>Feature sequence001 <1 733 gene locus_tag LOCUS_00010 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA 820 1857 gene locus_tag LOCUS_00020 gene prfB 820 1857 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193576902.1 protein_id gnl|my_center|LOCUS_00020 1900 2805 gene locus_tag LOCUS_00030 1900 2805 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_00030 2821 4080 gene locus_tag LOCUS_00040 2821 4080 CDS product alcohol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930145.1 protein_id gnl|my_center|LOCUS_00040 4096 4803 gene locus_tag LOCUS_00050 4096 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4913 6904 gene locus_tag LOCUS_00060 4913 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6963 7388 gene locus_tag LOCUS_00070 6963 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_00070 7413 7631 gene locus_tag LOCUS_00080 7413 7631 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_00080 7650 7805 gene locus_tag LOCUS_00090 7650 7805 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_00090 7890 8327 gene locus_tag LOCUS_00100 gene iscR 7890 8327 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_00100 8440 9594 gene locus_tag LOCUS_00110 8440 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9444 9453 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10049 9603 gene locus_tag LOCUS_00120 10049 9603 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_00120 10592 10140 gene locus_tag LOCUS_00130 10592 10140 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815079.1 protein_id gnl|my_center|LOCUS_00130 10686 10922 gene locus_tag LOCUS_00140 10686 10922 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156275601.1 protein_id gnl|my_center|LOCUS_00140 10926 13076 gene locus_tag LOCUS_00150 gene feoB 10926 13076 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_00150 14811 13141 gene locus_tag LOCUS_00160 14811 13141 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_00160 15053 16441 gene locus_tag LOCUS_00170 gene cysS 15053 16441 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048360.1 protein_id gnl|my_center|LOCUS_00170 17121 16540 gene locus_tag LOCUS_00180 17121 16540 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_00180 18201 17185 gene locus_tag LOCUS_00190 18201 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19175 18249 gene locus_tag LOCUS_00200 gene gpr 19175 18249 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_00200 19979 19260 gene locus_tag LOCUS_00210 19979 19260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_00210 20758 19976 gene locus_tag LOCUS_00220 20758 19976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080269.1 protein_id gnl|my_center|LOCUS_00220 21891 20755 gene locus_tag LOCUS_00230 21891 20755 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869389.1 protein_id gnl|my_center|LOCUS_00230 22792 21905 gene locus_tag LOCUS_00240 22792 21905 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869388.1 protein_id gnl|my_center|LOCUS_00240 24030 22894 gene locus_tag LOCUS_00250 24030 22894 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_00250 25713 24235 gene locus_tag LOCUS_00260 gene spoIVA 25713 24235 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_00260 26630 25881 gene locus_tag LOCUS_00270 26630 25881 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_00270 27062 26694 gene locus_tag LOCUS_00280 27062 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28139 27126 gene locus_tag LOCUS_00290 gene galE 28139 27126 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_00290 28280 29125 gene locus_tag LOCUS_00300 28280 29125 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_00300 29509 29195 gene locus_tag LOCUS_00310 gene trxA 29509 29195 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311093.1 protein_id gnl|my_center|LOCUS_00310 30265 29594 gene locus_tag LOCUS_00320 30265 29594 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_00320 32741 30354 gene locus_tag LOCUS_00330 32741 30354 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_00330 33413 32751 gene locus_tag LOCUS_00340 33413 32751 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_00340 34285 33404 gene locus_tag LOCUS_00350 gene metF 34285 33404 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_00350 34645 35634 gene locus_tag LOCUS_00360 34645 35634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_00360 36374 35685 gene locus_tag LOCUS_00370 36374 35685 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 protein_id gnl|my_center|LOCUS_00370 36629 37450 gene locus_tag LOCUS_00380 36629 37450 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886529.1 protein_id gnl|my_center|LOCUS_00380 37721 40099 gene locus_tag LOCUS_00390 37721 40099 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184871.1 protein_id gnl|my_center|LOCUS_00390 40096 41010 gene locus_tag LOCUS_00400 40096 41010 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_00400 41007 42776 gene locus_tag LOCUS_00410 41007 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 43620 42787 gene locus_tag LOCUS_00420 43620 42787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_00420 44503 43637 gene locus_tag LOCUS_00430 44503 43637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986699.1 protein_id gnl|my_center|LOCUS_00430 45327 44494 gene locus_tag LOCUS_00440 45327 44494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070109415.1 protein_id gnl|my_center|LOCUS_00440 45713 45324 gene locus_tag LOCUS_00450 45713 45324 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392925.1 protein_id gnl|my_center|LOCUS_00450 46089 45718 gene locus_tag LOCUS_00460 46089 45718 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_00460 46402 46148 gene locus_tag LOCUS_00470 46402 46148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46786 49416 gene locus_tag LOCUS_00480 gene mgtA 46786 49416 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_00480 50334 49423 gene locus_tag LOCUS_00490 50334 49423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50750 50439 gene locus_tag LOCUS_00500 50750 50439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51169 50801 gene locus_tag LOCUS_00510 51169 50801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51441 52742 gene locus_tag LOCUS_00520 gene rsxC 51441 52742 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_00520 52739 53698 gene locus_tag LOCUS_00530 52739 53698 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_00530 53691 53981 gene locus_tag LOCUS_00540 53691 53981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 53950 54225 gene locus_tag LOCUS_00550 53950 54225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54238 54891 gene locus_tag LOCUS_00560 54238 54891 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_00560 54888 55496 gene locus_tag LOCUS_00570 gene rsxA 54888 55496 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366851.1 protein_id gnl|my_center|LOCUS_00570 55509 56309 gene locus_tag LOCUS_00580 55509 56309 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_00580 57861 56353 gene locus_tag LOCUS_00590 57861 56353 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_00590 59390 57984 gene locus_tag LOCUS_00600 59390 57984 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_00600 59621 61162 gene locus_tag LOCUS_00610 59621 61162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 62957 61209 gene locus_tag LOCUS_00620 62957 61209 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00620 63266 63961 gene locus_tag LOCUS_00630 63266 63961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_00630 63988 65754 gene locus_tag LOCUS_00640 63988 65754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65751 67079 gene locus_tag LOCUS_00650 65751 67079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_00650 67189 67638 gene locus_tag LOCUS_00660 gene mscL 67189 67638 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_00660 67638 68063 gene locus_tag LOCUS_00670 67638 68063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 68126 69355 gene locus_tag LOCUS_00680 gene tyrS 68126 69355 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_00680 69355 69984 gene locus_tag LOCUS_00690 69355 69984 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_00690 70042 70266 gene locus_tag LOCUS_00700 70042 70266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00700 70218 70227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 70328 71092 gene locus_tag LOCUS_00710 70328 71092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 71161 72966 gene locus_tag LOCUS_00720 71161 72966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 73057 73728 gene locus_tag LOCUS_00730 73057 73728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 75590 73731 gene locus_tag LOCUS_00740 75590 73731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 76048 75599 gene locus_tag LOCUS_00750 76048 75599 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813451.1 protein_id gnl|my_center|LOCUS_00750 76145 76708 gene locus_tag LOCUS_00760 76145 76708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76822 78063 gene locus_tag LOCUS_00770 76822 78063 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_00770 78173 78826 gene locus_tag LOCUS_00780 78173 78826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 78828 79328 gene locus_tag LOCUS_00790 78828 79328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 79237 79246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 79422 79811 gene locus_tag LOCUS_00800 79422 79811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 79848 80111 gene locus_tag LOCUS_00810 79848 80111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 80133 81914 gene locus_tag LOCUS_00820 80133 81914 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_00820 82733 81915 gene locus_tag LOCUS_00830 82733 81915 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_00830 83430 82717 gene locus_tag LOCUS_00840 83430 82717 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_00840 84374 83430 gene locus_tag LOCUS_00850 84374 83430 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_00850 84810 84367 gene locus_tag LOCUS_00860 84810 84367 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_00860 85003 86082 gene locus_tag LOCUS_00870 85003 86082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 86067 86076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 86100 86750 gene locus_tag LOCUS_00880 86100 86750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 86893 87924 gene locus_tag LOCUS_00890 gene ltaE 86893 87924 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903270.1 protein_id gnl|my_center|LOCUS_00890 87943 89049 gene locus_tag LOCUS_00900 87943 89049 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_00900 89797 89060 gene locus_tag LOCUS_00910 89797 89060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886492.1 protein_id gnl|my_center|LOCUS_00910 89903 89739 gene locus_tag LOCUS_00920 89903 89739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 <91481 90509 gene locus_tag LOCUS_00930 <91481 90509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460899.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence002 2438 1845 gene locus_tag LOCUS_00940 2438 1845 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_00940 3116 2439 gene locus_tag LOCUS_00950 gene cmk 3116 2439 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303123.1 protein_id gnl|my_center|LOCUS_00950 4355 3135 gene locus_tag LOCUS_00960 4355 3135 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_00960 4987 4352 gene locus_tag LOCUS_00970 4987 4352 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_00970 5861 4995 gene locus_tag LOCUS_00980 5861 4995 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_00980 6677 5886 gene locus_tag LOCUS_00990 gene surE 6677 5886 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_00990 6861 7238 gene locus_tag LOCUS_01000 6861 7238 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_01000 7385 9124 gene locus_tag LOCUS_01010 7385 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9719 9183 gene locus_tag LOCUS_01020 gene raiA 9719 9183 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_01020 10817 9876 gene locus_tag LOCUS_01030 gene fba 10817 9876 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_01030 11010 11945 gene locus_tag LOCUS_01040 11010 11945 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_01040 11968 12351 gene locus_tag LOCUS_01050 11968 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 12386 13501 gene locus_tag LOCUS_01060 12386 13501 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_01060 13663 14679 gene locus_tag LOCUS_01070 gene gapA 13663 14679 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 protein_id gnl|my_center|LOCUS_01070 15359 14763 gene locus_tag LOCUS_01080 15359 14763 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_01080 15618 15373 gene locus_tag LOCUS_01090 15618 15373 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_01090 16406 17299 gene locus_tag LOCUS_01100 16406 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 17365 18171 gene locus_tag LOCUS_01110 17365 18171 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_01110 18174 18926 gene locus_tag LOCUS_01120 18174 18926 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_01120 20420 18987 gene locus_tag LOCUS_01130 20420 18987 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921831.1 protein_id gnl|my_center|LOCUS_01130 20550 20912 gene locus_tag LOCUS_01140 20550 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 20909 21907 gene locus_tag LOCUS_01150 20909 21907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 22004 22825 gene locus_tag LOCUS_01160 22004 22825 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_01160 22822 23739 gene locus_tag LOCUS_01170 gene hprK 22822 23739 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_01170 23753 24697 gene locus_tag LOCUS_01180 23753 24697 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_01180 25072 25500 gene locus_tag LOCUS_01190 25072 25500 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_01190 25775 25796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25877 29293 gene locus_tag LOCUS_01200 gene nifJ 25877 29293 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_01200 28639 28679 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30008 29403 gene locus_tag LOCUS_01210 30008 29403 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_01210 30473 30009 gene locus_tag LOCUS_01220 30473 30009 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_01220 30710 31852 gene locus_tag LOCUS_01230 30710 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 31807 31816 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31920 32195 gene locus_tag LOCUS_01240 31920 32195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 32205 34229 gene locus_tag LOCUS_01250 32205 34229 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680599.1 protein_id gnl|my_center|LOCUS_01250 34231 35127 gene locus_tag LOCUS_01260 gene ftcD 34231 35127 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_01260 35138 36367 gene locus_tag LOCUS_01270 gene hutI 35138 36367 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673322.1 protein_id gnl|my_center|LOCUS_01270 36364 36990 gene locus_tag LOCUS_01280 36364 36990 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_01280 37770 37054 gene locus_tag LOCUS_01290 gene nagB 37770 37054 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_01290 38876 37767 gene locus_tag LOCUS_01300 gene nagA 38876 37767 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963512.1 protein_id gnl|my_center|LOCUS_01300 40262 38883 gene locus_tag LOCUS_01310 40262 38883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 42101 40473 gene locus_tag LOCUS_01320 gene hcp 42101 40473 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_01320 42275 42111 gene locus_tag LOCUS_01330 42275 42111 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_01330 42645 42331 gene locus_tag LOCUS_01340 42645 42331 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870220.1 protein_id gnl|my_center|LOCUS_01340 42740 42922 gene locus_tag LOCUS_01350 42740 42922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 42915 44069 gene locus_tag LOCUS_01360 42915 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 44401 46860 gene locus_tag LOCUS_01370 44401 46860 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_01370 46954 47301 gene locus_tag LOCUS_01380 46954 47301 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_01380 47325 47798 gene locus_tag LOCUS_01390 47325 47798 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_01390 47795 48346 gene locus_tag LOCUS_01400 47795 48346 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393699.1 protein_id gnl|my_center|LOCUS_01400 48541 49365 gene locus_tag LOCUS_01410 48541 49365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 49919 50167 gene locus_tag LOCUS_01420 49919 50167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 50164 51303 gene locus_tag LOCUS_01430 50164 51303 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_01430 51300 52103 gene locus_tag LOCUS_01440 gene korB 51300 52103 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_01440 52103 52636 gene locus_tag LOCUS_01450 52103 52636 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_01450 52668 54326 gene locus_tag LOCUS_01460 52668 54326 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_01460 54342 54740 gene locus_tag LOCUS_01470 54342 54740 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_01470 54743 55708 gene locus_tag LOCUS_01480 gene meaB 54743 55708 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_01480 55720 56118 gene locus_tag LOCUS_01490 gene mce 55720 56118 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_01490 56185 57732 gene locus_tag LOCUS_01500 56185 57732 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 protein_id gnl|my_center|LOCUS_01500 57753 57941 gene locus_tag LOCUS_01510 57753 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 59235 57973 gene locus_tag LOCUS_01520 59235 57973 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_01520 60627 59266 gene locus_tag LOCUS_01530 gene hydA 60627 59266 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_01530 60955 61146 gene locus_tag LOCUS_01540 gene rpmB 60955 61146 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_01540 61722 61459 gene locus_tag LOCUS_01550 gene rpsT 61722 61459 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence003 3 353 gene locus_tag LOCUS_01560 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 600 2090 gene locus_tag LOCUS_01570 600 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 2312 2130 gene locus_tag LOCUS_01580 2312 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2719 2943 gene locus_tag LOCUS_01590 2719 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3951 3745 gene locus_tag LOCUS_01600 3951 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 4317 4015 gene locus_tag LOCUS_01610 gene tnpB 4317 4015 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_01610 4727 4362 gene locus_tag LOCUS_01620 4727 4362 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272552.1 protein_id gnl|my_center|LOCUS_01620 4989 7607 gene locus_tag LOCUS_01630 gene feoB 4989 7607 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_01630 7888 7670 gene locus_tag LOCUS_01640 7888 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7887 9959 gene locus_tag LOCUS_01650 gene fusA 7887 9959 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_01650 10118 11005 gene locus_tag LOCUS_01660 gene thrB 10118 11005 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897262.1 protein_id gnl|my_center|LOCUS_01660 11440 11018 gene locus_tag LOCUS_01670 11440 11018 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013326.1 protein_id gnl|my_center|LOCUS_01670 12010 11525 gene locus_tag LOCUS_01680 12010 11525 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_01680 13045 12056 gene locus_tag LOCUS_01690 13045 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 13300 13974 gene locus_tag LOCUS_01700 13300 13974 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 protein_id gnl|my_center|LOCUS_01700 13995 14303 gene locus_tag LOCUS_01710 13995 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 14316 14783 gene locus_tag LOCUS_01720 14316 14783 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_01720 14991 16466 gene locus_tag LOCUS_01730 14991 16466 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_01730 18091 16589 gene locus_tag LOCUS_01740 18091 16589 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817435.1 protein_id gnl|my_center|LOCUS_01740 19235 18108 gene locus_tag LOCUS_01750 gene alr 19235 18108 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01750 20427 19264 gene locus_tag LOCUS_01760 20427 19264 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_01760 20567 20582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20635 21186 gene locus_tag LOCUS_01770 gene rsmD 20635 21186 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_01770 21195 21689 gene locus_tag LOCUS_01780 gene coaD 21195 21689 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_01780 21689 22126 gene locus_tag LOCUS_01790 21689 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 22109 22118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22183 22524 gene locus_tag LOCUS_01800 22183 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 23471 22539 gene locus_tag LOCUS_01810 23471 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 27062 23499 gene locus_tag LOCUS_01820 gene smc 27062 23499 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_01820 27824 27108 gene locus_tag LOCUS_01830 gene rnc 27824 27108 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_01830 28116 27892 gene locus_tag LOCUS_01840 gene acpP 28116 27892 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_01840 29226 28225 gene locus_tag LOCUS_01850 gene plsX 29226 28225 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_01850 29548 29345 gene locus_tag LOCUS_01860 gene rpmF 29548 29345 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_01860 30047 29592 gene locus_tag LOCUS_01870 30047 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 30625 30080 gene locus_tag LOCUS_01880 gene pgsA 30625 30080 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_01880 32247 30793 gene locus_tag LOCUS_01890 32247 30793 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_01890 33446 32262 gene locus_tag LOCUS_01900 33446 32262 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_01900 33889 33479 gene locus_tag LOCUS_01910 33889 33479 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_01910 34349 33948 gene locus_tag LOCUS_01920 34349 33948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 35306 34584 gene locus_tag LOCUS_01930 35306 34584 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_01930 36447 35326 gene locus_tag LOCUS_01940 36447 35326 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_01940 36898 36473 gene locus_tag LOCUS_01950 gene ytfJ 36898 36473 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460223.1 protein_id gnl|my_center|LOCUS_01950 37524 36907 gene locus_tag LOCUS_01960 37524 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 39104 37608 gene locus_tag LOCUS_01970 gene pbpA 39104 37608 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_01970 