUS_35610 105 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35610 807 959 gene locus_tag LOCUS_35620 807 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 950 2047 gene locus_tag LOCUS_35630 950 2047 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_35630 >Feature sequence1093 >Feature sequence1094 1764 937 gene locus_tag LOCUS_35640 1764 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 >Feature sequence1095 291 851 gene locus_tag LOCUS_35650 291 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 >Feature sequence1096 2171 90 gene locus_tag LOCUS_35660 2171 90 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence1097 314 853 gene locus_tag LOCUS_35670 314 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 850 1098 gene locus_tag LOCUS_35680 850 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 1230 1448 gene locus_tag LOCUS_35690 1230 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence1098 452 745 gene locus_tag LOCUS_35700 452 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 742 1437 gene locus_tag LOCUS_35710 742 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 1552 1758 gene locus_tag LOCUS_35720 1552 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence1099 129 257 gene locus_tag LOCUS_35730 129 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence1100 778 1599 gene locus_tag LOCUS_35740 778 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence1101 128 736 gene locus_tag LOCUS_35750 128 736 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_35750 762 1328 gene locus_tag LOCUS_35760 762 1328 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957728.1 protein_id gnl|my_center|LOCUS_35760 2031 1387 gene locus_tag LOCUS_35770 2031 1387 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence1102 2113 1559 gene locus_tag LOCUS_35780 2113 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence1103 >Feature sequence1104 279 1568 gene locus_tag LOCUS_35790 279 1568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942689.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence1105 2095 1250 gene locus_tag LOCUS_35800 2095 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence1106 392 910 gene locus_tag LOCUS_35810 392 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 1854 883 gene locus_tag LOCUS_35820 1854 883 CDS product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence1107 393 557 gene locus_tag LOCUS_35830 393 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 1318 689 gene locus_tag LOCUS_35840 gene rpsD 1318 689 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_35840 1828 1421 gene locus_tag LOCUS_35850 gene rpsK 1828 1421 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701334.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence1108 1593 82 gene locus_tag LOCUS_35860 1593 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 <2216 1600 gene locus_tag LOCUS_35870 <2216 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941539.1:diacylglycerol kinase family protein >Feature sequence1109 1569 295 gene locus_tag LOCUS_35880 1569 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence1110 <2212 25 gene locus_tag LOCUS_35890 <2212 25 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence1111 1093 95 gene locus_tag LOCUS_35900 1093 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1215 1373 gene locus_tag LOCUS_35910 1215 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1599 1477 gene locus_tag LOCUS_35920 1599 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 1751 1596 gene locus_tag LOCUS_35930 1751 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 1817 2044 gene locus_tag LOCUS_35940 1817 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2145 2011 gene locus_tag LOCUS_35950 2145 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 >Feature sequence1112 1 372 gene locus_tag LOCUS_35960 1 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 1104 505 gene locus_tag LOCUS_35970 1104 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 1901 1221 gene locus_tag LOCUS_35980 1901 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence1113 468 106 gene locus_tag LOCUS_35990 468 106 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880109.1 protein_id gnl|my_center|LOCUS_35990 1064 600 gene locus_tag LOCUS_36000 1064 600 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_36000 2047 1061 gene locus_tag LOCUS_36010 2047 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence1114 408 1292 gene locus_tag LOCUS_36020 408 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 1562 1882 gene locus_tag LOCUS_36030 1562 1882 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212347691.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence1115 110 856 gene locus_tag LOCUS_36040 110 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 853 1194 gene locus_tag LOCUS_36050 853 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 1191 1628 gene locus_tag LOCUS_36060 1191 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 1975 1718 gene locus_tag LOCUS_36070 1975 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence1116 <2198 623 gene locus_tag LOCUS_36080 <2198 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262844.1:glycosyltransferase family 2 protein >Feature sequence1117 >Feature sequence1118 1346 1540 gene locus_tag LOCUS_36090 1346 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence1119 <2189 1429 gene locus_tag LOCUS_36100 <2189 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965611.1:flippase >Feature sequence1120 >Feature sequence1121 1315 875 gene locus_tag LOCUS_36110 1315 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 1498 1337 gene locus_tag LOCUS_36120 1498 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence1122 368 81 gene locus_tag LOCUS_36130 368 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 614 751 gene locus_tag LOCUS_36140 614 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 1988 861 gene locus_tag LOCUS_36150 1988 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence1123 384 695 gene locus_tag LOCUS_36160 384 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 721 1017 gene locus_tag LOCUS_36170 721 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1047 1985 gene locus_tag LOCUS_36180 1047 1985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence1124 <1 889 gene locus_tag LOCUS_36190 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210221.1:sugar ABC transporter permease >Feature sequence1125 2176 1187 gene locus_tag LOCUS_36200 2176 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence1126 969 208 gene locus_tag LOCUS_36210 969 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 1424 972 gene locus_tag LOCUS_36220 gene smpB 1424 972 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence1127 >Feature sequence1128 522 1697 gene locus_tag LOCUS_36230 522 1697 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_36230 1979 1827 gene locus_tag LOCUS_36240 1979 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1129 1418 237 gene locus_tag LOCUS_36250 1418 237 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_36250 2166 1615 gene locus_tag LOCUS_36260 2166 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 >Feature sequence1130 1229 273 gene locus_tag LOCUS_36270 1229 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 <2166 1226 gene locus_tag LOCUS_36280 <2166 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544988.1:M48 family metalloprotease >Feature sequence1131 1007 180 gene locus_tag LOCUS_36290 1007 180 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025991008.1 protein_id gnl|my_center|LOCUS_36290 <2163 1258 gene locus_tag LOCUS_36300 <2163 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140637.1:hybrid sensor histidine kinase/response regulator >Feature sequence1132 1160 159 gene locus_tag LOCUS_36310 1160 159 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_36310 2161 1157 gene locus_tag LOCUS_36320 2161 1157 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_36320 >Feature sequence1133 <1 870 gene locus_tag LOCUS_36330 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030222.1:methylmalonyl Co-A mutase-associated GTPase MeaB 960 1364 gene locus_tag LOCUS_36340 gene mce 960 1364 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence1134 1122 355 gene locus_tag LOCUS_36350 1122 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 1283 1420 gene locus_tag LOCUS_36360 1283 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 <2159 1644 gene locus_tag LOCUS_36370 <2159 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037397899.1:mannonate dehydratase >Feature sequence1135 >Feature sequence1136 149 2035 gene locus_tag LOCUS_36380 149 2035 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_36380 >Feature sequence1137 338 1591 gene locus_tag LOCUS_36390 338 1591 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_36390 2008 1601 gene locus_tag LOCUS_36400 2008 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence1138 2059 605 gene locus_tag LOCUS_36410 2059 605 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence1139 >Feature sequence1140 242 442 gene locus_tag LOCUS_36420 242 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 643 2025 gene locus_tag LOCUS_36430 643 2025 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence1141 374 892 gene locus_tag LOCUS_36440 gene casB 374 892 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227613.1 protein_id gnl|my_center|LOCUS_36440 889 2070 gene locus_tag LOCUS_36450 gene cas7e 889 2070 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_36450 >Feature sequence1142 566 2026 gene locus_tag LOCUS_36460 566 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence1143 984 400 gene locus_tag LOCUS_36470 984 400 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_36470 1161 1556 gene locus_tag LOCUS_36480 1161 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence1144 209 400 gene locus_tag LOCUS_36490 209 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence1145 2078 210 gene locus_tag LOCUS_36500 2078 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence1146 531 241 gene locus_tag LOCUS_36510 531 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 828 586 gene locus_tag LOCUS_36520 828 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 1375 995 gene locus_tag LOCUS_36530 1375 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 1588 1385 gene locus_tag LOCUS_36540 1588 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 1736 1485 gene locus_tag LOCUS_36550 1736 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 1966 1733 gene locus_tag LOCUS_36560 1966 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1147 209 1234 gene locus_tag LOCUS_36570 209 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1189 1113 gene locus_tag LOCUS_t00400 1189 1113 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1148 508 224 gene locus_tag LOCUS_36580 gene cas2 508 224 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_36580 1596 565 gene locus_tag LOCUS_36590 gene cas1c 1596 565 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence1149 1470 55 gene locus_tag LOCUS_36600 1470 55 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_36600 <2141 1467 gene locus_tag LOCUS_36610 <2141 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119785.1:DNA polymerase IV >Feature sequence1150 1370 2131 gene locus_tag LOCUS_36620 1370 2131 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_36620 >Feature sequence1151 154 360 gene locus_tag LOCUS_36630 154 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 760 1092 gene locus_tag LOCUS_36640 760 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence1152 <1 772 gene locus_tag LOCUS_36650 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582443.1:nucleotide exchange factor GrpE 1720 761 gene locus_tag LOCUS_36660 1720 761 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_36660 >Feature sequence1153 >Feature sequence1154 103 360 gene locus_tag LOCUS_36670 103 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence1155 1791 109 gene locus_tag LOCUS_36680 1791 109 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721578.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence1156 604 449 gene locus_tag LOCUS_36690 604 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 1732 620 gene locus_tag LOCUS_36700 1732 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence1157 311 1918 gene locus_tag LOCUS_36710 311 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence1158 555 268 gene locus_tag LOCUS_36720 555 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 1099 713 gene locus_tag LOCUS_36730 1099 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 1311 1096 gene locus_tag LOCUS_36740 1311 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1776 1423 gene locus_tag LOCUS_36750 1776 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence1159 339 1079 gene locus_tag LOCUS_36760 339 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 1287 1430 gene locus_tag LOCUS_36770 1287 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1160 618 1298 gene locus_tag LOCUS_36780 618 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 1336 1953 gene locus_tag LOCUS_36790 1336 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence1161 1865 771 gene locus_tag LOCUS_36800 1865 771 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence1162 <1 951 gene locus_tag LOCUS_36810 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141900.1:tetratricopeptide repeat protein 1283 1837 gene locus_tag LOCUS_36820 1283 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 1821 2063 gene locus_tag LOCUS_36830 1821 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence1163 125 1924 gene locus_tag LOCUS_36840 125 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence1164 136 891 gene locus_tag LOCUS_36850 136 891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529934.1 protein_id gnl|my_center|LOCUS_36850 998 2023 gene locus_tag LOCUS_36860 998 2023 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_36860 >Feature sequence1165 478 771 gene locus_tag LOCUS_36870 478 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 1782 790 gene locus_tag LOCUS_36880 gene galM 1782 790 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence1166 216 842 gene locus_tag LOCUS_36890 216 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 859 1596 gene locus_tag LOCUS_36900 859 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 1593 2033 gene locus_tag LOCUS_36910 1593 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence1167 420 788 gene locus_tag LOCUS_36920 420 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 801 1217 gene locus_tag LOCUS_36930 801 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2099 1107 gene locus_tag LOCUS_36940 2099 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence1168 75 165 gene locus_tag LOCUS_t00410 75 165 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1328 396 gene locus_tag LOCUS_36950 1328 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence1169 1932 280 gene locus_tag LOCUS_36960 1932 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2111 1929 gene locus_tag LOCUS_36970 2111 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence1170 <2112 979 gene locus_tag LOCUS_36980 <2112 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein >Feature sequence1171 1122 2042 gene locus_tag LOCUS_36990 1122 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 >Feature sequence1172 61 157 gene locus_tag LOCUS_t00420 61 157 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1173 66 407 gene locus_tag LOCUS_37000 66 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 408 1595 gene locus_tag LOCUS_37010 408 1595 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_37010 >Feature sequence1174 >Feature sequence1175 229 1041 gene locus_tag LOCUS_37020 229 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 1162 1497 gene locus_tag LOCUS_37030 1162 1497 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140928.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence1176 <2102 702 gene locus_tag LOCUS_37040 <2102 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119511.1:biosynthetic arginine decarboxylase >Feature sequence1177 1897 1778 gene locus_tag LOCUS_37050 1897 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence1178 527 1432 gene locus_tag LOCUS_37060 527 1432 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065352.1 protein_id gnl|my_center|LOCUS_37060 1539 1796 gene locus_tag LOCUS_37070 1539 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence1179 >Feature sequence1180 813 691 gene locus_tag LOCUS_37080 813 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 1497 874 gene locus_tag LOCUS_37090 1497 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence1181 1501 1088 gene locus_tag LOCUS_37100 1501 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 >Feature sequence1182 >Feature sequence1183 415 855 gene locus_tag LOCUS_37110 415 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence1184 1121 279 gene locus_tag LOCUS_37120 1121 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 1442 1266 gene locus_tag LOCUS_37130 1442 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 1817 1614 gene locus_tag LOCUS_37140 1817 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 >Feature sequence1185 1301 72 gene locus_tag LOCUS_37150 1301 72 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence1186 <1 1401 gene locus_tag LOCUS_37160 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392069.1:valine--tRNA ligase >Feature sequence1187 >Feature sequence1188 1549 950 gene locus_tag LOCUS_37170 1549 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 1763 1975 gene locus_tag LOCUS_37180 1763 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 >Feature sequence1189 1740 133 gene locus_tag LOCUS_37190 1740 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 >Feature sequence1190 1926 160 gene locus_tag LOCUS_37200 1926 160 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence1191 >Feature sequence1192 1617 241 gene locus_tag LOCUS_37210 1617 241 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_37210 2073 1783 gene locus_tag LOCUS_37220 2073 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 >Feature sequence1193 804 568 gene locus_tag LOCUS_37230 804 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 >Feature sequence1194 741 166 gene locus_tag LOCUS_37240 741 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1053 1838 gene locus_tag LOCUS_37250 1053 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence1195 1381 323 gene locus_tag LOCUS_37260 1381 323 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970799.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence1196 <1 1937 gene locus_tag LOCUS_37270 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence1197 910 443 gene locus_tag LOCUS_37280 910 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 1804 1361 gene locus_tag LOCUS_37290 1804 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence1198 311 1411 gene locus_tag LOCUS_37300 311 1411 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_37300 1619 1744 gene locus_tag LOCUS_37310 1619 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence1199 >Feature sequence1200 404 922 gene locus_tag LOCUS_37320 404 922 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_37320 939 1910 gene locus_tag LOCUS_37330 939 1910 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 protein_id gnl|my_center|LOCUS_37330 >Feature sequence1201 174 1580 gene locus_tag LOCUS_37340 gene selA 174 1580 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_37340 1818 1669 gene locus_tag LOCUS_37350 1818 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 1777 1908 gene locus_tag LOCUS_37360 1777 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence1202 328 1698 gene locus_tag LOCUS_37370 328 1698 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence1203 >Feature sequence1204 903 127 gene locus_tag LOCUS_37380 903 127 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_37380 2051 1140 gene locus_tag LOCUS_37390 2051 1140 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence1205 159 1574 gene locus_tag LOCUS_37400 159 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence1206 1149 1 gene locus_tag LOCUS_37410 1149 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence1207 <1 1196 gene locus_tag LOCUS_37420 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119960.1:TolC family protein 1257 1613 gene locus_tag LOCUS_37430 1257 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 >Feature sequence1208 2054 1320 gene locus_tag LOCUS_37440 2054 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence1209 >Feature sequence1210 165 1985 gene locus_tag LOCUS_37450 165 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence1211 <1 993 gene locus_tag LOCUS_37460 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142259.1:peptide MFS transporter >Feature sequence1212 >Feature sequence1213 1280 108 gene locus_tag LOCUS_37470 1280 108 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_37470 >Feature sequence1214 <1 1264 gene locus_tag LOCUS_37480 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein 1856 1332 gene locus_tag LOCUS_37490 1856 1332 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence1215 >Feature sequence1216 1512 166 gene locus_tag LOCUS_37500 1512 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence1217 >Feature sequence1218 <2037 1236 gene locus_tag LOCUS_37510 <2037 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583911.