40345 39101 gene locus_tag LOCUS_01980 40345 39101 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_01980 40802 40338 gene locus_tag LOCUS_01990 40802 40338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 42826 40901 gene locus_tag LOCUS_02000 42826 40901 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_02000 44058 43093 gene locus_tag LOCUS_02010 44058 43093 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_02010 44612 44118 gene locus_tag LOCUS_02020 gene lspA 44612 44118 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_02020 46166 44670 gene locus_tag LOCUS_02030 46166 44670 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_02030 46131 46154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46852 46280 gene locus_tag LOCUS_02040 46852 46280 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_02040 47491 46874 gene locus_tag LOCUS_02050 47491 46874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 50061 47488 gene locus_tag LOCUS_02060 gene polA 50061 47488 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_02060 51402 50095 gene locus_tag LOCUS_02070 51402 50095 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_02070 52691 51525 gene locus_tag LOCUS_02080 52691 51525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681920.1 protein_id gnl|my_center|LOCUS_02080 53820 52678 gene locus_tag LOCUS_02090 53820 52678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 54763 53822 gene locus_tag LOCUS_02100 54763 53822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_02100 55009 56001 gene locus_tag LOCUS_02110 55009 56001 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 protein_id gnl|my_center|LOCUS_02110 55998 56621 gene locus_tag LOCUS_02120 55998 56621 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_02120 57218 56646 gene locus_tag LOCUS_02130 57218 56646 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 protein_id gnl|my_center|LOCUS_02130 57431 58075 gene locus_tag LOCUS_02140 57431 58075 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_02140 58480 58091 gene locus_tag LOCUS_02150 gene rsfS 58480 58091 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_02150 59635 58505 gene locus_tag LOCUS_02160 59635 58505 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_02160 59758 60591 gene locus_tag LOCUS_02170 59758 60591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 60705 60848 gene locus_tag LOCUS_02180 60705 60848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 61155 62051 gene locus_tag LOCUS_02190 61155 62051 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_02190 62063 63139 gene locus_tag LOCUS_02200 gene buk 62063 63139 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence004 1990 1256 gene locus_tag LOCUS_02210 1990 1256 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360546.1 protein_id gnl|my_center|LOCUS_02210 2719 2141 gene locus_tag LOCUS_02220 2719 2141 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_02220 2849 3379 gene locus_tag LOCUS_02230 2849 3379 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_02230 4199 3426 gene locus_tag LOCUS_02240 4199 3426 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723203.1 protein_id gnl|my_center|LOCUS_02240 4411 5190 gene locus_tag LOCUS_02250 gene soj 4411 5190 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_02250 5177 6073 gene locus_tag LOCUS_02260 gene spo0J 5177 6073 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_02260 6777 6070 gene locus_tag LOCUS_02270 6777 6070 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860717.1 protein_id gnl|my_center|LOCUS_02270 6913 7806 gene locus_tag LOCUS_02280 6913 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 7817 8263 gene locus_tag LOCUS_02290 7817 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8363 9226 gene locus_tag LOCUS_02300 8363 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9348 11501 gene locus_tag LOCUS_02310 gene pbpC 9348 11501 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 protein_id gnl|my_center|LOCUS_02310 11529 12125 gene locus_tag LOCUS_02320 11529 12125 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_02320 12125 12538 gene locus_tag LOCUS_02330 12125 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 12605 13993 gene locus_tag LOCUS_02340 12605 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13994 14953 gene locus_tag LOCUS_02350 13994 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14986 16773 gene locus_tag LOCUS_02360 gene pepF 14986 16773 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_02360 16777 17523 gene locus_tag LOCUS_02370 16777 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 18093 19211 gene locus_tag LOCUS_02380 18093 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 19226 19927 gene locus_tag LOCUS_02390 19226 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 20415 19924 gene locus_tag LOCUS_02400 20415 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 20648 21622 gene locus_tag LOCUS_02410 gene spoIID 20648 21622 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_02410 22576 21626 gene locus_tag LOCUS_02420 22576 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 23546 22647 gene locus_tag LOCUS_02430 gene rarD 23546 22647 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458084.1 protein_id gnl|my_center|LOCUS_02430 23710 24768 gene locus_tag LOCUS_02440 23710 24768 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_02440 25098 27071 gene locus_tag LOCUS_02450 gene metG 25098 27071 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_02450 27094 27864 gene locus_tag LOCUS_02460 27094 27864 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_02460 28247 29653 gene locus_tag LOCUS_02470 28247 29653 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 protein_id gnl|my_center|LOCUS_02470 29781 31076 gene locus_tag LOCUS_02480 29781 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 30994 31557 gene locus_tag LOCUS_02490 30994 31557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 31559 31777 gene locus_tag LOCUS_02500 31559 31777 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_02500 31998 32681 gene locus_tag LOCUS_02510 31998 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 32889 32665 gene locus_tag LOCUS_02520 32889 32665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 33290 32997 gene locus_tag LOCUS_02530 33290 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 33516 33301 gene locus_tag LOCUS_02540 33516 33301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 34258 33527 gene locus_tag LOCUS_02550 34258 33527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 34538 34347 gene locus_tag LOCUS_02560 34538 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 35131 34544 gene locus_tag LOCUS_02570 35131 34544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 35928 35137 gene locus_tag LOCUS_02580 35928 35137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 37539 36040 gene locus_tag LOCUS_02590 37539 36040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 37744 38109 gene locus_tag LOCUS_02600 37744 38109 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701043.1 protein_id gnl|my_center|LOCUS_02600 38158 38544 gene locus_tag LOCUS_02610 38158 38544 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_02610 39759 38611 gene locus_tag LOCUS_02620 gene chvE 39759 38611 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085992.1 protein_id gnl|my_center|LOCUS_02620 41062 39824 gene locus_tag LOCUS_02630 gene gguB 41062 39824 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727841.1 protein_id gnl|my_center|LOCUS_02630 42639 41077 gene locus_tag LOCUS_02640 gene gguA 42639 41077 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_02640 43129 43138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 43168 45456 gene locus_tag LOCUS_02650 43168 45456 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_02650 45467 46387 gene locus_tag LOCUS_02660 45467 46387 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence005 39 1532 gene locus_tag LOCUS_02670 gene malQ 39 1532 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_02670 2018 1824 gene locus_tag LOCUS_02680 2018 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2264 2064 gene locus_tag LOCUS_02690 2264 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3298 2219 gene locus_tag LOCUS_02700 3298 2219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 protein_id gnl|my_center|LOCUS_02700 5012 3291 gene locus_tag LOCUS_02710 5012 3291 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974158.1 protein_id gnl|my_center|LOCUS_02710 6277 5132 gene locus_tag LOCUS_02720 6277 5132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_02720 7094 6393 gene locus_tag LOCUS_02730 7094 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7281 7877 gene locus_tag LOCUS_02740 7281 7877 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_02740 9316 7904 gene locus_tag LOCUS_02750 gene argH 9316 7904 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_02750 10567 9362 gene locus_tag LOCUS_02760 10567 9362 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_02760 10854 11345 gene locus_tag LOCUS_02770 gene infC 10854 11345 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_02770 11387 11584 gene locus_tag LOCUS_02780 gene rpmI 11387 11584 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_02780 11599 11955 gene locus_tag LOCUS_02790 gene rplT 11599 11955 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_02790 12102 12803 gene locus_tag LOCUS_02800 12102 12803 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357968.1 protein_id gnl|my_center|LOCUS_02800 12818 13852 gene locus_tag LOCUS_02810 12818 13852 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_02810 14007 14681 gene locus_tag LOCUS_02820 14007 14681 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_02820 14900 14742 gene locus_tag LOCUS_02830 14900 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 15109 15420 gene locus_tag LOCUS_02840 15109 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 15417 17339 gene locus_tag LOCUS_02850 15417 17339 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_02850 17405 17902 gene locus_tag LOCUS_02860 17405 17902 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_02860 17998 18606 gene locus_tag LOCUS_02870 17998 18606 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422659.1 protein_id gnl|my_center|LOCUS_02870 18621 19601 gene locus_tag LOCUS_02880 18621 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 19594 19929 gene locus_tag LOCUS_02890 19594 19929 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_02890 19930 21705 gene locus_tag LOCUS_02900 19930 21705 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_02900 21698 23080 gene locus_tag LOCUS_02910 21698 23080 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_02910 23083 23712 gene locus_tag LOCUS_02920 23083 23712 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_02920 23919 24611 gene locus_tag LOCUS_02930 23919 24611 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_02930 24686 26362 gene locus_tag LOCUS_02940 24686 26362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_02940 26795 26499 gene locus_tag LOCUS_02950 26795 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 26812 27294 gene locus_tag LOCUS_02960 26812 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27326 28024 gene locus_tag LOCUS_02970 gene sigE 27326 28024 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_02970 28825 28052 gene locus_tag LOCUS_02980 gene sigG 28825 28052 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_02980 29055 29372 gene locus_tag LOCUS_02990 gene yqfC 29055 29372 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_02990 29402 30577 gene locus_tag LOCUS_03000 29402 30577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 30614 31615 gene locus_tag LOCUS_03010 30614 31615 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_03010 31628 33760 gene locus_tag LOCUS_03020 gene pgpH 31628 33760 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_03020 33762 34211 gene locus_tag LOCUS_03030 33762 34211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 34192 34608 gene locus_tag LOCUS_03040 34192 34608 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_03040 34608 35495 gene locus_tag LOCUS_03050 gene era 34608 35495 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_03050 35752 36510 gene locus_tag LOCUS_03060 gene recO 35752 36510 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_03060 36656 39295 gene locus_tag LOCUS_03070 gene ppdK 36656 39295 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_03070 39509 40897 gene locus_tag LOCUS_03080 gene tig 39509 40897 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_03080 40935 41519 gene locus_tag LOCUS_03090 gene clpP 40935 41519 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_03090 41528 42787 gene locus_tag LOCUS_03100 gene clpX 41528 42787 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_03100 42924 44639 gene locus_tag LOCUS_03110 gene lonB 42924 44639 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357503.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence006 106 867 gene locus_tag LOCUS_03120 gene dapB 106 867 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496490.1 protein_id gnl|my_center|LOCUS_03120 1326 1003 gene locus_tag LOCUS_03130 1326 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2310 1411 gene locus_tag LOCUS_03140 2310 1411 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393187.1 protein_id gnl|my_center|LOCUS_03140 3118 2498 gene locus_tag LOCUS_03150 3118 2498 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393188.1 protein_id gnl|my_center|LOCUS_03150 3735 3094 gene locus_tag LOCUS_03160 3735 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4861 3728 gene locus_tag LOCUS_03170 4861 3728 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_03170 5139 5438 gene locus_tag LOCUS_03180 gene spoIIID 5139 5438 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_03180 6124 5474 gene locus_tag LOCUS_03190 6124 5474 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_03190 8343 6115 gene locus_tag LOCUS_03200 8343 6115 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_03200 8528 9151 gene locus_tag LOCUS_03210 8528 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9404 9162 gene locus_tag LOCUS_03220 gene rpsR 9404 9162 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_03220 9853 9434 gene locus_tag LOCUS_03230 gene ssb 9853 9434 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272405.1 protein_id gnl|my_center|LOCUS_03230 10190 9903 gene locus_tag LOCUS_03240 gene rpsF 10190 9903 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_03240 10713 10324 gene locus_tag LOCUS_03250 10713 10324 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_03250 11363 10728 gene locus_tag LOCUS_03260 11363 10728 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_03260 11575 11979 gene locus_tag LOCUS_03270 11575 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14185 12065 gene locus_tag LOCUS_03280 gene rnr 14185 12065 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_03280 14552 14310 gene locus_tag LOCUS_03290 14552 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 16177 14630 gene locus_tag LOCUS_03300 gene gpmI 16177 14630 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_03300 16936 16190 gene locus_tag LOCUS_03310 gene tpiA 16936 16190 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_03310 18142 16952 gene locus_tag LOCUS_03320 18142 16952 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_03320 19416 18319 gene locus_tag LOCUS_03330 gene mnmA 19416 18319 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028041.1 protein_id gnl|my_center|LOCUS_03330 19622 19419 gene locus_tag LOCUS_03340 19622 19419 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545426.1 protein_id gnl|my_center|LOCUS_03340 21002 20073 gene locus_tag LOCUS_03350 21002 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 21760 21023 gene locus_tag LOCUS_03360 21760 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 24633 21775 gene locus_tag LOCUS_03370 gene uvrA 24633 21775 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03370 24820 24665 gene locus_tag LOCUS_03380 24820 24665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 26577 24760 gene locus_tag LOCUS_03390 gene uvrB 26577 24760 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03390 24831 24854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26807 26974 gene locus_tag LOCUS_03400 26807 26974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 27798 26983 gene locus_tag LOCUS_03410 27798 26983 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594854.1 protein_id gnl|my_center|LOCUS_03410 28348 27800 gene locus_tag LOCUS_03420 28348 27800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <29673 28366 gene locus_tag LOCUS_03430 <29673 28366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895182.1:proline--tRNA ligase >Feature sequence007 442 1005 gene locus_tag LOCUS_03440 442 1005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_03440 1015 1761 gene locus_tag LOCUS_03450 1015 1761 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_03450 1892 2989 gene locus_tag LOCUS_03460 gene recF 1892 2989 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_03460 3004 3261 gene locus_tag LOCUS_03470 3004 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3295 5241 gene locus_tag LOCUS_03480 gene gyrB 3295 5241 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_03480 5279 7801 gene locus_tag LOCUS_03490 gene gyrA 5279 7801 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_03490 7819 9276 gene locus_tag LOCUS_03500 7819 9276 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364052.1 protein_id gnl|my_center|LOCUS_03500 9389 10441 gene locus_tag LOCUS_03510 9389 10441 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_03510 10460 11083 gene locus_tag LOCUS_03520 10460 11083 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_03520 11350 11087 gene locus_tag LOCUS_03530 11350 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 11493 12032 gene locus_tag LOCUS_03540 11493 12032 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_03540 13158 12109 gene locus_tag LOCUS_03550 gene tsaD 13158 12109 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964219.1 protein_id gnl|my_center|LOCUS_03550 13871 13158 gene locus_tag LOCUS_03560 13871 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 16219 13865 gene locus_tag LOCUS_03570 16219 13865 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_03570 16436 16918 gene locus_tag LOCUS_03580 16436 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 16920 17147 gene locus_tag LOCUS_03590 16920 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 17179 18180 gene locus_tag LOCUS_03600 gene floA 17179 18180 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_03600 18196 18732 gene locus_tag LOCUS_03610 18196 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 18694 18722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18923 20362 gene locus_tag LOCUS_03620 18923 20362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 20372 20959 gene locus_tag LOCUS_03630 20372 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 20956 21504 gene locus_tag LOCUS_03640 20956 21504 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_03640 21530 22966 gene locus_tag LOCUS_03650 21530 22966 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_03650 24330 22963 gene locus_tag LOCUS_03660 gene murC 24330 22963 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_03660 24796 25188 gene locus_tag LOCUS_03670 gene rnpA 24796 25188 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_03670 25185 25397 gene locus_tag LOCUS_03680 gene yidD 25185 25397 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_03680 25448 26404 gene locus_tag LOCUS_03690 25448 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 26401 27165 gene locus_tag LOCUS_03700 26401 27165 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_03700 27840 27277 gene locus_tag LOCUS_03710 gene spoIIR 27840 27277 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460947.1 protein_id gnl|my_center|LOCUS_03710 28179 27946 gene locus_tag LOCUS_03720 28179 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence008 1263 118 gene locus_tag LOCUS_03730 gene dnaJ 1263 118 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_03730 3182 1347 gene locus_tag LOCUS_03740 gene dnaK 3182 1347 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_03740 3830 3258 gene locus_tag LOCUS_03750 gene grpE 3830 3258 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_03750 4898 3855 gene locus_tag LOCUS_03760 gene hrcA 4898 3855 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_03760 5128 6291 gene locus_tag LOCUS_03770 gene hemW 5128 6291 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_03770 6642 6310 gene locus_tag LOCUS_03780 6642 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8450 6648 gene locus_tag LOCUS_03790 gene lepA 8450 6648 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_03790 8577 9185 gene locus_tag LOCUS_03800 8577 9185 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_03800 9457 9533 gene locus_tag LOCUS_t00010 9457 9533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10189 9644 gene locus_tag LOCUS_03810 10189 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 10856 10398 gene locus_tag LOCUS_03820 10856 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 11733 11041 gene locus_tag LOCUS_03830 11733 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12116 13948 gene locus_tag LOCUS_03840 12116 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 13929 14744 gene locus_tag LOCUS_03850 13929 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 14905 15969 gene locus_tag LOCUS_03860 14905 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15996 16175 gene locus_tag LOCUS_03870 15996 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 16142 17224 gene locus_tag LOCUS_03880 16142 17224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_03880 17236 18162 gene locus_tag LOCUS_03890 17236 18162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_03890 18174 19700 gene locus_tag LOCUS_03900 18174 19700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193235.1 protein_id gnl|my_center|LOCUS_03900 20369 21274 gene locus_tag LOCUS_03910 20369 21274 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_03910 21300 21635 gene locus_tag LOCUS_03920 21300 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 22130 22795 gene locus_tag LOCUS_03930 22130 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 23352 23957 gene locus_tag LOCUS_03940 23352 23957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 23950 25470 gene locus_tag LOCUS_03950 gene rng 23950 25470 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_03950 25500 26258 gene locus_tag LOCUS_03960 25500 26258 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_03960 26274 26618 gene locus_tag LOCUS_03970 26274 26618 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817220.1 protein_id gnl|my_center|LOCUS_03970 26654 26663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26801 28321 gene locus_tag LOCUS_03980 26801 28321 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence009 1654 803 gene locus_tag LOCUS_03990 1654 803 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_03990 