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence1219 1219 197 gene locus_tag LOCUS_37520 1219 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence1220 565 1617 gene locus_tag LOCUS_37530 565 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence1221 >Feature sequence1222 81 1031 gene locus_tag LOCUS_37540 81 1031 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_37540 1032 2033 gene locus_tag LOCUS_37550 1032 2033 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_37550 >Feature sequence1223 >Feature sequence1224 317 727 gene locus_tag LOCUS_37560 317 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 636 1238 gene locus_tag LOCUS_37570 636 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1874 1290 gene locus_tag LOCUS_37580 1874 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence1225 316 390 gene locus_tag LOCUS_t00430 316 390 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 592 1473 gene locus_tag LOCUS_37590 592 1473 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_37590 1791 1516 gene locus_tag LOCUS_37600 1791 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence1226 40 462 gene locus_tag LOCUS_37610 40 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 >Feature sequence1227 299 919 gene locus_tag LOCUS_37620 299 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 2004 1060 gene locus_tag LOCUS_37630 2004 1060 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_37630 >Feature sequence1228 2 178 gene locus_tag LOCUS_37640 2 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 492 202 gene locus_tag LOCUS_37650 492 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 527 910 gene locus_tag LOCUS_37660 527 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 930 1523 gene locus_tag LOCUS_37670 930 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence1229 3 695 gene locus_tag LOCUS_37680 3 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1831 932 gene locus_tag LOCUS_37690 1831 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence1230 435 1628 gene locus_tag LOCUS_37700 435 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence1231 82 1185 gene locus_tag LOCUS_37710 82 1185 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_37710 >Feature sequence1232 1338 841 gene locus_tag LOCUS_37720 1338 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence1233 1495 767 gene locus_tag LOCUS_37730 1495 767 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_37730 >Feature sequence1234 1310 1125 gene locus_tag LOCUS_37740 1310 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 1905 1315 gene locus_tag LOCUS_37750 1905 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 >Feature sequence1235 <2013 702 gene locus_tag LOCUS_37760 <2013 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880932.1:ABC transporter substrate-binding protein >Feature sequence1236 <2011 227 gene locus_tag LOCUS_37770 <2011 227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839612.1:TonB-dependent receptor >Feature sequence1237 1336 1169 gene locus_tag LOCUS_37780 1336 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 1725 1399 gene locus_tag LOCUS_37790 1725 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 >Feature sequence1238 451 1158 gene locus_tag LOCUS_37800 451 1158 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 protein_id gnl|my_center|LOCUS_37800 1145 1804 gene locus_tag LOCUS_37810 1145 1804 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_37810 >Feature sequence1239 1552 239 gene locus_tag LOCUS_37820 1552 239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_37820 >Feature sequence1240 1532 1206 gene locus_tag LOCUS_37830 1532 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 1762 1529 gene locus_tag LOCUS_37840 1762 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence1241 <2001 193 gene locus_tag LOCUS_37850 <2001 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006311047.1:altronate dehydratase family protein >Feature sequence1242 <1 582 gene locus_tag LOCUS_37860 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227844.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 734 1513 gene locus_tag LOCUS_37870 734 1513 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_37870 >Feature sequence1243 1885 380 gene locus_tag LOCUS_37880 1885 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 >Feature sequence1244 1832 252 gene locus_tag LOCUS_37890 gene uxaE 1832 252 CDS product D-tagaturonate epimerase UxaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_37890 >Feature sequence1245 <1 920 gene locus_tag LOCUS_37900 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088347.1:M81 family metallopeptidase <1995 1261 gene locus_tag LOCUS_37910 <1995 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase >Feature sequence1246 >Feature sequence1247 663 1025 gene locus_tag LOCUS_37920 663 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1541 1086 gene locus_tag LOCUS_37930 1541 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence1248 386 1225 gene locus_tag LOCUS_37940 386 1225 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence1249 583 1533 gene locus_tag LOCUS_37950 583 1533 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_37950 >Feature sequence1250 1893 103 gene locus_tag LOCUS_37960 gene fadE 1893 103 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence1251 <1988 704 gene locus_tag LOCUS_37970 <1988 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081154.1:exopolysaccharide transport family protein >Feature sequence1252 368 700 gene locus_tag LOCUS_37980 368 700 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 protein_id gnl|my_center|LOCUS_37980 829 1161 gene locus_tag LOCUS_37990 829 1161 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_37990 1163 1675 gene locus_tag LOCUS_38000 1163 1675 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence1253 1962 151 gene locus_tag LOCUS_38010 1962 151 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence1254 <1 580 gene locus_tag LOCUS_38020 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001243061.1:pyrimidine-nucleoside phosphorylase 825 1676 gene locus_tag LOCUS_38030 825 1676 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_38030 >Feature sequence1255 604 215 gene locus_tag LOCUS_38040 604 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 858 1631 gene locus_tag LOCUS_38050 858 1631 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_38050 >Feature sequence1256 1729 692 gene locus_tag LOCUS_38060 1729 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence1257 1378 44 gene locus_tag LOCUS_38070 1378 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 1776 1363 gene locus_tag LOCUS_38080 1776 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900634.1 protein_id gnl|my_center|LOCUS_38080 >Feature sequence1258 >Feature sequence1259 >Feature sequence1260 1911 499 gene locus_tag LOCUS_38090 1911 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1261 1781 1605 gene locus_tag LOCUS_38100 1781 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence1262 881 420 gene locus_tag LOCUS_38110 881 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 <1971 918 gene locus_tag LOCUS_38120 <1971 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000839519.1:HAMP domain-containing sensor histidine kinase >Feature sequence1263 818 651 gene locus_tag LOCUS_38130 818 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 1921 872 gene locus_tag LOCUS_38140 1921 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence1264 3 407 gene locus_tag LOCUS_38150 3 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1399 449 gene locus_tag LOCUS_38160 gene lipA 1399 449 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_38160 >Feature sequence1265 268 1716 gene locus_tag LOCUS_38170 268 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 >Feature sequence1266 767 363 gene locus_tag LOCUS_38180 gene lysM 767 363 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_38180 1577 786 gene locus_tag LOCUS_38190 1577 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 >Feature sequence1267 1621 140 gene locus_tag LOCUS_38200 1621 140 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_38200 >Feature sequence1268 212 463 gene locus_tag LOCUS_38210 212 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 467 1801 gene locus_tag LOCUS_38220 467 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 >Feature sequence1269 637 1335 gene locus_tag LOCUS_38230 637 1335 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229023.1 protein_id gnl|my_center|LOCUS_38230 >Feature sequence1270 933 454 gene locus_tag LOCUS_38240 933 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence1271 <1 887 gene locus_tag LOCUS_38250 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase >Feature sequence1272 >Feature sequence1273 70 870 gene locus_tag LOCUS_38260 70 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 <1957 1029 gene locus_tag LOCUS_38270 <1957 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator >Feature sequence1274 >Feature sequence1275 >Feature sequence1276 1955 1527 gene locus_tag LOCUS_38280 1955 1527 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815662.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence1277 <1 1305 gene locus_tag LOCUS_38290 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384536.1:RNA polymerase sigma factor RpoD 1343 1717 gene locus_tag LOCUS_38300 1343 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 >Feature sequence1278 >Feature sequence1279 280 1722 gene locus_tag LOCUS_38310 280 1722 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence1280 34 489 gene locus_tag LOCUS_38320 gene rimP 34 489 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence1281 1801 101 gene locus_tag LOCUS_38330 1801 101 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_38330 >Feature sequence1282 1239 829 gene locus_tag LOCUS_38340 1239 829 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_38340 1820 1239 gene locus_tag LOCUS_38350 1820 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence1283 116 192 gene locus_tag LOCUS_t00440 116 192 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1422 241 gene locus_tag LOCUS_38360 1422 241 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905971.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence1284 1008 109 gene locus_tag LOCUS_38370 1008 109 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970449.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence1285 >Feature sequence1286 1911 352 gene locus_tag LOCUS_38380 1911 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence1287 574 206 gene locus_tag LOCUS_38390 574 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1589 1927 gene locus_tag LOCUS_38400 1589 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence1288 1564 254 gene locus_tag LOCUS_38410 1564 254 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436675.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence1289 >Feature sequence1290 307 612 gene locus_tag LOCUS_38420 307 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 716 1879 gene locus_tag LOCUS_38430 716 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence1291 121 1299 gene locus_tag LOCUS_38440 121 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 >Feature sequence1292 667 533 gene locus_tag LOCUS_38450 667 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1526 729 gene locus_tag LOCUS_38460 1526 729 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence1293 1121 1432 gene locus_tag LOCUS_38470 1121 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence1294 1422 1021 gene locus_tag LOCUS_38480 1422 1021 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727731.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence1295 1705 374 gene locus_tag LOCUS_38490 gene hemL 1705 374 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence1296 >Feature sequence1297 1298 420 gene locus_tag LOCUS_38500 1298 420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence1298 1487 888 gene locus_tag LOCUS_38510 1487 888 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_38510 >Feature sequence1299 >Feature sequence1300 456 1616 gene locus_tag LOCUS_38520 456 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence1301 399 1637 gene locus_tag LOCUS_38530 399 1637 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444040.1 protein_id gnl|my_center|LOCUS_38530 >Feature sequence1302 >Feature sequence1303 <1912 908 gene locus_tag LOCUS_38540 <1912 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942602.1:polysaccharide deacetylase family protein >Feature sequence1304 <1 1589 gene locus_tag LOCUS_38550 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241097.1:choline-sulfatase >Feature sequence1305 207 440 gene locus_tag LOCUS_38560 207 440 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070876731.1 protein_id gnl|my_center|LOCUS_38560 1586 522 gene locus_tag LOCUS_38570 1586 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 >Feature sequence1306 670 1632 gene locus_tag LOCUS_38580 670 1632 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_38580 >Feature sequence1307 746 441 gene locus_tag LOCUS_38590 gene nuoK 746 441 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_38590 1243 743 gene locus_tag LOCUS_38600 1243 743 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_38600 1786 1289 gene locus_tag LOCUS_38610 1786 1289 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence1308 612 58 gene locus_tag LOCUS_38620 612 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 984 673 gene locus_tag LOCUS_38630 984 673 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_38630 >Feature sequence1309 374 628 gene locus_tag LOCUS_38640 374 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38640 >Feature sequence1310 180 1574 gene locus_tag LOCUS_38650 180 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 >Feature sequence1311 215 526 gene locus_tag LOCUS_38660 215 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 541 1185 gene locus_tag LOCUS_38670 541 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 >Feature sequence1312 227 1726 gene locus_tag LOCUS_38680 gene rpoN 227 1726 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 1304 1068 gene locus_tag LOCUS_38690 1304 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 1758 1288 gene locus_tag LOCUS_38700 1758 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence1316 <1892 199 gene locus_tag LOCUS_38710 <1892 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869562.1:SpoIVB peptidase S55 domain-containing protein >Feature sequence1317 <1 960 gene locus_tag LOCUS_38720 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880602.1:M48 family metallopeptidase 924 1868 gene locus_tag LOCUS_38730 924 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 >Feature sequence1318 <1 531 gene locus_tag LOCUS_38740 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121858.1:PSD1 and planctomycete cytochrome C domain-containing protein 1695 472 gene locus_tag LOCUS_38750 1695 472 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584031.1 protein_id gnl|my_center|LOCUS_38750 >Feature sequence1319 1689 1441 gene locus_tag LOCUS_38760 1689 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence1320 <1 777 gene locus_tag LOCUS_38770 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679544.1:integron integrase >Feature sequence1321 190 50 gene locus_tag LOCUS_38780 190 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 350 526 gene locus_tag LOCUS_38790 350 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 771 1241 gene locus_tag LOCUS_38800 771 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence1322 1830 559 gene locus_tag LOCUS_38810 1830 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence1323 <1 864 gene locus_tag LOCUS_38820 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876812.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence1324 <1 1371 gene locus_tag LOCUS_38830 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257384.1:O-antigen ligase family protein 1382 1690 gene locus_tag LOCUS_38840 1382 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 40 495 gene locus_tag LOCUS_38850 40 495 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_38850 1605 736 gene locus_tag LOCUS_38860 1605 736 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_38860 >Feature sequence1328 <1 566 gene locus_tag LOCUS_38870 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339547.1:FAD-dependent oxidoreductase 830 1240 gene locus_tag LOCUS_38880 830 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 1635 1811 gene locus_tag LOCUS_38890 1635 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence1329 <1866 834 gene locus_tag LOCUS_38900 <1866 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392247.1:four-carbon acid sugar kinase family protein >Feature sequence1330 1785 79 gene locus_tag LOCUS_38910 1785 79 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029096096.1 protein_id gnl|my_center|LOCUS_38910 >Feature sequence1331 737 1630 gene locus_tag LOCUS_38920 737 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence1332 534 1628 gene locus_tag LOCUS_38930 534 1628 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence1333 491 330 gene locus_tag LOCUS_38940 491 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 <1862 473 gene locus_tag LOCUS_38950 <1862 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922199.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence1334 >Feature sequence1335 <1 1494 gene locus_tag LOCUS_38960 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272172.1:reverse transcriptase domain-containing protein >Feature sequence1336 >Feature sequence1337 420 1442 gene locus_tag LOCUS_38970 420 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence1338 1524 601 gene locus_tag LOCUS_38980 1524 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence1339 2 454 gene locus_tag LOCUS_38990 2 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 473 685 gene locus_tag LOCUS_39000 473 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 844 1149 gene locus_tag LOCUS_39010 844 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 <1856 1297 gene locus_tag LOCUS_39020 <1856 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391561.1:1-phosphofructokinase >Feature sequence1340 1068 640 gene locus_tag LOCUS_39030 1068 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence1341 1311 988 gene locus_tag LOCUS_39040 gene erpA 1311 988 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence1342 >Feature sequence1343 306 1424 gene locus_tag LOCUS_39050 gene tsaD 306 1424 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_39050 1848 1465 gene locus_tag LOCUS_39060 1848 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence1344 >Feature sequence1345 >Feature sequence1346 >Feature sequence1347 1462 305 gene locus_tag LOCUS_39070 1462 305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_39070 >Feature sequence1348 >Feature sequence1349 794 1015 gene locus_tag LOCUS_39080 794 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 1172 1762 gene locus_tag LOCUS_39090 1172 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 >Feature sequence1350 460 1758 gene locus_tag LOCUS_39100 460 1758 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011379003.1 protein_id gnl|my_center|LOCUS_39100 >Feature sequence1351 >Feature sequence1352 >Feature sequence1353 262 1428 gene locus_tag LOCUS_39110 262 1428 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933906.1 protein_id gnl|my_center|LOCUS_39110 >Feature sequence1354 >Feature sequence1355 1235 66 gene locus_tag LOCUS_39120 1235 66 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence1356 609 49 gene locus_tag LOCUS_39130 609 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 1482 1201 gene locus_tag LOCUS_39140 1482 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 >Feature sequence1357 756 1379 gene locus_tag LOCUS_39150 756 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1393 1581 gene locus_tag LOCUS_39160 1393 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 1602 1802 gene locus_tag LOCUS_39170 1602 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 >Feature sequence1358 577 1335 gene locus_tag LOCUS_39180 577 1335 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_39180 >Feature sequence1359 <1 866 gene locus_tag LOCUS_39190 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383504.1:Z1 domain-containing protein >Feature sequence1360 <1 592 gene locus_tag LOCUS_39200 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103865.1:non-ribosomal peptide synthetase >Feature sequence1361 1692 532 gene locus_tag LOCUS_39210 1692 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence1362 481 1284 gene locus_tag LOCUS_39220 481 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1337 1705 gene locus_tag LOCUS_39230 1337 1705 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053204416.