3125 1794 gene locus_tag LOCUS_04000 3125 1794 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_04000 3041 3250 gene locus_tag LOCUS_04010 3041 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4253 3219 gene locus_tag LOCUS_04020 gene rbsR 4253 3219 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 protein_id gnl|my_center|LOCUS_04020 4645 4559 gene locus_tag LOCUS_t00020 4645 4559 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5777 4755 gene locus_tag LOCUS_04030 5777 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7023 5986 gene locus_tag LOCUS_04040 7023 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7733 7134 gene locus_tag LOCUS_04050 gene recR 7733 7134 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_04050 8068 7736 gene locus_tag LOCUS_04060 8068 7736 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_04060 8277 9482 gene locus_tag LOCUS_04070 8277 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 9485 10816 gene locus_tag LOCUS_04080 gene radA 9485 10816 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_04080 11087 12052 gene locus_tag LOCUS_04090 11087 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 13060 12053 gene locus_tag LOCUS_04100 gene asnA 13060 12053 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_04100 13546 13118 gene locus_tag LOCUS_04110 13546 13118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14175 14672 gene locus_tag LOCUS_04120 14175 14672 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_04120 14799 16577 gene locus_tag LOCUS_04130 14799 16577 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941952.1 protein_id gnl|my_center|LOCUS_04130 16858 18294 gene locus_tag LOCUS_04140 16858 18294 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459143.1 protein_id gnl|my_center|LOCUS_04140 18450 19346 gene locus_tag LOCUS_04150 18450 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 18521 18530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19492 20904 gene locus_tag LOCUS_04160 19492 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 21334 21930 gene locus_tag LOCUS_04170 21334 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04170 21901 21910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21986 22999 gene locus_tag LOCUS_04180 21986 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04180 23085 24359 gene locus_tag LOCUS_04190 23085 24359 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_04190 25184 24456 gene locus_tag LOCUS_04200 25184 24456 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_04200 26108 25194 gene locus_tag LOCUS_04210 26108 25194 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence010 178 104 gene locus_tag LOCUS_t00030 178 104 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 260 184 gene locus_tag LOCUS_t00040 260 184 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 539 1855 gene locus_tag LOCUS_04220 gene miaB 539 1855 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_04220 1870 2253 gene locus_tag LOCUS_04230 1870 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2298 4925 gene locus_tag LOCUS_04240 gene mutS 2298 4925 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_04240 4922 5176 gene locus_tag LOCUS_04250 4922 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 5112 5121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5190 6779 gene locus_tag LOCUS_04260 gene mutL 5190 6779 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 protein_id gnl|my_center|LOCUS_04260 6789 7781 gene locus_tag LOCUS_04270 gene miaA 6789 7781 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861408.1 protein_id gnl|my_center|LOCUS_04270 7747 7977 gene locus_tag LOCUS_04280 gene hfq 7747 7977 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_04280 7987 9270 gene locus_tag LOCUS_04290 7987 9270 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_04290 10307 9324 gene locus_tag LOCUS_04300 10307 9324 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_04300 10971 10519 gene locus_tag LOCUS_04310 gene rnhA 10971 10519 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_04310 11767 10961 gene locus_tag LOCUS_04320 gene proC 11767 10961 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_04320 13364 11958 gene locus_tag LOCUS_04330 13364 11958 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_04330 14899 13697 gene locus_tag LOCUS_04340 gene thiI 14899 13697 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_04340 16072 14927 gene locus_tag LOCUS_04350 16072 14927 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_04350 16453 16304 gene locus_tag LOCUS_04360 16453 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 16440 16919 gene locus_tag LOCUS_04370 16440 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 18351 16921 gene locus_tag LOCUS_04380 gene purB 18351 16921 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_04380 19635 18448 gene locus_tag LOCUS_04390 19635 18448 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071480.1 protein_id gnl|my_center|LOCUS_04390 19950 20120 gene locus_tag LOCUS_04400 19950 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 20257 20520 gene locus_tag LOCUS_04410 20257 20520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 20592 21047 gene locus_tag LOCUS_04420 gene nrdR 20592 21047 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_04420 21047 21892 gene locus_tag LOCUS_04430 gene pgeF 21047 21892 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_04430 22275 21889 gene locus_tag LOCUS_04440 22275 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 23102 22356 gene locus_tag LOCUS_04450 23102 22356 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_04450 23515 23141 gene locus_tag LOCUS_04460 23515 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 23829 23512 gene locus_tag LOCUS_04470 23829 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 24306 23857 gene locus_tag LOCUS_04480 24306 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence011 220 1458 gene locus_tag LOCUS_04490 220 1458 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_04490 1921 1586 gene locus_tag LOCUS_04500 1921 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2159 2386 gene locus_tag LOCUS_04510 2159 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 2366 2375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2383 3315 gene locus_tag LOCUS_04520 2383 3315 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263229.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04520 3599 4369 gene locus_tag LOCUS_04530 gene hpaI 3599 4369 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_04530 4437 5216 gene locus_tag LOCUS_04540 gene zupT 4437 5216 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811500.1 protein_id gnl|my_center|LOCUS_04540 5217 6191 gene locus_tag LOCUS_04550 5217 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6252 6665 gene locus_tag LOCUS_04560 6252 6665 CDS product DUF3887 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680505.1 protein_id gnl|my_center|LOCUS_04560 6800 8539 gene locus_tag LOCUS_04570 6800 8539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_04570 8523 10409 gene locus_tag LOCUS_04580 8523 10409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_04580 11206 10415 gene locus_tag LOCUS_04590 11206 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12770 11199 gene locus_tag LOCUS_04600 12770 11199 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_04600 13171 12770 gene locus_tag LOCUS_04610 13171 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 14364 13303 gene locus_tag LOCUS_04620 14364 13303 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933588.1 protein_id gnl|my_center|LOCUS_04620 14706 15494 gene locus_tag LOCUS_04630 14706 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15678 16967 gene locus_tag LOCUS_04640 15678 16967 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_04640 17792 17040 gene locus_tag LOCUS_04650 17792 17040 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_04650 19199 17862 gene locus_tag LOCUS_04660 19199 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 20267 19584 gene locus_tag LOCUS_04670 20267 19584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 21931 20303 gene locus_tag LOCUS_04680 21931 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 23375 22500 gene locus_tag LOCUS_04690 23375 22500 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964266.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence012 2034 649 gene locus_tag LOCUS_04700 gene amrA 2034 649 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_04700 2212 4764 gene locus_tag LOCUS_04710 gene xdh 2212 4764 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_04710 5310 4819 gene locus_tag LOCUS_04720 5310 4819 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_04720 6191 5310 gene locus_tag LOCUS_04730 gene xdhB 6191 5310 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_04730 8496 6211 gene locus_tag LOCUS_04740 gene xdhA 8496 6211 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_04740 8702 9295 gene locus_tag LOCUS_04750 8702 9295 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978539.1 protein_id gnl|my_center|LOCUS_04750 9633 9304 gene locus_tag LOCUS_04760 9633 9304 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_04760 9807 10403 gene locus_tag LOCUS_04770 9807 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10388 11191 gene locus_tag LOCUS_04780 gene yqeB 10388 11191 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_04780 11200 12234 gene locus_tag LOCUS_04790 gene selD 11200 12234 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_04790 13068 12394 gene locus_tag LOCUS_04800 13068 12394 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_04800 13253 14080 gene locus_tag LOCUS_04810 13253 14080 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_04810 14103 15050 gene locus_tag LOCUS_04820 gene cysK 14103 15050 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_04820 15227 16102 gene locus_tag LOCUS_04830 15227 16102 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_04830 17284 16103 gene locus_tag LOCUS_04840 17284 16103 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_04840 17508 18425 gene locus_tag LOCUS_04850 17508 18425 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139264482.1 protein_id gnl|my_center|LOCUS_04850 18541 20268 gene locus_tag LOCUS_04860 18541 20268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_04860 20433 21260 gene locus_tag LOCUS_04870 20433 21260 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_04870 21270 21785 gene locus_tag LOCUS_04880 21270 21785 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_04880 21828 23492 gene locus_tag LOCUS_04890 gene araB 21828 23492 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence013 1114 392 gene locus_tag LOCUS_04900 1114 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1254 2195 gene locus_tag LOCUS_04910 gene msrB 1254 2195 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_04910 2513 3925 gene locus_tag LOCUS_04920 2513 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4338 4991 gene locus_tag LOCUS_04930 4338 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5003 5188 gene locus_tag LOCUS_04940 5003 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5245 5655 gene locus_tag LOCUS_04950 5245 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5742 6482 gene locus_tag LOCUS_04960 5742 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6492 7610 gene locus_tag LOCUS_04970 6492 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7607 8947 gene locus_tag LOCUS_04980 7607 8947 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_04980 8963 9889 gene locus_tag LOCUS_04990 8963 9889 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_04990 9917 10840 gene locus_tag LOCUS_05000 9917 10840 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_05000 10927 11172 gene locus_tag LOCUS_05010 10927 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11182 12009 gene locus_tag LOCUS_05020 11182 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12062 12223 gene locus_tag LOCUS_05030 12062 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 12462 12220 gene locus_tag LOCUS_05040 12462 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 13000 12446 gene locus_tag LOCUS_05050 13000 12446 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_05050 13844 13011 gene locus_tag LOCUS_05060 13844 13011 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_05060 15328 13874 gene locus_tag LOCUS_05070 15328 13874 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_05070 16724 15330 gene locus_tag LOCUS_05080 gene trkA 16724 15330 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_05080 17840 16866 gene locus_tag LOCUS_05090 17840 16866 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_05090 18068 18718 gene locus_tag LOCUS_05100 18068 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 18749 19399 gene locus_tag LOCUS_05110 18749 19399 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_05110 19675 19908 gene locus_tag LOCUS_05120 19675 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 19908 21260 gene locus_tag LOCUS_05130 19908 21260 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_05130 22710 21247 gene locus_tag LOCUS_05140 22710 21247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence014 97 1374 gene locus_tag LOCUS_05150 gene spoIVB 97 1374 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_05150 370 379 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1422 2198 gene locus_tag LOCUS_05160 gene spo0A 1422 2198 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_05160 3094 2210 gene locus_tag LOCUS_05170 3094 2210 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_05170 3300 3094 gene locus_tag LOCUS_05180 3300 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4513 3287 gene locus_tag LOCUS_05190 gene xseA 4513 3287 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_05190 5393 4542 gene locus_tag LOCUS_05200 gene folD 5393 4542 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_05200 5914 5495 gene locus_tag LOCUS_05210 gene nusB 5914 5495 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_05210 6178 5951 gene locus_tag LOCUS_05220 6178 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6757 6200 gene locus_tag LOCUS_05230 6757 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7336 6878 gene locus_tag LOCUS_05240 7336 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7973 7464 gene locus_tag LOCUS_05250 7973 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8607 8008 gene locus_tag LOCUS_05260 8607 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8915 8631 gene locus_tag LOCUS_05270 8915 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10083 8917 gene locus_tag LOCUS_05280 gene spoIIIAE 10083 8917 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438121.1 protein_id gnl|my_center|LOCUS_05280 9207 9217 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10478 10080 gene locus_tag LOCUS_05290 gene spoIIIAD 10478 10080 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428424.1 protein_id gnl|my_center|LOCUS_05290 10687 10490 gene locus_tag LOCUS_05300 gene spoIIIAC 10687 10490 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965391.1 protein_id gnl|my_center|LOCUS_05300 11218 10703 gene locus_tag LOCUS_05310 11218 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12186 11203 gene locus_tag LOCUS_05320 gene spoIIIAA 12186 11203 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_05320 12400 13050 gene locus_tag LOCUS_05330 12400 13050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_05330 13093 14304 gene locus_tag LOCUS_05340 13093 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 14522 15166 gene locus_tag LOCUS_05350 14522 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 16130 15381 gene locus_tag LOCUS_05360 16130 15381 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193046641.1 protein_id gnl|my_center|LOCUS_05360 16962 16234 gene locus_tag LOCUS_05370 16962 16234 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_05370 17579 17013 gene locus_tag LOCUS_05380 17579 17013 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_05380 18236 17955 gene locus_tag LOCUS_05390 18236 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 19806 18619 gene locus_tag LOCUS_05400 19806 18619 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_05400 20049 19822 gene locus_tag LOCUS_05410 20049 19822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20072 21757 gene locus_tag LOCUS_05420 20072 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 21979 21803 gene locus_tag LOCUS_05430 21979 21803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 <23326 22086 gene locus_tag LOCUS_05440 <23326 22086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257899.1:excinuclease ABC subunit UvrC >Feature sequence015 317 1234 gene locus_tag LOCUS_05450 317 1234 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_05450 2398 1331 gene locus_tag LOCUS_05460 2398 1331 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_05460 1834 1843 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2583 4463 gene locus_tag LOCUS_05470 gene mnmG 2583 4463 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_05470 4460 5140 gene locus_tag LOCUS_05480 gene rsmG 4460 5140 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393994.1 protein_id gnl|my_center|LOCUS_05480 5272 6171 gene locus_tag LOCUS_05490 gene noc 5272 6171 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966991.1 protein_id gnl|my_center|LOCUS_05490 6905 6168 gene locus_tag LOCUS_05500 gene sigF 6905 6168 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_05500 7333 6902 gene locus_tag LOCUS_05510 gene spoIIAB 7333 6902 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_05510 7667 7362 gene locus_tag LOCUS_05520 gene spoIIAA 7667 7362 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_05520 8019 8966 gene locus_tag LOCUS_05530 8019 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9249 10754 gene locus_tag LOCUS_05540 9249 10754 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_05540 11608 10829 gene locus_tag LOCUS_05550 11608 10829 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_05550 12149 11610 gene locus_tag LOCUS_05560 12149 11610 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990647.1 protein_id gnl|my_center|LOCUS_05560 12976 12146 gene locus_tag LOCUS_05570 12976 12146 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_05570 13201 14997 gene locus_tag LOCUS_05580 13201 14997 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_05580 15128 16765 gene locus_tag LOCUS_05590 15128 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 16875 17351 gene locus_tag LOCUS_05600 16875 17351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 17361 18596 gene locus_tag LOCUS_05610 17361 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 18684 18959 gene locus_tag LOCUS_05620 18684 18959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 18962 19504 gene locus_tag LOCUS_05630 18962 19504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 19508 20977 gene locus_tag LOCUS_05640 19508 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 20991 21167 gene locus_tag LOCUS_05650 20991 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 21176 21826 gene locus_tag LOCUS_05660 21176 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 21835 22650 gene locus_tag LOCUS_05670 21835 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence016 2 268 gene locus_tag LOCUS_05680 2 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 234 243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 282 1136 gene locus_tag LOCUS_05690 282 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1922 1182 gene locus_tag LOCUS_05700 1922 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2433 1915 gene locus_tag LOCUS_05710 2433 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3866 2541 gene locus_tag LOCUS_05720 3866 2541 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_05720 4058 4570 gene locus_tag LOCUS_05730 4058 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5805 4627 gene locus_tag LOCUS_05740 gene gltX 5805 4627 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 6080 5781 gene locus_tag LOCUS_05750 6080 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 5847 5872 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7763 6126 gene locus_tag LOCUS_05760 7763 6126 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_05760 11232 7846 gene locus_tag LOCUS_05770 gene addA 11232 7846 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_05770 14663 11229 gene locus_tag LOCUS_05780 gene addB 14663 11229 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_05780 16623 14683 gene locus_tag LOCUS_05790 16623 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16820 17332 gene locus_tag LOCUS_05800 16820 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17894 17334 gene locus_tag LOCUS_05810 17894 17334 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_05810 18050 20122 gene locus_tag LOCUS_05820 18050 20122 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_05820 20133 21959 gene locus_tag LOCUS_05830 20133 21959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 20985 20994 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence017 1486 551 gene locus_tag LOCUS_05840 1486 551 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861264.1 protein_id gnl|my_center|LOCUS_05840 2600 1488 gene locus_tag LOCUS_05850 2600 1488 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861263.1 protein_id gnl|my_center|LOCUS_05850 4098 2812 gene locus_tag LOCUS_05860 4098 2812 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_05860 4482 4192 gene locus_tag LOCUS_05870 4482 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5760 4537 gene locus_tag LOCUS_05880 gene roeA 5760 4537 CDS product diguanylate cyclase RoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_05880 9186 5824 gene locus_tag LOCUS_05890 9186 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 9262 10356 gene locus_tag LOCUS_05900 9262 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 12109 10415 gene locus_tag LOCUS_05910 12109 10415 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_05910 12687 12139 gene locus_tag LOCUS_05920 12687 12139 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022863.1 protein_id gnl|my_center|LOCUS_05920 12857 12684 gene locus_tag LOCUS_05930 12857 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 13189 13863 gene locus_tag LOCUS_05940 13189 13863 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_05940 13956 15497 gene locus_tag LOCUS_05950 13956 15497 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_05950 15497 16702 gene locus_tag LOCUS_05960 15497 16702 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543120.1 protein_id gnl|my_center|LOCUS_05960 18379 16871 gene locus_tag LOCUS_05970 gene glpK 18379 16871 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_05970 18753 19037 gene locus_tag LOCUS_05980 gene groES 18753 19037 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_05980 19068 20696 gene locus_tag LOCUS_05990 gene groL 19068 20696 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_05990 20832 21707 gene locus_tag LOCUS_06000 20832 21707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence018 1371 178 gene locus_tag LOCUS_06010 1371 178 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_06010 2977 1397 gene locus_tag LOCUS_06020 2977 1397 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_06020 3533 3006 gene locus_tag LOCUS_06030 3533 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06030 4302 3811 gene locus_tag LOCUS_06040 gene rimI 4302 3811 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_06040 4981 4295 gene locus_tag LOCUS_06050 gene tsaB 4981 4295 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_06050 5450 4962 gene locus_tag LOCUS_06060 gene tsaE 5450 4962 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_06060 6562 5438 gene locus_tag LOCUS_06070 gene tgt 6562 5438 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_06070 7591 6572 gene locus_tag LOCUS_06080 gene queA 7591 6572 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_06080 8535 7726 gene locus_tag LOCUS_06090 8535 7726 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_06090 8960 10093 gene locus_tag LOCUS_06100 8960 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10090 11061 gene locus_tag LOCUS_06110 10090 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13605 11098 gene locus_tag LOCUS_06120 13605 11098 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949077.1 protein_id gnl|my_center|LOCUS_06120 14872 13865 gene locus_tag LOCUS_06130 gene ispG 14872 13865 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_06130 15921 14914 gene locus_tag LOCUS_06140 gene rseP 15921 14914 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_06140 17091 15937 gene locus_tag LOCUS_06150 17091 15937 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06150 17934 17119 gene locus_tag LOCUS_06160 17934 17119 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_06160 18693 17950 gene locus_tag LOCUS_06170 18693 17950 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_06170 18964 18752 gene locus_tag LOCUS_06180 18964 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19529 18972 gene locus_tag LOCUS_06190 gene frr 19529 18972 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_06190 20307 19615 gene locus_tag LOCUS_06200 gene pyrH 20307 19615 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_06200 21048 20398 gene locus_tag LOCUS_06210 gene tsf 21048 20398 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_06210 21831 21109 gene locus_tag LOCUS_06220 gene rpsB 21831 21109 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence019 302 135 gene locus_tag LOCUS_06230 302 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 906 262 gene locus_tag LOCUS_06240 906 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 2394 925 gene locus_tag LOCUS_06250 gene thrC 2394 925 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_06250 2850 2440 gene locus_tag LOCUS_06260 2850 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_06260 3078 3332 gene locus_tag LOCUS_06270 3078 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3551 3814 gene locus_tag LOCUS_06280 gene rpsO 3551 3814 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_06280 3952 6045 gene locus_tag LOCUS_06290 gene pnp 3952 6045 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06290 6160 6861 gene locus_tag LOCUS_06300 6160 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6864 8129 gene locus_tag LOCUS_06310 6864 8129 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_06310 8160 8537 gene locus_tag LOCUS_06320 8160 8537 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_06320 8546 9733 gene locus_tag LOCUS_06330 8546 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9583 9592 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9757 10437 gene locus_tag LOCUS_06340 9757 10437 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_06340 10551 10997 gene locus_tag LOCUS_06350 10551 10997 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_06350 11080 11262 gene locus_tag LOCUS_06360 11080 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11337 11648 gene locus_tag LOCUS_06370 11337 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11847 12866 gene locus_tag LOCUS_06380 gene lgt 11847 12866 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812530.1 protein_id gnl|my_center|LOCUS_06380 12896 14338 gene locus_tag LOCUS_06390 12896 14338 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_06390 14350 14835 gene locus_tag LOCUS_06400 14350 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 15896 14886 gene locus_tag LOCUS_06410 15896 14886 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_06410 16120 16923 gene locus_tag LOCUS_06420 16120 16923 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_06420 16956 18374 gene locus_tag LOCUS_06430 16956 18374 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_06430 18533 19678 gene locus_tag LOCUS_06440 18533 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 19707 20867 gene locus_tag LOCUS_06450 gene rodA 19707 20867 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence020 996 457 gene locus_tag LOCUS_06460 996 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2439 1168 gene locus_tag LOCUS_06470 2439 1168 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_06470 3722 2634 gene locus_tag LOCUS_06480 3722 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4714 3794 gene locus_tag LOCUS_06490 4714 3794 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_06490 5723 4800 gene locus_tag LOCUS_06500 gene arcC 5723 4800 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680441.1 protein_id gnl|my_center|LOCUS_06500 5919 7409 gene locus_tag LOCUS_06510 5919 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8435 7452 gene locus_tag LOCUS_06520 8435 7452 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_06520 8738 10309 gene locus_tag LOCUS_06530 gene pckA 8738 10309 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_06530 10485 11354 gene locus_tag LOCUS_06540 10485 11354 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_06540 11408 12280 gene locus_tag LOCUS_06550 11408 12280 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_06550 12294 13427 gene locus_tag LOCUS_06560 12294 13427 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_06560 13424 16543 gene locus_tag LOCUS_06570 13424 16543 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247443.1 protein_id gnl|my_center|LOCUS_06570 17763 16618 gene locus_tag LOCUS_06580 17763 16618 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815362.1 protein_id gnl|my_center|LOCUS_06580 18308 17889 gene locus_tag LOCUS_06590 18308 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 18687 18310 gene locus_tag LOCUS_06600 18687 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 18878 19237 gene locus_tag LOCUS_06610 18878 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 20200 19520 gene locus_tag LOCUS_06620 20200 19520 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_06620 20321 21034 gene locus_tag LOCUS_06630 20321 21034 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence021 169 1419 gene locus_tag LOCUS_06640 169 1419 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_06640 1613 3805 gene locus_tag LOCUS_06650 gene pcrA 1613 3805 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_06650 3821 5797 gene locus_tag LOCUS_06660 gene ligA 3821 5797 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 protein_id gnl|my_center|LOCUS_06660 4192 4201 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5884 6762 gene locus_tag LOCUS_06670 5884 6762 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_06670 6781 7032 gene locus_tag LOCUS_06680 6781 7032 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_06680 7076 7708 gene locus_tag LOCUS_06690 gene gmk 7076 7708 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_06690 7702 7905 gene locus_tag LOCUS_06700 7702 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 7886 9103 gene locus_tag LOCUS_06710 gene coaBC 7886 9103 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_06710 9184 11442 gene locus_tag LOCUS_06720 gene priA 9184 11442 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_06720 11524 12021 gene locus_tag LOCUS_06730 gene def 11524 12021 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_06730 12018 12947 gene locus_tag LOCUS_06740 gene fmt 12018 12947 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_06740 12944 14248 gene locus_tag LOCUS_06750 gene rsmB 12944 14248 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830124.1 protein_id gnl|my_center|LOCUS_06750 14245 15288 gene locus_tag LOCUS_06760 gene rlmN 14245 15288 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_06760 15292 16206 gene locus_tag LOCUS_06770 gene whiA 15292 16206 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_06770 16251 16505 gene locus_tag LOCUS_06780 16251 16505 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_06780 16509 19943 gene locus_tag LOCUS_06790 16509 19943 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_06790 20109 20666 gene locus_tag LOCUS_06800 gene efp 20109 20666 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_06800 20709 21104 gene locus_tag LOCUS_06810 20709 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869788.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence022 1422 259 gene locus_tag LOCUS_06820 1422 259 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_06820 4098 1438 gene locus_tag LOCUS_06830 4098 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5332 4247 gene locus_tag LOCUS_06840 gene ychF 5332 4247 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_06840 5466 6752 gene locus_tag LOCUS_06850 5466 6752 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_06850 6743 7591 gene locus_tag LOCUS_06860 6743 7591 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_06860 7592 8296 gene locus_tag LOCUS_06870 7592 8296 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_06870 8293 8511 gene locus_tag LOCUS_06880 8293 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8486 8803 gene locus_tag LOCUS_06890 8486 8803 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_06890 8904 9803 gene locus_tag LOCUS_06900 gene murB 8904 9803 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_06900 9829 10731 gene locus_tag LOCUS_06910 gene rapZ 9829 10731 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_06910 10728 11465 gene locus_tag LOCUS_06920 10728 11465 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_06920 11462 13312 gene locus_tag LOCUS_06930 gene pknB 11462 13312 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_06930 13334 14194 gene locus_tag LOCUS_06940 gene rsgA 13334 14194 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865389.1 protein_id gnl|my_center|LOCUS_06940 14218 14868 gene locus_tag LOCUS_06950 gene rpe 14218 14868 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_06950 14898 15827 gene locus_tag LOCUS_06960 gene trxB 14898 15827 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_06960 15840 17198 gene locus_tag LOCUS_06970 gene glmM 15840 17198 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_06970 17200 17853 gene locus_tag LOCUS_06980 17200 17853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 17855 19126 gene locus_tag LOCUS_06990 gene obgE 17855 19126 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_06990 19228 20064 gene locus_tag LOCUS_07000 gene purR 19228 20064 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence023 636 1511 gene locus_tag LOCUS_07010 636 1511 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_07010 1629 2192 gene locus_tag LOCUS_07020 1629 2192 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462242.1 protein_id gnl|my_center|LOCUS_07020 2359 3003 gene locus_tag LOCUS_07030 2359 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3033 4082 gene locus_tag LOCUS_07040 3033 4082 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_07040 4108 4869 gene locus_tag LOCUS_07050 4108 4869 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_07050 4866 5441 gene locus_tag LOCUS_07060 4866 5441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537702.1 protein_id gnl|my_center|LOCUS_07060 6606 5494 gene locus_tag LOCUS_07070 6606 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6903 7154 gene locus_tag LOCUS_07080 6903 7154 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_07080 7565 8860 gene locus_tag LOCUS_07090 7565 8860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968416.1 protein_id gnl|my_center|LOCUS_07090 8993 9934 gene locus_tag LOCUS_07100 8993 9934 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 protein_id gnl|my_center|LOCUS_07100 10160 10792 gene locus_tag LOCUS_07110 10160 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11387 10953 gene locus_tag LOCUS_07120 11387 10953 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_07120 11694 13148 gene locus_tag LOCUS_07130 11694 13148 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_07130 15572 13152 gene locus_tag LOCUS_07140 gene ligD 15572 13152 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809852.1 protein_id gnl|my_center|LOCUS_07140 16346 15573 gene locus_tag LOCUS_07150 16346 15573 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_07150 17190 16507 gene locus_tag LOCUS_07160 17190 16507 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406252.1 protein_id gnl|my_center|LOCUS_07160 18891 17230 gene locus_tag LOCUS_07170 18891 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 19256 18894 gene locus_tag LOCUS_07180 19256 18894 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_07180 19432 20103 gene locus_tag LOCUS_07190 19432 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 20228 20304 gene locus_tag LOCUS_t00050 20228 20304 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1187 1897 gene locus_tag LOCUS_07200 gene deoD 1187 1897 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_07200 2124 3092 gene locus_tag LOCUS_07210 2124 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 2940 2949 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3071 3343 gene locus_tag LOCUS_07220 3071 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 4439 3501 gene locus_tag LOCUS_07230 4439 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 5593 4871 gene locus_tag LOCUS_07240 5593 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6416 5625 gene locus_tag LOCUS_07250 6416 5625 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_07250 7149 6436 gene locus_tag LOCUS_07260 7149 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7633 7184 gene locus_tag LOCUS_07270 7633 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7869 9197 gene locus_tag LOCUS_07280 gene ssnA 7869 9197 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 protein_id gnl|my_center|LOCUS_07280 9235 12231 gene locus_tag LOCUS_07290 gene ygfK 9235 12231 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_07290 13233 12298 gene locus_tag LOCUS_07300 13233 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14675 13464 gene locus_tag LOCUS_07310 gene tuf 14675 13464 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_07310 16794 14725 gene locus_tag LOCUS_07320 gene fusA 16794 14725 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07320 17407 16937 gene locus_tag LOCUS_07330 gene rpsG 17407 16937 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_07330 17792 17418 gene locus_tag LOCUS_07340 gene rpsL 17792 17418 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357676.1 protein_id gnl|my_center|LOCUS_07340 18189 17941 gene locus_tag LOCUS_07350 18189 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 19067 18336 gene locus_tag LOCUS_07360 19067 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 <19687 19084 gene locus_tag LOCUS_07370 <19687 19084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193345594.1:DNA-directed RNA polymerase subunit beta' >Feature sequence025 319 927 gene locus_tag LOCUS_07380 319 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 947 1774 gene locus_tag LOCUS_07390 947 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2093 1821 gene locus_tag LOCUS_07400 2093 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2921 2289 gene locus_tag LOCUS_07410 2921 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07410 4594 2963 gene locus_tag LOCUS_07420 4594 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 3080 3089 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4775 4858 gene locus_tag LOCUS_t00060 4775 4858 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5327 4950 gene locus_tag LOCUS_07430 5327 4950 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_07430 5566 5324 gene locus_tag LOCUS_07440 5566 5324 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_07440 6013 5804 gene locus_tag LOCUS_07450 gene csrA 6013 5804 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667708.1 protein_id gnl|my_center|LOCUS_07450 6467 5997 gene locus_tag LOCUS_07460 gene fliW 6467 5997 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987029.1 protein_id gnl|my_center|LOCUS_07460 7090 6500 gene locus_tag LOCUS_07470 7090 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6912 6921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8041 7109 gene locus_tag LOCUS_07480 gene flgL 8041 7109 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_07480 8064 8073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9628 8114 gene locus_tag LOCUS_07490 gene flgK 9628 8114 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_07490 10129 9635 gene locus_tag LOCUS_07500 10129 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 10433 10155 gene locus_tag LOCUS_07510 10433 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10882 10454 gene locus_tag LOCUS_07520 10882 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11671 10904 gene locus_tag LOCUS_07530 gene flgG 11671 10904 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_07530 12426 11677 gene locus_tag LOCUS_07540 gene flgF 12426 11677 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_07540 13004 12507 gene locus_tag LOCUS_07550 13004 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 13350 13054 gene locus_tag LOCUS_07560 13350 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 15012 13369 gene locus_tag LOCUS_07570 15012 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 15789 15031 gene locus_tag LOCUS_07580 gene whiG 15789 15031 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_07580 16547 15918 gene locus_tag LOCUS_07590 16547 15918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17401 16553 gene locus_tag LOCUS_07600 17401 16553 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_07600 18525 17398 gene locus_tag LOCUS_07610 gene flhF 18525 17398 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_07610 17416 17425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <19620 18525 gene locus_tag LOCUS_07620 <19620 18525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231947.1:flagellar biosynthesis protein FlhA >Feature sequence026 371 652 gene locus_tag LOCUS_07630 371 652 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_07630 1153 752 gene locus_tag LOCUS_07640 1153 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07640 3207 1186 gene locus_tag LOCUS_07650 3207 1186 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07650 1203 1212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4625 3258 gene locus_tag LOCUS_07660 gene lpdA 4625 3258 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_07660 6004 4664 gene locus_tag LOCUS_07670 6004 4664 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949164.1 protein_id gnl|my_center|LOCUS_07670 8814 6352 gene locus_tag LOCUS_07680 gene clpC 8814 6352 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_07680 9836 8838 gene locus_tag LOCUS_07690 9836 8838 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_07690 10345 9833 gene locus_tag LOCUS_07700 10345 9833 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870146.1 protein_id gnl|my_center|LOCUS_07700 10766 10359 gene locus_tag LOCUS_07710 gene ctsR 10766 10359 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244565.1 protein_id gnl|my_center|LOCUS_07710 11007 12905 gene locus_tag LOCUS_07720 11007 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 12756 12765 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13526 12948 gene locus_tag LOCUS_07730 13526 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15515 13839 gene locus_tag LOCUS_07740 15515 13839 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_07740 16103 15600 gene locus_tag LOCUS_07750 16103 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 16696 16331 gene locus_tag LOCUS_07760 gene spoVAE 16696 16331 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_07760 17743 16697 gene locus_tag LOCUS_07770 gene spoVAD 17743 16697 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_07770 18205 17762 gene locus_tag LOCUS_07780 gene spoVAC 18205 17762 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_07780 18374 18231 gene locus_tag LOCUS_07790 18374 18231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 18543 18367 gene locus_tag LOCUS_07800 18543 18367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence027 1441 212 gene locus_tag LOCUS_07810 1441 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1645 2385 gene locus_tag LOCUS_07820 1645 2385 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811701.1 protein_id gnl|my_center|LOCUS_07820 2499 4451 gene locus_tag LOCUS_07830 2499 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4463 5731 gene locus_tag LOCUS_07840 gene larA 4463 5731 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964087.1 protein_id gnl|my_center|LOCUS_07840 5790 6500 gene locus_tag LOCUS_07850 5790 6500 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_07850 6585 6661 gene locus_tag LOCUS_t00070 6585 6661 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6783 7301 gene locus_tag LOCUS_07860 6783 7301 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836897.1 protein_id gnl|my_center|LOCUS_07860 7887 7339 gene locus_tag LOCUS_07870 7887 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 8450 7869 gene locus_tag LOCUS_07880 8450 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 10327 8570 gene locus_tag LOCUS_07890 10327 8570 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_07890 10779 10360 gene locus_tag LOCUS_07900 10779 10360 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461063.1 protein_id gnl|my_center|LOCUS_07900 12784 10760 gene locus_tag LOCUS_07910 12784 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 13845 12805 gene locus_tag LOCUS_07920 13845 12805 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_07920 14662 13850 gene locus_tag LOCUS_07930 14662 13850 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_07930 16759 14720 gene locus_tag LOCUS_07940 16759 14720 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_07940 17024 17659 gene locus_tag LOCUS_07950 17024 17659 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07950 19026 17767 gene locus_tag LOCUS_07960 gene sleC 19026 17767 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence028 1220 747 gene locus_tag LOCUS_07970 gene ilvN 1220 747 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_07970 1819 1889 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1957 2472 gene locus_tag LOCUS_07980 1957 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2483 2785 gene locus_tag LOCUS_07990 2483 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2856 3830 gene locus_tag LOCUS_08000 