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence1363 276 536 gene locus_tag LOCUS_39240 276 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 533 742 gene locus_tag LOCUS_39250 533 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1011 1262 gene locus_tag LOCUS_39260 1011 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1658 1389 gene locus_tag LOCUS_39270 1658 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence1364 93 1313 gene locus_tag LOCUS_39280 93 1313 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_39280 >Feature sequence1365 483 25 gene locus_tag LOCUS_39290 483 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 1085 597 gene locus_tag LOCUS_39300 1085 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 1429 1250 gene locus_tag LOCUS_39310 1429 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 1762 1583 gene locus_tag LOCUS_39320 1762 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 >Feature sequence1366 <1 712 gene locus_tag LOCUS_39330 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829938.1:fructose-bisphosphate aldolase >Feature sequence1367 <1 603 gene locus_tag LOCUS_39340 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950807.1:IS607 family transposase >Feature sequence1368 >Feature sequence1369 <1 957 gene locus_tag LOCUS_39350 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526483.1:sensor histidine kinase 954 1604 gene locus_tag LOCUS_39360 954 1604 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence1370 167 1621 gene locus_tag LOCUS_39370 167 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 >Feature sequence1371 >Feature sequence1372 430 122 gene locus_tag LOCUS_39380 430 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 737 561 gene locus_tag LOCUS_39390 737 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 1398 1198 gene locus_tag LOCUS_39400 1398 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 >Feature sequence1373 >Feature sequence1374 3 1328 gene locus_tag LOCUS_39410 3 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence1375 >Feature sequence1376 560 982 gene locus_tag LOCUS_39420 560 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence1377 78 803 gene locus_tag LOCUS_39430 78 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 892 1686 gene locus_tag LOCUS_39440 892 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence1378 <1802 890 gene locus_tag LOCUS_39450 <1802 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942281.1:amidophosphoribosyltransferase >Feature sequence1379 >Feature sequence1380 703 930 gene locus_tag LOCUS_39460 703 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 927 1274 gene locus_tag LOCUS_39470 927 1274 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_39470 >Feature sequence1381 569 147 gene locus_tag LOCUS_39480 569 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 950 759 gene locus_tag LOCUS_39490 950 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 1215 1685 gene locus_tag LOCUS_39500 1215 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence1382 145 300 gene locus_tag LOCUS_39510 145 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 550 302 gene locus_tag LOCUS_39520 550 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 >Feature sequence1383 1777 1442 gene locus_tag LOCUS_39530 1777 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence1384 515 967 gene locus_tag LOCUS_39540 515 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 1156 1692 gene locus_tag LOCUS_39550 1156 1692 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 protein_id gnl|my_center|LOCUS_39550 >Feature sequence1385 <1794 892 gene locus_tag LOCUS_39560 <1794 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242878.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 1379 1056 gene locus_tag LOCUS_39570 1379 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence1389 535 1050 gene locus_tag LOCUS_39580 535 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 >Feature sequence1390 <1787 162 gene locus_tag LOCUS_39590 <1787 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339387.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence1391 >Feature sequence1392 1523 222 gene locus_tag LOCUS_39600 1523 222 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_39600 >Feature sequence1393 781 1509 gene locus_tag LOCUS_39610 781 1509 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 >Feature sequence1397 <1 587 gene locus_tag LOCUS_39620 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880318.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 716 805 gene locus_tag LOCUS_t00450 716 805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1398 >Feature sequence1399 >Feature sequence1400 >Feature sequence1401 1589 330 gene locus_tag LOCUS_39630 1589 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence1402 >Feature sequence1403 <1770 822 gene locus_tag LOCUS_39640 <1770 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173640842.1:recombinase family protein >Feature sequence1404 1124 39 gene locus_tag LOCUS_39650 1124 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 1246 1395 gene locus_tag LOCUS_39660 1246 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence1405 1587 466 gene locus_tag LOCUS_39670 gene dprA 1587 466 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_39670 >Feature sequence1406 103 1140 gene locus_tag LOCUS_39680 gene gmd 103 1140 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_39680 1147 1713 gene locus_tag LOCUS_39690 gene rfbC 1147 1713 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence1407 944 573 gene locus_tag LOCUS_39700 944 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1146 952 gene locus_tag LOCUS_39710 1146 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence1408 1198 1674 gene locus_tag LOCUS_39720 1198 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence1409 500 126 gene locus_tag LOCUS_39730 500 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1734 820 gene locus_tag LOCUS_39740 1734 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence1410 220 1059 gene locus_tag LOCUS_39750 220 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 1011 1433 gene locus_tag LOCUS_39760 1011 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 >Feature sequence1411 922 131 gene locus_tag LOCUS_39770 922 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 <1765 956 gene locus_tag LOCUS_39780 <1765 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:arsenosugar biosynthesis radical SAM protein ArsS >Feature sequence1412 1693 1445 gene locus_tag LOCUS_39790 1693 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence1413 <1 746 gene locus_tag LOCUS_39800 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932564.1:CHAD domain-containing protein 1354 917 gene locus_tag LOCUS_39810 1354 917 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_39810 1614 1366 gene locus_tag LOCUS_39820 1614 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 >Feature sequence1414 >Feature sequence1415 <1758 455 gene locus_tag LOCUS_39830 <1758 455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003124441.1:ATP-binding protein >Feature sequence1416 74 781 gene locus_tag LOCUS_39840 74 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 778 1698 gene locus_tag LOCUS_39850 778 1698 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_39850 >Feature sequence1417 >Feature sequence1418 <1757 140 gene locus_tag LOCUS_39860 <1757 140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139457041.1:ATP-binding protein >Feature sequence1419 <1 1656 gene locus_tag LOCUS_39870 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545094.1:proline--tRNA ligase >Feature sequence1420 1685 108 gene locus_tag LOCUS_39880 1685 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345469.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence1421 <1 792 gene locus_tag LOCUS_39890 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583249.1:excinuclease ABC subunit UvrB 1042 1311 gene locus_tag LOCUS_39900 gene rpsT 1042 1311 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_39900 >Feature sequence1422 540 956 gene locus_tag LOCUS_39910 540 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence1423 1225 302 gene locus_tag LOCUS_39920 gene trxB 1225 302 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390648.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence1424 <1750 208 gene locus_tag LOCUS_39930 <1750 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence1425 >Feature sequence1426 >Feature sequence1427 <1 1006 gene locus_tag LOCUS_39940 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1428 878 801 gene locus_tag LOCUS_t00460 878 801 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1012 937 gene locus_tag LOCUS_t00470 1012 937 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1139 1273 gene locus_tag LOCUS_39950 1139 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence1429 <1745 1064 gene locus_tag LOCUS_39960 <1745 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978133.1:[LysW]-aminoadipate/[LysW]-glutamate kinase >Feature sequence1430 462 40 gene locus_tag LOCUS_39970 462 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 413 1720 gene locus_tag LOCUS_39980 413 1720 CDS product ISL3-like element ISBma1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531014.1 protein_id gnl|my_center|LOCUS_39980 >Feature sequence1431 >Feature sequence1432 >Feature sequence1433 >Feature sequence1434 1623 268 gene locus_tag LOCUS_39990 1623 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence1435 978 274 gene locus_tag LOCUS_40000 978 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 <1739 1056 gene locus_tag LOCUS_40010 <1739 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142597.1:sorbosone dehydrogenase family protein >Feature sequence1436 >Feature sequence1437 929 384 gene locus_tag LOCUS_40020 929 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 1362 1066 gene locus_tag LOCUS_40030 1362 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 >Feature sequence1438 1 555 gene locus_tag LOCUS_40040 gene radC 1 555 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260988.1 protein_id gnl|my_center|LOCUS_40040 1649 705 gene locus_tag LOCUS_40050 1649 705 CDS product ADP-dependent ribose-1-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867540.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence1439 >Feature sequence1440 328 197 gene locus_tag LOCUS_40060 328 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 1603 467 gene locus_tag LOCUS_40070 1603 467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_40070 >Feature sequence1441 >Feature sequence1442 262 972 gene locus_tag LOCUS_40080 262 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1672 1142 gene locus_tag LOCUS_40090 1672 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 >Feature sequence1443 1466 240 gene locus_tag LOCUS_40100 1466 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 1657 1466 gene locus_tag LOCUS_40110 1657 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence1444 77 634 gene locus_tag LOCUS_40120 77 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 865 1326 gene locus_tag LOCUS_40130 865 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence1445 478 311 gene locus_tag LOCUS_40140 478 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 477 1457 gene locus_tag LOCUS_40150 477 1457 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence1446 882 289 gene locus_tag LOCUS_40160 882 289 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813527.1 protein_id gnl|my_center|LOCUS_40160 1557 1024 gene locus_tag LOCUS_40170 1557 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 >Feature sequence1447 339 1202 gene locus_tag LOCUS_40180 339 1202 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_40180 1398 1276 gene locus_tag LOCUS_40190 1398 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence1448 >Feature sequence1449 304 459 gene locus_tag LOCUS_40200 304 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 863 1054 gene locus_tag LOCUS_40210 863 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 1074 1382 gene locus_tag LOCUS_40220 1074 1382 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 protein_id gnl|my_center|LOCUS_40220 >Feature sequence1450 >Feature sequence1451 414 244 gene locus_tag LOCUS_40230 414 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 641 1012 gene locus_tag LOCUS_40240 641 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence1452 >Feature sequence1453 1715 66 gene locus_tag LOCUS_40250 gene flhA 1715 66 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816738.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40250 >Feature sequence1454 <1714 588 gene locus_tag LOCUS_40260 <1714 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427755.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence1455 41 442 gene locus_tag LOCUS_40270 41 442 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916859.1 protein_id gnl|my_center|LOCUS_40270 650 865 gene locus_tag LOCUS_40280 650 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 920 1273 gene locus_tag LOCUS_40290 gene frdD 920 1273 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_40290 >Feature sequence1456 579 1253 gene locus_tag LOCUS_40300 579 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence1457 398 1471 gene locus_tag LOCUS_40310 398 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 >Feature sequence1458 53 1264 gene locus_tag LOCUS_40320 53 1264 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_40320 1549 1707 gene locus_tag LOCUS_40330 1549 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence1459 1595 96 gene locus_tag LOCUS_40340 1595 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965503.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence1460 3 1124 gene locus_tag LOCUS_40350 3 1124 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_40350 1705 1265 gene locus_tag LOCUS_40360 1705 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence1461 577 35 gene locus_tag LOCUS_40370 577 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 1307 552 gene locus_tag LOCUS_40380 1307 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence1462 <1 1214 gene locus_tag LOCUS_40390 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937589.1:glycosyltransferase 1704 1168 gene locus_tag LOCUS_40400 1704 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 >Feature sequence1463 194 355 gene locus_tag LOCUS_40410 194 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 549 833 gene locus_tag LOCUS_40420 549 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 840 1634 gene locus_tag LOCUS_40430 840 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence1464 1445 111 gene locus_tag LOCUS_40440 1445 111 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_40440 >Feature sequence1465 1495 161 gene locus_tag LOCUS_40450 1495 161 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence1466 1543 572 gene locus_tag LOCUS_40460 1543 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence1467 685 161 gene locus_tag LOCUS_40470 685 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 1275 682 gene locus_tag LOCUS_40480 gene rpoE 1275 682 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_40480 >Feature sequence1468 340 930 gene locus_tag LOCUS_40490 340 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 1051 1335 gene locus_tag LOCUS_40500 1051 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence1469 467 607 gene locus_tag LOCUS_40510 467 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 651 1667 gene locus_tag LOCUS_40520 651 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence1470 1169 516 gene locus_tag LOCUS_40530 gene lexA 1169 516 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_40530 >Feature sequence1471 1463 1284 gene locus_tag LOCUS_40540 1463 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 >Feature sequence1472 >Feature sequence1473 >Feature sequence1474 >Feature sequence1475 1071 859 gene locus_tag LOCUS_40550 1071 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 1399 1043 gene locus_tag LOCUS_40560 1399 1043 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_40560 >Feature sequence1476 204 761 gene locus_tag LOCUS_40570 204 761 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_40570 <1688 866 gene locus_tag LOCUS_40580 <1688 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259329.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence1477 <1687 464 gene locus_tag LOCUS_40590 <1687 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924850.1:MFS transporter >Feature sequence1478 1006 257 gene locus_tag LOCUS_40600 1006 257 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence1479 1438 404 gene locus_tag LOCUS_40610 gene lpxK 1438 404 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence1480 736 1617 gene locus_tag LOCUS_40620 736 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence1481 331 1485 gene locus_tag LOCUS_40630 331 1485 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210328108.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence1482 91 1467 gene locus_tag LOCUS_40640 91 1467 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_40640 >Feature sequence1483 >Feature sequence1484 86 1585 gene locus_tag LOCUS_40650 86 1585 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067451.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence1485 866 342 gene locus_tag LOCUS_40660 gene cobU 866 342 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_40660 1485 901 gene locus_tag LOCUS_40670 gene cobC 1485 901 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_40670 >Feature sequence1486 1518 70 gene locus_tag LOCUS_40680 1518 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence1487 294 824 gene locus_tag LOCUS_40690 294 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 925 1368 gene locus_tag LOCUS_40700 925 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence1488 474 971 gene locus_tag LOCUS_40710 474 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 1183 1596 gene locus_tag LOCUS_40720 1183 1596 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_40720 >Feature sequence1489 87 281 gene locus_tag LOCUS_40730 87 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence1490 1058 489 gene locus_tag LOCUS_40740 1058 489 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227008.1 protein_id gnl|my_center|LOCUS_40740 1545 1282 gene locus_tag LOCUS_40750 1545 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 >Feature sequence1491 376 1140 gene locus_tag LOCUS_40760 gene pxpA 376 1140 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207350.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence1492 >Feature sequence1493 427 795 gene locus_tag LOCUS_40770 gene rplR 427 795 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_40770 875 1381 gene locus_tag LOCUS_40780 gene rpsE 875 1381 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_40780 1386 1592 gene locus_tag LOCUS_40790 gene rpmD 1386 1592 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence1494 1141 1620 gene locus_tag LOCUS_40800 1141 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 >Feature sequence1495 1480 221 gene locus_tag LOCUS_40810 1480 221 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227900.1 protein_id gnl|my_center|LOCUS_40810 >Feature sequence1496 <1668 703 gene locus_tag LOCUS_40820 <1668 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038796350.1:ABC transporter ATP-binding protein >Feature sequence1497 1495 122 gene locus_tag LOCUS_40830 1495 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 >Feature sequence1498 1471 614 gene locus_tag LOCUS_40840 1471 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence1499 <1666 627 gene locus_tag LOCUS_40850 <1666 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986981.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence1500 37 1164 gene locus_tag LOCUS_40860 37 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 >Feature sequence1501 <1 1308 gene locus_tag LOCUS_40870 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein 1331 1483 gene locus_tag LOCUS_40880 1331 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence1502 1536 223 gene locus_tag LOCUS_40890 1536 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence1503 >Feature sequence1504 149 412 gene locus_tag LOCUS_40900 149 412 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_40900 409 825 gene locus_tag LOCUS_40910 409 825 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_40910 1116 907 gene locus_tag LOCUS_40920 1116 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 >Feature sequence1505 >Feature sequence1506 268 131 gene locus_tag LOCUS_40930 268 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 653 429 gene locus_tag LOCUS_40940 653 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 1402 1022 gene locus_tag LOCUS_40950 1402 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence1507 >Feature sequence1508 1457 558 gene locus_tag LOCUS_40960 1457 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence1509 >Feature sequence1510 951 679 gene locus_tag LOCUS_40970 951 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 >Feature sequence1511 >Feature sequence1512 165 1415 gene locus_tag LOCUS_40980 165 1415 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence1513 1560 172 gene locus_tag LOCUS_40990 1560 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence1514 39 677 gene locus_tag LOCUS_41000 gene nth 39 677 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_41000 1351 740 gene locus_tag LOCUS_41010 gene nudF 1351 740 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369649.1 protein_id gnl|my_center|LOCUS_41010 >Feature sequence1515 >Feature sequence1516 3 1469 gene locus_tag LOCUS_41020 3 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 >Feature sequence1517 >Feature sequence1518 1409 828 gene locus_tag LOCUS_41030 1409 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 >Feature sequence1519 >Feature sequence1520 <1 760 gene locus_tag LOCUS_41040 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615465.