gene gerM 2856 3830 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126760.1 protein_id gnl|my_center|LOCUS_08000 4296 4066 gene locus_tag LOCUS_08010 4296 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6613 4562 gene locus_tag LOCUS_08020 gene recG 6613 4562 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_08020 8278 6644 gene locus_tag LOCUS_08030 8278 6644 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_08030 8705 8352 gene locus_tag LOCUS_08040 8705 8352 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_08040 9467 9009 gene locus_tag LOCUS_08050 9467 9009 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948662.1 protein_id gnl|my_center|LOCUS_08050 10501 9593 gene locus_tag LOCUS_08060 gene rbsK 10501 9593 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_08060 10883 12100 gene locus_tag LOCUS_08070 gene nagC 10883 12100 CDS product DNA-binding transcriptional regulator NagC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187578.1 protein_id gnl|my_center|LOCUS_08070 12141 13109 gene locus_tag LOCUS_08080 12141 13109 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296123.1 protein_id gnl|my_center|LOCUS_08080 13343 14776 gene locus_tag LOCUS_08090 13343 14776 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_08090 16581 15064 gene locus_tag LOCUS_08100 16581 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 17007 16681 gene locus_tag LOCUS_08110 17007 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 18067 18564 gene locus_tag LOCUS_08120 18067 18564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 18589 19059 gene locus_tag LOCUS_08130 18589 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence029 1447 506 gene locus_tag LOCUS_08140 1447 506 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966385.1 protein_id gnl|my_center|LOCUS_08140 2197 1568 gene locus_tag LOCUS_08150 gene rpsD 2197 1568 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_08150 2613 2212 gene locus_tag LOCUS_08160 gene rpsK 2613 2212 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_08160 2992 2627 gene locus_tag LOCUS_08170 gene rpsM 2992 2627 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_08170 3017 3052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3524 3303 gene locus_tag LOCUS_08180 gene infA 3524 3303 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_08180 3828 3526 gene locus_tag LOCUS_08190 3828 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4610 3828 gene locus_tag LOCUS_08200 gene map 4610 3828 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_08200 5227 4610 gene locus_tag LOCUS_08210 5227 4610 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_08210 6519 5242 gene locus_tag LOCUS_08220 gene secY 6519 5242 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08220 6962 6519 gene locus_tag LOCUS_08230 gene rplO 6962 6519 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_08230 7155 6976 gene locus_tag LOCUS_08240 gene rpmD 7155 6976 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_08240 7685 7179 gene locus_tag LOCUS_08250 gene rpsE 7685 7179 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_08250 8064 7696 gene locus_tag LOCUS_08260 gene rplR 8064 7696 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459106.1 protein_id gnl|my_center|LOCUS_08260 8626 8087 gene locus_tag LOCUS_08270 gene rplF 8626 8087 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_08270 9046 8654 gene locus_tag LOCUS_08280 gene rpsH 9046 8654 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_08280 9248 9063 gene locus_tag LOCUS_08290 9248 9063 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_08290 9912 9265 gene locus_tag LOCUS_08300 gene rplE 9912 9265 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_08300 10251 9934 gene locus_tag LOCUS_08310 gene rplX 10251 9934 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_08310 10631 10263 gene locus_tag LOCUS_08320 gene rplN 10631 10263 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_08320 10908 10645 gene locus_tag LOCUS_08330 gene rpsQ 10908 10645 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_08330 11129 10926 gene locus_tag LOCUS_08340 gene rpmC 11129 10926 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966404.1 protein_id gnl|my_center|LOCUS_08340 11559 11116 gene locus_tag LOCUS_08350 gene rplP 11559 11116 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_08350 12218 11562 gene locus_tag LOCUS_08360 gene rpsC 12218 11562 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_08360 12617 12231 gene locus_tag LOCUS_08370 gene rplV 12617 12231 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148025.1 protein_id gnl|my_center|LOCUS_08370 12915 12634 gene locus_tag LOCUS_08380 gene rpsS 12915 12634 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_08380 13770 12937 gene locus_tag LOCUS_08390 gene rplB 13770 12937 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_08390 14077 13781 gene locus_tag LOCUS_08400 gene rplW 14077 13781 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_08400 14697 14077 gene locus_tag LOCUS_08410 gene rplD 14697 14077 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_08410 15351 14722 gene locus_tag LOCUS_08420 gene rplC 15351 14722 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_08420 15679 15371 gene locus_tag LOCUS_08430 gene rpsJ 15679 15371 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_08430 16702 16031 gene locus_tag LOCUS_08440 16702 16031 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_08440 16809 16907 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence030 1301 108 gene locus_tag LOCUS_08450 1301 108 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986421.1 protein_id gnl|my_center|LOCUS_08450 1986 1426 gene locus_tag LOCUS_08460 1986 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2300 1983 gene locus_tag LOCUS_08470 2300 1983 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827865.1 protein_id gnl|my_center|LOCUS_08470 3142 2459 gene locus_tag LOCUS_08480 3142 2459 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533045.1 protein_id gnl|my_center|LOCUS_08480 3898 3257 gene locus_tag LOCUS_08490 3898 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5579 3792 gene locus_tag LOCUS_08500 5579 3792 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459072.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 3813 3822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6266 5709 gene locus_tag LOCUS_08510 6266 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6895 6260 gene locus_tag LOCUS_08520 6895 6260 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_08520 7721 6882 gene locus_tag LOCUS_08530 7721 6882 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_08530 7919 9169 gene locus_tag LOCUS_08540 7919 9169 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_08540 10069 9236 gene locus_tag LOCUS_08550 10069 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10217 10720 gene locus_tag LOCUS_08560 10217 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 10735 11706 gene locus_tag LOCUS_08570 10735 11706 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192063.1 protein_id gnl|my_center|LOCUS_08570 12913 11741 gene locus_tag LOCUS_08580 12913 11741 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_08580 13268 13277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14492 14917 gene locus_tag LOCUS_08590 14492 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 14934 15749 gene locus_tag LOCUS_08600 14934 15749 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_08600 15848 16645 gene locus_tag LOCUS_08610 15848 16645 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08610 16692 17144 gene locus_tag LOCUS_08620 16692 17144 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence031 1386 166 gene locus_tag LOCUS_08630 gene hslU 1386 166 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_08630 1513 1522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2088 1555 gene locus_tag LOCUS_08640 gene hslV 2088 1555 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_08640 3468 2167 gene locus_tag LOCUS_08650 gene trmFO 3468 2167 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_08650 5557 3458 gene locus_tag LOCUS_08660 gene topA 5557 3458 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_08660 6693 5584 gene locus_tag LOCUS_08670 gene dprA 6693 5584 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_08670 8224 6686 gene locus_tag LOCUS_08680 8224 6686 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08680 8675 8289 gene locus_tag LOCUS_08690 8675 8289 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231531.1 protein_id gnl|my_center|LOCUS_08690 12420 8689 gene locus_tag LOCUS_08700 12420 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 12860 12501 gene locus_tag LOCUS_08710 12860 12501 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_08710 13496 12864 gene locus_tag LOCUS_08720 13496 12864 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_08720 14340 13489 gene locus_tag LOCUS_08730 gene ylqF 14340 13489 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_08730 14797 14426 gene locus_tag LOCUS_08740 gene rplS 14797 14426 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_08740 14948 14742 gene locus_tag LOCUS_08750 14948 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 15743 14958 gene locus_tag LOCUS_08760 gene tcyC 15743 14958 CDS product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 protein_id gnl|my_center|LOCUS_08760 16406 15762 gene locus_tag LOCUS_08770 16406 15762 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_08770 17271 16477 gene locus_tag LOCUS_08780 17271 16477 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_08780 17834 17406 gene locus_tag LOCUS_08790 17834 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence032 1461 850 gene locus_tag LOCUS_08800 gene safA 1461 850 CDS product SafA/ExsA family spore coat assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986322.1 protein_id gnl|my_center|LOCUS_08800 1676 2785 gene locus_tag LOCUS_08810 1676 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2899 4071 gene locus_tag LOCUS_08820 2899 4071 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_08820 4847 4143 gene locus_tag LOCUS_08830 4847 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 5418 4810 gene locus_tag LOCUS_08840 5418 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08840 5749 6921 gene locus_tag LOCUS_08850 5749 6921 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_08850 7051 9402 gene locus_tag LOCUS_08860 7051 9402 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458990.1 protein_id gnl|my_center|LOCUS_08860 9470 9904 gene locus_tag LOCUS_08870 9470 9904 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 protein_id gnl|my_center|LOCUS_08870 9939 10628 gene locus_tag LOCUS_08880 9939 10628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_08880 10640 12226 gene locus_tag LOCUS_08890 10640 12226 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_08890 12248 13510 gene locus_tag LOCUS_08900 12248 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 13541 14791 gene locus_tag LOCUS_08910 13541 14791 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986541.1 protein_id gnl|my_center|LOCUS_08910 15296 15766 gene locus_tag LOCUS_08920 gene moaC 15296 15766 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899917.1 protein_id gnl|my_center|LOCUS_08920 15848 17287 gene locus_tag LOCUS_08930 15848 17287 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence033 371 138 gene locus_tag LOCUS_08940 371 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 461 1249 gene locus_tag LOCUS_08950 gene murI 461 1249 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_08950 1411 2460 gene locus_tag LOCUS_08960 1411 2460 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_08960 2479 3045 gene locus_tag LOCUS_08970 2479 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3069 5237 gene locus_tag LOCUS_08980 3069 5237 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_08980 5463 6047 gene locus_tag LOCUS_08990 5463 6047 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_08990 6881 6249 gene locus_tag LOCUS_09000 6881 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 7198 8541 gene locus_tag LOCUS_09010 7198 8541 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_09010 8559 9872 gene locus_tag LOCUS_09020 8559 9872 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_09020 10042 11058 gene locus_tag LOCUS_09030 gene mreB 10042 11058 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_09030 11186 12031 gene locus_tag LOCUS_09040 gene mreC 11186 12031 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_09040 12028 12540 gene locus_tag LOCUS_09050 12028 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 12587 15232 gene locus_tag LOCUS_09060 12587 15232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16418 15306 gene locus_tag LOCUS_09070 16418 15306 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence034 1589 1179 gene locus_tag LOCUS_09080 1589 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2320 1604 gene locus_tag LOCUS_09090 2320 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3595 2342 gene locus_tag LOCUS_09100 gene murA 3595 2342 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_09100 4799 3687 gene locus_tag LOCUS_09110 gene ftsW 4799 3687 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_09110 6212 4863 gene locus_tag LOCUS_09120 gene murD 6212 4863 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_09120 7406 6408 gene locus_tag LOCUS_09130 gene mraY 7406 6408 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_09130 8895 7453 gene locus_tag LOCUS_09140 8895 7453 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_09140 11166 9043 gene locus_tag LOCUS_09150 11166 9043 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_09150 11711 11211 gene locus_tag LOCUS_09160 11711 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12682 11744 gene locus_tag LOCUS_09170 gene rsmH 12682 11744 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_09170 13125 12679 gene locus_tag LOCUS_09180 gene mraZ 13125 12679 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565149.1 protein_id gnl|my_center|LOCUS_09180 14032 13313 gene locus_tag LOCUS_09190 14032 13313 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_09190 14469 14059 gene locus_tag LOCUS_09200 14469 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 15231 14614 gene locus_tag LOCUS_09210 gene yihA 15231 14614 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_09210 <16865 15228 gene locus_tag LOCUS_09220 <16865 15228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460911.1:endopeptidase La >Feature sequence035 184 417 gene locus_tag LOCUS_09230 184 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1582 755 gene locus_tag LOCUS_09240 1582 755 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 protein_id gnl|my_center|LOCUS_09240 2131 1643 gene locus_tag LOCUS_09250 2131 1643 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_09250 3486 2128 gene locus_tag LOCUS_09260 3486 2128 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_09260 4849 3527 gene locus_tag LOCUS_09270 4849 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6012 4882 gene locus_tag LOCUS_09280 6012 4882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_09280 6363 6169 gene locus_tag LOCUS_09290 6363 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7904 6429 gene locus_tag LOCUS_09300 7904 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 9493 8063 gene locus_tag LOCUS_09310 9493 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10549 9590 gene locus_tag LOCUS_09320 10549 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 12017 10542 gene locus_tag LOCUS_09330 12017 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12690 12004 gene locus_tag LOCUS_09340 gene yycF 12690 12004 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_09340 12955 14298 gene locus_tag LOCUS_09350 12955 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 14315 14773 gene locus_tag LOCUS_09360 gene smpB 14315 14773 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_09360 14692 14701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14803 15132 gene locus_tag LOCUS_09370 14803 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 15005 15014 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15065 16036 gene locus_tag LOCUS_09380 gene lysA 15065 16036 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 >Feature sequence036 631 1887 gene locus_tag LOCUS_09390 631 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1919 3304 gene locus_tag LOCUS_09400 1919 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3538 4773 gene locus_tag LOCUS_09410 3538 4773 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_09410 4924 6123 gene locus_tag LOCUS_09420 4924 6123 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_09420 6299 7861 gene locus_tag LOCUS_09430 6299 7861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09430 7858 8952 gene locus_tag LOCUS_09440 7858 8952 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_09440 8952 9929 gene locus_tag LOCUS_09450 8952 9929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_09450 9997 11076 gene locus_tag LOCUS_09460 gene serC 9997 11076 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_09460 11117 12031 gene locus_tag LOCUS_09470 11117 12031 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_09470 12213 12992 gene locus_tag LOCUS_09480 12213 12992 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_09480 13039 13755 gene locus_tag LOCUS_09490 13039 13755 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_09490 13739 13966 gene locus_tag LOCUS_09500 13739 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 13918 13939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13963 14415 gene locus_tag LOCUS_09510 13963 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09510 14563 15435 gene locus_tag LOCUS_09520 14563 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence037 979 1794 gene locus_tag LOCUS_09530 979 1794 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662583.1 protein_id gnl|my_center|LOCUS_09530 2332 1796 gene locus_tag LOCUS_09540 2332 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09540 3001 2498 gene locus_tag LOCUS_09550 3001 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09550 3171 4169 gene locus_tag LOCUS_09560 gene pta 3171 4169 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_09560 4180 5382 gene locus_tag LOCUS_09570 4180 5382 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_09570 5637 7001 gene locus_tag LOCUS_09580 gene scfB 5637 7001 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_09580 7150 8442 gene locus_tag LOCUS_09590 gene secD 7150 8442 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048083.1 protein_id gnl|my_center|LOCUS_09590 8458 9360 gene locus_tag LOCUS_09600 gene secF 8458 9360 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_09600 9406 11778 gene locus_tag LOCUS_09610 9406 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 11806 12318 gene locus_tag LOCUS_09620 11806 12318 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_09620 12400 14658 gene locus_tag LOCUS_09630 12400 14658 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_09630 14688 15134 gene locus_tag LOCUS_09640 gene dtd 14688 15134 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_09640 15134 15769 gene locus_tag LOCUS_09650 15134 15769 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence038 <1 832 gene locus_tag LOCUS_09660 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048098.1:PBP1A family penicillin-binding protein 948 2087 gene locus_tag LOCUS_09670 948 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2108 2782 gene locus_tag LOCUS_09680 2108 2782 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_09680 2897 4810 gene locus_tag LOCUS_09690 2897 4810 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_09690 4890 5801 gene locus_tag LOCUS_09700 4890 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5833 6183 gene locus_tag LOCUS_09710 5833 6183 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_09710 6197 6625 gene locus_tag LOCUS_09720 6197 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 6640 7953 gene locus_tag LOCUS_09730 6640 7953 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_09730 7975 8313 gene locus_tag LOCUS_09740 7975 8313 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081549.1 protein_id gnl|my_center|LOCUS_09740 8379 9026 gene locus_tag LOCUS_09750 8379 9026 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_09750 9598 9023 gene locus_tag LOCUS_09760 9598 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 9815 10246 gene locus_tag LOCUS_09770 gene rplM 9815 10246 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_09770 10267 10659 gene locus_tag LOCUS_09780 gene rpsI 10267 10659 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09780 11099 10722 gene locus_tag LOCUS_09790 11099 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12102 11233 gene locus_tag LOCUS_09800 12102 11233 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584032.1 protein_id gnl|my_center|LOCUS_09800 12461 12661 gene locus_tag LOCUS_09810 12461 12661 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_09810 12945 12664 gene locus_tag LOCUS_09820 12945 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 13337 13032 gene locus_tag LOCUS_09830 13337 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13817 13521 gene locus_tag LOCUS_09840 gene rpmA 13817 13521 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_09840 14147 13821 gene locus_tag LOCUS_09850 14147 13821 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_09850 14457 14152 gene locus_tag LOCUS_09860 gene rplU 14457 14152 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_09860 15551 14877 gene locus_tag LOCUS_09870 15551 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 15827 15925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence039 1308 640 gene locus_tag LOCUS_09880 1308 640 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_09880 2261 1323 gene locus_tag LOCUS_09890 2261 1323 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_09890 2308 2457 gene locus_tag LOCUS_09900 2308 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2444 2866 gene locus_tag LOCUS_09910 gene fabZ 2444 2866 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_09910 4105 2873 gene locus_tag LOCUS_09920 4105 2873 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_09920 5713 4139 gene locus_tag LOCUS_09930 5713 4139 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459143.1 protein_id gnl|my_center|LOCUS_09930 5914 7812 gene locus_tag LOCUS_09940 5914 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7815 8522 gene locus_tag LOCUS_09950 7815 8522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_09950 8509 9429 gene locus_tag LOCUS_09960 8509 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09960 9403 9412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9444 9767 gene locus_tag LOCUS_09970 9444 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09970 10134 9772 gene locus_tag LOCUS_09980 gene gloA 10134 9772 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 protein_id gnl|my_center|LOCUS_09980 10430 10161 gene locus_tag LOCUS_09990 10430 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 10944 10432 gene