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence1521 107 370 gene locus_tag LOCUS_41050 107 370 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_41050 363 851 gene locus_tag LOCUS_41060 363 851 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_41060 >Feature sequence1522 315 109 gene locus_tag LOCUS_41070 315 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 750 577 gene locus_tag LOCUS_41080 750 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 1084 896 gene locus_tag LOCUS_41090 1084 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41090 1326 1081 gene locus_tag LOCUS_41100 1326 1081 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_41100 1525 1343 gene locus_tag LOCUS_41110 1525 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 >Feature sequence1523 <1 748 gene locus_tag LOCUS_41120 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932603.1:amino acid permease 850 1242 gene locus_tag LOCUS_41130 850 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence1524 >Feature sequence1525 197 63 gene locus_tag LOCUS_41140 197 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence1526 <1641 40 gene locus_tag LOCUS_41150 <1641 40 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028520.1:formylglycine-generating enzyme family protein >Feature sequence1527 >Feature sequence1528 109 501 gene locus_tag LOCUS_41160 109 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 510 1442 gene locus_tag LOCUS_41170 510 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 >Feature sequence1529 411 1268 gene locus_tag LOCUS_41180 411 1268 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664611.1 protein_id gnl|my_center|LOCUS_41180 >Feature sequence1530 1504 140 gene locus_tag LOCUS_41190 1504 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence1531 <1637 473 gene locus_tag LOCUS_41200 <1637 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229117.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence1532 1451 408 gene locus_tag LOCUS_41210 1451 408 CDS product IS110-like element ISCc4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640573.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence1533 944 402 gene locus_tag LOCUS_41220 gene hpt 944 402 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_41220 1011 1211 gene locus_tag LOCUS_41230 1011 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence1534 966 340 gene locus_tag LOCUS_41240 966 340 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence1535 144 656 gene locus_tag LOCUS_41250 gene ilvN 144 656 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_41250 846 1355 gene locus_tag LOCUS_41260 846 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 >Feature sequence1536 641 1621 gene locus_tag LOCUS_41270 641 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence1537 22 780 gene locus_tag LOCUS_41280 22 780 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_41280 777 950 gene locus_tag LOCUS_41290 777 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 1067 921 gene locus_tag LOCUS_41300 1067 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 1346 1486 gene locus_tag LOCUS_41310 1346 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 >Feature sequence1538 1206 670 gene locus_tag LOCUS_41320 1206 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence1539 1 1530 gene locus_tag LOCUS_41330 1 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence1540 790 191 gene locus_tag LOCUS_41340 gene hisH 790 191 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_41340 1383 790 gene locus_tag LOCUS_41350 gene hisB 1383 790 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_41350 >Feature sequence1541 1604 132 gene locus_tag LOCUS_41360 1604 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence1542 251 72 gene locus_tag LOCUS_41370 251 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 797 1387 gene locus_tag LOCUS_41380 797 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 >Feature sequence1543 >Feature sequence1544 1230 301 gene locus_tag LOCUS_41390 gene prfB 1230 301 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41390 1132 1425 gene locus_tag LOCUS_41400 1132 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 >Feature sequence1545 >Feature sequence1546 >Feature sequence1547 556 227 gene locus_tag LOCUS_41410 556 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 803 561 gene locus_tag LOCUS_41420 803 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1589 1131 gene locus_tag LOCUS_41430 1589 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 >Feature sequence1548 <1 626 gene locus_tag LOCUS_41440 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176621.1:DUF3473 domain-containing protein >Feature sequence1549 73 1434 gene locus_tag LOCUS_41450 73 1434 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_41450 >Feature sequence1550 110 1294 gene locus_tag LOCUS_41460 110 1294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_41460 >Feature sequence1551 1549 986 gene locus_tag LOCUS_41470 1549 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence1552 >Feature sequence1553 3 698 gene locus_tag LOCUS_41480 gene icmH 3 698 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521948.1 protein_id gnl|my_center|LOCUS_41480 >Feature sequence1554 109 717 gene locus_tag LOCUS_41490 109 717 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_41490 710 1543 gene locus_tag LOCUS_41500 gene pssA 710 1543 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_41500 >Feature sequence1555 355 179 gene locus_tag LOCUS_41510 355 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 513 974 gene locus_tag LOCUS_41520 513 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 983 1561 gene locus_tag LOCUS_41530 983 1561 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence1556 1309 968 gene locus_tag LOCUS_41540 1309 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 >Feature sequence1557 >Feature sequence1558 126 857 gene locus_tag LOCUS_41550 126 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence1559 >Feature sequence1560 >Feature sequence1561 449 282 gene locus_tag LOCUS_41560 449 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 <1616 609 gene locus_tag LOCUS_41570 <1616 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005649877.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence1562 <1616 207 gene locus_tag LOCUS_41580 <1616 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau >Feature sequence1563 >Feature sequence1564 830 1276 gene locus_tag LOCUS_41590 gene zntR 830 1276 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285610.1 protein_id gnl|my_center|LOCUS_41590 >Feature sequence1565 1456 107 gene locus_tag LOCUS_41600 gene trmFO 1456 107 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083750.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence1566 119 1348 gene locus_tag LOCUS_41610 119 1348 CDS product IS701-like element ISBj6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038951335.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence1567 >Feature sequence1568 <1 1381 gene locus_tag LOCUS_41620 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001296244.1:two-component system sensor histidine kinase AtoS >Feature sequence1569 >Feature sequence1570 <1 812 gene locus_tag LOCUS_41630 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941191.1:aminodeoxychorismate synthase component I >Feature sequence1571 653 486 gene locus_tag LOCUS_41640 653 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1176 700 gene locus_tag LOCUS_41650 1176 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 1488 1216 gene locus_tag LOCUS_41660 1488 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 >Feature sequence1572 <1604 774 gene locus_tag LOCUS_41670 <1604 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106459194.1:tetratricopeptide repeat protein >Feature sequence1573 <1 1197 gene locus_tag LOCUS_41680 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021922.1:plasmid pRiA4b ORF-3 family protein 1282 1428 gene locus_tag LOCUS_41690 1282 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence1574 1235 1516 gene locus_tag LOCUS_41700 1235 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence1575 978 667 gene locus_tag LOCUS_41710 978 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence1576 1472 753 gene locus_tag LOCUS_41720 gene pepE 1472 753 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072673.1 protein_id gnl|my_center|LOCUS_41720 >Feature sequence1577 529 356 gene locus_tag LOCUS_41730 529 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 >Feature sequence1578 >Feature sequence1579 240 1541 gene locus_tag LOCUS_41740 240 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence1580 177 383 gene locus_tag LOCUS_41750 177 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 >Feature sequence1581 1231 836 gene locus_tag LOCUS_41760 1231 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 >Feature sequence1582 >Feature sequence1583 1158 220 gene locus_tag LOCUS_41770 1158 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 >Feature sequence1584 1373 528 gene locus_tag LOCUS_41780 1373 528 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence1585 >Feature sequence1586 611 1474 gene locus_tag LOCUS_41790 gene oxyR 611 1474 CDS product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974587.1 protein_id gnl|my_center|LOCUS_41790 >Feature sequence1587 1009 164 gene locus_tag LOCUS_41800 1009 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence1588 776 21 gene locus_tag LOCUS_41810 776 21 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846658.1 protein_id gnl|my_center|LOCUS_41810 >Feature sequence1589 >Feature sequence1590 209 733 gene locus_tag LOCUS_41820 209 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence1591 1448 414 gene locus_tag LOCUS_41830 1448 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence1592 >Feature sequence1593 <1 1001 gene locus_tag LOCUS_41840 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein 1024 1500 gene locus_tag LOCUS_41850 1024 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence1594 165 929 gene locus_tag LOCUS_41860 165 929 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_41860 1462 1184 gene locus_tag LOCUS_41870 1462 1184 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233591.1 protein_id gnl|my_center|LOCUS_41870 >Feature sequence1595 1196 477 gene locus_tag LOCUS_41880 1196 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 >Feature sequence1596 >Feature sequence1597 <1572 467 gene locus_tag LOCUS_41890 <1572 467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085450.1:arylsulfatase >Feature sequence1598 >Feature sequence1599 62 721 gene locus_tag LOCUS_41900 62 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 761 1393 gene locus_tag LOCUS_41910 761 1393 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894962.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence1600 <1570 720 gene locus_tag LOCUS_41920 <1570 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460177.1:putative heme d1 biosynthesis radical SAM protein NirJ2 >Feature sequence1601 726 145 gene locus_tag LOCUS_41930 726 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 1474 773 gene locus_tag LOCUS_41940 1474 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 >Feature sequence1602 >Feature sequence1603 623 105 gene locus_tag LOCUS_41950 623 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 1566 646 gene locus_tag LOCUS_41960 1566 646 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_41960 >Feature sequence1604 142 1191 gene locus_tag LOCUS_41970 142 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 >Feature sequence1605 >Feature sequence1606 507 142 gene locus_tag LOCUS_41980 507 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 1474 767 gene locus_tag LOCUS_41990 1474 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 >Feature sequence1607 585 229 gene locus_tag LOCUS_42000 585 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence1608 <1 916 gene locus_tag LOCUS_42010 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928612.1:substrate-binding domain-containing protein >Feature sequence1609 <1 1239 gene locus_tag LOCUS_42020 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000903240.1:aminomethyl-transferring glycine dehydrogenase subunit 1 >Feature sequence1610 1513 128 gene locus_tag LOCUS_42030 gene atoC 1513 128 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125282.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence1611 319 1218 gene locus_tag LOCUS_42040 319 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 1246 1557 gene locus_tag LOCUS_42050 1246 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 >Feature sequence1612 174 473 gene locus_tag LOCUS_42060 174 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 522 1409 gene locus_tag LOCUS_42070 gene garL 522 1409 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703578.1 protein_id gnl|my_center|LOCUS_42070 >Feature sequence1613 405 899 gene locus_tag LOCUS_42080 405 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 902 1321 gene locus_tag LOCUS_42090 902 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 >Feature sequence1614 <1 904 gene locus_tag LOCUS_42100 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119021.1:DUF1552 domain-containing protein >Feature sequence1615 346 131 gene locus_tag LOCUS_42110 346 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 1039 662 gene locus_tag LOCUS_42120 1039 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1424 1056 gene locus_tag LOCUS_42130 1424 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence1616 >Feature sequence1617 >Feature sequence1618 484 1545 gene locus_tag LOCUS_42140 484 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence1619 >Feature sequence1620 289 1428 gene locus_tag LOCUS_42150 289 1428 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466931.1 protein_id gnl|my_center|LOCUS_42150 >Feature sequence1621 1139 144 gene locus_tag LOCUS_42160 1139 144 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_42160 >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 429 259 gene locus_tag LOCUS_42170 429 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 1359 1093 gene locus_tag LOCUS_42180 1359 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 >Feature sequence1625 1364 36 gene locus_tag LOCUS_42190 1364 36 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_42190 >Feature sequence1626 287 1420 gene locus_tag LOCUS_42200 287 1420 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_42200 >Feature sequence1627 >Feature sequence1628 <1544 78 gene locus_tag LOCUS_42210 <1544 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223297.1:alkaline phosphatase family protein >Feature sequence1629 84 1502 gene locus_tag LOCUS_42220 84 1502 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_42220 >Feature sequence1630 >Feature sequence1631 1263 115 gene locus_tag LOCUS_42230 1263 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 >Feature sequence1632 538 389 gene locus_tag LOCUS_42240 538 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 873 586 gene locus_tag LOCUS_42250 873 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 1346 870 gene locus_tag LOCUS_42260 1346 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 >Feature sequence1633 59 334 gene locus_tag LOCUS_42270 59 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 >Feature sequence1634 237 599 gene locus_tag LOCUS_42280 237 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 895 1458 gene locus_tag LOCUS_42290 895 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 >Feature sequence1635 116 1306 gene locus_tag LOCUS_42300 116 1306 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_42300 >Feature sequence1636 >Feature sequence1637 >Feature sequence1638 903 550 gene locus_tag LOCUS_42310 903 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 >Feature sequence1639 <1 813 gene locus_tag LOCUS_42320 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921456.1:DUF1080 domain-containing protein >Feature sequence1640 >Feature sequence1641 <1537 416 gene locus_tag LOCUS_42330 <1537 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065470411.1:XRE family transcriptional regulator >Feature sequence1642 <1537 875 gene locus_tag LOCUS_42340 <1537 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583296.1:asparagine--tRNA ligase >Feature sequence1643 271 1185 gene locus_tag LOCUS_42350 271 1185 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_42350 1270 1455 gene locus_tag LOCUS_42360 1270 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence1644 478 1473 gene locus_tag LOCUS_42370 478 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 >Feature sequence1645 565 89 gene locus_tag LOCUS_42380 565 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 <1535 736 gene locus_tag LOCUS_42390 <1535 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921425.1:aldose 1-epimerase family protein >Feature sequence1646 1025 288 gene locus_tag LOCUS_42400 gene kduD 1025 288 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_42400 >Feature sequence1647 1179 841 gene locus_tag LOCUS_42410 1179 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 >Feature sequence1648 365 1267 gene locus_tag LOCUS_42420 365 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 >Feature sequence1649 <1 751 gene locus_tag LOCUS_42430 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120982.1:DUF1501 domain-containing protein 961 1161 gene locus_tag LOCUS_42440 961 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence1650 >Feature sequence1651 1051 1245 gene locus_tag LOCUS_42450 1051 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 >Feature sequence1652 <1530 21 gene locus_tag LOCUS_42460 <1530 21 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141384.1:tetratricopeptide repeat protein >Feature sequence1653 54 1397 gene locus_tag LOCUS_42470 54 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence1654 872 1171 gene locus_tag LOCUS_42480 872 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 >Feature sequence1655 30 521 gene locus_tag LOCUS_42490 30 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 >Feature sequence1656 >Feature sequence1657 317 817 gene locus_tag LOCUS_42500 317 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 1098 1388 gene locus_tag LOCUS_42510 1098 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence1658 >Feature sequence1659 479 342 gene locus_tag LOCUS_42520 479 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 532 666 gene locus_tag LOCUS_42530 532 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 >Feature sequence1660 >Feature sequence1661 >Feature sequence1662 >Feature sequence1663 607 263 gene locus_tag LOCUS_42540 607 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 801 1403 gene locus_tag LOCUS_42550 801 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 >Feature sequence1664 1201 203 gene locus_tag LOCUS_42560 1201 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 >Feature sequence1665 >Feature sequence1666 106 1365 gene locus_tag LOCUS_42570 106 1365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence1667 <1517 70 gene locus_tag LOCUS_42580 <1517 70 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein >Feature sequence1668 600 412 gene locus_tag LOCUS_42590 600 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 >Feature sequence1669 1094 474 gene locus_tag LOCUS_42600 1094 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 >Feature sequence1670 338 628 gene locus_tag LOCUS_42610 338 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 921 1304 gene locus_tag LOCUS_42620 921 1304 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227927.1 protein_id gnl|my_center|LOCUS_42620 >Feature sequence1671 >Feature sequence1672 <1 1476 gene locus_tag LOCUS_42630 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391699.1:lysine--tRNA ligase >Feature sequence1673 >Feature sequence1674 509 294 gene locus_tag LOCUS_42640 509 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 649 512 gene locus_tag LOCUS_42650 649 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 1505 1065 gene locus_tag LOCUS_42660 1505 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 >Feature sequence1675 156 19 gene locus_tag LOCUS_42670 156 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence1676 157 597 gene locus_tag LOCUS_42680 157 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 594 1337 gene locus_tag LOCUS_42690 594 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence1677 446 222 gene locus_tag LOCUS_42700 446 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42700 1377 1096 gene locus_tag LOCUS_42710 1377 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42710 >Feature sequence1678 680 111 gene locus_tag LOCUS_42720 680 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 >Feature sequence1679 >Feature sequence1680 1047 130 gene locus_tag LOCUS_42730 1047 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 1207 1449 gene locus_tag LOCUS_42740 1207 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 >Feature sequence1681 <1504 879 gene locus_tag LOCUS_42750 <1504 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016328122.1:formylglycine-generating enzyme family protein >Feature sequence1682 670 383 gene locus_tag LOCUS_42760 670 383 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 protein_id gnl|my_center|LOCUS_42760 947 1396 gene locus_tag LOCUS_42770 gene tnpA 947 1396 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_42770 >Feature sequence1683 345 73 gene locus_tag LOCUS_42780 345 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 <1502 389 gene locus_tag LOCUS_42790 <1502 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545345.1:DEAD/DEAH box helicase family protein >Feature sequence1684 <1502 647 gene locus_tag LOCUS_42800 <1502 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244130.1:ABC transporter permease >Feature sequence1685 >Feature sequence1686 <1501 634 gene locus_tag LOCUS_42810 <1501 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972789.1:D-galactarolactone cycloisomerase >Feature sequence1687 88 1086 gene locus_tag LOCUS_42820 88 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 1283 1212 gene locus_tag LOCUS_t00480 1283 1212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1688 <1 1150 gene locus_tag LOCUS_42830 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943466.1:preprotein translocase subunit SecY 1101 1256 gene locus_tag LOCUS_42840 1101 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 >Feature sequence1689 386 1210 gene locus_tag LOCUS_42850 386 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence1690 803 501 gene locus_tag LOCUS_42860 