locus_tag LOCUS_10000 10944 10432 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391840.1 protein_id gnl|my_center|LOCUS_10000 11432 10953 gene locus_tag LOCUS_10010 11432 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 11572 12804 gene locus_tag LOCUS_10020 11572 12804 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_10020 12914 13390 gene locus_tag LOCUS_10030 12914 13390 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438486.1 protein_id gnl|my_center|LOCUS_10030 13413 13772 gene locus_tag LOCUS_10040 13413 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 13788 14225 gene locus_tag LOCUS_10050 13788 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 15475 15484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence040 <1 1119 gene locus_tag LOCUS_10060 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048250.1:ABC-F family ATP-binding cassette domain-containing protein 1122 2690 gene locus_tag LOCUS_10070 1122 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2796 4388 gene locus_tag LOCUS_10080 2796 4388 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_10080 4385 5497 gene locus_tag LOCUS_10090 4385 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5494 6804 gene locus_tag LOCUS_10100 5494 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6833 6994 gene locus_tag LOCUS_10110 6833 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7212 6991 gene locus_tag LOCUS_10120 7212 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7423 8487 gene locus_tag LOCUS_10130 7423 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8654 9496 gene locus_tag LOCUS_10140 gene cdaA 8654 9496 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_10140 9486 10796 gene locus_tag LOCUS_10150 9486 10796 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048337.1 protein_id gnl|my_center|LOCUS_10150 10977 11693 gene locus_tag LOCUS_10160 10977 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_10160 11800 12006 gene locus_tag LOCUS_10170 11800 12006 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_10170 12022 13092 gene locus_tag LOCUS_10180 12022 13092 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_10180 13095 13832 gene locus_tag LOCUS_10190 13095 13832 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_10190 13835 14371 gene locus_tag LOCUS_10200 13835 14371 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_10200 14446 14477 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 976 1074 gene locus_tag LOCUS_r00010 976 1074 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2084 1140 gene locus_tag LOCUS_10210 2084 1140 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_10210 2247 3545 gene locus_tag LOCUS_10220 2247 3545 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_10220 4675 3572 gene locus_tag LOCUS_10230 gene fliY 4675 3572 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_10230 5672 4668 gene locus_tag LOCUS_10240 gene fliM 5672 4668 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392325.1 protein_id gnl|my_center|LOCUS_10240 6128 5715 gene locus_tag LOCUS_10250 6128 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6903 6142 gene locus_tag LOCUS_10260 6903 6142 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_10260 7720 6893 gene locus_tag LOCUS_10270 7720 6893 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_10270 7940 7725 gene locus_tag LOCUS_10280 7940 7725 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392301.1 protein_id gnl|my_center|LOCUS_10280 8856 8011 gene locus_tag LOCUS_10290 gene flgG 8856 8011 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_10290 9486 8872 gene locus_tag LOCUS_10300 9486 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10760 9498 gene locus_tag LOCUS_10310 10760 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 11515 10835 gene locus_tag LOCUS_10320 11515 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11968 11528 gene locus_tag LOCUS_10330 11968 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 13309 12089 gene locus_tag LOCUS_10340 gene fliI 13309 12089 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_10340 13988 13290 gene locus_tag LOCUS_10350 13988 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <14758 13981 gene locus_tag LOCUS_10360 <14758 13981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000932791.1:flagellar motor switch protein FliG >Feature sequence042 229 684 gene locus_tag LOCUS_10370 229 684 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_10370 737 1828 gene locus_tag LOCUS_10380 gene nusA 737 1828 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10380 1850 2119 gene locus_tag LOCUS_10390 1850 2119 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_10390 2112 2423 gene locus_tag LOCUS_10400 2112 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2456 5257 gene locus_tag LOCUS_10410 2456 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5286 5654 gene locus_tag LOCUS_10420 gene rbfA 5286 5654 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_10420 5668 6630 gene locus_tag LOCUS_10430 5668 6630 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10430 6614 7510 gene locus_tag LOCUS_10440 gene truB 6614 7510 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_10440 7542 8471 gene locus_tag LOCUS_10450 7542 8471 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_10450 8743 9075 gene locus_tag LOCUS_10460 gene yajC 8743 9075 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_10460 9170 9574 gene locus_tag LOCUS_10470 9170 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9790 11445 gene locus_tag LOCUS_10480 9790 11445 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_10480 11476 11817 gene locus_tag LOCUS_10490 11476 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11922 13070 gene locus_tag LOCUS_10500 gene mltG 11922 13070 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_10500 13420 14184 gene locus_tag LOCUS_10510 13420 14184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 14580 14314 gene locus_tag LOCUS_10520 14580 14314 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242983.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence043 2288 1104 gene locus_tag LOCUS_10530 2288 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3083 2502 gene locus_tag LOCUS_10540 3083 2502 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_10540 4819 3080 gene locus_tag LOCUS_10550 4819 3080 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_10550 5130 6443 gene locus_tag LOCUS_10560 gene dnaA 5130 6443 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10560 6726 7826 gene locus_tag LOCUS_10570 gene dnaN 6726 7826 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_10570 8185 7940 gene locus_tag LOCUS_10580 8185 7940 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815009.1 protein_id gnl|my_center|LOCUS_10580 8347 8913 gene locus_tag LOCUS_10590 8347 8913 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_10590 8910 9416 gene locus_tag LOCUS_10600 8910 9416 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_10600 9439 10194 gene locus_tag LOCUS_10610 9439 10194 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_10610 10723 10208 gene locus_tag LOCUS_10620 10723 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12270 10774 gene locus_tag LOCUS_10630 gene guaA 12270 10774 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_10630 <13909 12284 gene locus_tag LOCUS_10640 <13909 12284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase >Feature sequence044 1281 991 gene locus_tag LOCUS_10650 1281 991 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890716.1 protein_id gnl|my_center|LOCUS_10650 1665 1740 gene locus_tag LOCUS_t00080 1665 1740 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3845 1893 gene locus_tag LOCUS_10660 3845 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4501 3941 gene locus_tag LOCUS_10670 4501 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5345 4602 gene locus_tag LOCUS_10680 5345 4602 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_10680 6063 5356 gene locus_tag LOCUS_10690 6063 5356 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263654.1 protein_id gnl|my_center|LOCUS_10690 6785 6060 gene locus_tag LOCUS_10700 6785 6060 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356307.1 protein_id gnl|my_center|LOCUS_10700 7762 6872 gene locus_tag LOCUS_10710 7762 6872 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880638.1 protein_id gnl|my_center|LOCUS_10710 8867 8181 gene locus_tag LOCUS_10720 8867 8181 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_10720 9913 9056 gene locus_tag LOCUS_10730 9913 9056 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_10730 10702 10238 gene locus_tag LOCUS_10740 gene bfr 10702 10238 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 protein_id gnl|my_center|LOCUS_10740 11004 11744 gene locus_tag LOCUS_10750 11004 11744 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_10750 11882 12214 gene locus_tag LOCUS_10760 11882 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence045 2427 4094 gene locus_tag LOCUS_10770 2427 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4423 5700 gene locus_tag LOCUS_10780 4423 5700 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_10780 5718 6680 gene locus_tag LOCUS_10790 gene metA 5718 6680 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_10790 7894 6674 gene locus_tag LOCUS_10800 7894 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9603 8017 gene locus_tag LOCUS_10810 9603 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8027 8058 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12036 9808 gene locus_tag LOCUS_10820 12036 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 <13554 12236 gene locus_tag LOCUS_10830 <13554 12236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986521.1:molecular chaperone HtpG >Feature sequence046 1020 553 gene locus_tag LOCUS_10840 1020 553 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458837.1 protein_id gnl|my_center|LOCUS_10840 2257 1052 gene locus_tag LOCUS_10850 2257 1052 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_10850 3376 2348 gene locus_tag LOCUS_10860 3376 2348 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_10860 3971 3411 gene locus_tag LOCUS_10870 3971 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4366 3980 gene locus_tag LOCUS_10880 4366 3980 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_10880 4689 4721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4955 5176 gene locus_tag LOCUS_10890 4955 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5495 5166 gene locus_tag LOCUS_10900 5495 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 6743 5517 gene locus_tag LOCUS_10910 6743 5517 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_10910 6907 7743 gene locus_tag LOCUS_10920 6907 7743 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_10920 7805 8650 gene locus_tag LOCUS_10930 7805 8650 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_10930 8647 9447 gene locus_tag LOCUS_10940 8647 9447 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_10940 9464 9874 gene locus_tag LOCUS_10950 9464 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9878 10648 gene locus_tag LOCUS_10960 gene truA 9878 10648 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_10960 11050 10658 gene locus_tag LOCUS_10970 11050 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 11694 11125 gene locus_tag LOCUS_10980 11694 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 11149 11158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12562 11744 gene locus_tag LOCUS_10990 12562 11744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence047 898 233 gene locus_tag LOCUS_11000 898 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11000 284 293 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1442 891 gene locus_tag LOCUS_11010 1442 891 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_11010 3397 1805 gene locus_tag LOCUS_11020 3397 1805 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_11020 4648 3398 gene locus_tag LOCUS_11030 4648 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 5142 4735 gene locus_tag LOCUS_11040 5142 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5901 5161 gene locus_tag LOCUS_11050 5901 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5177 5186 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6304 5891 gene locus_tag LOCUS_11060 6304 5891 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_11060 8151 6358 gene locus_tag LOCUS_11070 8151 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8664 8161 gene locus_tag LOCUS_11080 8664 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9706 8669 gene locus_tag LOCUS_11090 9706 8669 CDS product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 protein_id gnl|my_center|LOCUS_11090 10598 9750 gene locus_tag LOCUS_11100 10598 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence048 2803 1415 gene locus_tag LOCUS_11110 gene gltA 2803 1415 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_11110 3653 2817 gene locus_tag LOCUS_11120 3653 2817 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_11120 3854 5563 gene locus_tag LOCUS_11130 3854 5563 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_11130 6154 5570 gene locus_tag LOCUS_11140 6154 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6896 6267 gene locus_tag LOCUS_11150 6896 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 7340 7119 gene locus_tag LOCUS_11160 7340 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 7774 7370 gene locus_tag LOCUS_11170 7774 7370 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_11170 8004 9398 gene locus_tag LOCUS_11180 gene pepV 8004 9398 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_11180 9455 9643 gene locus_tag LOCUS_11190 9455 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 10078 9704 gene locus_tag LOCUS_11200 gene rplL 10078 9704 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583725.1 protein_id gnl|my_center|LOCUS_11200 10626 10081 gene locus_tag LOCUS_11210 gene rplJ 10626 10081 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_11210 11520 10828 gene locus_tag LOCUS_11220 gene rplA 11520 10828 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_11220 11957 11532 gene locus_tag LOCUS_11230 gene rplK 11957 11532 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence049 2766 844 gene locus_tag LOCUS_11240 2766 844 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_11240 3389 2901 gene locus_tag LOCUS_11250 3389 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3871 3377 gene locus_tag LOCUS_11260 3871 3377 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702788.1 protein_id gnl|my_center|LOCUS_11260 3435 3444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4866 3901 gene locus_tag LOCUS_11270 4866 3901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_11270 6044 4866 gene locus_tag LOCUS_11280 6044 4866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_11280 7569 6037 gene locus_tag LOCUS_11290 7569 6037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_11290 8779 7703 gene locus_tag LOCUS_11300 8779 7703 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_11300 9008 9700 gene locus_tag LOCUS_11310 gene sigK 9008 9700 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_11310 10550 9726 gene locus_tag LOCUS_11320 10550 9726 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723600.1 protein_id gnl|my_center|LOCUS_11320 10732 11289 gene locus_tag LOCUS_11330 10732 11289 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_11330 <12198 11317 gene locus_tag LOCUS_11340 <12198 11317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021361993.1:coproporphyrinogen III oxidase >Feature sequence050 164 436 gene locus_tag LOCUS_11350 164 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1008 508 gene locus_tag LOCUS_11360 1008 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11360 1449 1024 gene locus_tag LOCUS_11370 1449 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 1782 1531 gene locus_tag LOCUS_11380 gene cdd1 1782 1531 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_11380 2016 1943 gene locus_tag LOCUS_t00090 2016 1943 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2814 2083 gene locus_tag LOCUS_11390 gene nagB 2814 2083 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_11390 3763 2792 gene locus_tag LOCUS_11400 3763 2792 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_11400 4237 4845 gene locus_tag LOCUS_11410 4237 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5517 4885 gene locus_tag LOCUS_11420 gene plsY 5517 4885 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_11420 6852 5521 gene locus_tag LOCUS_11430 gene der 6852 5521 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_11430 8183 6852 gene locus_tag LOCUS_11440 8183 6852 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_11440 8027 8053 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8484 8185 gene locus_tag LOCUS_11450 8484 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8930 8481 gene locus_tag LOCUS_11460 gene ruvX 8930 8481 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_11460 9878 8934 gene locus_tag LOCUS_11470 9878 8934 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_11470 10150 9884 gene locus_tag LOCUS_11480 10150 9884 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_11480 10415 10251 gene locus_tag LOCUS_11490 10415 10251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 11016 10639 gene locus_tag LOCUS_11500 gene nifU 11016 10639 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_11500 <12188 11027 gene locus_tag LOCUS_11510 <12188 11027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861166.1:cysteine desulfurase NifS >Feature sequence051 2445 1111 gene locus_tag LOCUS_11520 gene gcvPA 2445 1111 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_11520 2838 2458 gene locus_tag LOCUS_11530 gene gcvH 2838 2458 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259335.1 protein_id gnl|my_center|LOCUS_11530 3952 3185 gene locus_tag LOCUS_11540 3952 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 4193 3954 gene locus_tag LOCUS_11550 4193 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6434 4320 gene locus_tag LOCUS_11560 6434 4320 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_11560 6599 6901 gene locus_tag LOCUS_11570 6599 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7453 6911 gene locus_tag LOCUS_11580 gene lepB 7453 6911 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_11580 8073 7459 gene locus_tag LOCUS_11590 gene lepB 8073 7459 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_11590 8317 8120 gene locus_tag LOCUS_11600 8317 8120 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 protein_id gnl|my_center|LOCUS_11600 9257 8358 gene locus_tag LOCUS_11610 9257 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9567 10409 gene locus_tag LOCUS_11620 9567 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10427 11890 gene locus_tag LOCUS_11630 10427 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 11688 11722 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 247 444 gene locus_tag LOCUS_11640 gene rpmE 247 444 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_11640 617 1585 gene locus_tag LOCUS_11650 617 1585 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_11650 1595 2266 gene locus_tag LOCUS_11660 1595 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11660 2227 2263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2443 3513 gene locus_tag LOCUS_11670 gene prfA 2443 3513 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_11670 3530 4564 gene locus_tag LOCUS_11680 3530 4564 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_11680 4606 5118 gene locus_tag LOCUS_11690 4606 5118 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832356.1 protein_id gnl|my_center|LOCUS_11690 5121 5561 gene locus_tag LOCUS_11700 gene rpiB 5121 5561 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869549.1 protein_id gnl|my_center|LOCUS_11700 5605 6234 gene locus_tag LOCUS_11710 gene upp 5605 6234 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_11710 7680 6301 gene locus_tag LOCUS_11720 gene asnS 7680 6301 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_11720 7804 8835 gene locus_tag LOCUS_11730 7804 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 8925 9629 gene locus_tag LOCUS_11740 8925 9629 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_11740 9864 9694 gene locus_tag LOCUS_11750 9864 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 10042 10461 gene locus_tag LOCUS_11760 10042 10461 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_11760 10472 11434 gene locus_tag LOCUS_11770 10472 11434 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence053 1648 905 gene locus_tag LOCUS_11780 1648 905 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_11780 1942 2886 gene locus_tag LOCUS_11790 1942 2886 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357473.1 protein_id gnl|my_center|LOCUS_11790 2944 3819 gene locus_tag LOCUS_11800 gene dapA 2944 3819 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_11800 3838 5052 gene locus_tag LOCUS_11810 3838 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5832 5134 gene locus_tag LOCUS_11820 gene deoC 5832 5134 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_11820 6097 7725 gene locus_tag LOCUS_11830 6097 7725 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869969.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 7691 7717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7779 7991 gene locus_tag LOCUS_11840 7779 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 8105 9397 gene locus_tag LOCUS_11850 8105 9397 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_11850 9707 9495 gene locus_tag LOCUS_11860 9707 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 10630 9821 gene locus_tag LOCUS_11870 10630 9821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_11870 11483 10632 gene locus_tag LOCUS_11880 11483 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 11795 11493 gene locus_tag LOCUS_11890 11795 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence054 384 1322 gene locus_tag LOCUS_11900 384 1322 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_11900 1554 1384 gene locus_tag LOCUS_11910 1554 1384 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_11910 2858 1653 gene locus_tag LOCUS_11920 2858 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 3829 2858 gene locus_tag LOCUS_11930 3829 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4488 3814 gene locus_tag LOCUS_11940 4488 3814 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_11940 5910 4528 gene locus_tag LOCUS_11950 5910 4528 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_11950 6278 6352 gene locus_tag LOCUS_t00100 6278 6352 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7327 6455 gene locus_tag LOCUS_11960 7327 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8758 7376 gene locus_tag LOCUS_11970 8758 7376 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_11970 9665 8805 gene locus_tag LOCUS_11980 9665 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 9934 10509 gene locus_tag LOCUS_11990 9934 10509 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461340.1 protein_id gnl|my_center|LOCUS_11990 10698 10623 gene locus_tag LOCUS_t00110 10698 10623 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11207 11025 gene locus_tag LOCUS_12000 11207 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence055 1380 343 gene locus_tag LOCUS_12010 1380 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1531 2613 gene locus_tag LOCUS_12020 1531 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3217 2675 gene locus_tag LOCUS_12030 3217 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3721 3224 gene locus_tag LOCUS_12040 3721 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4120 5256 gene locus_tag LOCUS_12050 4120 5256 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868876.1 protein_id gnl|my_center|LOCUS_12050 5422 7029 gene locus_tag LOCUS_12060 5422 7029 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868877.1 protein_id gnl|my_center|LOCUS_12060 7022 8089 gene locus_tag LOCUS_12070 7022 8089 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_12070 8086 9390 gene locus_tag LOCUS_12080 8086 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9403 10473 gene locus_tag LOCUS_12090 9403 10473 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356041.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence056 586 1959 gene locus_tag LOCUS_12100 gene tilS 586 1959 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_12100 2010 2561 gene locus_tag LOCUS_12110 gene hpt 2010 2561 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_12110 2721 4682 gene locus_tag LOCUS_12120 gene ftsH 2721 4682 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_12120 4759 5148 gene locus_tag LOCUS_12130 4759 5148 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_12130 5145 5978 gene locus_tag LOCUS_12140 5145 5978 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_12140 6106 7125 gene locus_tag LOCUS_12150 6106 7125 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_12150 7531 7139 gene locus_tag LOCUS_12160 7531 7139 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197242566.1 protein_id gnl|my_center|LOCUS_12160 7669 8898 gene locus_tag LOCUS_12170 7669 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9162 8953 gene locus_tag LOCUS_12180 9162 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9287 10102 gene locus_tag LOCUS_12190 9287 10102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence057 298 2241 gene locus_tag LOCUS_12200 298 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2196 3164 gene locus_tag LOCUS_12210 gene holA 2196 3164 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_12210 3466 3173 gene locus_tag LOCUS_12220 3466 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3578 4072 gene locus_tag LOCUS_12230 3578 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5093 4104 gene locus_tag LOCUS_12240 5093 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814297.1 protein_id gnl|my_center|LOCUS_12240 5424 5086 gene locus_tag LOCUS_12250 5424 5086 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339344.1 protein_id gnl|my_center|LOCUS_12250 6266 5583 gene locus_tag LOCUS_12260 6266 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7650 6286 gene locus_tag LOCUS_12270 7650 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7649 7804 gene locus_tag LOCUS_12280 7649 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8450 8887 gene locus_tag LOCUS_12290 8450 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 8787 9380 gene locus_tag LOCUS_12300 8787 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12300 >Feature sequence058 1556 1212 gene locus_tag LOCUS_12310 1556 1212 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_12310 2867 1584 gene locus_tag LOCUS_12320 gene mtaB 2867 1584 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_12320 3597 2869 gene locus_tag LOCUS_12330 3597 2869 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_12330 3237 3246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4607 3606 gene locus_tag LOCUS_12340 gene prmA 4607 3606 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_12340 6352 4649 gene locus_tag LOCUS_12350 6352 4649 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_12350 6593 7054 gene locus_tag LOCUS_12360 gene trmL 6593 7054 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_12360 7144 8898 gene locus_tag LOCUS_12370 7144 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence059 <1 939 gene locus_tag LOCUS_12380 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048370.1:glycine--tRNA ligase 2204 951 gene locus_tag LOCUS_12390 2204 951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_12390 2361 2735 gene locus_tag LOCUS_12400 2361 2735 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_12400 2748 3518 gene locus_tag LOCUS_12410 2748 3518 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_12410 3534 3971 gene locus_tag LOCUS_12420 gene tadA 3534 3971 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_12420 4018 4395 gene locus_tag LOCUS_12430 4018 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4552 4947 gene locus_tag LOCUS_12440 4552 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5024 6202 gene locus_tag LOCUS_12450 5024 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 6259 7617 gene locus_tag LOCUS_12460 6259 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 7782 8117 gene locus_tag LOCUS_12470 7782 8117 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 protein_id gnl|my_center|LOCUS_12470 8120 9082 gene locus_tag LOCUS_12480 8120 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254091.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence060 <1 2626 gene locus_tag LOCUS_12490 <1 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582704.1:glycosyltransferase family 4 protein 3930 2623 gene locus_tag LOCUS_12500 3930 2623 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_12500 5266 4016 gene locus_tag LOCUS_12510 5266 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5470 6420 gene locus_tag LOCUS_12520 5470 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 <9008 6424 gene locus_tag LOCUS_12530 <9008 6424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase >Feature sequence061 651 681 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1930 845 gene locus_tag LOCUS_12540 gene flhB 1930 845 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_12540 2715 1927 gene locus_tag LOCUS_12550 gene fliR 2715 1927 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_12550 2982 2719 gene locus_tag LOCUS_12560 gene fliQ 2982 2719 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965448.1 protein_id gnl|my_center|LOCUS_12560 3835 3005 gene locus_tag LOCUS_12570 3835 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4238 3882 gene locus_tag LOCUS_12580 4238 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4571 4287 gene locus_tag LOCUS_12590 4571 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5023 4592 gene locus_tag LOCUS_12600 gene flgC 5023 4592 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_12600 5423 5028 gene locus_tag LOCUS_12610 gene flgB 5423 5028 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_12610 6003 5434 gene locus_tag LOCUS_12620 6003 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6572 6120 gene locus_tag LOCUS_12630 6572 6120 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816309.1 protein_id gnl|my_center|LOCUS_12630 7026 6607 gene locus_tag LOCUS_12640 7026 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7430 7032 gene locus_tag LOCUS_12650 7430 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8700 7459 gene locus_tag LOCUS_12660 8700 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence062 2587 1748 gene locus_tag LOCUS_12670 gene rsmA 2587 1748 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814989.1 protein_id gnl|my_center|LOCUS_12670 3654 2584 gene locus_tag LOCUS_12680 3654 2584 CDS product G5 and 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966270.1 protein_id gnl|my_center|LOCUS_12680 4322 3777 gene locus_tag LOCUS_12690 4322 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4455 4531 gene locus_tag LOCUS_t00120 4455 4531 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4718 4791 gene locus_tag LOCUS_t00130 4718 4791 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4920 5444 gene locus_tag LOCUS_12700 4920 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 6221 5463 gene locus_tag LOCUS_12710 6221 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7409 6228 gene locus_tag LOCUS_12720 7409 6228 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969853.1 protein_id gnl|my_center|LOCUS_12720 7827 7420 gene locus_tag LOCUS_12730 7827 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 7856 7886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence063 857 1357 gene locus_tag LOCUS_12740 857 1357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458837.1 protein_id gnl|my_center|LOCUS_12740 1543 2052 gene locus_tag LOCUS_12750 1543 2052 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_12750 2217 3683 gene locus_tag LOCUS_12760 gene xylB 2217 3683 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_12760 3841 4359 gene locus_tag LOCUS_12770 3841 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4372 4758 gene locus_tag LOCUS_12780 4372 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5467 4865 gene locus_tag LOCUS_12790 5467 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6464 5631 gene locus_tag LOCUS_12800 6464 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 7494 6592 gene locus_tag LOCUS_12810 7494 6592 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394166.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence064 929 1846 gene locus_tag LOCUS_12820 929 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2012 3055 gene locus_tag LOCUS_12830 2012 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4170 3208 gene locus_tag LOCUS_12840 4170 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4961 4287 gene locus_tag LOCUS_12850 gene yunB 4961 4287 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965597.1 protein_id gnl|my_center|LOCUS_12850 5382 5403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5498 7147 gene locus_tag LOCUS_12860 5498 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7645 7736 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence065 1154 120 gene locus_tag LOCUS_12870 1154 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1276 1887 gene locus_tag LOCUS_12880 1276 1887 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_12880 3192 1888 gene locus_tag LOCUS_12890 3192 1888 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_12890 3974 3189 gene locus_tag LOCUS_12900 3974 3189 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_12900 4617 3988 gene locus_tag LOCUS_12910 4617 3988 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_12910 4775 5272 gene locus_tag LOCUS_12920 gene ruvC 4775 5272 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_12920 5303 5884 gene locus_tag LOCUS_12930 gene ruvA 5303 5884 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_12930 5911 6948 gene locus_tag LOCUS_12940 gene ruvB 5911 6948 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_12940 6971 7774 gene locus_tag LOCUS_12950 6971 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence066 1573 1388 gene locus_tag LOCUS_12960 1573 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1789 1598 gene locus_tag LOCUS_12970 1789 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2123 2734 gene locus_tag LOCUS_12980 2123 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2749 3444 gene locus_tag LOCUS_12990 2749 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3481 5022 gene locus_tag LOCUS_13000 3481 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4909 4974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5028 7445 gene locus_tag LOCUS_13010 5028 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence067 1855 803 gene locus_tag LOCUS_13020 1855 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459067.1 protein_id gnl|my_center|LOCUS_13020 2055 2684 gene locus_tag LOCUS_13030 2055 2684 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_13030 2686 3171 gene locus_tag LOCUS_13040 2686 3171 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_13040 3214 3570 gene locus_tag LOCUS_13050 gene cheY 3214 3570 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081049.1 protein_id gnl|my_center|LOCUS_13050 3600 4685 gene locus_tag LOCUS_13060 3600 4685 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_13060 5665 4850 gene locus_tag LOCUS_13070 5665 4850 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987022.1 protein_id gnl|my_center|LOCUS_13070 5992 7590 gene locus_tag LOCUS_13080 gene fliF 5992 7590 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082905.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence068 348 91 gene locus_tag LOCUS_13090 gene secE 348 91 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429494.1 protein_id gnl|my_center|LOCUS_13090 533 384 gene locus_tag LOCUS_13100 gene rpmG 533 384 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_13100 795 1772 gene locus_tag LOCUS_13110 795 1772 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_13110 1837 3207 gene locus_tag LOCUS_13120 gene glmU 1837 3207 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 protein_id gnl|my_center|LOCUS_13120 3848 3213 gene locus_tag LOCUS_13130 3848 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4020 3856 gene locus_tag LOCUS_13140 4020 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4044 4706 gene locus_tag LOCUS_13150 gene sdaAB 4044 4706 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_13150 4725 5624 gene locus_tag LOCUS_13160 gene sdaAA 4725 5624 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_13160 7263 5632 gene locus_tag LOCUS_13170 7263 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence069 2438 873 gene locus_tag LOCUS_13180 gene glgA 2438 873 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_13180 3591 2461 gene locus_tag LOCUS_13190 gene glgD 3591 2461 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_13190 4825 3578 gene locus_tag LOCUS_13200 4825 3578 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_13200 6745 4889 gene locus_tag LOCUS_13210 gene glgB 6745 4889 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence070 234 374 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgataatcgcccctacat 457 1377 gene locus_tag LOCUS_13220 457 1377 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_13220 1945 1379 gene locus_tag LOCUS_13230 1945 1379 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_13230 2328 3287 gene locus_tag LOCUS_13240 2328 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3311 5257 gene locus_tag LOCUS_13250 3311 5257 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_13250 5262 5711 gene locus_tag LOCUS_13260 gene rplI 5262 5711 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence071 2053 2367 gene locus_tag LOCUS_13270 2053 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4805 2403 gene locus_tag LOCUS_13280 gene gyrA 4805 2403 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_13280 6834 4864 gene locus_tag LOCUS_13290 gene gyrB 6834 4864 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence072 1714 860 gene locus_tag LOCUS_13300 1714 860 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_13300 2606 1776 gene locus_tag LOCUS_13310 2606 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3945 2782 gene locus_tag LOCUS_13320 gene ugpC 3945 2782 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_13320 4283 5233 gene locus_tag LOCUS_13330 gene moaA 4283 5233 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_13330 5235 5672 gene locus_tag LOCUS_13340 5235 5672 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_13340 5787 6521 gene locus_tag LOCUS_13350 5787 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence073 <1 864 gene locus_tag LOCUS_13360 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371207.1:formate dehydrogenase subunit alpha 937 1536 gene locus_tag LOCUS_13370 937 1536 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_13370 1543 2346 gene locus_tag LOCUS_13380 gene fdhD 1543 2346 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_13380 2376 3188 gene locus_tag LOCUS_13390 2376 3188 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_13390 3680 3300 gene locus_tag LOCUS_13400 3680 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5615 3702 gene locus_tag LOCUS_13410 5615 3702 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_13410 <6583 5620 gene locus_tag LOCUS_13420 <6583 5620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986481.1:molybdopterin molybdotransferase MoeA >Feature sequence074 <1 635 gene locus_tag LOCUS_13430 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971736.1:DNA repair protein RadC 672 2393 gene locus_tag LOCUS_13440 672 2393 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_13440 2404 3126 gene locus_tag LOCUS_13450 2404 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3151 3759 gene locus_tag LOCUS_13460 gene udk 3151 3759 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_13460 3813 4976 gene locus_tag LOCUS_13470 3813 4976 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_13470 5148 6152 gene locus_tag LOCUS_13480 5148 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 6094 6103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 1510 1055 gene locus_tag LOCUS_13490 1510 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3060 1537 gene locus_tag LOCUS_13500 3060 1537 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_13500 3306 4475 gene locus_tag LOCUS_13510 3306 4475 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_13510 4493 5317 gene locus_tag LOCUS_13520 4493 5317 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_13520 5406 6368 gene locus_tag LOCUS_13530 5406 6368 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803849.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence076 <1 956 gene locus_tag LOCUS_13540 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947906.1:serine--tRNA ligase 1290 1018 gene locus_tag LOCUS_13550 1290 1018 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_13550 2836 1391 gene locus_tag LOCUS_13560 gene mazG 2836 1391 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_13560 4467 2845 gene locus_tag LOCUS_13570 4467 2845 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_13570 4651 5529 gene locus_tag LOCUS_13580 4651 5529 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence077 1238 2428 gene locus_tag LOCUS_13590 1238 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2428 3384 gene locus_tag LOCUS_13600 2428 3384 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_13600 3381 4220 gene locus_tag LOCUS_13610 gene ispE 3381 4220 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638870.1 protein_id gnl|my_center|LOCUS_13610 4617 5336 gene locus_tag LOCUS_13620 4617 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence078 317 991 gene locus_tag LOCUS_13630 317 991 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 protein_id gnl|my_center|LOCUS_13630 1036 2232 gene locus_tag LOCUS_13640 1036 2232 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_13640 2494 3708 gene locus_tag LOCUS_13650 2494 3708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_13650 3799 4701 gene locus_tag LOCUS_13660 3799 4701 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_13660 4822 5748 gene locus_tag LOCUS_13670 4822 5748 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence079 841 374 gene locus_tag LOCUS_13680 841 374 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_13680 1097 2245 gene locus_tag LOCUS_13690 1097 2245 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_13690 2702 2355 gene locus_tag LOCUS_13700 2702 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130296.1 protein_id gnl|my_center|LOCUS_13700 3018 3320 gene locus_tag LOCUS_13710 3018 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3353 5215 gene locus_tag LOCUS_13720 3353 5215 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476588.