803 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1067 921 gene locus_tag LOCUS_42870 1067 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 1138 1410 gene locus_tag LOCUS_42880 1138 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 >Feature sequence1691 52 1440 gene locus_tag LOCUS_42890 52 1440 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_42890 >Feature sequence1692 26 937 gene locus_tag LOCUS_42900 gene ftsX 26 937 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364071.1 protein_id gnl|my_center|LOCUS_42900 >Feature sequence1693 154 1308 gene locus_tag LOCUS_42910 154 1308 CDS product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence1694 >Feature sequence1695 637 302 gene locus_tag LOCUS_42920 637 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 956 627 gene locus_tag LOCUS_42930 956 627 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_42930 >Feature sequence1696 196 465 gene locus_tag LOCUS_42940 196 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 551 1375 gene locus_tag LOCUS_42950 551 1375 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012321.1 protein_id gnl|my_center|LOCUS_42950 >Feature sequence1697 >Feature sequence1698 538 867 gene locus_tag LOCUS_42960 538 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 1322 879 gene locus_tag LOCUS_42970 1322 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence1699 <1491 186 gene locus_tag LOCUS_42980 <1491 186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922542.1:DUF1553 domain-containing protein >Feature sequence1700 68 1399 gene locus_tag LOCUS_42990 68 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 >Feature sequence1701 <1489 11 gene locus_tag LOCUS_43000 <1489 11 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092499.1:OmpA family protein >Feature sequence1702 1349 123 gene locus_tag LOCUS_43010 1349 123 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_43010 >Feature sequence1703 >Feature sequence1704 378 1082 gene locus_tag LOCUS_43020 gene ispD 378 1082 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_43020 >Feature sequence1705 606 304 gene locus_tag LOCUS_43030 606 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 >Feature sequence1706 1331 96 gene locus_tag LOCUS_43040 1331 96 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence1707 1043 132 gene locus_tag LOCUS_43050 1043 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43050 1345 1064 gene locus_tag LOCUS_43060 1345 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43060 >Feature sequence1708 >Feature sequence1709 806 174 gene locus_tag LOCUS_43070 806 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1297 803 gene locus_tag LOCUS_43080 1297 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 >Feature sequence1710 <1480 322 gene locus_tag LOCUS_43090 <1480 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941824.1:ABC transporter permease >Feature sequence1711 86 1402 gene locus_tag LOCUS_43100 86 1402 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867352.1 protein_id gnl|my_center|LOCUS_43100 >Feature sequence1712 183 959 gene locus_tag LOCUS_43110 183 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 956 1369 gene locus_tag LOCUS_43120 956 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 >Feature sequence1713 >Feature sequence1714 1262 180 gene locus_tag LOCUS_43130 1262 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence1715 >Feature sequence1716 161 1087 gene locus_tag LOCUS_43140 161 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 1087 1299 gene locus_tag LOCUS_43150 1087 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 >Feature sequence1717 >Feature sequence1718 >Feature sequence1719 194 1324 gene locus_tag LOCUS_43160 194 1324 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_43160 >Feature sequence1720 1334 171 gene locus_tag LOCUS_43170 gene sucC 1334 171 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_43170 >Feature sequence1721 >Feature sequence1722 >Feature sequence1723 >Feature sequence1724 1248 178 gene locus_tag LOCUS_43180 1248 178 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence1725 <1 846 gene locus_tag LOCUS_43190 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919370.1:sugar kinase >Feature sequence1726 873 1325 gene locus_tag LOCUS_43200 873 1325 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence1727 250 735 gene locus_tag LOCUS_43210 250 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256278.1 protein_id gnl|my_center|LOCUS_43210 891 1322 gene locus_tag LOCUS_43220 891 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 >Feature sequence1728 872 1348 gene locus_tag LOCUS_43230 872 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence1729 >Feature sequence1730 1356 52 gene locus_tag LOCUS_43240 1356 52 CDS product IS256-like element ISDha1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459365.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence1731 1362 412 gene locus_tag LOCUS_43250 gene rbsB 1362 412 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634030.1 protein_id gnl|my_center|LOCUS_43250 >Feature sequence1732 >Feature sequence1733 1123 803 gene locus_tag LOCUS_43260 1123 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence1734 <1 1414 gene locus_tag LOCUS_43270 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942256.1:efflux RND transporter permease subunit >Feature sequence1735 >Feature sequence1736 622 810 gene locus_tag LOCUS_43280 622 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 800 1285 gene locus_tag LOCUS_43290 800 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 >Feature sequence1737 <1 1250 gene locus_tag LOCUS_43300 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525443.1:bifunctional GNAT family N-acetyltransferase/PLP-dependent aspartate aminotransferase family protein >Feature sequence1738 1086 40 gene locus_tag LOCUS_43310 1086 40 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_43310 >Feature sequence1739 >Feature sequence1740 1115 1252 gene locus_tag LOCUS_43320 1115 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43320 >Feature sequence1741 643 245 gene locus_tag LOCUS_43330 gene rpsH 643 245 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_43330 >Feature sequence1742 >Feature sequence1743 >Feature sequence1744 <1 1170 gene locus_tag LOCUS_43340 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460052.1:AarF/ABC1/UbiB kinase family protein 1185 1355 gene locus_tag LOCUS_43350 1185 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence1745 >Feature sequence1746 <1 746 gene locus_tag LOCUS_43360 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966857.1:DUF6502 family protein >Feature sequence1747 >Feature sequence1748 748 281 gene locus_tag LOCUS_43370 748 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence1749 1352 24 gene locus_tag LOCUS_43380 1352 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence1750 >Feature sequence1751 518 1186 gene locus_tag LOCUS_43390 518 1186 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044973.1 protein_id gnl|my_center|LOCUS_43390 >Feature sequence1752 >Feature sequence1753 151 810 gene locus_tag LOCUS_43400 151 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 >Feature sequence1754 396 124 gene locus_tag LOCUS_43410 396 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 387 620 gene locus_tag LOCUS_43420 387 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 638 997 gene locus_tag LOCUS_43430 638 997 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_43430 >Feature sequence1755 <1 1306 gene locus_tag LOCUS_43440 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121001.1:ATP-binding protein >Feature sequence1756 221 1426 gene locus_tag LOCUS_43450 221 1426 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_43450 >Feature sequence1757 <1449 619 gene locus_tag LOCUS_43460 <1449 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387821.1:adenosyl-hopene transferase HpnH >Feature sequence1758 285 797 gene locus_tag LOCUS_43470 285 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 809 1051 gene locus_tag LOCUS_43480 809 1051 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_43480 1051 1434 gene locus_tag LOCUS_43490 1051 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence1759 346 1263 gene locus_tag LOCUS_43500 346 1263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_43500 >Feature sequence1760 1225 236 gene locus_tag LOCUS_43510 1225 236 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994093.1 protein_id gnl|my_center|LOCUS_43510 >Feature sequence1761 765 76 gene locus_tag LOCUS_43520 765 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence1762 1292 618 gene locus_tag LOCUS_43530 1292 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence1763 >Feature sequence1764 <1 936 gene locus_tag LOCUS_43540 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144354.1:class I SAM-dependent methyltransferase 942 1199 gene locus_tag LOCUS_43550 942 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence1765 >Feature sequence1766 77 367 gene locus_tag LOCUS_43560 77 367 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398761.1 protein_id gnl|my_center|LOCUS_43560 756 394 gene locus_tag LOCUS_43570 756 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 676 1410 gene locus_tag LOCUS_43580 676 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43580 >Feature sequence1767 790 449 gene locus_tag LOCUS_43590 790 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 1443 1147 gene locus_tag LOCUS_43600 1443 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence1768 483 298 gene locus_tag LOCUS_43610 483 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 945 706 gene locus_tag LOCUS_43620 945 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1021 1272 gene locus_tag LOCUS_43630 1021 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence1769 832 302 gene locus_tag LOCUS_43640 832 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 >Feature sequence1770 >Feature sequence1771 785 9 gene locus_tag LOCUS_43650 785 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 >Feature sequence1772 558 698 gene locus_tag LOCUS_43660 558 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence1773 >Feature sequence1774 387 1061 gene locus_tag LOCUS_43670 gene psmA 387 1061 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846326.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence1775 1177 1305 gene locus_tag LOCUS_43680 1177 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 >Feature sequence1776 <1 957 gene locus_tag LOCUS_43690 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403639.1:DUF2461 domain-containing protein 950 1069 gene locus_tag LOCUS_43700 950 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence1777 359 81 gene locus_tag LOCUS_43710 359 81 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_43710 1100 513 gene locus_tag LOCUS_43720 1100 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence1778 46 423 gene locus_tag LOCUS_43730 46 423 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_43730 >Feature sequence1779 >Feature sequence1780 1135 101 gene locus_tag LOCUS_43740 1135 101 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_43740 >Feature sequence1781 <1 1122 gene locus_tag LOCUS_43750 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224419.1:amidohydrolase family protein >Feature sequence1782 52 537 gene locus_tag LOCUS_43760 52 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 >Feature sequence1783 98 826 gene locus_tag LOCUS_43770 98 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 >Feature sequence1784 560 1147 gene locus_tag LOCUS_43780 560 1147 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence1785 <1 505 gene locus_tag LOCUS_43790 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome c peroxidase >Feature sequence1786 72 413 gene locus_tag LOCUS_43800 72 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43800 485 1273 gene locus_tag LOCUS_43810 485 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43810 >Feature sequence1787 1 663 gene locus_tag LOCUS_43820 1 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 720 1334 gene locus_tag LOCUS_43830 720 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence1788 >Feature sequence1789 143 1078 gene locus_tag LOCUS_43840 gene rsmH 143 1078 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_43840 1081 1275 gene locus_tag LOCUS_43850 1081 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 >Feature sequence1790 >Feature sequence1791 <1427 660 gene locus_tag LOCUS_43860 <1427 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein >Feature sequence1792 454 696 gene locus_tag LOCUS_43870 454 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 681 1022 gene locus_tag LOCUS_43880 681 1022 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_43880 1123 1314 gene locus_tag LOCUS_43890 1123 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 >Feature sequence1793 330 1319 gene locus_tag LOCUS_43900 gene selD 330 1319 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_43900 >Feature sequence1794 1236 58 gene locus_tag LOCUS_43910 1236 58 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078903565.1 protein_id gnl|my_center|LOCUS_43910 >Feature sequence1795 473 703 gene locus_tag LOCUS_43920 473 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 690 923 gene locus_tag LOCUS_43930 690 923 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_43930 1114 929 gene locus_tag LOCUS_43940 1114 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence1796 532 1344 gene locus_tag LOCUS_43950 532 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 >Feature sequence1797 734 246 gene locus_tag LOCUS_43960 gene coaD 734 246 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_43960 1307 741 gene locus_tag LOCUS_43970 gene rsmD 1307 741 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_43970 >Feature sequence1798 1408 533 gene locus_tag LOCUS_43980 1408 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence1799 133 429 gene locus_tag LOCUS_43990 133 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 426 548 gene locus_tag LOCUS_44000 426 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 617 1084 gene locus_tag LOCUS_44010 617 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 >Feature sequence1800 976 437 gene locus_tag LOCUS_44020 976 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 >Feature sequence1801 >Feature sequence1802 572 81 gene locus_tag LOCUS_44030 572 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence1803 <1420 731 gene locus_tag LOCUS_44040 <1420 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942274.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence1804 1273 95 gene locus_tag LOCUS_44050 1273 95 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804023.1 protein_id gnl|my_center|LOCUS_44050 >Feature sequence1805 >Feature sequence1806 711 379 gene locus_tag LOCUS_44060 711 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 >Feature sequence1807 647 78 gene locus_tag LOCUS_44070 647 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 1109 663 gene locus_tag LOCUS_44080 1109 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 1400 1110 gene locus_tag LOCUS_44090 1400 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence1808 <1 1049 gene locus_tag LOCUS_44100 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100953.1:cystathionine gamma-synthase 1290 1063 gene locus_tag LOCUS_44110 1290 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence1809 <1 572 gene locus_tag LOCUS_44120 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070868.1:3'-5' exonuclease 1198 650 gene locus_tag LOCUS_44130 1198 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 >Feature sequence1810 <1 590 gene locus_tag LOCUS_44140 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392473.1:RNA polymerase sigma factor SigX >Feature sequence1811 >Feature sequence1812 86 1231 gene locus_tag LOCUS_44150 86 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 1231 1392 gene locus_tag LOCUS_44160 1231 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 >Feature sequence1813 1184 264 gene locus_tag LOCUS_44170 1184 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence1814 >Feature sequence1815 >Feature sequence1816 >Feature sequence1817 253 732 gene locus_tag LOCUS_44180 253 732 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_44180 899 1369 gene locus_tag LOCUS_44190 899 1369 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_44190 >Feature sequence1818 14 910 gene locus_tag LOCUS_44200 14 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 >Feature sequence1819 <1413 69 gene locus_tag LOCUS_44210 <1413 69 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase >Feature sequence1820 >Feature sequence1821 >Feature sequence1822 >Feature sequence1823 171 518 gene locus_tag LOCUS_44220 171 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 >Feature sequence1824 >Feature sequence1825 74 1096 gene locus_tag LOCUS_44230 74 1096 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_44230 >Feature sequence1826 >Feature sequence1827 95 388 gene locus_tag LOCUS_44240 95 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 <1408 446 gene locus_tag LOCUS_44250 <1408 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942970.1:UPF0182 family protein >Feature sequence1828 69 188 gene locus_tag LOCUS_44260 69 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 <1407 390 gene locus_tag LOCUS_44270 <1407 390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403935.1:efflux RND transporter permease subunit >Feature sequence1829 1007 597 gene locus_tag LOCUS_44280 1007 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence1830 1289 207 gene locus_tag LOCUS_44290 1289 207 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267463.1 protein_id gnl|my_center|LOCUS_44290 >Feature sequence1831 >Feature sequence1832 108 1361 gene locus_tag LOCUS_44300 108 1361 CDS product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence1833 <1 520 gene locus_tag LOCUS_44310 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392851.1:phosphoribosylanthranilate isomerase 723 535 gene locus_tag LOCUS_44320 723 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 817 1305 gene locus_tag LOCUS_44330 817 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 >Feature sequence1834 675 538 gene locus_tag LOCUS_44340 675 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 1056 808 gene locus_tag LOCUS_44350 1056 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 >Feature sequence1835 <1 1366 gene locus_tag LOCUS_44360 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943656.1:acyl-[ACP]--phospholipid O-acyltransferase >Feature sequence1836 >Feature sequence1837 >Feature sequence1838 <1 1092 gene locus_tag LOCUS_44370 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119311.1:sodium/solute symporter >Feature sequence1839 >Feature sequence1840 <1 745 gene locus_tag LOCUS_44380 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence1841 516 22 gene locus_tag LOCUS_44390 516 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 1160 1378 gene locus_tag LOCUS_44400 1160 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 >Feature sequence1842 115 402 gene locus_tag LOCUS_44410 115 402 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_44410 576 652 gene locus_tag LOCUS_t00490 576 652 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1843 >Feature sequence1844 >Feature sequence1845 <1 1182 gene locus_tag LOCUS_44420 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008667343.1:serine hydrolase domain-containing protein >Feature sequence1846 >Feature sequence1847 >Feature sequence1848 1063 38 gene locus_tag LOCUS_44430 1063 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence1849 >Feature sequence1850 <1 641 gene locus_tag LOCUS_44440 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189327688.1:IS21 family transposase >Feature sequence1851 251 649 gene locus_tag LOCUS_44450 251 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 860 1243 gene locus_tag LOCUS_44460 860 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 >Feature sequence1852 >Feature sequence1853 261 103 gene locus_tag LOCUS_44470 261 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 1361 480 gene locus_tag LOCUS_44480 1361 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence1854 135 893 gene locus_tag LOCUS_44490 135 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 909 1304 gene locus_tag LOCUS_44500 909 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 >Feature sequence1855 >Feature sequence1856 <1 573 gene locus_tag LOCUS_44510 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141457.1:aspartate ammonia-lyase >Feature sequence1857 >Feature sequence1858 1250 126 gene locus_tag LOCUS_44520 1250 126 CDS product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 protein_id gnl|my_center|LOCUS_44520 >Feature sequence1859 574 236 gene locus_tag LOCUS_44530 574 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44530 1074 697 gene locus_tag LOCUS_44540 1074 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 >Feature sequence1860 >Feature sequence1861 >Feature sequence1862 326 517 gene locus_tag LOCUS_44550 326 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 566 748 gene locus_tag LOCUS_44560 566 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 823 1068 gene locus_tag LOCUS_44570 823 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 >Feature sequence1863 <1 697 gene locus_tag LOCUS_44580 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393864.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence1864 105 470 gene locus_tag LOCUS_44590 105 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 >Feature sequence1865 307 1047 gene locus_tag LOCUS_44600 307 1047 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_44600 >Feature sequence1866 <1383 417 gene locus_tag LOCUS_44610 <1383 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226319327.1:LssY C-terminal domain-containing protein >Feature sequence1867 >Feature sequence1868 >Feature sequence1869 1020 259 gene locus_tag LOCUS_44620 1020 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 >Feature sequence1870 989 486 gene locus_tag LOCUS_44630 989 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 >Feature sequence1871 1238 885 gene locus_tag LOCUS_44640 1238 885 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533874.1 protein_id gnl|my_center|LOCUS_44640 >Feature sequence1872 368 1120 gene locus_tag LOCUS_44650 368 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence1873 >Feature sequence1874 105 1217 gene locus_tag LOCUS_44660 105 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 >Feature sequence1875 1264 413 gene locus_tag LOCUS_44670 1264 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence1876 <1 1128 gene locus_tag LOCUS_44680 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272692.1:group II intron reverse transcriptase/maturase >Feature sequence1877 <1372 710 gene locus_tag LOCUS_44690 <1372 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123104.1:PQQ-like beta-propeller repeat protein >Feature sequence1878 789 103 gene locus_tag LOCUS_44700 789 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence1879 169 741 gene locus_tag LOCUS_44710 169 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 >Feature sequence1880 1135 269 gene locus_tag LOCUS_44720 1135 269 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_44720 >Feature sequence1881 545 126 gene locus_tag LOCUS_44730 545 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1288 542 gene locus_tag LOCUS_44740 1288 542 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_44740 >Feature sequence1882 451 527 gene locus_tag LOCUS_t00500 451 527 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 717 792 gene locus_tag LOCUS_t00510 717 792 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1883 354 551 gene locus_tag LOCUS_44750 354 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 >Feature sequence1884 >Feature sequence1885 463 636 gene locus_tag LOCUS_44760 463 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 1235 702 gene locus_tag LOCUS_44770 1235 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 >Feature sequence1886 928 761 gene locus_tag LOCUS_44780 gene lysW 928 761 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_44780 >Feature sequence1887 <1 1183 gene locus_tag LOCUS_44790 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066875.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1888 274 1137 gene locus_tag LOCUS_44800 274 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 >Feature sequence1889 52 456 gene locus_tag LOCUS_44810 52 456 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_44810 456 920 gene locus_tag LOCUS_44820 456 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44820 >Feature sequence1890 1278 130 gene locus_tag LOCUS_44830 1278 130 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_44830 >Feature sequence1891 187 339 gene locus_tag LOCUS_44840 187 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 762 559 gene locus_tag LOCUS_44850 762 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 1127 672 gene locus_tag LOCUS_44860 1127 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 >Feature sequence1892 232 918 gene locus_tag LOCUS_44870 232 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence1893 714 274 gene locus_tag LOCUS_44880 714 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 <1363 711 gene locus_tag LOCUS_44890 <1363 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase >Feature sequence1894 426 1253 gene locus_tag LOCUS_44900 426 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 >Feature sequence1895 >Feature sequence1896 >Feature sequence1897 <1 675 gene locus_tag LOCUS_44910 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074378.1:tyrosine-type recombinase/integrase >Feature sequence1898 71 1159 gene locus_tag LOCUS_44920 71 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence1899 >Feature sequence1900 1193 738 gene locus_tag LOCUS_44930 1193 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence1901 527 1150 gene locus_tag LOCUS_44940 527 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 >Feature sequence1902 >Feature sequence1903 777 1 gene locus_tag LOCUS_44950 777 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence1904 >Feature sequence1905 252 1286 gene locus_tag LOCUS_44960 252 1286 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_44960 >Feature sequence1906 862 86 gene locus_tag LOCUS_44970 862 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence1907 >Feature sequence1908 1088 135 gene locus_tag LOCUS_44980 1088 135 CDS product IS630-like element ISTth6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926047.1 protein_id gnl|my_center|LOCUS_44980 >Feature sequence1909 >Feature sequence1910 >Feature sequence1911 1146 217 gene locus_tag LOCUS_44990 1146 217 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_44990 >Feature sequence1912 849 1112 gene locus_tag LOCUS_45000 849 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence1913 47 463 gene locus_tag LOCUS_45010 47 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 <1352 490 gene locus_tag LOCUS_45020 <1352 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228417.1:Xaa-Pro peptidase family protein >Feature sequence1914 >Feature sequence1915 725 1057 gene locus_tag LOCUS_45030 725 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence1916 352 552 gene locus_tag LOCUS_45040 352 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 <1350 803 gene locus_tag LOCUS_45050 <1350 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122406836.1:IS66 family transposase >Feature sequence1917 >Feature sequence1918 570 1328 gene locus_tag LOCUS_45060 570 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 >Feature sequence1919 >Feature sequence1920 >Feature sequence1921 >Feature sequence1922 >Feature sequence1923 >Feature sequence1924 >Feature sequence1925 536 120 gene locus_tag LOCUS_45070 536 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence1926 >Feature sequence1927 >Feature sequence1928 >Feature sequence1929 >Feature sequence1930 >Feature sequence1931 >Feature sequence1932 58 813 gene locus_tag LOCUS_45080 58 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 >Feature sequence1933 >Feature sequence1934 >Feature sequence1935 >Feature sequence1936 704 1225 gene locus_tag LOCUS_45090 704 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 >Feature sequence1937 >Feature sequence1938 65 1249 gene locus_tag LOCUS_45100 65 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence1939 258 1073 gene locus_tag LOCUS_45110 gene larE 258 1073 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_45110 >Feature sequence1940 1095 271 gene locus_tag LOCUS_45120 1095 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 >Feature sequence1941 <1332 495 gene locus_tag LOCUS_45130 <1332 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120880.1:glucans biosynthesis glucosyltransferase MdoH >Feature sequence1942 >Feature sequence1943 >Feature sequence1944 347 144 gene locus_tag LOCUS_45140 347 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 742 344 gene locus_tag LOCUS_45150 742 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 1218 910 gene locus_tag LOCUS_45160 1218 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 >Feature sequence1945 1133 135 gene locus_tag LOCUS_45170 1133 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence1946 674 465 gene locus_tag LOCUS_45180 674 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 1052 1198 gene locus_tag LOCUS_45190 1052 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 >Feature sequence1947 185 490 gene locus_tag LOCUS_45200 185 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 <1328 551 gene locus_tag LOCUS_45210 <1328 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124063.1:DUF1501 domain-containing protein >Feature sequence1948 <1 946 gene locus_tag LOCUS_45220 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332337.1:sugar phosphate isomerase/epimerase >Feature sequence1949 >Feature sequence1950 2 154 gene locus_tag LOCUS_45230 2 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 297 767 gene locus_tag LOCUS_45240 297 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256450.1 protein_id gnl|my_center|LOCUS_45240 >Feature sequence1951 >Feature sequence1952 959 780 gene locus_tag LOCUS_45250 959 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 >Feature sequence1953 1099 212 gene locus_tag LOCUS_45260 1099 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 1326 1096 gene locus_tag LOCUS_45270 1326 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence1954 >Feature sequence1955 1080 139 gene locus_tag LOCUS_45280 1080 139 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047962736.1 protein_id gnl|my_center|LOCUS_45280 >Feature sequence1956 >Feature sequence1957 >Feature sequence1958 946 131 gene locus_tag LOCUS_45290 946 131 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence1959 >Feature sequence1960 1041 88 gene locus_tag LOCUS_45300 1041 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence1961 >Feature sequence1962 904 29 gene locus_tag LOCUS_45310 904 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence1963 336 1094 gene locus_tag LOCUS_45320 336 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 >Feature sequence1964 >Feature sequence1965 1052 249 gene locus_tag LOCUS_45330 1052 249 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_45330 >Feature sequence1966 1212 1078 gene locus_tag LOCUS_45340 1212 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 >Feature sequence1967 824 597 gene locus_tag LOCUS_45350 824 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 >Feature sequence1968 1181 693 gene locus_tag LOCUS_45360 1181 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 >Feature sequence1969 >Feature sequence1970 505 104 gene locus_tag LOCUS_45370 505 104 CDS product DUF6326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021642.1 protein_id gnl|my_center|LOCUS_45370 >Feature sequence1971 >Feature sequence1972 >Feature sequence1973 >Feature sequence1974 694 449 gene locus_tag LOCUS_45380 694 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence1975 <1 1277 gene locus_tag LOCUS_45390 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941973.1:ATP-binding protein >Feature sequence1976 116 970 gene locus_tag LOCUS_45400 116 970 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224997.1 protein_id gnl|my_center|LOCUS_45400 >Feature sequence1977 >Feature sequence1978 >Feature sequence1979 334 23 gene locus_tag LOCUS_45410 334 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45410 543 349 gene locus_tag LOCUS_45420 543 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 850 599 gene locus_tag LOCUS_45430 850 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 >Feature sequence1980 120 257 gene locus_tag LOCUS_45440 120 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence1981 1152 208 gene locus_tag LOCUS_45450 1152 208 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence1982 <1 1254 gene locus_tag LOCUS_45460 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964225.1:amino acid permease >Feature sequence1983 462 40 gene locus_tag LOCUS_45470 462 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 <1306 446 gene locus_tag LOCUS_45480 <1306 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265618.1:PAS domain S-box protein >Feature sequence1984 <1 1024 gene locus_tag LOCUS_45490 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142186.1:glycosyltransferase >Feature sequence1985 >Feature sequence1986 >Feature sequence1987 >Feature sequence1988 >Feature sequence1989 >Feature sequence1990 853 296 gene locus_tag LOCUS_45500 853 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45500 1176 814 gene locus_tag LOCUS_45510 1176 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45510 >Feature sequence1991 <1303 461 gene locus_tag LOCUS_45520 <1303 461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942180.1:exodeoxyribonuclease V subunit gamma >Feature sequence1992 <1302 229 gene locus_tag LOCUS_45530 <1302 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941298.1:YfhO family protein >Feature sequence1993 224 1264 gene locus_tag LOCUS_45540 224 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence1994 >Feature sequence1995 >Feature sequence1996 >Feature sequence1997 >Feature sequence1998 >Feature sequence1999 1295 621 gene locus_tag LOCUS_45550 1295 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 >Feature sequence2000 864 109 gene locus_tag LOCUS_45560 864 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 >Feature sequence2001 >Feature sequence2002 <1 1218 gene locus_tag LOCUS_45570 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994211.1:MFS transporter >Feature sequence2003 >Feature sequence2004 1184 168 gene locus_tag LOCUS_45580 gene doeB 1184 168 CDS product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401275.1 protein_id gnl|my_center|LOCUS_45580 >Feature sequence2005 184 1113 gene locus_tag LOCUS_45590 184 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_45590 >Feature sequence2006 >Feature sequence2007 564 34 gene locus_tag LOCUS_45600 gene infC 564 34 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_45600 <1295 576 gene locus_tag LOCUS_45610 <1295 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443963.1:threonine--tRNA ligase >Feature sequence2008 1293 61 gene locus_tag LOCUS_45620 1293 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 >Feature sequence2009 749 144 gene locus_tag LOCUS_45630 749 144 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878776.1 protein_id gnl|my_center|LOCUS_45630 >Feature sequence2010 >Feature sequence2011 >Feature sequence2012 231 629 gene locus_tag LOCUS_45640 231 629 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 protein_id gnl|my_center|LOCUS_45640 >Feature sequence2013 >Feature sequence2014 532 305 gene locus_tag LOCUS_45650 532 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 1115 546 gene locus_tag LOCUS_45660 1115 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 >Feature sequence2015 >Feature sequence2016 >Feature sequence2017 341 814 gene locus_tag LOCUS_45670 341 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 >Feature sequence2018 1216 38 gene locus_tag LOCUS_45680 1216 38 CDS product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082855.1 protein_id gnl|my_center|LOCUS_45680 >Feature sequence2019 1152 373 gene locus_tag LOCUS_45690 1152 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 >Feature sequence2020 >Feature sequence2021 >Feature sequence2022 <1 1172 gene locus_tag LOCUS_45700 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921592.1:PQQ-like beta-propeller repeat protein >Feature sequence2023 354 1133 gene locus_tag LOCUS_45710 354 1133 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_45710 >Feature sequence2024 1281 211 gene locus_tag LOCUS_45720 1281 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 >Feature sequence2025 771 289 gene locus_tag LOCUS_45730 771 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 >Feature sequence2026 1052 585 gene locus_tag LOCUS_45740 1052 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence2027 >Feature sequence2028 >Feature sequence2029 838 704 gene locus_tag LOCUS_45750 838 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 >Feature sequence2030 >Feature sequence2031 419 57 gene locus_tag LOCUS_45760 419 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 1173 637 gene locus_tag LOCUS_45770 1173 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 >Feature sequence2032 >Feature sequence2033 66 272 gene locus_tag LOCUS_45780 66 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 293 958 gene locus_tag LOCUS_45790 293 958 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_45790 >Feature sequence2034 >Feature sequence2035 <1280 645 gene locus_tag LOCUS_45800 <1280 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064251940.1:HAD-IIB family hydrolase >Feature sequence2036 >Feature sequence2037 <1 530 gene locus_tag LOCUS_45810 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein >Feature sequence2038 >Feature sequence2039 959 399 gene locus_tag LOCUS_45820 959 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 1156 1001 gene locus_tag LOCUS_45830 1156 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 >Feature sequence2040 225 19 gene locus_tag LOCUS_45840 225 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence2041 >Feature sequence2042 144 1214 gene locus_tag LOCUS_45850 144 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 >Feature sequence2043 288 773 gene locus_tag LOCUS_45860 288 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 >Feature sequence2044 130 462 gene locus_tag LOCUS_45870 130 462 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943536.1 protein_id gnl|my_center|LOCUS_45870 1219 797 gene locus_tag LOCUS_45880 1219 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 >Feature sequence2045 55 1179 gene locus_tag LOCUS_45890 55 1179 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence2046 >Feature sequence2047 398 1201 gene locus_tag LOCUS_45900 398 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 >Feature sequence2048 168 470 gene locus_tag LOCUS_45910 168 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 463 1065 gene locus_tag LOCUS_45920 463 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 >Feature sequence2049 >Feature sequence2050 759 253 gene locus_tag LOCUS_45930 759 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence2051 331 131 gene locus_tag LOCUS_45940 331 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 776 489 gene locus_tag LOCUS_45950 776 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 1152 814 gene locus_tag LOCUS_45960 1152 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence2052 173 568 gene locus_tag LOCUS_45970 173 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 580 1236 gene locus_tag LOCUS_45980 580 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 >Feature sequence2053 >Feature sequence2054 >Feature sequence2055 >Feature sequence2056 101 517 gene locus_tag LOCUS_45990 101 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence2057 1192 524 gene locus_tag LOCUS_46000 1192 524 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496520.1 protein_id gnl|my_center|LOCUS_46000 >Feature sequence2058 >Feature sequence2059 740 306 gene locus_tag LOCUS_46010 740 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46010 1138 737 gene locus_tag LOCUS_46020 1138 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46020 >Feature sequence2060 <1262 282 gene locus_tag LOCUS_46030 <1262 282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803908.1:DUF5009 domain-containing protein >Feature sequence2061 <1262 359 gene locus_tag LOCUS_46040 <1262 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088795.1:IS110 family transposase >Feature sequence2062 >Feature sequence2063 449 736 gene locus_tag LOCUS_46050 449 736 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_46050 >Feature sequence2064 375 1127 gene locus_tag LOCUS_46060 375 1127 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015123.1 protein_id gnl|my_center|LOCUS_46060 >Feature sequence2065 367 23 gene locus_tag LOCUS_46070 367 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 1166 696 gene locus_tag LOCUS_46080 1166 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence2066 756 1157 gene locus_tag LOCUS_46090 756 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 >Feature sequence2067 308 940 gene locus_tag LOCUS_46100 308 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 >Feature sequence2068 >Feature sequence2069 >Feature sequence2070 <1 990 gene locus_tag LOCUS_46110 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112820.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence2071 >Feature sequence2072 >Feature sequence2073 >Feature sequence2074 794 943 gene locus_tag LOCUS_46120 794 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 >Feature sequence2075 >Feature sequence2076 590 1156 gene locus_tag LOCUS_46130 590 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 >Feature sequence2077 >Feature sequence2078 >Feature sequence2079 >Feature sequence2080 1134 127 gene locus_tag LOCUS_46140 1134 127 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_46140 >Feature sequence2081 >Feature sequence2082 >Feature sequence2083 967 191 gene locus_tag LOCUS_46150 967 191 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_46150 >Feature sequence2084 >Feature sequence2085 795 88 gene locus_tag LOCUS_46160 795 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 >Feature sequence2086 >Feature sequence2087 >Feature sequence2088 >Feature sequence2089 <1 692 gene locus_tag LOCUS_46170 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014665.1:S49 family peptidase 703 1029 gene locus_tag LOCUS_46180 703 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 >Feature sequence2090 >Feature sequence2091 >Feature sequence2092 >Feature sequence2093 >Feature sequence2094 >Feature sequence2095 371 21 gene locus_tag LOCUS_46190 371 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 759 349 gene locus_tag LOCUS_46200 759 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 >Feature sequence2096 <1 1164 gene locus_tag LOCUS_46210 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584014.1:sugar ABC transporter ATP-binding protein >Feature sequence2097 91 444 gene locus_tag LOCUS_46220 91 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 462 695 gene locus_tag LOCUS_46230 462 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 720 1007 gene locus_tag LOCUS_46240 720 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 >Feature sequence2098 >Feature sequence2099 <1 801 gene locus_tag LOCUS_46250 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943006.1:tryptophan synthase subunit alpha 805 1080 gene locus_tag LOCUS_46260 805 1080 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_46260 >Feature sequence2100 632 198 gene locus_tag LOCUS_46270 632 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 1067 732 gene locus_tag LOCUS_46280 1067 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 >Feature sequence2101 59 1072 gene locus_tag LOCUS_46290 59 1072 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 protein_id gnl|my_center|LOCUS_46290 >Feature sequence2102 311 114 gene locus_tag LOCUS_46300 311 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 503 967 gene locus_tag LOCUS_46310 gene sixA 503 967 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_46310 >Feature sequence2103 >Feature sequence2104 240 494 gene locus_tag LOCUS_46320 240 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 >Feature sequence2105 125 505 gene locus_tag LOCUS_46330 125 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 962 546 gene locus_tag LOCUS_46340 962 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 >Feature sequence2106 >Feature sequence2107 571 104 gene locus_tag LOCUS_46350 571 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 773 561 gene locus_tag LOCUS_46360 773 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 >Feature sequence2108 645 211 gene locus_tag LOCUS_46370 645 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 1008 682 gene locus_tag LOCUS_46380 1008 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 >Feature sequence2109 >Feature sequence2110 91 717 gene locus_tag LOCUS_46390 91 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 >Feature sequence2111 <1 974 gene locus_tag LOCUS_46400 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257218.1:alpha-ketoacid dehydrogenase subunit beta >Feature sequence2112 594 872 gene locus_tag LOCUS_46410 594 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 >Feature sequence2113 315 1082 gene locus_tag LOCUS_46420 315 1082 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence2114 880 197 gene locus_tag LOCUS_46430 880 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 >Feature sequence2115 >Feature sequence2116 <1 556 gene locus_tag LOCUS_46440 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245485.1:RNA polymerase sigma factor YlaC 543 941 gene locus_tag LOCUS_46450 543 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence2117 >Feature sequence2118 >Feature sequence2119 >Feature sequence2120 380 69 gene locus_tag LOCUS_46460 380 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 951 487 gene locus_tag LOCUS_46470 951 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 >Feature sequence2121 2 724 gene locus_tag LOCUS_46480 2 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence2122 <1 1141 gene locus_tag LOCUS_46490 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940957.1:DNA repair protein RadA >Feature sequence2123 734 270 gene locus_tag LOCUS_46500 734 270 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_46500 1045 734 gene locus_tag LOCUS_46510 1045 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 >Feature sequence2124 >Feature sequence2125 >Feature sequence2126 1112 822 gene locus_tag LOCUS_46520 1112 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 >Feature sequence2127 >Feature sequence2128 >Feature sequence2129 884 45 gene locus_tag LOCUS_46530 884 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence2130 42 1184 gene locus_tag LOCUS_46540 42 1184 CDS product IS630-like element ISBj5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082855.1 protein_id gnl|my_center|LOCUS_46540 >Feature sequence2131 >Feature sequence2132 133 480 gene locus_tag LOCUS_46550 133 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 1163 489 gene locus_tag LOCUS_46560 1163 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 >Feature sequence2133 1138 263 gene locus_tag LOCUS_46570 1138 263 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 protein_id gnl|my_center|LOCUS_46570 >Feature sequence2134 >Feature sequence2135 1050 94 gene locus_tag LOCUS_46580 1050 94 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_46580 >Feature sequence2136 1044 >1208 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgcgccccgccttgtgagcgggg >Feature sequence2137 >Feature sequence2138 1205 864 gene locus_tag LOCUS_46590 1205 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 >Feature sequence2139 >Feature sequence2140 >Feature sequence2141 514 840 gene locus_tag LOCUS_46600 514 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence2142 943 98 gene locus_tag LOCUS_46610 943 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence2143 <1 861 gene locus_tag LOCUS_46620 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206764.1:TonB-dependent receptor >Feature sequence2144 >Feature sequence2145 >Feature sequence2146 >Feature sequence2147 349 987 gene locus_tag LOCUS_46630 349 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence2148 322 906 gene locus_tag LOCUS_46640 322 906 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_46640 >Feature sequence2149 65 805 gene locus_tag LOCUS_46650 65 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 >Feature sequence2150 >Feature sequence2151 >Feature sequence2152 >Feature sequence2153 1082 237 gene locus_tag LOCUS_46660 1082 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence2154 172 618 gene locus_tag LOCUS_46670 172 618 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_46670 615 1049 gene locus_tag LOCUS_46680 615 1049 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_46680 >Feature sequence2155 154 1077 gene locus_tag LOCUS_46690 154 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 >Feature sequence2156 775 605 gene locus_tag LOCUS_46700 775 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 922 794 gene locus_tag LOCUS_46710 922 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 >Feature sequence2157 995 546 gene locus_tag LOCUS_46720 995 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089586.1 protein_id gnl|my_center|LOCUS_46720 >Feature sequence2158 899 312 gene locus_tag LOCUS_46730 899 312 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_46730 >Feature sequence2159 55 996 gene locus_tag LOCUS_46740 55 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 >Feature sequence2160 <1193 348 gene locus_tag LOCUS_46750 <1193 348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388586.1:type I-C CRISPR-associated protein Cas7/Csd2 >Feature sequence2161 92 319 gene locus_tag LOCUS_46760 92 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 347 535 gene locus_tag LOCUS_46770 347 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 557 988 gene locus_tag LOCUS_46780 557 988 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967809.1 protein_id gnl|my_center|LOCUS_46780 991 1128 gene locus_tag LOCUS_46790 991 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 >Feature sequence2162 591 893 gene locus_tag LOCUS_46800 591 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence2163 34 1014 gene locus_tag LOCUS_46810 34 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 >Feature sequence2164 >Feature sequence2165 >Feature sequence2166 301 864 gene locus_tag LOCUS_46820 301 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 >Feature sequence2167 164 1105 gene locus_tag LOCUS_46830 164 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 >Feature sequence2168 432 1154 gene locus_tag LOCUS_46840 432 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 >Feature sequence2169 <1189 18 gene locus_tag LOCUS_46850 <1189 18 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940834.1:diaminopimelate decarboxylase >Feature sequence2170 >Feature sequence2171 550 702 gene locus_tag LOCUS_46860 550 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 >Feature sequence2172 >Feature sequence2173 <1 616 gene locus_tag LOCUS_46870 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546841.1:response regulator 862 1179 gene locus_tag LOCUS_46880 862 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 >Feature sequence2174 1 1143 gene locus_tag LOCUS_46890 1 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 >Feature sequence2175 403 735 gene locus_tag LOCUS_46900 403 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 >Feature sequence2176 <1 732 gene locus_tag LOCUS_46910 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975627.1:glycosyltransferase family 4 protein >Feature sequence2177 1033 230 gene locus_tag LOCUS_46920 1033 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 >Feature sequence2178 1023 430 gene locus_tag LOCUS_46930 1023 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 >Feature sequence2179 727 476 gene locus_tag LOCUS_46940 727 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1049 738 gene locus_tag LOCUS_46950 1049 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 >Feature sequence2180 >Feature sequence2181 1033 455 gene locus_tag LOCUS_46960 1033 455 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_46960 >Feature sequence2182 676 834 gene locus_tag LOCUS_46970 676 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 >Feature sequence2183 >Feature sequence2184 >Feature sequence2185 596 27 gene locus_tag LOCUS_46980 596 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 <1182 568 gene locus_tag LOCUS_46990 <1182 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460118.1:thioredoxin domain-containing protein >Feature sequence2186 >Feature sequence2187 >Feature sequence2188 >Feature sequence2189 >Feature sequence2190 >Feature sequence2191 83 859 gene locus_tag LOCUS_47000 83 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 >Feature sequence2192 873 217 gene locus_tag LOCUS_47010 873 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 >Feature sequence2193 55 831 gene locus_tag LOCUS_47020 55 831 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_47020 >Feature sequence2194 <1175 280 gene locus_tag LOCUS_47030 <1175 280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017132.1:threonine ammonia-lyase >Feature sequence2195 >Feature sequence2196 >Feature sequence2197 106 1050 gene locus_tag LOCUS_47040 106 1050 CDS product PTO1314 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980496.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence2198 692 447 gene locus_tag LOCUS_47050 692 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 995 699 gene locus_tag LOCUS_47060 995 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 >Feature sequence2199 >Feature sequence2200 126 866 gene locus_tag LOCUS_47070 126 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence2201 412 140 gene locus_tag LOCUS_47080 412 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 >Feature sequence2202 >Feature sequence2203 227 730 gene locus_tag LOCUS_47090 227 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 >Feature sequence2204 >Feature sequence2205 651 343 gene locus_tag LOCUS_47100 651 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1113 658 gene locus_tag LOCUS_47110 1113 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037917.1 protein_id gnl|my_center|LOCUS_47110 >Feature sequence2206 >Feature sequence2207 805 89 gene locus_tag LOCUS_47120 805 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 >Feature sequence2208 581 192 gene locus_tag LOCUS_47130 581 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 1060 581 gene locus_tag LOCUS_47140 1060 581 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_47140 >Feature sequence2209 <1 1124 gene locus_tag LOCUS_47150 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463959.1:site-specific integrase >Feature sequence2210 286 528 gene locus_tag LOCUS_47160 286 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 515 1003 gene locus_tag LOCUS_47170 515 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 >Feature sequence2211 <1 633 gene locus_tag LOCUS_47180 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117905.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence2212 1069 851 gene locus_tag LOCUS_47190 1069 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 >Feature sequence2213 >Feature sequence2214 >Feature sequence2215 <1164 120 gene locus_tag LOCUS_47200 <1164 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766157.1:efflux transporter outer membrane subunit >Feature sequence2216 <1 821 gene locus_tag LOCUS_47210 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058098.1:aminopeptidase P N-terminal domain-containing protein >Feature sequence2217 1126 83 gene locus_tag LOCUS_47220 1126 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 >Feature sequence2218 >Feature sequence2219 <1163 533 gene locus_tag LOCUS_47230 <1163 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940146.1:AraC family transcriptional regulator >Feature sequence2220 1146 505 gene locus_tag LOCUS_47240 gene fabI 1146 505 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_47240 >Feature sequence2221 >Feature sequence2222 <1160 220 gene locus_tag LOCUS_47250 <1160 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208806.1:xylulokinase >Feature sequence2223 979 503 gene locus_tag LOCUS_47260 979 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 >Feature sequence2224 631 368 gene locus_tag LOCUS_47270 631 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 1157 837 gene locus_tag LOCUS_47280 1157 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 >Feature sequence2225 187 879 gene locus_tag LOCUS_47290 187 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1049 855 gene locus_tag LOCUS_47300 1049 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 >Feature sequence2226 83 997 gene locus_tag LOCUS_47310 83 997 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_47310 >Feature sequence2227 >Feature sequence2228 14 175 gene locus_tag LOCUS_47320 14 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 260 385 gene locus_tag LOCUS_47330 260 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 829 464 gene locus_tag LOCUS_47340 829 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 >Feature sequence2229 >Feature sequence2230 >Feature sequence2231 >Feature sequence2232 >Feature sequence2233 <1 618 gene locus_tag LOCUS_47350 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001050401.1:type I-E CRISPR-associated protein Cse1/CasA 615 1070 gene locus_tag LOCUS_47360 gene casB 615 1070 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942035.1 protein_id gnl|my_center|LOCUS_47360 >Feature sequence2234 >Feature sequence2235 >Feature sequence2236 >Feature sequence2237 >Feature sequence2238 166 924 gene locus_tag LOCUS_47370 gene lepB 166 924 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_47370 >Feature sequence2239 <1149 403 gene locus_tag LOCUS_47380 <1149 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941031.1:ATP-dependent DNA helicase DinG >Feature sequence2240 >Feature sequence2241 459 776 gene locus_tag LOCUS_47390 459 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 >Feature sequence2242 >Feature sequence2243 917 150 gene locus_tag LOCUS_47400 917 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 >Feature sequence2244 >Feature sequence2245 3 581 gene locus_tag LOCUS_47410 3 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 886 731 gene locus_tag LOCUS_47420 886 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 >Feature sequence2246 >Feature sequence2247 602 141 gene locus_tag LOCUS_47430 602 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence2248 >Feature sequence2249 >Feature sequence2250 101 628 gene locus_tag LOCUS_47440 101 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 619 915 gene locus_tag LOCUS_47450 619 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 >Feature sequence2251 611 273 gene locus_tag LOCUS_47460 611 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 >Feature sequence2252 155 880 gene locus_tag LOCUS_47470 155 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 >Feature sequence2253 108 698 gene locus_tag LOCUS_47480 108 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 >Feature sequence2254 673 224 gene locus_tag LOCUS_47490 673 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_47490 >Feature sequence2255 >Feature sequence2256 >Feature sequence2257 <1 1138 gene locus_tag LOCUS_47500 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC >Feature sequence2258 360 605 gene locus_tag LOCUS_47510 360 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 >Feature sequence2259 <1 584 gene locus_tag LOCUS_47520 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545922.1:MASE3 domain-containing protein >Feature sequence2260 >Feature sequence2261 <1 1001 gene locus_tag LOCUS_47530 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879704.1:methylmalonyl-CoA mutase family protein >Feature sequence2262 >Feature sequence2263 >Feature sequence2264 >Feature sequence2265 >Feature sequence2266 155 628 gene locus_tag LOCUS_47540 155 628 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908043.1 protein_id gnl|my_center|LOCUS_47540 >Feature sequence2267 <1 897 gene locus_tag LOCUS_47550 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194588.1:MFS transporter >Feature sequence2268 <1127 272 gene locus_tag LOCUS_47560 <1127 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978312.1:transcription initiation factor IIB >Feature sequence2269 917 357 gene locus_tag LOCUS_47570 917 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 >Feature sequence2270 1067 243 gene locus_tag LOCUS_47580 1067 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 >Feature sequence2271 483 253 gene locus_tag LOCUS_47590 483 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence2272 140 298 gene locus_tag LOCUS_47600 140 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 312 905 gene locus_tag LOCUS_47610 312 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence2273 22 861 gene locus_tag LOCUS_47620 22 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 >Feature sequence2274 >Feature sequence2275 >Feature sequence2276 >Feature sequence2277 3 200 gene locus_tag LOCUS_47630 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 >Feature sequence2278 >Feature sequence2279 779 576 gene locus_tag LOCUS_47640 779 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 >Feature sequence2280 >Feature sequence2281 >Feature sequence2282 1 873 gene locus_tag LOCUS_47650 1 873 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_47650 >Feature sequence2283 >Feature sequence2284 1099 104 gene locus_tag LOCUS_47660 1099 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 >Feature sequence2285 966 154 gene locus_tag LOCUS_47670 966 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 >Feature sequence2286 992 801 gene locus_tag LOCUS_47680 992 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 >Feature sequence2287 <1116 473 gene locus_tag LOCUS_47690 <1116 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase >Feature sequence2288 473 198 gene locus_tag LOCUS_47700 473 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence2289 228 593 gene locus_tag LOCUS_47710 228 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 >Feature sequence2290 622 500 gene locus_tag LOCUS_47720 622 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 914 666 gene locus_tag LOCUS_47730 914 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 >Feature sequence2291 1091 915 gene locus_tag LOCUS_47740 1091 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 >Feature sequence2292 >Feature sequence2293 >Feature sequence2294 >Feature sequence2295 >Feature sequence2296 <1 845 gene locus_tag LOCUS_47750 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861789.1:VWA-like domain-containing protein >Feature sequence2297 <1 1062 gene locus_tag LOCUS_47760 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932452.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence2298 >Feature sequence2299 32 817 gene locus_tag LOCUS_47770 32 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 >Feature sequence2300 >Feature sequence2301 >Feature sequence2302 703 308 gene locus_tag LOCUS_47780 703 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 >Feature sequence2303 >Feature sequence2304 >Feature sequence2305 >Feature sequence2306 <1 760 gene locus_tag LOCUS_47790 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113879.1:APC family permease >Feature sequence2307 <1 757 gene locus_tag LOCUS_47800 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940757.1:DegQ family serine endoprotease >Feature sequence2308 902 288 gene locus_tag LOCUS_47810 902 288 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_47810 >Feature sequence2309 <1108 89 gene locus_tag LOCUS_47820 <1108 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128948458.1:sulfotransferase >Feature sequence2310 >Feature sequence2311 >Feature sequence2312 548 976 gene locus_tag LOCUS_47830 548 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 >Feature sequence2313 1008 334 gene locus_tag LOCUS_47840 1008 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 >Feature sequence2314 >Feature sequence2315 153 350 gene locus_tag LOCUS_47850 153 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 462 914 gene locus_tag LOCUS_47860 462 914 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_47860 >Feature sequence2316 702 406 gene locus_tag LOCUS_47870 702 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence2317 <1105 122 gene locus_tag LOCUS_47880 <1105 122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260625.1:DUF4159 domain-containing protein >Feature sequence2318 352 1011 gene locus_tag LOCUS_47890 352 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 >Feature sequence2319 60 653 gene locus_tag LOCUS_47900 60 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence2320 >Feature sequence2321 >Feature sequence2322 >Feature sequence2323 595 215 gene locus_tag LOCUS_47910 595 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 >Feature sequence2324 >Feature sequence2325 648 794 gene locus_tag LOCUS_47920 648 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 >Feature sequence2326 854 210 gene locus_tag LOCUS_47930 854 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 >Feature sequence2327 267 683 gene locus_tag LOCUS_47940 267 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence2328 >Feature sequence2329 >Feature sequence2330 >Feature sequence2331 >Feature sequence2332 <1098 28 gene locus_tag LOCUS_47950 <1098 28 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066875.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence2333 537 704 gene locus_tag LOCUS_47960 537 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 >Feature sequence2334 >Feature sequence2335 <1 513 gene locus_tag LOCUS_47970 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249288.1:5-oxoprolinase subunit PxpB >Feature sequence2336 >Feature sequence2337 106 804 gene locus_tag LOCUS_47980 106 804 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 protein_id gnl|my_center|LOCUS_47980 >Feature sequence2338 1018 53 gene locus_tag LOCUS_47990 1018 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 >Feature sequence2339 75 980 gene locus_tag LOCUS_48000 75 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 >Feature sequence2340 513 166 gene locus_tag LOCUS_48010 513 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 653 835 gene locus_tag LOCUS_48020 653 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 >Feature sequence2341 >Feature sequence2342 >Feature sequence2343 497 288 gene locus_tag LOCUS_48030 497 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 >Feature sequence2344 183 920 gene locus_tag LOCUS_48040 183 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 >Feature sequence2345 <1 777 gene locus_tag LOCUS_48050 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258689.1:ISL3 family transposase >Feature sequence2346 >Feature sequence2347 667 999 gene locus_tag LOCUS_48060 667 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 >Feature sequence2348 <1 870 gene locus_tag LOCUS_48070 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403490.1:mycofactocin radical SAM maturase >Feature sequence2349 <1091 259 gene locus_tag LOCUS_48080 <1091 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963798.1:two-component system sensory protein >Feature sequence2350 <1090 117 gene locus_tag LOCUS_48090 <1090 117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076055578.1:radical SAM protein >Feature sequence2351 445 158 gene locus_tag LOCUS_48100 445 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48100 861 397 gene locus_tag LOCUS_48110 861 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48110 >Feature sequence2352 >Feature sequence2353 1 696 gene locus_tag LOCUS_48120 1 696 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence2354 3 923 gene locus_tag LOCUS_48130 3 923 CDS product IS110-like element ISMac14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022688.1 protein_id gnl|my_center|LOCUS_48130 >Feature sequence2355 >Feature sequence2356 >Feature sequence2357 95 928 gene locus_tag LOCUS_48140 95 928 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461127.1 protein_id gnl|my_center|LOCUS_48140 >Feature sequence2358 1 825 gene locus_tag LOCUS_48150 1 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 >Feature sequence2359 >Feature sequence2360 >Feature sequence2361 >Feature sequence2362 <1086 409 gene locus_tag LOCUS_48160 <1086 409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943809.1:tetratricopeptide repeat protein >Feature sequence2363 >Feature sequence2364 >Feature sequence2365 >Feature sequence2366 958 56 gene locus_tag LOCUS_48170 958 56 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_48170 >Feature sequence2367 >Feature sequence2368 107 781 gene locus_tag LOCUS_48180 107 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence2369 <1082 51 gene locus_tag LOCUS_48190 <1082 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041608957.1:transposase >Feature sequence2370 747 73 gene locus_tag LOCUS_48200 747 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 >Feature sequence2371 >Feature sequence2372 >Feature sequence2373 <1 785 gene locus_tag LOCUS_48210 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723905.1:tetratricopeptide repeat protein >Feature sequence2374 696 1004 gene locus_tag LOCUS_48220 696 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 >Feature sequence2375 >Feature sequence2376 >Feature sequence2377 <1 823 gene locus_tag LOCUS_48230 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986950.1:fused FliR family export protein/FlhB family type III secretion system protein >Feature sequence2378 >Feature sequence2379 >Feature sequence2380 360 872 gene locus_tag LOCUS_48240 360 872 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_48240 >Feature sequence2381 884 102 gene locus_tag LOCUS_48250 884 102 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973873.1 protein_id gnl|my_center|LOCUS_48250 >Feature sequence2382 489 944 gene locus_tag LOCUS_48260 489 944 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence2383 >Feature sequence2384 >Feature sequence2385 >Feature sequence2386 255 482 gene locus_tag LOCUS_48270 255 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence2387 >Feature sequence2388 <1072 305 gene locus_tag LOCUS_48280 <1072 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120117.1:sulfatase-like hydrolase/transferase >Feature sequence2389 600 427 gene locus_tag LOCUS_48290 600 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 835 587 gene locus_tag LOCUS_48300 835 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 >Feature sequence2390 <1 809 gene locus_tag LOCUS_48310 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073892.1:preprotein translocase subunit SecA >Feature sequence2391 >Feature sequence2392 <1 758 gene locus_tag LOCUS_48320 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257995.1:glycosyltransferase family 4 protein >Feature sequence2393 <1069 119 gene locus_tag LOCUS_48330 <1069 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942254.1:TolC family protein >Feature sequence2394 365 670 gene locus_tag LOCUS_48340 365 670 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_48340 >Feature sequence2395 222 19 gene locus_tag LOCUS_48350 222 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 >Feature sequence2396 <1 671 gene locus_tag LOCUS_48360 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940806.1:methionyl-tRNA formyltransferase >Feature sequence2397 <1068 367 gene locus_tag LOCUS_48370 <1068 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030976.1:Vms1/Ankzf1 family peptidyl-tRNA hydrolase >Feature sequence2398 >Feature sequence2399 <1 1043 gene locus_tag LOCUS_48380 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011921673.1:IS110 family transposase >Feature sequence2400 >Feature sequence2401 >Feature sequence2402 >Feature sequence2403 909 751 gene locus_tag LOCUS_48390 909 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 >Feature sequence2404 >Feature sequence2405 1029 415 gene locus_tag LOCUS_48400 1029 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 >Feature sequence2406 991 740 gene locus_tag LOCUS_48410 991 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 >Feature sequence2407 1041 442 gene locus_tag LOCUS_48420 gene kdpC 1041 442 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973321.1 protein_id gnl|my_center|LOCUS_48420 >Feature sequence2408 <1061 419 gene locus_tag LOCUS_48430 <1061 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence2409 >Feature sequence2410 281 853 gene locus_tag LOCUS_48440 gene sigR 281 853 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_48440 >Feature sequence2411 >Feature sequence2412 <1 974 gene locus_tag LOCUS_48450 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141097.1:serine/threonine-protein kinase >Feature sequence2413 168 31 gene locus_tag LOCUS_48460 168 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 976 140 gene locus_tag LOCUS_48470 976 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 >Feature sequence2414 >Feature sequence2415 908 177 gene locus_tag LOCUS_48480 908 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 >Feature sequence2416 >Feature sequence2417 <1 983 gene locus_tag LOCUS_48490 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524118.1:glycosyltransferase >Feature sequence2418 101 895 gene locus_tag LOCUS_48500 101 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 >Feature sequence2419 >Feature sequence2420 822 100 gene locus_tag LOCUS_48510 822 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 >Feature sequence2421 >Feature sequence2422 335 517 gene locus_tag LOCUS_48520 335 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence2423 529 134 gene locus_tag LOCUS_48530 529 134 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_48530 900 721 gene locus_tag LOCUS_48540 900 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 >Feature sequence2424 666 58 gene locus_tag LOCUS_48550 gene rplJ 666 58 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_48550 1053 709 gene locus_tag LOCUS_48560 1053 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 >Feature sequence2425 23 262 gene locus_tag LOCUS_48570 23 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 <1053 386 gene locus_tag LOCUS_48580 <1053 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978560.1:isochorismatase family protein >Feature sequence2426 109 1023 gene locus_tag LOCUS_48590 109 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 >Feature sequence2427 >Feature sequence2428 288 773 gene locus_tag LOCUS_48600 gene tssE 288 773 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318239.1 protein_id gnl|my_center|LOCUS_48600 >Feature sequence2429 >Feature sequence2430 >Feature sequence2431 745 221 gene locus_tag LOCUS_48610 745 221 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220565.1 protein_id gnl|my_center|LOCUS_48610 >Feature sequence2432 497 219 gene locus_tag LOCUS_48620 497 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 >Feature sequence2433 <1050 342 gene locus_tag LOCUS_48630 <1050 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496756.1:proteasome assembly chaperone family protein >Feature sequence2434 >Feature sequence2435 85 348 gene locus_tag LOCUS_48640 85 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 >Feature sequence2436 >Feature sequence2437 >Feature sequence2438 317 198 gene locus_tag LOCUS_48650 317 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 351 911 gene locus_tag LOCUS_48660 351 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 >Feature sequence2439 <1048 106 gene locus_tag LOCUS_48670 <1048 106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392052.1:histidinol-phosphate transaminase >Feature sequence2440 269 144 gene locus_tag LOCUS_48680 269 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 680 297 gene locus_tag LOCUS_48690 680 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 995 867 gene locus_tag LOCUS_48700 995 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 >Feature sequence2441 903 691 gene locus_tag LOCUS_48710 903 691 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_48710 >Feature sequence2442 <1 504 gene locus_tag LOCUS_48720 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119312.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD 508 912 gene locus_tag LOCUS_48730 gene rplS 508 912 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_48730 >Feature sequence2443 >Feature sequence2444 >Feature sequence2445 619 35 gene locus_tag LOCUS_48740 619 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence2446 <1046 164 gene locus_tag LOCUS_48750 <1046 164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929187.1:FAD-binding oxidoreductase >Feature sequence2447 >Feature sequence2448 >Feature sequence2449 >Feature sequence2450 >Feature sequence2451 647 165 gene locus_tag LOCUS_48760 gene moaC 647 165 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_48760 1043 789 gene locus_tag LOCUS_48770 1043 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 >Feature sequence2452 <1044 468 gene locus_tag LOCUS_48780 <1044 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000567017.1:tetratricopeptide repeat protein >Feature sequence2453 >Feature sequence2454 <1042 23 gene locus_tag LOCUS_48790 <1042 23 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256724.1:N-6 DNA methylase >Feature sequence2455 >Feature sequence2456 >Feature sequence2457 295 486 gene locus_tag LOCUS_48800 295 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 640 888 gene locus_tag LOCUS_48810 640 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 >Feature sequence2458 957 691 gene locus_tag LOCUS_48820 957 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 >Feature sequence2459 366 139 gene locus_tag LOCUS_48830 366 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 1038 370 gene locus_tag LOCUS_48840 1038 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 >Feature sequence2460 >Feature sequence2461 276 929 gene locus_tag LOCUS_48850 276 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 >Feature sequence2462 630 965 gene locus_tag LOCUS_48860 630 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 >Feature sequence2463 418 1014 gene locus_tag LOCUS_48870 418 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48870 >Feature sequence2464 >Feature sequence2465 >Feature sequence2466 >Feature sequence2467 873 562 gene locus_tag LOCUS_48880 873 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 >Feature sequence2468 >Feature sequence2469 >Feature sequence2470 >Feature sequence2471 >Feature sequence2472 183 49 gene locus_tag LOCUS_48890 183 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 723 598 gene locus_tag LOCUS_48900 723 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 >Feature sequence2473 >Feature sequence2474 348 635 gene locus_tag LOCUS_48910 348 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 >Feature sequence2475 <1 1013 gene locus_tag LOCUS_48920 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922542.1:DUF1553 domain-containing protein >Feature sequence2476 1011 190 gene locus_tag LOCUS_48930 gene uppS 1011 190 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_48930 >Feature sequence2477 >Feature sequence2478 >Feature sequence2479 990 172 gene locus_tag LOCUS_48940 gene mazG 990 172 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_48940 >Feature sequence2480 232 459 gene locus_tag LOCUS_48950 232 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 519 716 gene locus_tag LOCUS_48960 519 716 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393285.1 protein_id gnl|my_center|LOCUS_48960 >Feature sequence2481 >Feature sequence2482 >Feature sequence2483 >Feature sequence2484 >Feature sequence2485 217 546 gene locus_tag LOCUS_48970 217 546 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229481.1 protein_id gnl|my_center|LOCUS_48970 >Feature sequence2486 535 383 gene locus_tag LOCUS_48980 535 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 742 605 gene locus_tag LOCUS_48990 742 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 >Feature sequence2487 <1 938 gene locus_tag LOCUS_49000 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142246.1:IS1634 family transposase >Feature sequence2488 405 82 gene locus_tag LOCUS_49010 405 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 >Feature sequence2489 149 1006 gene locus_tag LOCUS_49020 gene atpG 149 1006 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_49020 >Feature sequence2490 >Feature sequence2491 >Feature sequence2492 >Feature sequence2493 179 949 gene locus_tag LOCUS_49030 gene surE 179 949 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_49030 950 1026 gene locus_tag LOCUS_t00520 950 1026 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2494 >Feature sequence2495 316 822 gene locus_tag LOCUS_49040 316 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 >Feature sequence2496 749 381 gene locus_tag LOCUS_49050 749 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 866 1000 gene locus_tag LOCUS_49060 866 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence2497 876 121 gene locus_tag LOCUS_49070 876 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 >Feature sequence2498 <1024 14 gene locus_tag LOCUS_49080 <1024 14 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003862769.1:Fic family protein >Feature sequence2499 777 439 gene locus_tag LOCUS_49090 777 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence2500 805 978 gene locus_tag LOCUS_49100 805 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 >Feature sequence2501 232 351 gene locus_tag LOCUS_49110 232 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 >Feature sequence2502 18 230 gene locus_tag LOCUS_49120 18 230 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_49120 419 1015 gene locus_tag LOCUS_49130 419 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 >Feature sequence2503 >Feature sequence2504 >Feature sequence2505 >Feature sequence2506 757 611 gene locus_tag LOCUS_49140 757 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 >Feature sequence2507 700 545 gene locus_tag LOCUS_49150 700 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence2508 >Feature sequence2509 747 91 gene locus_tag LOCUS_49160 747 91 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142952.1 protein_id gnl|my_center|LOCUS_49160 >Feature sequence2510 >Feature sequence2511 >Feature sequence2512 115 534 gene locus_tag LOCUS_49170 115 534 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_49170 >Feature sequence2513 286 669 gene locus_tag LOCUS_49180 286 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 >Feature sequence2514 >Feature sequence2515 55 870 gene locus_tag LOCUS_49190 55 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 >Feature sequence2516 >Feature sequence2517 542 868 gene locus_tag LOCUS_49200 542 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 >Feature sequence2518 >Feature sequence2519 >Feature sequence2520 >Feature sequence2521 >Feature sequence2522 >Feature sequence2523 >Feature sequence2524 713 636 gene locus_tag LOCUS_t00530 713 636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2525 401 724 gene locus_tag LOCUS_49210 401 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence2526 183 46 gene locus_tag LOCUS_49220 183 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 >Feature sequence2527 >Feature sequence2528 717 956 gene locus_tag LOCUS_49230 717 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 >Feature sequence2529 647 39 gene locus_tag LOCUS_49240 647 39 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_49240 >Feature sequence2530 >Feature sequence2531 >Feature sequence2532 873 439 gene locus_tag LOCUS_49250 873 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 >Feature sequence2533 599 1003 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gactcaatgccctgacgggcattccttcttttccac >Feature sequence2534 115 360 gene locus_tag LOCUS_49260 115 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 >Feature sequence2535 153 713 gene locus_tag LOCUS_49270 153 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728163.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence2536 >Feature sequence2537 284 3 gene locus_tag LOCUS_49280 284 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 907 395 gene locus_tag LOCUS_49290 907 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 >Feature sequence2538 <1 764 gene locus_tag LOCUS_49300 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975826.1:adenylate/guanylate cyclase domain-containing protein 944 681 gene locus_tag LOCUS_49310 944 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 >Feature sequence2539 >Feature sequence2540 <1005 398 gene locus_tag LOCUS_49320 <1005 398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681381.1:type I restriction-modification system subunit M >Feature sequence2541 404 712 gene locus_tag LOCUS_49330 404 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 >Feature sequence2542 1005 127 gene locus_tag LOCUS_49340 1005 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 >Feature sequence2543 >Feature sequence2544 >Feature sequence2545 >Feature sequence2546 553 245 gene locus_tag LOCUS_49350 553 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 >Feature sequence2547 311 57 gene locus_tag LOCUS_49360 311 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 815 402 gene locus_tag LOCUS_49370 815 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 >Feature sequence2548 >Feature sequence2549 740 985 gene locus_tag LOCUS_49380 740 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 >Feature sequence2550 >Feature sequence2551 <1001 261 gene locus_tag LOCUS_49390 <1001 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665703.1:TIGR01777 family oxidoreductase >Feature sequence2552 774 406 gene locus_tag LOCUS_49400 774 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 >Feature sequence2553 >Feature sequence2554 <1 887 gene locus_tag LOCUS_49410 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000687652.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence2555 >Feature sequence2556 <1 745 gene locus_tag LOCUS_49420 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024698054.1:IS66 family transposase 727 903 gene locus_tag LOCUS_49430 727 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 >Feature sequence2557 738 962 gene locus_tag LOCUS_49440 738 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 >Feature sequence2558