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence080 354 2135 gene locus_tag LOCUS_13730 gene dnaG 354 2135 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_13730 2591 2662 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2712 3185 gene locus_tag LOCUS_13740 2712 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3441 4985 gene locus_tag LOCUS_13750 gene rny 3441 4985 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence081 261 404 gene locus_tag LOCUS_13760 261 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 480 391 gene locus_tag LOCUS_t00140 480 391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1615 719 gene locus_tag LOCUS_13770 1615 719 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399477.1 protein_id gnl|my_center|LOCUS_13770 1778 2371 gene locus_tag LOCUS_13780 1778 2371 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964669.1 protein_id gnl|my_center|LOCUS_13780 2412 3401 gene locus_tag LOCUS_13790 2412 3401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_13790 3582 3412 gene locus_tag LOCUS_13800 3582 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3812 4411 gene locus_tag LOCUS_13810 3812 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4960 4481 gene locus_tag LOCUS_13820 4960 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13820 >Feature sequence082 <1 1051 gene locus_tag LOCUS_13830 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880489.1:dihydroorotase 1029 1640 gene locus_tag LOCUS_13840 1029 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13840 1633 1863 gene locus_tag LOCUS_13850 1633 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 1854 2570 gene locus_tag LOCUS_13860 1854 2570 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_13860 2560 3468 gene locus_tag LOCUS_13870 2560 3468 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_13870 3477 4049 gene locus_tag LOCUS_13880 gene pyrE 3477 4049 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361660.1 protein_id gnl|my_center|LOCUS_13880 4177 4731 gene locus_tag LOCUS_13890 gene spoVT 4177 4731 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence083 499 3153 gene locus_tag LOCUS_13900 499 3153 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_13900 3317 4555 gene locus_tag LOCUS_13910 3317 4555 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence084 1319 942 gene locus_tag LOCUS_13920 1319 942 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_13920 1880 1323 gene locus_tag LOCUS_13930 1880 1323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_13930 2375 1887 gene locus_tag LOCUS_13940 gene nuoE 2375 1887 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_13940 3119 2535 gene locus_tag LOCUS_13950 3119 2535 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_13950 3491 3123 gene locus_tag LOCUS_13960 3491 3123 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_13960 4476 3529 gene locus_tag LOCUS_13970 4476 3529 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_13970 4757 4682 gene locus_tag LOCUS_t00150 4757 4682 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 888 202 gene locus_tag LOCUS_13980 888 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1406 3124 gene locus_tag LOCUS_13990 1406 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3157 3987 gene locus_tag LOCUS_14000 3157 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14000 >Feature sequence086 854 1876 gene locus_tag LOCUS_14010 gene pheS 854 1876 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_14010 1921 4326 gene locus_tag LOCUS_14020 gene pheT 1921 4326 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence087 91 1281 gene locus_tag LOCUS_14030 gene paaK 91 1281 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_14030 2108 1398 gene locus_tag LOCUS_14040 2108 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <4501 2533 gene locus_tag LOCUS_14050 <4501 2533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948003.1:CoA-disulfide reductase >Feature sequence088 81 3509 gene locus_tag LOCUS_14060 gene mfd 81 3509 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_14060 4407 3520 gene locus_tag LOCUS_14070 4407 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence089 1174 146 gene locus_tag LOCUS_14080 1174 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1966 1187 gene locus_tag LOCUS_14090 1966 1187 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_14090 2513 2043 gene locus_tag LOCUS_14100 2513 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2710 3432 gene locus_tag LOCUS_14110 2710 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3432 4154 gene locus_tag LOCUS_14120 3432 4154 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence090 <4277 3669 gene locus_tag LOCUS_14130 <4277 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966462.1:PIN/TRAM domain-containing protein >Feature sequence091 2754 2023 gene locus_tag LOCUS_14140 2754 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3189 2959 gene locus_tag LOCUS_14150 3189 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3949 3251 gene locus_tag LOCUS_14160 3949 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence092 1010 918 gene locus_tag LOCUS_t00160 1010 918 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1047 1091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1280 1708 gene locus_tag LOCUS_14170 1280 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 1589 1598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1666 2313 gene locus_tag LOCUS_14180 1666 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14180 2322 3107 gene locus_tag LOCUS_14190 gene modA 2322 3107 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461081.1 protein_id gnl|my_center|LOCUS_14190 3135 3818 gene locus_tag LOCUS_14200 gene modB 3135 3818 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence093 608 192 gene locus_tag LOCUS_14210 608 192 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582698.1 protein_id gnl|my_center|LOCUS_14210 1852 605 gene locus_tag LOCUS_14220 1852 605 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_14220 2105 2527 gene locus_tag LOCUS_14230 2105 2527 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_14230 2811 2608 gene locus_tag LOCUS_14240 2811 2608 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_14240 3092 2817 gene locus_tag LOCUS_14250 3092 2817 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence094 265 435 gene locus_tag LOCUS_14260 265 435 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460425.1 protein_id gnl|my_center|LOCUS_14260 1996 524 gene locus_tag LOCUS_14270 gene guaB 1996 524 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_14270 2591 2046 gene locus_tag LOCUS_14280 gene scpB 2591 2046 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_14280 3373 2597 gene locus_tag LOCUS_14290 3373 2597 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_14290 4059 3394 gene locus_tag LOCUS_14300 4059 3394 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence095 3 1235 gene locus_tag LOCUS_14310 gene rimO 3 1235 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_14310 1232 1768 gene locus_tag LOCUS_14320 gene pgsA 1232 1768 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 protein_id gnl|my_center|LOCUS_14320 1782 3029 gene locus_tag LOCUS_14330 1782 3029 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence096 138 1313 gene locus_tag LOCUS_14340 138 1313 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_14340 2759 1434 gene locus_tag LOCUS_14350 2759 1434 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_14350 3790 2819 gene locus_tag LOCUS_14360 3790 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence097 1137 805 gene locus_tag LOCUS_14370 1137 805 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462029.1 protein_id gnl|my_center|LOCUS_14370 1278 1430 gene locus_tag LOCUS_14380 1278 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1755 1420 gene locus_tag LOCUS_14390 1755 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2006 2073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2518 2186 gene locus_tag LOCUS_14400 2518 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence098 593 874 gene locus_tag LOCUS_14410 593 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 896 2590 gene locus_tag LOCUS_14420 896 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence099 3284 372 gene locus_tag LOCUS_14430 3284 372 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_14430 <3967 3277 gene locus_tag LOCUS_14440 <3967 3277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000599739.1:Fic family protein >Feature sequence100 1972 719 gene locus_tag LOCUS_14450 1972 719 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_14450 2269 3171 gene locus_tag LOCUS_14460 gene cysL 2269 3171 CDS product cysJI operon transcriptional regulator CysL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243173.1 protein_id gnl|my_center|LOCUS_14460 <3929 3379 gene locus_tag LOCUS_14470 <3929 3379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080443.1:FMN-binding glutamate synthase family protein >Feature sequence101 211 438 gene locus_tag LOCUS_14480 211 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 755 1099 gene locus_tag LOCUS_14490 755 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1101 2435 gene locus_tag LOCUS_14500 gene ffh 1101 2435 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863460.1 protein_id gnl|my_center|LOCUS_14500 2486 2728 gene locus_tag LOCUS_14510 gene rpsP 2486 2728 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392482.1 protein_id gnl|my_center|LOCUS_14510 2739 2966 gene locus_tag LOCUS_14520 2739 2966 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_14520 2966 3481 gene locus_tag LOCUS_14530 gene rimM 2966 3481 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence102 145 3528 gene locus_tag LOCUS_14540 145 3528 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence103 704 408 gene locus_tag LOCUS_14550 704 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1390 1094 gene locus_tag LOCUS_14560 1390 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1817 3703 gene locus_tag LOCUS_14570 1817 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence104 <1 2031 gene locus_tag LOCUS_14580 <1 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027389.1:DEAD/DEAH box helicase family protein 2037 3512 gene locus_tag LOCUS_14590 2037 3512 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence105 958 617 gene locus_tag LOCUS_14600 958 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1281 1895 gene locus_tag LOCUS_14610 1281 1895 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_14610 1974 3173 gene locus_tag LOCUS_14620 1974 3173 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280517.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence106 1719 859 gene locus_tag LOCUS_14630 1719 859 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906390.1 protein_id gnl|my_center|LOCUS_14630 2656 1757 gene locus_tag LOCUS_14640 2656 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2924 2616 gene locus_tag LOCUS_14650 2924 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2640 2649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence107 321 938 gene locus_tag LOCUS_14660 321 938 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439354.1 protein_id gnl|my_center|LOCUS_14660 931 1065 gene locus_tag LOCUS_14670 931 1065 CDS product CD1871A family CXXC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674194.1 protein_id gnl|my_center|LOCUS_14670 1058 1951 gene locus_tag LOCUS_14680 1058 1951 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_14680 1941 2399 gene locus_tag LOCUS_14690 1941 2399 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 protein_id gnl|my_center|LOCUS_14690 2475 2852 gene locus_tag LOCUS_14700 2475 2852 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence108 <1 591 gene locus_tag LOCUS_14710 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948757.1:MBL fold metallo-hydrolase 722 904 gene locus_tag LOCUS_14720 722 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 921 1226 gene locus_tag LOCUS_14730 921 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1450 1274 gene locus_tag LOCUS_14740 1450 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1844 1932 gene locus_tag LOCUS_t00170 1844 1932 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3182 2040 gene locus_tag LOCUS_14750 3182 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence109 883 560 gene locus_tag LOCUS_14760 883 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1201 896 gene locus_tag LOCUS_14770 1201 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1673 1185 gene locus_tag LOCUS_14780 1673 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence110 563 1510 gene locus_tag LOCUS_14790 563 1510 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_14790 1525 2742 gene locus_tag LOCUS_14800 1525 2742 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence111 1409 672 gene locus_tag LOCUS_14810 1409 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2181 1444 gene locus_tag LOCUS_14820 2181 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <3174 2374 gene locus_tag LOCUS_14830 <3174 2374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262593.1:N,N'-diacetylchitobiose phosphorylase >Feature sequence112 858 2120 gene locus_tag LOCUS_14840 858 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2310 2495 gene locus_tag LOCUS_14850 2310 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence113 272 493 gene locus_tag LOCUS_14860 272 493 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_14860 1121 582 gene locus_tag LOCUS_14870 1121 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2370 1144 gene locus_tag LOCUS_14880 2370 1144 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence114 <1 628 gene locus_tag LOCUS_14890 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888694.1:sulfate/molybdate ABC transporter ATP-binding protein 1128 625 gene locus_tag LOCUS_14900 1128 625 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_14900 2085 1144 gene locus_tag LOCUS_14910 2085 1144 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083193.1 protein_id gnl|my_center|LOCUS_14910 <3026 2121 gene locus_tag LOCUS_14920 <3026 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582433.1:diguanylate cyclase >Feature sequence115 12 1130 gene locus_tag LOCUS_14930 12 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 255 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1138 1443 gene locus_tag LOCUS_14940 1138 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1440 1760 gene locus_tag LOCUS_14950 1440 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1732 2163 gene locus_tag LOCUS_14960 1732 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2160 2510 gene locus_tag LOCUS_14970 2160 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence116 1191 517 gene locus_tag LOCUS_14980 1191 517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986484.1 protein_id gnl|my_center|LOCUS_14980 2085 1258 gene locus_tag LOCUS_14990 2085 1258 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_14990 2506 2820 gene locus_tag LOCUS_15000 2506 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence117 209 1000 gene locus_tag LOCUS_15010 gene spo0A 209 1000 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_15010 1545 1084 gene locus_tag LOCUS_15020 1545 1084 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429434.1 protein_id gnl|my_center|LOCUS_15020 1666 2490 gene locus_tag LOCUS_15030 1666 2490 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence118 479 760 gene locus_tag LOCUS_15040 479 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence119 220 95 gene locus_tag LOCUS_15050 220 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 237 312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1044 1922 gene locus_tag LOCUS_15060 1044 1922 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_15060 2692 2000 gene locus_tag LOCUS_15070 2692 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence120 335 394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 403 1140 gene locus_tag LOCUS_15080 403 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence121 340 1866 gene locus_tag LOCUS_15090 340 1866 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence122 491 1258 gene locus_tag LOCUS_15100 491 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1694 2002 gene locus_tag LOCUS_15110 1694 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence123 1515 64 gene locus_tag LOCUS_15120 gene gnd 1515 64 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_15120 2608 1535 gene locus_tag LOCUS_15130 2608 1535 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence124 756 103 gene locus_tag LOCUS_15140 756 103 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_15140 1845 760 gene locus_tag LOCUS_15150 1845 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2201 1854 gene locus_tag LOCUS_15160 2201 1854 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence125 929 411 gene locus_tag LOCUS_15170 929 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence126 281 1654 gene locus_tag LOCUS_15180 281 1654 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence127 1580 528 gene locus_tag LOCUS_15190 1580 528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_15190 2148 1609 gene locus_tag LOCUS_15200 2148 1609 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence128 457 1221 gene locus_tag LOCUS_15210 457 1221 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_15210 1227 1793 gene locus_tag LOCUS_15220 1227 1793 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881116.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence129 602 327 gene locus_tag LOCUS_15230 602 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 785 648 gene locus_tag LOCUS_15240 785 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2440 1064 gene locus_tag LOCUS_15250 2440 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence130 533 1720 gene locus_tag LOCUS_15260 533 1720 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence131 292 789 gene locus_tag LOCUS_15270 292 789 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence132 <1 582 gene locus_tag LOCUS_15280 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025773590.1:ABC transporter ATP-binding protein 572 1279 gene locus_tag LOCUS_15290 572 1279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_15290 1407 2111 gene locus_tag LOCUS_15300 1407 2111 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324453.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence133 889 71 gene locus_tag LOCUS_15310 889 71 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_15310 1851 886 gene locus_tag LOCUS_15320 1851 886 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250076.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15320 2032 1838 gene locus_tag LOCUS_15330 2032 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 >Feature sequence134 136 345 gene locus_tag LOCUS_15340 136 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence135 1238 264 gene locus_tag LOCUS_15350 1238 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1573 1235 gene locus_tag LOCUS_15360 1573 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence136 12 386 gene locus_tag LOCUS_15370 12 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 345 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 358 1290 gene locus_tag LOCUS_15380 358 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1283 1906 gene locus_tag LOCUS_15390 1283 1906 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence137 1223 498 gene locus_tag LOCUS_15400 1223 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1561 2013 gene locus_tag LOCUS_15410 1561 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence138 67 798 gene locus_tag LOCUS_15420 67 798 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_15420 791 1171 gene locus_tag LOCUS_15430 791 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence139 577 1362 gene locus_tag LOCUS_15440 577 1362 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_15440 1518 1594 gene locus_tag LOCUS_t00180 1518 1594 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence140 1666 545 gene locus_tag LOCUS_15450 gene sucC 1666 545 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence141 <1 546 gene locus_tag LOCUS_15460 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003020063.1:NADP-specific glutamate dehydrogenase 717 1118 gene locus_tag LOCUS_15470 717 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1207 1449 gene locus_tag LOCUS_15480 1207 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence142 >Feature sequence143 1663 935 gene locus_tag LOCUS_15490 1663 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence144 <1 677 gene locus_tag LOCUS_15500 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207285050.1:serine O-acetyltransferase <1833 700 gene locus_tag LOCUS_15510 <1833 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964362.1:FAD-dependent oxidoreductase >Feature sequence145 299 308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence146 <1 649 gene locus_tag LOCUS_15520 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391440.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase 1542 1551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 55 684 gene locus_tag LOCUS_15530 55 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence148 >Feature sequence149 <1 579 gene locus_tag LOCUS_15540 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' note possible pseudo, frameshifted >Feature sequence150 610 1584 gene locus_tag LOCUS_15550 610 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence151 30 164 gene locus_tag LOCUS_15560 30 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1513 275 gene locus_tag LOCUS_15570 1513 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 289 315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 1423 158 gene locus_tag LOCUS_15580 1423 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence153 >Feature sequence154 249 602 gene locus_tag LOCUS_15590 249 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence155 245 287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 796 1449 gene locus_tag LOCUS_15600 796 1449 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393404.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence156 477 121 gene locus_tag LOCUS_15610 477 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 476 598 gene locus_tag LOCUS_15620 476 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 888 619 gene locus_tag LOCUS_15630 888 619 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_15630 1123 881 gene locus_tag LOCUS_15640 1123 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1389 1213 gene locus_tag LOCUS_15650 1389 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence157 >Feature sequence158 >Feature sequence159 <1 1137 gene locus_tag LOCUS_15660 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081526.1:D-tagaturonate epimerase UxaE >Feature sequence160 1243 449 gene locus_tag LOCUS_15670 1243 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence161 1261 80 gene locus_tag LOCUS_15680 1261 80 CDS product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence162 258 596 gene locus_tag LOCUS_15690 258 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 >Feature sequence163 >Feature sequence164 522 1112 gene locus_tag LOCUS_15700 522 1112 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583150.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence165 318 713 gene locus_tag LOCUS_15710 318 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1085 1094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 174 776 gene locus_tag LOCUS_15720 174 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence167 <1217 355 gene locus_tag LOCUS_15730 <1217 355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948895.1:cation diffusion facilitator family transporter >Feature sequence168 >Feature sequence169 >Feature sequence170 >Feature sequence171 <1103 254 gene locus_tag LOCUS_15740 <1103 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002295261.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 814 855 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence172 >Feature sequence173 <1050 487 gene locus_tag LOCUS_15750 <1050 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000764065.1:RNA polymerase sigma factor RpoD >Feature sequence174 >Feature sequence175 1 699 gene locus_tag LOCUS_15760 1 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence176 144 446 gene locus_tag LOCUS_15770 144 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15770 397 409 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence177 35 295 gene locus_tag LOCUS_15780 35 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 310 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 572 486 gene locus_tag LOCUS_t00190 572 486 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 672 701 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 >Feature sequence180 >Feature sequence181 <876 244 gene locus_tag LOCUS_15790 <876 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012099491.1:TIGR03960 family B12-binding radical SAM protein note possible pseudo, frameshifted 608 617 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 >Feature sequence183 >Feature sequence184 357 85 gene locus_tag LOCUS_15800 357 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 434 490 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence185 >Feature sequence186 426 504 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence187 532 293 gene locus_tag LOCUS_15810 532 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 645 570 gene locus_tag LOCUS_t00200 645 570 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence188 >Feature sequence189 <1 686 gene locus_tag LOCUS_15820 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530184.1:sugar ABC transporter permease >Feature sequence190 395 423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence191 >Feature sequence192 243 382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence193 236 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence194 >Feature sequence195 >Feature sequence196 >Feature sequence197 254 311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence198 >Feature sequence199 184 109 gene locus_tag LOCUS_t00210 184 109 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence200 >Feature sequence201 >Feature sequence202 236 284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence203 >Feature sequence204 132 42 gene locus_tag LOCUS_t00220 132 42 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 229 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends