>Feature sequence001 315 118 gene locus_tag LOCUS_00010 315 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 755 312 gene locus_tag LOCUS_00020 755 312 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_00020 1305 901 gene locus_tag LOCUS_00030 1305 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1926 1498 gene locus_tag LOCUS_00040 1926 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2254 2003 gene locus_tag LOCUS_00050 2254 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2746 2447 gene locus_tag LOCUS_00060 2746 2447 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_00060 3853 2861 gene locus_tag LOCUS_00070 3853 2861 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_00070 4833 3856 gene locus_tag LOCUS_00080 4833 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6088 4844 gene locus_tag LOCUS_00090 6088 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6964 6347 gene locus_tag LOCUS_00100 6964 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7374 6961 gene locus_tag LOCUS_00110 7374 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8956 7739 gene locus_tag LOCUS_00120 8956 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9275 8940 gene locus_tag LOCUS_00130 9275 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9786 9397 gene locus_tag LOCUS_00140 9786 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10056 9853 gene locus_tag LOCUS_00150 10056 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 10359 11204 gene locus_tag LOCUS_00160 10359 11204 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_00160 11325 12260 gene locus_tag LOCUS_00170 gene queG 11325 12260 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_00170 12335 13294 gene locus_tag LOCUS_00180 gene trxB 12335 13294 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_00180 13699 13349 gene locus_tag LOCUS_00190 13699 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13875 14441 gene locus_tag LOCUS_00200 gene sigW 13875 14441 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_00200 14441 14944 gene locus_tag LOCUS_00210 14441 14944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 15073 15984 gene locus_tag LOCUS_00220 gene era 15073 15984 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_00220 16009 16914 gene locus_tag LOCUS_00230 16009 16914 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_00230 16907 17188 gene locus_tag LOCUS_00240 16907 17188 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534971.1 protein_id gnl|my_center|LOCUS_00240 17717 18094 gene locus_tag LOCUS_00250 17717 18094 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_00250 18610 19107 gene locus_tag LOCUS_00260 gene ispF 18610 19107 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_00260 19100 19708 gene locus_tag LOCUS_00270 19100 19708 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932641.1 protein_id gnl|my_center|LOCUS_00270 19705 21357 gene locus_tag LOCUS_00280 gene lnt 19705 21357 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_00280 21391 22413 gene locus_tag LOCUS_00290 21391 22413 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_00290 22526 22975 gene locus_tag LOCUS_00300 22526 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 23079 23768 gene locus_tag LOCUS_00310 23079 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 23775 24860 gene locus_tag LOCUS_00320 23775 24860 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_00320 24851 25681 gene locus_tag LOCUS_00330 24851 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 28182 25768 gene locus_tag LOCUS_00340 28182 25768 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583480.1 protein_id gnl|my_center|LOCUS_00340 29102 30310 gene locus_tag LOCUS_00350 29102 30310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 30342 30800 gene locus_tag LOCUS_00360 30342 30800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30851 32191 gene locus_tag LOCUS_00370 gene tssK 30851 32191 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027548748.1 protein_id gnl|my_center|LOCUS_00370 32231 32923 gene locus_tag LOCUS_00380 gene icmH 32231 32923 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206369.1 protein_id gnl|my_center|LOCUS_00380 32966 36487 gene locus_tag LOCUS_00390 gene tssM 32966 36487 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206361.1 protein_id gnl|my_center|LOCUS_00390 36491 37438 gene locus_tag LOCUS_00400 36491 37438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 37471 39174 gene locus_tag LOCUS_00410 37471 39174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39176 39691 gene locus_tag LOCUS_00420 gene tssB 39176 39691 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_00420 39734 41203 gene locus_tag LOCUS_00430 gene tssC 39734 41203 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640195.1 protein_id gnl|my_center|LOCUS_00430 41259 41726 gene locus_tag LOCUS_00440 41259 41726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41916 42368 gene locus_tag LOCUS_00450 41916 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42368 44221 gene locus_tag LOCUS_00460 gene tssF 42368 44221 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480666.1 protein_id gnl|my_center|LOCUS_00460 44185 45204 gene locus_tag LOCUS_00470 gene tssG 44185 45204 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105487.1 protein_id gnl|my_center|LOCUS_00470 45306 47924 gene locus_tag LOCUS_00480 gene tssH 45306 47924 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_00480 47982 50099 gene locus_tag LOCUS_00490 47982 50099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50117 51193 gene locus_tag LOCUS_00500 50117 51193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51202 54456 gene locus_tag LOCUS_00510 51202 54456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54428 55579 gene locus_tag LOCUS_00520 54428 55579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55582 56445 gene locus_tag LOCUS_00530 55582 56445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56486 57508 gene locus_tag LOCUS_00540 56486 57508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 57414 58193 gene locus_tag LOCUS_00550 57414 58193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58195 58794 gene locus_tag LOCUS_00560 58195 58794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58825 60306 gene locus_tag LOCUS_00570 58825 60306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 60317 62206 gene locus_tag LOCUS_00580 60317 62206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62235 64601 gene locus_tag LOCUS_00590 62235 64601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64682 65503 gene locus_tag LOCUS_00600 64682 65503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65573 68074 gene locus_tag LOCUS_00610 65573 68074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 68254 68090 gene locus_tag LOCUS_00620 68254 68090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 68321 68821 gene locus_tag LOCUS_00630 68321 68821 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765100.1 protein_id gnl|my_center|LOCUS_00630 68904 69791 gene locus_tag LOCUS_00640 68904 69791 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_00640 69914 75178 gene locus_tag LOCUS_00650 69914 75178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75309 77537 gene locus_tag LOCUS_00660 gene purL 75309 77537 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_00660 77659 78519 gene locus_tag LOCUS_00670 77659 78519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 78522 79223 gene locus_tag LOCUS_00680 78522 79223 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_00680 80293 79250 gene locus_tag LOCUS_00690 80293 79250 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_00690 80657 80884 gene locus_tag LOCUS_00700 80657 80884 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_00700 80897 81700 gene locus_tag LOCUS_00710 80897 81700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81707 82972 gene locus_tag LOCUS_00720 81707 82972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_00720 82977 83279 gene locus_tag LOCUS_00730 82977 83279 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_00730 83283 83738 gene locus_tag LOCUS_00740 83283 83738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83738 83980 gene locus_tag LOCUS_00750 83738 83980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 83994 85400 gene locus_tag LOCUS_00760 83994 85400 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887595.1 protein_id gnl|my_center|LOCUS_00760 85529 85834 gene locus_tag LOCUS_00770 85529 85834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 85847 86578 gene locus_tag LOCUS_00780 gene ric 85847 86578 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_00780 86646 87110 gene locus_tag LOCUS_00790 86646 87110 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_00790 87225 87605 gene locus_tag LOCUS_00800 87225 87605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87786 88247 gene locus_tag LOCUS_00810 87786 88247 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313306.1 protein_id gnl|my_center|LOCUS_00810 88295 88966 gene locus_tag LOCUS_00820 88295 88966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 89003 89359 gene locus_tag LOCUS_00830 89003 89359 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_00830 91257 89449 gene locus_tag LOCUS_00840 91257 89449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 92264 91275 gene locus_tag LOCUS_00850 92264 91275 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_00850 93320 92520 gene locus_tag LOCUS_00860 93320 92520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94138 94635 gene locus_tag LOCUS_00870 94138 94635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94675 95019 gene locus_tag LOCUS_00880 94675 95019 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_00880 95220 95966 gene locus_tag LOCUS_00890 95220 95966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95987 96772 gene locus_tag LOCUS_00900 95987 96772 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_00900 97502 96930 gene locus_tag LOCUS_00910 97502 96930 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_00910 99367 97739 gene locus_tag LOCUS_00920 99367 97739 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_00920 100510 99611 gene locus_tag LOCUS_00930 100510 99611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101070 102752 gene locus_tag LOCUS_00940 101070 102752 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00940 103380 102844 gene locus_tag LOCUS_00950 103380 102844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 104633 103398 gene locus_tag LOCUS_00960 104633 103398 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_00960 105179 105388 gene locus_tag LOCUS_00970 105179 105388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 105401 105907 gene locus_tag LOCUS_00980 105401 105907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106049 106537 gene locus_tag LOCUS_00990 106049 106537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106558 108516 gene locus_tag LOCUS_01000 gene nosZ 106558 108516 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_01000 108570 109148 gene locus_tag LOCUS_01010 108570 109148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 109141 109590 gene locus_tag LOCUS_01020 109141 109590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 109591 110835 gene locus_tag LOCUS_01030 109591 110835 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_01030 110832 111548 gene locus_tag LOCUS_01040 110832 111548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895282.1 protein_id gnl|my_center|LOCUS_01040 111539 112327 gene locus_tag LOCUS_01050 111539 112327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112340 112759 gene locus_tag LOCUS_01060 112340 112759 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_01060 113618 113016 gene locus_tag LOCUS_01070 113618 113016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 113970 113647 gene locus_tag LOCUS_01080 113970 113647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 114198 114482 gene locus_tag LOCUS_01090 114198 114482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 114855 115739 gene locus_tag LOCUS_01100 114855 115739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 115767 119375 gene locus_tag LOCUS_01110 115767 119375 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729051.1 protein_id gnl|my_center|LOCUS_01110 119596 121146 gene locus_tag LOCUS_01120 gene narH 119596 121146 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_01120 121194 121673 gene locus_tag LOCUS_01130 121194 121673 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_01130 121676 122335 gene locus_tag LOCUS_01140 121676 122335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 122345 123073 gene locus_tag LOCUS_01150 gene narI 122345 123073 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 protein_id gnl|my_center|LOCUS_01150 123117 124598 gene locus_tag LOCUS_01160 123117 124598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 125807 124755 gene locus_tag LOCUS_01170 125807 124755 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_01170 126123 127004 gene locus_tag LOCUS_01180 126123 127004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 127064 128932 gene locus_tag LOCUS_01190 127064 128932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01190 129006 129647 gene locus_tag LOCUS_01200 129006 129647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 129640 130728 gene locus_tag LOCUS_01210 129640 130728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 130765 131394 gene locus_tag LOCUS_01220 130765 131394 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_01220 132465 131527 gene locus_tag LOCUS_01230 132465 131527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 133449 133009 gene locus_tag LOCUS_01240 133449 133009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 134767 133493 gene locus_tag LOCUS_01250 134767 133493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 135108 135485 gene locus_tag LOCUS_01260 135108 135485 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_01260 135519 136631 gene locus_tag LOCUS_01270 135519 136631 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271909.1 protein_id gnl|my_center|LOCUS_01270 136964 137554 gene locus_tag LOCUS_01280 gene nrfH 136964 137554 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_01280 137583 139079 gene locus_tag LOCUS_01290 gene nrfA 137583 139079 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_01290 139318 139737 gene locus_tag LOCUS_01300 139318 139737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 139884 141137 gene locus_tag LOCUS_01310 139884 141137 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_01310 141327 143012 gene locus_tag LOCUS_01320 141327 143012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 143118 146282 gene locus_tag LOCUS_01330 143118 146282 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706761.1 protein_id gnl|my_center|LOCUS_01330 146551 146961 gene locus_tag LOCUS_01340 146551 146961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 147115 147534 gene locus_tag LOCUS_01350 147115 147534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 147754 148125 gene locus_tag LOCUS_01360 147754 148125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 148449 148934 gene locus_tag LOCUS_01370 148449 148934 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_01370 149034 149504 gene locus_tag LOCUS_01380 149034 149504 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403602.1 protein_id gnl|my_center|LOCUS_01380 149624 150895 gene locus_tag LOCUS_01390 gene hisS 149624 150895 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_01390 150922 151353 gene locus_tag LOCUS_01400 150922 151353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 151537 152268 gene locus_tag LOCUS_01410 gene rlmB 151537 152268 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_01410 152329 154188 gene locus_tag LOCUS_01420 152329 154188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 154264 156660 gene locus_tag LOCUS_01430 154264 156660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence002 929 105 gene locus_tag LOCUS_01440 929 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 2402 1059 gene locus_tag LOCUS_01450 2402 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030565.1 protein_id gnl|my_center|LOCUS_01450 3825 2482 gene locus_tag LOCUS_01460 3825 2482 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_01460 4558 3860 gene locus_tag LOCUS_01470 4558 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5573 4539 gene locus_tag LOCUS_01480 5573 4539 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_01480 6570 5560 gene locus_tag LOCUS_01490 6570 5560 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_01490 7495 6563 gene locus_tag LOCUS_01500 7495 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 8831 7470 gene locus_tag LOCUS_01510 gene gabT 8831 7470 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_01510 9696 8815 gene locus_tag LOCUS_01520 9696 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10695 9733 gene locus_tag LOCUS_01530 10695 9733 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_01530 11473 10682 gene locus_tag LOCUS_01540 11473 10682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932018.1 protein_id gnl|my_center|LOCUS_01540 12243 11458 gene locus_tag LOCUS_01550 12243 11458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932019.1 protein_id gnl|my_center|LOCUS_01550 12941 12240 gene locus_tag LOCUS_01560 12941 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 13462 12977 gene locus_tag LOCUS_01570 13462 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 14647 13547 gene locus_tag LOCUS_01580 14647 13547 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695909.1 protein_id gnl|my_center|LOCUS_01580 15086 14676 gene locus_tag LOCUS_01590 15086 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16850 15504 gene locus_tag LOCUS_01600 16850 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17627 17082 gene locus_tag LOCUS_01610 17627 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 18900 17770 gene locus_tag LOCUS_01620 18900 17770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_01620 20035 18902 gene locus_tag LOCUS_01630 20035 18902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_01630 20966 20037 gene locus_tag LOCUS_01640 20966 20037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_01640 22279 20966 gene locus_tag LOCUS_01650 22279 20966 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_01650 23219 22311 gene locus_tag LOCUS_01660 23219 22311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_01660 24202 23237 gene locus_tag LOCUS_01670 24202 23237 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_01670 24837 24199 gene locus_tag LOCUS_01680 24837 24199 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_01680 25477 24893 gene locus_tag LOCUS_01690 25477 24893 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_01690 26807 25677 gene locus_tag LOCUS_01700 26807 25677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_01700 28045 26915 gene locus_tag LOCUS_01710 28045 26915 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_01710 28973 28038 gene locus_tag LOCUS_01720 28973 28038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_01720 29355 28996 gene locus_tag LOCUS_01730 29355 28996 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_01730 30762 29446 gene locus_tag LOCUS_01740 30762 29446 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_01740 31691 30777 gene locus_tag LOCUS_01750 31691 30777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_01750 32150 31767 gene locus_tag LOCUS_01760 32150 31767 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180982954.1 protein_id gnl|my_center|LOCUS_01760 33196 32225 gene locus_tag LOCUS_01770 33196 32225 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_01770 33795 33193 gene locus_tag LOCUS_01780 33795 33193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_01780 33912 34307 gene locus_tag LOCUS_01790 33912 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 34401 35495 gene locus_tag LOCUS_01800 34401 35495 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583703.1 protein_id gnl|my_center|LOCUS_01800 35501 36355 gene locus_tag LOCUS_01810 35501 36355 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_01810 36352 37764 gene locus_tag LOCUS_01820 36352 37764 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_01820 37812 38924 gene locus_tag LOCUS_01830 37812 38924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 38983 39846 gene locus_tag LOCUS_01840 38983 39846 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619235.1 protein_id gnl|my_center|LOCUS_01840 39849 42308 gene locus_tag LOCUS_01850 39849 42308 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_01850 42332 45076 gene locus_tag LOCUS_01860 42332 45076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 45096 46091 gene locus_tag LOCUS_01870 gene porV 45096 46091 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_01870 46095 47309 gene locus_tag LOCUS_01880 46095 47309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 47316 49364 gene locus_tag LOCUS_01890 47316 49364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 49424 50854 gene locus_tag LOCUS_01900 49424 50854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 51032 52171 gene locus_tag LOCUS_01910 51032 52171 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_01910 52177 53190 gene locus_tag LOCUS_01920 gene dcyD 52177 53190 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_01920 53352 54806 gene locus_tag LOCUS_01930 53352 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 54925 56022 gene locus_tag LOCUS_01940 gene menC 54925 56022 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398737.1 protein_id gnl|my_center|LOCUS_01940 56164 56664 gene locus_tag LOCUS_01950 56164 56664 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_01950 57397 56933 gene locus_tag LOCUS_01960 57397 56933 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903188.1 protein_id gnl|my_center|LOCUS_01960 57987 57454 gene locus_tag LOCUS_01970 57987 57454 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_01970 58368 58048 gene locus_tag LOCUS_01980 58368 58048 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_01980 58851 58390 gene locus_tag LOCUS_01990 58851 58390 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_01990 60107 58848 gene locus_tag LOCUS_02000 60107 58848 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_02000 61434 60118 gene locus_tag LOCUS_02010 gene sufD 61434 60118 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_02010 62246 61479 gene locus_tag LOCUS_02020 gene sufC 62246 61479 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_02020 63816 62368 gene locus_tag LOCUS_02030 gene sufB 63816 62368 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_02030 64298 64225 gene locus_tag LOCUS_t00010 64298 64225 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67091 64401 gene locus_tag LOCUS_02040 67091 64401 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_02040 68136 67096 gene locus_tag LOCUS_02050 68136 67096 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_02050 68754 68137 gene locus_tag LOCUS_02060 gene darT 68754 68137 CDS product toxin-antitoxin system toxin DarT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400548.1 protein_id gnl|my_center|LOCUS_02060 69974 68814 gene locus_tag LOCUS_02070 69974 68814 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_02070 72615 69976 gene locus_tag LOCUS_02080 72615 69976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_02080 74648 72627 gene locus_tag LOCUS_02090 74648 72627 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804178.1 protein_id gnl|my_center|LOCUS_02090 75526 74741 gene locus_tag LOCUS_02100 75526 74741 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_02100 76475 75570 gene locus_tag LOCUS_02110 gene rfbD 76475 75570 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_02110 77342 76491 gene locus_tag LOCUS_02120 77342 76491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 77468 78595 gene locus_tag LOCUS_02130 gene bshA 77468 78595 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_02130 78597 79019 gene locus_tag LOCUS_02140 78597 79019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 79016 79444 gene locus_tag LOCUS_02150 79016 79444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 79444 80877 gene locus_tag LOCUS_02160 79444 80877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 82319 80880 gene locus_tag LOCUS_02170 82319 80880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 82481 84187 gene locus_tag LOCUS_02180 gene sulP 82481 84187 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_02180 87047 84270 gene locus_tag LOCUS_02190 gene uvrA 87047 84270 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_02190 88150 87125 gene locus_tag LOCUS_02200 88150 87125 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_02200 88908 88150 gene locus_tag LOCUS_02210 88908 88150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_02210 89724 88918 gene locus_tag LOCUS_02220 89724 88918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_02220 90197 89832 gene locus_tag LOCUS_02230 90197 89832 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_02230 90823 90194 gene locus_tag LOCUS_02240 90823 90194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 91662 90820 gene locus_tag LOCUS_02250 91662 90820 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_02250 92476 92273 gene locus_tag LOCUS_02260 92476 92273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 94411 92645 gene locus_tag LOCUS_02270 94411 92645 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404845.1 protein_id gnl|my_center|LOCUS_02270 95360 94389 gene locus_tag LOCUS_02280 95360 94389 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468897.1 protein_id gnl|my_center|LOCUS_02280 96676 95390 gene locus_tag LOCUS_02290 96676 95390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 97980 96676 gene locus_tag LOCUS_02300 gene rimO 97980 96676 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_02300 98821 98000 gene locus_tag LOCUS_02310 98821 98000 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_02310 99144 98818 gene locus_tag LOCUS_02320 99144 98818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 100151 99156 gene locus_tag LOCUS_02330 100151 99156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 100762 102111 gene locus_tag LOCUS_02340 gene miaB 100762 102111 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_02340 102200 102865 gene locus_tag LOCUS_02350 102200 102865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 102862 103650 gene locus_tag LOCUS_02360 102862 103650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 103714 104823 gene locus_tag LOCUS_02370 103714 104823 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_02370 104813 105346 gene locus_tag LOCUS_02380 104813 105346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 105365 106816 gene locus_tag LOCUS_02390 105365 106816 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_02390 106823 107518 gene locus_tag LOCUS_02400 106823 107518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 107562 108173 gene locus_tag LOCUS_02410 107562 108173 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_02410 108170 109210 gene locus_tag LOCUS_02420 108170 109210 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 protein_id gnl|my_center|LOCUS_02420 109211 110005 gene locus_tag LOCUS_02430 109211 110005 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_02430 110225 112117 gene locus_tag LOCUS_02440 110225 112117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 112294 112704 gene locus_tag LOCUS_02450 112294 112704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 112967 113422 gene locus_tag LOCUS_02460 112967 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 113429 115000 gene locus_tag LOCUS_02470 113429 115000 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_02470 115986 115318 gene locus_tag LOCUS_02480 gene rpiA 115986 115318 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 protein_id gnl|my_center|LOCUS_02480 116093 117298 gene locus_tag LOCUS_02490 116093 117298 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_02490 118584 117307 gene locus_tag LOCUS_02500 118584 117307 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_02500 118750 119124 gene locus_tag LOCUS_02510 118750 119124 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02510 119276 119127 gene locus_tag LOCUS_02520 119276 119127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 120854 119490 gene locus_tag LOCUS_02530 120854 119490 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_02530 122206 120947 gene locus_tag LOCUS_02540 122206 120947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 122812 122213 gene locus_tag LOCUS_02550 122812 122213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 123321 122821 gene locus_tag LOCUS_02560 123321 122821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 124190 123720 gene locus_tag LOCUS_02570 124190 123720 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840117.1 protein_id gnl|my_center|LOCUS_02570 124434 126536 gene locus_tag LOCUS_02580 124434 126536 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_02580 126641 127906 gene locus_tag LOCUS_02590 gene hflX 126641 127906 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933052.1 protein_id gnl|my_center|LOCUS_02590 127896 129461 gene locus_tag LOCUS_02600 gene hutH 127896 129461 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_02600 129478 129780 gene locus_tag LOCUS_02610 129478 129780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 129773 130849 gene locus_tag LOCUS_02620 129773 130849 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_02620 132624 131083 gene locus_tag LOCUS_02630 132624 131083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 133001 134527 gene locus_tag LOCUS_02640 gene hutH 133001 134527 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681759.1 protein_id gnl|my_center|LOCUS_02640 134558 134935 gene locus_tag LOCUS_02650 134558 134935 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_02650 134983 136317 gene locus_tag LOCUS_02660 134983 136317 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_02660 136879 136412 gene locus_tag LOCUS_02670 136879 136412 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence003 157 1092 gene locus_tag LOCUS_02680 gene murQ 157 1092 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_02680 1229 2872 gene locus_tag LOCUS_02690 1229 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2999 4582 gene locus_tag LOCUS_02700 2999 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4799 7591 gene locus_tag LOCUS_02710 4799 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 7608 11084 gene locus_tag LOCUS_02720 7608 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11106 12119 gene locus_tag LOCUS_02730 11106 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13998 12370 gene locus_tag LOCUS_02740 13998 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 15558 13999 gene locus_tag LOCUS_02750 15558 13999 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_02750 16441 15626 gene locus_tag LOCUS_02760 16441 15626 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_02760 17310 16459 gene locus_tag LOCUS_02770 17310 16459 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_02770 17618 17352 gene locus_tag LOCUS_02780 17618 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 17742 19424 gene locus_tag LOCUS_02790 17742 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 19693 21690 gene locus_tag LOCUS_02800 19693 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 21896 22147 gene locus_tag LOCUS_02810 21896 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 22232 25063 gene locus_tag LOCUS_02820 22232 25063 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_02820 28416 25324 gene locus_tag LOCUS_02830 28416 25324 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868786.1 protein_id gnl|my_center|LOCUS_02830 29475 28429 gene locus_tag LOCUS_02840 gene czcB 29475 28429 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_02840 30949 29510 gene locus_tag LOCUS_02850 30949 29510 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_02850 31248 32687 gene locus_tag LOCUS_02860 31248 32687 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942268.1 protein_id gnl|my_center|LOCUS_02860 32680 33999 gene locus_tag LOCUS_02870 32680 33999 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085032097.1 protein_id gnl|my_center|LOCUS_02870 35274 34012 gene locus_tag LOCUS_02880 gene lysA 35274 34012 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_02880 37231 35339 gene locus_tag LOCUS_02890 37231 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 37362 38849 gene locus_tag LOCUS_02900 37362 38849 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_02900 38885 39802 gene locus_tag LOCUS_02910 38885 39802 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_02910 39849 41144 gene locus_tag LOCUS_02920 39849 41144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_02920 41195 43300 gene locus_tag LOCUS_02930 41195 43300 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_02930 44563 43373 gene locus_tag LOCUS_02940 44563 43373 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_02940 45994 44579 gene locus_tag LOCUS_02950 45994 44579 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_02950 46161 47297 gene locus_tag LOCUS_02960 46161 47297 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_02960 49554 47362 gene locus_tag LOCUS_02970 49554 47362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 50529 49786 gene locus_tag LOCUS_02980 50529 49786 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_02980 52043 50547 gene locus_tag LOCUS_02990 52043 50547 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_02990 54190 52121 gene locus_tag LOCUS_03000 54190 52121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 54691 54350 gene locus_tag LOCUS_03010 54691 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 55314 54955 gene locus_tag LOCUS_03020 55314 54955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 56895 55540 gene locus_tag LOCUS_03030 56895 55540 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03030 58332 56908 gene locus_tag LOCUS_03040 58332 56908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 58456 58938 gene locus_tag LOCUS_03050 58456 58938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 58958 59728 gene locus_tag LOCUS_03060 58958 59728 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466253.1 protein_id gnl|my_center|LOCUS_03060 59789 60187 gene locus_tag LOCUS_03070 59789 60187 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090571.1 protein_id gnl|my_center|LOCUS_03070 61598 60180 gene locus_tag LOCUS_03080 61598 60180 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449553.1 protein_id gnl|my_center|LOCUS_03080 62514 61606 gene locus_tag LOCUS_03090 62514 61606 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_03090 63347 62514 gene locus_tag LOCUS_03100 gene menB 63347 62514 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_03100 64179 63358 gene locus_tag LOCUS_03110 gene menH 64179 63358 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_03110 65941 64169 gene locus_tag LOCUS_03120 gene menD 65941 64169 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_03120 67307 65925 gene locus_tag LOCUS_03130 67307 65925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 68162 67380 gene locus_tag LOCUS_03140 gene rsgA 68162 67380 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_03140 69832 68411 gene locus_tag LOCUS_03150 69832 68411 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405255.1 protein_id gnl|my_center|LOCUS_03150 70356 69835 gene locus_tag LOCUS_03160 70356 69835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 71570 70362 gene locus_tag LOCUS_03170 71570 70362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 72506 71730 gene locus_tag LOCUS_03180 72506 71730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 73125 72748 gene locus_tag LOCUS_03190 73125 72748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 74039 73122 gene locus_tag LOCUS_03200 74039 73122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 74212 75981 gene locus_tag LOCUS_03210 74212 75981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 75978 76760 gene locus_tag LOCUS_03220 75978 76760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 76754 78004 gene locus_tag LOCUS_03230 76754 78004 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_03230 78014 79279 gene locus_tag LOCUS_03240 78014 79279 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_03240 79276 80379 gene locus_tag LOCUS_03250 gene glf 79276 80379 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639966.1 protein_id gnl|my_center|LOCUS_03250 80369 81319 gene locus_tag LOCUS_03260 80369 81319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 81321 82211 gene locus_tag LOCUS_03270 81321 82211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 82265 83266 gene locus_tag LOCUS_03280 82265 83266 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221227.1 protein_id gnl|my_center|LOCUS_03280 83263 84228 gene locus_tag LOCUS_03290 83263 84228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 84245 85189 gene locus_tag LOCUS_03300 84245 85189 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_03300 85182 85919 gene locus_tag LOCUS_03310 85182 85919 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930429.1 protein_id gnl|my_center|LOCUS_03310 85921 91266 gene locus_tag LOCUS_03320 85921 91266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 91289 92632 gene locus_tag LOCUS_03330 91289 92632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 92780 93490 gene locus_tag LOCUS_03340 92780 93490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 94017 94415 gene locus_tag LOCUS_03350 94017 94415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 95178 94537 gene locus_tag LOCUS_03360 gene ppaX 95178 94537 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_03360 96955 95180 gene locus_tag LOCUS_03370 96955 95180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 97290 99008 gene locus_tag LOCUS_03380 97290 99008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 99392 100870 gene locus_tag LOCUS_03390 99392 100870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence004 864 109 gene locus_tag LOCUS_03400 864 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2570 945 gene locus_tag LOCUS_03410 2570 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 3073 2615 gene locus_tag LOCUS_03420 3073 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6662 3090 gene locus_tag LOCUS_03430 gene addA 6662 3090 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154921.1 protein_id gnl|my_center|LOCUS_03430 10493 6666 gene locus_tag LOCUS_03440 10493 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 10936 10493 gene locus_tag LOCUS_03450 10936 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 11821 11012 gene locus_tag LOCUS_03460 11821 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 13266 11974 gene locus_tag LOCUS_03470 13266 11974 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_03470 14208 13288 gene locus_tag LOCUS_03480 14208 13288 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_03480 14765 14214 gene locus_tag LOCUS_03490 gene pyrR 14765 14214 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_03490 14972 15047 gene locus_tag LOCUS_t00020 14972 15047 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15067 15564 gene locus_tag LOCUS_03500 15067 15564 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_03500 17262 15598 gene locus_tag LOCUS_03510 17262 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 17429 17623 gene locus_tag LOCUS_03520 17429 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 17888 17691 gene locus_tag LOCUS_03530 17888 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 19223 17934 gene locus_tag LOCUS_03540 19223 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 20494 19244 gene locus_tag LOCUS_03550 gene ftsA 20494 19244 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015601.1 protein_id gnl|my_center|LOCUS_03550 21261 20494 gene locus_tag LOCUS_03560 21261 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22634 21267 gene locus_tag LOCUS_03570 gene murC 22634 21267 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_03570 23114 22635 gene locus_tag LOCUS_03580 23114 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 24211 23111 gene locus_tag LOCUS_03590 gene murG 24211 23111 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_03590 25368 24208 gene locus_tag LOCUS_03600 25368 24208 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931729.1 protein_id gnl|my_center|LOCUS_03600 26714 25365 gene locus_tag LOCUS_03610 gene murD 26714 25365 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_03610 27825 26716 gene locus_tag LOCUS_03620 gene mraY 27825 26716 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_03620 29213 27825 gene locus_tag LOCUS_03630 29213 27825 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_03630 30679 29213 gene locus_tag LOCUS_03640 30679 29213 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_03640 32598 30679 gene locus_tag LOCUS_03650 32598 30679 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_03650 32989 32657 gene locus_tag LOCUS_03660 32989 32657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 33909 32986 gene locus_tag LOCUS_03670 gene rsmH 33909 32986 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 protein_id gnl|my_center|LOCUS_03670 34346 33906 gene locus_tag LOCUS_03680 gene mraZ 34346 33906 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_03680 34748 35812 gene locus_tag LOCUS_03690 34748 35812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 35793 36470 gene locus_tag LOCUS_03700 35793 36470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_03700 36571 37035 gene locus_tag LOCUS_03710 36571 37035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 37038 37619 gene locus_tag LOCUS_03720 37038 37619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 37952 38299 gene locus_tag LOCUS_03730 37952 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 38532 38930 gene locus_tag LOCUS_03740 38532 38930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 39007 39498 gene locus_tag LOCUS_03750 39007 39498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 40091 39546 gene locus_tag LOCUS_03760 40091 39546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 43195 40427 gene locus_tag LOCUS_03770 43195 40427 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_03770 43829 43347 gene locus_tag LOCUS_03780 43829 43347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_03780 44536 43829 gene locus_tag LOCUS_03790 44536 43829 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_03790 45202 44543 gene locus_tag LOCUS_03800 45202 44543 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_03800 46294 45203 gene locus_tag LOCUS_03810 46294 45203 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_03810 49029 46396 gene locus_tag LOCUS_03820 49029 46396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 49366 49293 gene locus_tag LOCUS_t00030 49366 49293 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 50256 49549 gene locus_tag LOCUS_03830 50256 49549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 50561 50262 gene locus_tag LOCUS_03840 50561 50262 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_03840 50810 51157 gene locus_tag LOCUS_03850 50810 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 51278 51475 gene locus_tag LOCUS_03860 51278 51475 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545426.1 protein_id gnl|my_center|LOCUS_03860 51482 53710 gene locus_tag LOCUS_03870 51482 53710 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_03870 54781 53768 gene locus_tag LOCUS_03880 54781 53768 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_03880 56640 54799 gene locus_tag LOCUS_03890 gene pepF 56640 54799 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_03890 57770 56697 gene locus_tag LOCUS_03900 57770 56697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 58264 57890 gene locus_tag LOCUS_03910 58264 57890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 58502 59938 gene locus_tag LOCUS_03920 gene gatB 58502 59938 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_03920 60026 60970 gene locus_tag LOCUS_03930 gene lepB 60026 60970 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_03930 63048 61090 gene locus_tag LOCUS_03940 63048 61090 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_03940 66256 63119 gene locus_tag LOCUS_03950 gene addB 66256 63119 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989937.1 protein_id gnl|my_center|LOCUS_03950 66442 67095 gene locus_tag LOCUS_03960 66442 67095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 67640 67101 gene locus_tag LOCUS_03970 67640 67101 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_03970 67745 69151 gene locus_tag LOCUS_03980 67745 69151 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_03980 69216 69794 gene locus_tag LOCUS_03990 69216 69794 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_03990 69807 70652 gene locus_tag LOCUS_04000 69807 70652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 70672 71127 gene locus_tag LOCUS_04010 70672 71127 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_04010 71202 71612 gene locus_tag LOCUS_04020 71202 71612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 71613 71807 gene locus_tag LOCUS_04030 gene rpsU 71613 71807 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_04030 72510 71881 gene locus_tag LOCUS_04040 72510 71881 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_04040 73436 72576 gene locus_tag LOCUS_04050 73436 72576 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_04050 73567 74829 gene locus_tag LOCUS_04060 gene dacB 73567 74829 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_04060 75188 74850 gene locus_tag LOCUS_04070 75188 74850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 75283 75209 gene locus_tag LOCUS_t00040 75283 75209 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 76328 75339 gene locus_tag LOCUS_04080 gene obgE 76328 75339 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_04080 78127 76328 gene locus_tag LOCUS_04090 78127 76328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 79019 78249 gene locus_tag LOCUS_04100 79019 78249 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_04100 80929 79019 gene locus_tag LOCUS_04110 80929 79019 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_04110 81600 80929 gene locus_tag LOCUS_04120 81600 80929 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 protein_id gnl|my_center|LOCUS_04120 82191 84179 gene locus_tag LOCUS_04130 82191 84179 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_04130 84361 84897 gene locus_tag LOCUS_04140 84361 84897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_04140 86048 84990 gene locus_tag LOCUS_04150 86048 84990 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174672.1 protein_id gnl|my_center|LOCUS_04150 86131 86967 gene locus_tag LOCUS_04160 86131 86967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 87076 87633 gene locus_tag LOCUS_04170 87076 87633 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124945.1 protein_id gnl|my_center|LOCUS_04170 88442 87720 gene locus_tag LOCUS_04180 88442 87720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 88576 88926 gene locus_tag LOCUS_04190 88576 88926 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_04190 89435 89007 gene locus_tag LOCUS_04200 89435 89007 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_04200 90144 89506 gene locus_tag LOCUS_04210 90144 89506 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650034.1 protein_id gnl|my_center|LOCUS_04210 91603 90179 gene locus_tag LOCUS_04220 91603 90179 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210798.1 protein_id gnl|my_center|LOCUS_04220 92132 92518 gene locus_tag LOCUS_04230 92132 92518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence005 202 480 gene locus_tag LOCUS_04240 202 480 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891625.1 protein_id gnl|my_center|LOCUS_04240 485 1345 gene locus_tag LOCUS_04250 485 1345 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986620.1 protein_id gnl|my_center|LOCUS_04250 1448 2269 gene locus_tag LOCUS_04260 1448 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2307 2930 gene locus_tag LOCUS_04270 gene tmk 2307 2930 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_04270 2927 4588 gene locus_tag LOCUS_04280 2927 4588 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933908.1 protein_id gnl|my_center|LOCUS_04280 5147 5719 gene locus_tag LOCUS_04290 5147 5719 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_04290 5746 5922 gene locus_tag LOCUS_04300 5746 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5915 9007 gene locus_tag LOCUS_04310 5915 9007 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_04310 9007 10383 gene locus_tag LOCUS_04320 gene nrfD 9007 10383 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_04320 10376 11542 gene locus_tag LOCUS_04330 10376 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 11529 12719 gene locus_tag LOCUS_04340 11529 12719 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_04340 12745 13677 gene locus_tag LOCUS_04350 12745 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13716 14480 gene locus_tag LOCUS_04360 13716 14480 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_04360 14489 16150 gene locus_tag LOCUS_04370 gene ctaD 14489 16150 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940894.1 protein_id gnl|my_center|LOCUS_04370 16147 16767 gene locus_tag LOCUS_04380 16147 16767 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_04380 16786 17091 gene locus_tag LOCUS_04390 16786 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 17094 17717 gene locus_tag LOCUS_04400 17094 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 17736 18599 gene locus_tag LOCUS_04410 17736 18599 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939098.1 protein_id gnl|my_center|LOCUS_04410 18618 19940 gene locus_tag LOCUS_04420 18618 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 21501 19987 gene locus_tag LOCUS_04430 21501 19987 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_04430 22606 21506 gene locus_tag LOCUS_04440 22606 21506 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_04440 24117 22696 gene locus_tag LOCUS_04450 24117 22696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 24820 24200 gene locus_tag LOCUS_04460 gene clpP 24820 24200 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_04460 26126 24810 gene locus_tag LOCUS_04470 gene tig 26126 24810 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405385.1 protein_id gnl|my_center|LOCUS_04470 26254 26171 gene locus_tag LOCUS_t00050 26254 26171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26493 27221 gene locus_tag LOCUS_04480 26493 27221 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811803.1 protein_id gnl|my_center|LOCUS_04480 27218 29164 gene locus_tag LOCUS_04490 27218 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 29281 31422 gene locus_tag LOCUS_04500 29281 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 31406 32827 gene locus_tag LOCUS_04510 31406 32827 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_04510 33254 32832 gene locus_tag LOCUS_04520 33254 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 33526 34827 gene locus_tag LOCUS_04530 33526 34827 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933015.1 protein_id gnl|my_center|LOCUS_04530 34853 36145 gene locus_tag LOCUS_04540 34853 36145 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_04540 36161 36880 gene locus_tag LOCUS_04550 36161 36880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_04550 36955 38190 gene locus_tag LOCUS_04560 36955 38190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_04560 38208 39434 gene locus_tag LOCUS_04570 38208 39434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_04570 41488 39485 gene locus_tag LOCUS_04580 41488 39485 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838897.1 protein_id gnl|my_center|LOCUS_04580 42343 41489 gene locus_tag LOCUS_04590 42343 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 42417 43295 gene locus_tag LOCUS_04600 42417 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 45288 43297 gene locus_tag LOCUS_04610 45288 43297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 46428 45307 gene locus_tag LOCUS_04620 46428 45307 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_04620 47684 46494 gene locus_tag LOCUS_04630 47684 46494 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927123.1 protein_id gnl|my_center|LOCUS_04630 47791 48783 gene locus_tag LOCUS_04640 47791 48783 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_04640 49199 48780 gene locus_tag LOCUS_04650 49199 48780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 49491 49564 gene locus_tag LOCUS_t00060 49491 49564 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 49639 51003 gene locus_tag LOCUS_04660 49639 51003 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981895.1 protein_id gnl|my_center|LOCUS_04660 51115 51519 gene locus_tag LOCUS_04670 51115 51519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 51694 52797 gene locus_tag LOCUS_04680 51694 52797 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162390.1 protein_id gnl|my_center|LOCUS_04680 52790 53368 gene locus_tag LOCUS_04690 52790 53368 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_04690 53368 54324 gene locus_tag LOCUS_04700 53368 54324 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_04700 54487 54903 gene locus_tag LOCUS_04710 54487 54903 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398549.1 protein_id gnl|my_center|LOCUS_04710 54913 55299 gene locus_tag LOCUS_04720 54913 55299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 55340 57433 gene locus_tag LOCUS_04730 gene fusA 55340 57433 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_04730 57592 58095 gene locus_tag LOCUS_04740 57592 58095 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_04740 58140 58685 gene locus_tag LOCUS_04750 58140 58685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 58739 58813 gene locus_tag LOCUS_t00070 58739 58813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60563 59022 gene locus_tag LOCUS_04760 60563 59022 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_04760 61283 64480 gene locus_tag LOCUS_04770 61283 64480 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014855724.1 protein_id gnl|my_center|LOCUS_04770 64535 66631 gene locus_tag LOCUS_04780 64535 66631 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_04780 66635 67906 gene locus_tag LOCUS_04790 66635 67906 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_04790 68262 68936 gene locus_tag LOCUS_04800 68262 68936 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016761.1 protein_id gnl|my_center|LOCUS_04800 68923 69591 gene locus_tag LOCUS_04810 68923 69591 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_04810 71380 69665 gene locus_tag LOCUS_04820 71380 69665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 73060 71417 gene locus_tag LOCUS_04830 73060 71417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 75265 73229 gene locus_tag LOCUS_04840 75265 73229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 75507 76802 gene locus_tag LOCUS_04850 gene asnS 75507 76802 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_04850 76841 77356 gene locus_tag LOCUS_04860 76841 77356 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_04860 77367 77672 gene locus_tag LOCUS_04870 gene nuoK 77367 77672 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_04870 77691 79628 gene locus_tag LOCUS_04880 gene nuoL 77691 79628 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_04880 79630 81180 gene locus_tag LOCUS_04890 79630 81180 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence006 212 1687 gene locus_tag LOCUS_04900 212 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 3750 2530 gene locus_tag LOCUS_04910 3750 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4170 3943 gene locus_tag LOCUS_04920 4170 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4762 4256 gene locus_tag LOCUS_04930 4762 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5031 4801 gene locus_tag LOCUS_04940 5031 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6270 5203 gene locus_tag LOCUS_04950 gene rsgA 6270 5203 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_04950 7372 6452 gene locus_tag LOCUS_04960 7372 6452 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_04960 8234 7374 gene locus_tag LOCUS_04970 8234 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 10064 8457 gene locus_tag LOCUS_04980 10064 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 11229 10669 gene locus_tag LOCUS_04990 11229 10669 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975929.1 protein_id gnl|my_center|LOCUS_04990 11650 11258 gene locus_tag LOCUS_05000 11650 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 12549 11674 gene locus_tag LOCUS_05010 12549 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 13505 13011 gene locus_tag LOCUS_05020 13505 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15278 13896 gene locus_tag LOCUS_05030 15278 13896 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_05030 16462 15611 gene locus_tag LOCUS_05040 16462 15611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_05040 17520 16495 gene locus_tag LOCUS_05050 17520 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 18513 17770 gene locus_tag LOCUS_05060 18513 17770 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108685.1 protein_id gnl|my_center|LOCUS_05060 21708 18595 gene locus_tag LOCUS_05070 21708 18595 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_05070 22785 21730 gene locus_tag LOCUS_05080 22785 21730 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_05080 24188 22806 gene locus_tag LOCUS_05090 24188 22806 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_05090 24788 24198 gene locus_tag LOCUS_05100 24788 24198 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_05100 26036 25038 gene locus_tag LOCUS_05110 26036 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 27000 26014 gene locus_tag LOCUS_05120 27000 26014 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_05120 27329 27177 gene locus_tag LOCUS_05130 27329 27177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 28977 27541 gene locus_tag LOCUS_05140 28977 27541 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876880.1 protein_id gnl|my_center|LOCUS_05140 29926 29222 gene locus_tag LOCUS_05150 29926 29222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 30856 30194 gene locus_tag LOCUS_05160 30856 30194 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496500.1 protein_id gnl|my_center|LOCUS_05160 31075 32091 gene locus_tag LOCUS_05170 31075 32091 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_05170 33391 32408 gene locus_tag LOCUS_05180 33391 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 34513 33656 gene locus_tag LOCUS_05190 34513 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 35798 34524 gene locus_tag LOCUS_05200 35798 34524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 36443 35823 gene locus_tag LOCUS_05210 36443 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 37535 36573 gene locus_tag LOCUS_05220 37535 36573 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_05220 39904 37811 gene locus_tag LOCUS_05230 39904 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 40123 39911 gene locus_tag LOCUS_05240 40123 39911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 41041 40394 gene locus_tag LOCUS_05250 41041 40394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 41699 41244 gene locus_tag LOCUS_05260 41699 41244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 42870 42067 gene locus_tag LOCUS_05270 42870 42067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 43841 42867 gene locus_tag LOCUS_05280 43841 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 45886 44144 gene locus_tag LOCUS_05290 45886 44144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 48369 46273 gene locus_tag LOCUS_05300 48369 46273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 48618 48406 gene locus_tag LOCUS_05310 48618 48406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 48951 48739 gene locus_tag LOCUS_05320 48951 48739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 49604 49029 gene locus_tag LOCUS_05330 49604 49029 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045220.1 protein_id gnl|my_center|LOCUS_05330 51479 49785 gene locus_tag LOCUS_05340 51479 49785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 54078 51610 gene locus_tag LOCUS_05350 54078 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 54504 54274 gene locus_tag LOCUS_05360 54504 54274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 54993 55808 gene locus_tag LOCUS_05370 gene kdsA 54993 55808 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931782.1 protein_id gnl|my_center|LOCUS_05370 55829 56800 gene locus_tag LOCUS_05380 55829 56800 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_05380 56833 57336 gene locus_tag LOCUS_05390 gene lptC 56833 57336 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986830.1 protein_id gnl|my_center|LOCUS_05390 57384 58718 gene locus_tag LOCUS_05400 57384 58718 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_05400 58724 59461 gene locus_tag LOCUS_05410 gene lptB 58724 59461 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_05410 60242 59523 gene locus_tag LOCUS_05420 60242 59523 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_05420 61702 60242 gene locus_tag LOCUS_05430 61702 60242 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_05430 62225 61692 gene locus_tag LOCUS_05440 62225 61692 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_05440 63184 62228 gene locus_tag LOCUS_05450 63184 62228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 63342 64385 gene locus_tag LOCUS_05460 63342 64385 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_05460 64957 64382 gene locus_tag LOCUS_05470 64957 64382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 65076 65918 gene locus_tag LOCUS_05480 65076 65918 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_05480 66982 66116 gene locus_tag LOCUS_05490 66982 66116 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_05490 67451 66960 gene locus_tag LOCUS_05500 67451 66960 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_05500 67903 67487 gene locus_tag LOCUS_05510 67903 67487 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_05510 68693 67977 gene locus_tag LOCUS_05520 68693 67977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 69171 68722 gene locus_tag LOCUS_05530 69171 68722 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_05530 71294 69240 gene locus_tag LOCUS_05540 gene feoB 71294 69240 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_05540 71523 71302 gene locus_tag LOCUS_05550 71523 71302 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668304.1 protein_id gnl|my_center|LOCUS_05550 72145 72678 gene locus_tag LOCUS_05560 72145 72678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 72687 75446 gene locus_tag LOCUS_05570 72687 75446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 77010 77951 gene locus_tag LOCUS_05580 77010 77951 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence007 189 692 gene locus_tag LOCUS_05590 189 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 860 696 gene locus_tag LOCUS_05600 860 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1007 2500 gene locus_tag LOCUS_05610 1007 2500 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067929.1 protein_id gnl|my_center|LOCUS_05610 2638 3300 gene locus_tag LOCUS_05620 gene plsY 2638 3300 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_05620 3300 4301 gene locus_tag LOCUS_05630 3300 4301 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_05630 5814 4438 gene locus_tag LOCUS_05640 5814 4438 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_05640 6668 5925 gene locus_tag LOCUS_05650 6668 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 6978 7358 gene locus_tag LOCUS_05660 6978 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7364 7837 gene locus_tag LOCUS_05670 gene nuoE 7364 7837 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874113.1 protein_id gnl|my_center|LOCUS_05670 7847 9082 gene locus_tag LOCUS_05680 7847 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 9082 10989 gene locus_tag LOCUS_05690 9082 10989 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_05690 11070 12458 gene locus_tag LOCUS_05700 11070 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12726 12427 gene locus_tag LOCUS_05710 12726 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 12922 13266 gene locus_tag LOCUS_05720 12922 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 13282 14373 gene locus_tag LOCUS_05730 13282 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 15783 14413 gene locus_tag LOCUS_05740 15783 14413 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_05740 17801 15780 gene locus_tag LOCUS_05750 17801 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 18068 18649 gene locus_tag LOCUS_05760 18068 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 18942 20300 gene locus_tag LOCUS_05770 18942 20300 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_05770 20627 21817 gene locus_tag LOCUS_05780 20627 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 21910 22053 gene locus_tag LOCUS_05790 21910 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 22173 22667 gene locus_tag LOCUS_05800 22173 22667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 23348 22728 gene locus_tag LOCUS_05810 gene pncA 23348 22728 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444893.1 protein_id gnl|my_center|LOCUS_05810 24771 23350 gene locus_tag LOCUS_05820 24771 23350 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444894.1 protein_id gnl|my_center|LOCUS_05820 25175 25417 gene locus_tag LOCUS_05830 25175 25417 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_05830 25440 26540 gene locus_tag LOCUS_05840 25440 26540 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_05840 26552 27328 gene locus_tag LOCUS_05850 26552 27328 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_05850 27354 27917 gene locus_tag LOCUS_05860 27354 27917 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_05860 27945 28214 gene locus_tag LOCUS_05870 27945 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 28368 28441 gene locus_tag LOCUS_t00080 28368 28441 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28580 28653 gene locus_tag LOCUS_t00090 28580 28653 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28699 28947 gene locus_tag LOCUS_05880 28699 28947 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_05880 29173 31248 gene locus_tag LOCUS_05890 29173 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 31425 33431 gene locus_tag LOCUS_05900 31425 33431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 33607 33816 gene locus_tag LOCUS_05910 33607 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 34266 33817 gene locus_tag LOCUS_05920 34266 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 34365 35840 gene locus_tag LOCUS_05930 34365 35840 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_05930 36712 35861 gene locus_tag LOCUS_05940 36712 35861 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_05940 37316 36720 gene locus_tag LOCUS_05950 37316 36720 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932940.1 protein_id gnl|my_center|LOCUS_05950 37561 38127 gene locus_tag LOCUS_05960 37561 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 38752 38168 gene locus_tag LOCUS_05970 gene gmhA 38752 38168 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_05970 39236 38754 gene locus_tag LOCUS_05980 39236 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 40005 39229 gene locus_tag LOCUS_05990 40005 39229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 40781 40023 gene locus_tag LOCUS_06000 40781 40023 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_06000 41490 40864 gene locus_tag LOCUS_06010 41490 40864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 42028 41504 gene locus_tag LOCUS_06020 gene nudF 42028 41504 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_06020 42539 42123 gene locus_tag LOCUS_06030 42539 42123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 44578 42542 gene locus_tag LOCUS_06040 44578 42542 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_06040 44798 45970 gene locus_tag LOCUS_06050 44798 45970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_06050 45997 46710 gene locus_tag LOCUS_06060 45997 46710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 46776 48248 gene locus_tag LOCUS_06070 gene rlmD 46776 48248 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_06070 48619 48257 gene locus_tag LOCUS_06080 48619 48257 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143969.1 protein_id gnl|my_center|LOCUS_06080 48852 48619 gene locus_tag LOCUS_06090 48852 48619 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096668979.1 protein_id gnl|my_center|LOCUS_06090 49736 49062 gene locus_tag LOCUS_06100 gene rsmI 49736 49062 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_06100 49974 52790 gene locus_tag LOCUS_06110 49974 52790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 52805 54790 gene locus_tag LOCUS_06120 52805 54790 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_06120 54811 56115 gene locus_tag LOCUS_06130 54811 56115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 56249 57961 gene locus_tag LOCUS_06140 gene recN 56249 57961 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_06140 58028 58939 gene locus_tag LOCUS_06150 58028 58939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839453.1 protein_id gnl|my_center|LOCUS_06150 58949 59491 gene locus_tag LOCUS_06160 58949 59491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 59559 60689 gene locus_tag LOCUS_06170 gene hemW 59559 60689 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_06170 60733 61956 gene locus_tag LOCUS_06180 60733 61956 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_06180 62001 64682 gene locus_tag LOCUS_06190 62001 64682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 69773 64749 gene locus_tag LOCUS_06200 69773 64749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 70032 70517 gene locus_tag LOCUS_06210 70032 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 70688 71737 gene locus_tag LOCUS_06220 70688 71737 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565746.1 protein_id gnl|my_center|LOCUS_06220 72270 71848 gene locus_tag LOCUS_06230 72270 71848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 73119 72313 gene locus_tag LOCUS_06240 73119 72313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence008 <1 1045 gene locus_tag LOCUS_06250 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396112.1:alanine racemase 1045 1908 gene locus_tag LOCUS_06260 1045 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1908 2975 gene locus_tag LOCUS_06270 1908 2975 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_06270 3088 3849 gene locus_tag LOCUS_06280 3088 3849 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933603.1 protein_id gnl|my_center|LOCUS_06280 3846 4763 gene locus_tag LOCUS_06290 3846 4763 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_06290 4764 6026 gene locus_tag LOCUS_06300 4764 6026 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_06300 6173 7426 gene locus_tag LOCUS_06310 gene rho 6173 7426 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_06310 7522 8802 gene locus_tag LOCUS_06320 7522 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8799 9791 gene locus_tag LOCUS_06330 gene pdxA 8799 9791 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838548.1 protein_id gnl|my_center|LOCUS_06330 9778 10509 gene locus_tag LOCUS_06340 9778 10509 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965668.1 protein_id gnl|my_center|LOCUS_06340 10509 11183 gene locus_tag LOCUS_06350 10509 11183 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932277.1 protein_id gnl|my_center|LOCUS_06350 11836 11177 gene locus_tag LOCUS_06360 11836 11177 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06360 12381 11902 gene locus_tag LOCUS_06370 gene tadA 12381 11902 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872231.1 protein_id gnl|my_center|LOCUS_06370 12690 13532 gene locus_tag LOCUS_06380 12690 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13799 13725 gene locus_tag LOCUS_t00100 13799 13725 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13920 15938 gene locus_tag LOCUS_06390 13920 15938 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 protein_id gnl|my_center|LOCUS_06390 16090 20238 gene locus_tag LOCUS_06400 16090 20238 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_06400 20482 20682 gene locus_tag LOCUS_06410 20482 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 20971 22821 gene locus_tag LOCUS_06420 20971 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 22854 24725 gene locus_tag LOCUS_06430 22854 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 24769 25290 gene locus_tag LOCUS_06440 24769 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 25501 26520 gene locus_tag LOCUS_06450 25501 26520 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862382.1 protein_id gnl|my_center|LOCUS_06450 27085 26594 gene locus_tag LOCUS_06460 27085 26594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 27212 28693 gene locus_tag LOCUS_06470 gene purF 27212 28693 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421582.1 protein_id gnl|my_center|LOCUS_06470 28683 32894 gene locus_tag LOCUS_06480 28683 32894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 32891 33463 gene locus_tag LOCUS_06490 gene pgsA 32891 33463 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_06490 33450 34376 gene locus_tag LOCUS_06500 gene ftsY 33450 34376 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_06500 34385 34588 gene locus_tag LOCUS_06510 34385 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36457 34628 gene locus_tag LOCUS_06520 36457 34628 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_06520 37557 36706 gene locus_tag LOCUS_06530 37557 36706 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_06530 38750 37572 gene locus_tag LOCUS_06540 38750 37572 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_06540 39952 38834 gene locus_tag LOCUS_06550 39952 38834 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_06550 40201 39980 gene locus_tag LOCUS_06560 40201 39980 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_06560 41146 40235 gene locus_tag LOCUS_06570 41146 40235 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_06570 42221 41208 gene locus_tag LOCUS_06580 gene hprK 42221 41208 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_06580 42520 42218 gene locus_tag LOCUS_06590 42520 42218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 43429 42536 gene locus_tag LOCUS_06600 gene xerC 43429 42536 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_06600 43956 43531 gene locus_tag LOCUS_06610 gene ybeY 43956 43531 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_06610 44538 43966 gene locus_tag LOCUS_06620 44538 43966 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_06620 45323 44511 gene locus_tag LOCUS_06630 45323 44511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 46927 45320 gene locus_tag LOCUS_06640 46927 45320 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_06640 48515 47004 gene locus_tag LOCUS_06650 gene lysS 48515 47004 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_06650 49978 48518 gene locus_tag LOCUS_06660 gene dacB 49978 48518 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_06660 50726 50019 gene locus_tag LOCUS_06670 50726 50019 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222207.1 protein_id gnl|my_center|LOCUS_06670 51345 50698 gene locus_tag LOCUS_06680 gene scpB 51345 50698 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_06680 52057 51338 gene locus_tag LOCUS_06690 52057 51338 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_06690 53037 52057 gene locus_tag LOCUS_06700 gene trpS 53037 52057 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931707.1 protein_id gnl|my_center|LOCUS_06700 53681 53091 gene locus_tag LOCUS_06710 53681 53091 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_06710 54273 53899 gene locus_tag LOCUS_06720 gene acpS 54273 53899 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_06720 55878 54283 gene locus_tag LOCUS_06730 gene ggt 55878 54283 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_06730 56875 55967 gene locus_tag LOCUS_06740 56875 55967 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_06740 57411 56986 gene locus_tag LOCUS_06750 57411 56986 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942796.1 protein_id gnl|my_center|LOCUS_06750 57747 58226 gene locus_tag LOCUS_06760 57747 58226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 58236 58829 gene locus_tag LOCUS_06770 58236 58829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 58839 60194 gene locus_tag LOCUS_06780 58839 60194 CDS product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583543.1 protein_id gnl|my_center|LOCUS_06780 60652 60248 gene locus_tag LOCUS_06790 60652 60248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 62205 60715 gene locus_tag LOCUS_06800 62205 60715 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_06800 63462 62221 gene locus_tag LOCUS_06810 63462 62221 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_06810 64037 63534 gene locus_tag LOCUS_06820 64037 63534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 65520 64030 gene locus_tag LOCUS_06830 gene accC 65520 64030 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_06830 67874 65529 gene locus_tag LOCUS_06840 gene mutS2 67874 65529 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079958.1 protein_id gnl|my_center|LOCUS_06840 68392 67871 gene locus_tag LOCUS_06850 68392 67871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 68841 68389 gene locus_tag LOCUS_06860 68841 68389 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_06860 69328 68915 gene locus_tag LOCUS_06870 69328 68915 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_06870 69876 69343 gene locus_tag LOCUS_06880 69876 69343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 70591 69896 gene locus_tag LOCUS_06890 70591 69896 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence009 167 3064 gene locus_tag LOCUS_06900 167 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3232 5040 gene locus_tag LOCUS_06910 3232 5040 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_06910 5056 5301 gene locus_tag LOCUS_06920 5056 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5439 7595 gene locus_tag LOCUS_06930 5439 7595 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_06930 7655 8026 gene locus_tag LOCUS_06940 7655 8026 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_06940 8096 10267 gene locus_tag LOCUS_06950 gene scpA 8096 10267 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_06950 10453 11568 gene locus_tag LOCUS_06960 gene meaB 10453 11568 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_06960 11726 13084 gene locus_tag LOCUS_06970 11726 13084 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_06970 13099 14127 gene locus_tag LOCUS_06980 gene cydB 13099 14127 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_06980 14159 14731 gene locus_tag LOCUS_06990 14159 14731 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_06990 15254 14718 gene locus_tag LOCUS_07000 15254 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 17035 15341 gene locus_tag LOCUS_07010 17035 15341 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933778.1 protein_id gnl|my_center|LOCUS_07010 18275 17133 gene locus_tag LOCUS_07020 18275 17133 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_07020 18326 19864 gene locus_tag LOCUS_07030 18326 19864 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_07030 19985 20692 gene locus_tag LOCUS_07040 19985 20692 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941332.1 protein_id gnl|my_center|LOCUS_07040 21562 20699 gene locus_tag LOCUS_07050 21562 20699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_07050 22550 21615 gene locus_tag LOCUS_07060 22550 21615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_07060 24108 22561 gene locus_tag LOCUS_07070 24108 22561 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944014.1 protein_id gnl|my_center|LOCUS_07070 25098 24169 gene locus_tag LOCUS_07080 25098 24169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 26650 25112 gene locus_tag LOCUS_07090 26650 25112 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_07090 28160 26643 gene locus_tag LOCUS_07100 28160 26643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 29164 28172 gene locus_tag LOCUS_07110 29164 28172 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940962.1 protein_id gnl|my_center|LOCUS_07110 29904 29161 gene locus_tag LOCUS_07120 gene fabG 29904 29161 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_07120 30461 29970 gene locus_tag LOCUS_07130 30461 29970 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403129.1 protein_id gnl|my_center|LOCUS_07130 31304 30555 gene locus_tag LOCUS_07140 31304 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 32255 31308 gene locus_tag LOCUS_07150 32255 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 33092 32379 gene locus_tag LOCUS_07160 33092 32379 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_07160 33623 34861 gene locus_tag LOCUS_07170 33623 34861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 35706 35239 gene locus_tag LOCUS_07180 35706 35239 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_07180 36881 35868 gene locus_tag LOCUS_07190 36881 35868 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_07190 38407 36914 gene locus_tag LOCUS_07200 38407 36914 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259622.1 protein_id gnl|my_center|LOCUS_07200 39727 38594 gene locus_tag LOCUS_07210 39727 38594 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_07210 40751 39957 gene locus_tag LOCUS_07220 40751 39957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 41889 40891 gene locus_tag LOCUS_07230 41889 40891 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_07230 42735 43349 gene locus_tag LOCUS_07240 42735 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 43383 45959 gene locus_tag LOCUS_07250 43383 45959 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208040.1 protein_id gnl|my_center|LOCUS_07250 46405 46920 gene locus_tag LOCUS_07260 46405 46920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 46965 47219 gene locus_tag LOCUS_07270 46965 47219 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533122.1 protein_id gnl|my_center|LOCUS_07270 47222 49219 gene locus_tag LOCUS_07280 gene asnB 47222 49219 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_07280 49292 50248 gene locus_tag LOCUS_07290 gene nadE 49292 50248 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254737.1 protein_id gnl|my_center|LOCUS_07290 50433 51107 gene locus_tag LOCUS_07300 50433 51107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 51225 52208 gene locus_tag LOCUS_07310 51225 52208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 52484 53353 gene locus_tag LOCUS_07320 52484 53353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 53746 54780 gene locus_tag LOCUS_07330 53746 54780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 54982 55407 gene locus_tag LOCUS_07340 54982 55407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 55423 56334 gene locus_tag LOCUS_07350 55423 56334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 56337 57515 gene locus_tag LOCUS_07360 56337 57515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 57512 58444 gene locus_tag LOCUS_07370 57512 58444 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024331.1 protein_id gnl|my_center|LOCUS_07370 58472 60343 gene locus_tag LOCUS_07380 gene asnB 58472 60343 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_07380 60586 61692 gene locus_tag LOCUS_07390 60586 61692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 61773 63038 gene locus_tag LOCUS_07400 61773 63038 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 protein_id gnl|my_center|LOCUS_07400 63155 64111 gene locus_tag LOCUS_07410 63155 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 64183 65169 gene locus_tag LOCUS_07420 64183 65169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 65254 66390 gene locus_tag LOCUS_07430 65254 66390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 <68243 66526 gene locus_tag LOCUS_07440 <68243 66526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403046.1:T9SS type A sorting domain-containing protein >Feature sequence010 <1 2066 gene locus_tag LOCUS_07450 <1 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein 2215 5091 gene locus_tag LOCUS_07460 2215 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 7175 5178 gene locus_tag LOCUS_07470 7175 5178 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_07470 7774 7172 gene locus_tag LOCUS_07480 7774 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8814 7825 gene locus_tag LOCUS_07490 gene floA 8814 7825 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_07490 9133 11640 gene locus_tag LOCUS_07500 9133 11640 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_07500 11709 12140 gene locus_tag LOCUS_07510 11709 12140 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022301.1 protein_id gnl|my_center|LOCUS_07510 12144 15005 gene locus_tag LOCUS_07520 12144 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 15113 17452 gene locus_tag LOCUS_07530 15113 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 17594 18808 gene locus_tag LOCUS_07540 17594 18808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 19573 18809 gene locus_tag LOCUS_07550 19573 18809 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_07550 19911 19570 gene locus_tag LOCUS_07560 19911 19570 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 protein_id gnl|my_center|LOCUS_07560 20036 21355 gene locus_tag LOCUS_07570 20036 21355 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_07570 21417 21490 gene locus_tag LOCUS_t00110 21417 21490 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22491 21595 gene locus_tag LOCUS_07580 22491 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 24155 22491 gene locus_tag LOCUS_07590 24155 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 24612 25973 gene locus_tag LOCUS_07600 24612 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 26505 26182 gene locus_tag LOCUS_07610 26505 26182 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073636.1 protein_id gnl|my_center|LOCUS_07610 27183 26704 gene locus_tag LOCUS_07620 gene coaD 27183 26704 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_07620 27824 27270 gene locus_tag LOCUS_07630 gene rsmD 27824 27270 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_07630 28767 27841 gene locus_tag LOCUS_07640 28767 27841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 29352 28780 gene locus_tag LOCUS_07650 29352 28780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 29880 29383 gene locus_tag LOCUS_07660 29880 29383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 31082 29934 gene locus_tag LOCUS_07670 gene dnaJ 31082 29934 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_07670 31677 31105 gene locus_tag LOCUS_07680 31677 31105 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933151.1 protein_id gnl|my_center|LOCUS_07680 32748 31693 gene locus_tag LOCUS_07690 gene hrcA 32748 31693 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_07690 33006 33446 gene locus_tag LOCUS_07700 33006 33446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 33483 35060 gene locus_tag LOCUS_07710 33483 35060 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_07710 35057 35710 gene locus_tag LOCUS_07720 35057 35710 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_07720 35719 36234 gene locus_tag LOCUS_07730 35719 36234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 36252 37442 gene locus_tag LOCUS_07740 36252 37442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 39280 37556 gene locus_tag LOCUS_07750 39280 37556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 39585 40481 gene locus_tag LOCUS_07760 39585 40481 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870829.1 protein_id gnl|my_center|LOCUS_07760 40580 41512 gene locus_tag LOCUS_07770 40580 41512 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_07770 41535 41846 gene locus_tag LOCUS_07780 41535 41846 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062094.1 protein_id gnl|my_center|LOCUS_07780 41978 42199 gene locus_tag LOCUS_07790 41978 42199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 42203 42613 gene locus_tag LOCUS_07800 42203 42613 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079939.1 protein_id gnl|my_center|LOCUS_07800 42625 43014 gene locus_tag LOCUS_07810 42625 43014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 43040 43366 gene locus_tag LOCUS_07820 43040 43366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 43369 43812 gene locus_tag LOCUS_07830 gene dps 43369 43812 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846461.1 protein_id gnl|my_center|LOCUS_07830 44025 46367 gene locus_tag LOCUS_07840 44025 46367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966626.1 protein_id gnl|my_center|LOCUS_07840 46493 47371 gene locus_tag LOCUS_07850 46493 47371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 47386 47856 gene locus_tag LOCUS_07860 47386 47856 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_07860 47948 48943 gene locus_tag LOCUS_07870 gene purM 47948 48943 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931788.1 protein_id gnl|my_center|LOCUS_07870 48943 50304 gene locus_tag LOCUS_07880 48943 50304 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_07880 50450 51820 gene locus_tag LOCUS_07890 gene dacB 50450 51820 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_07890 51826 52677 gene locus_tag LOCUS_07900 51826 52677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 53297 52905 gene locus_tag LOCUS_07910 53297 52905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 54976 53372 gene locus_tag LOCUS_07920 54976 53372 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_07920 56800 55268 gene locus_tag LOCUS_07930 56800 55268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 56995 57720 gene locus_tag LOCUS_07940 gene bshB1 56995 57720 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_07940 57765 59366 gene locus_tag LOCUS_07950 gene pckA 57765 59366 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_07950 61480 59645 gene locus_tag LOCUS_07960 61480 59645 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_07960 64034 61536 gene locus_tag LOCUS_07970 64034 61536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 64967 64047 gene locus_tag LOCUS_07980 64967 64047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 65101 66567 gene locus_tag LOCUS_07990 65101 66567 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence011 738 2165 gene locus_tag LOCUS_08000 gene gatA 738 2165 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931960.1 protein_id gnl|my_center|LOCUS_08000 2149 2658 gene locus_tag LOCUS_08010 2149 2658 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907311.1 protein_id gnl|my_center|LOCUS_08010 2808 3854 gene locus_tag LOCUS_08020 gene sucD 2808 3854 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_08020 3864 4295 gene locus_tag LOCUS_08030 3864 4295 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_08030 4411 5643 gene locus_tag LOCUS_08040 4411 5643 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_08040 5653 6708 gene locus_tag LOCUS_08050 5653 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 8097 6790 gene locus_tag LOCUS_08060 8097 6790 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_08060 10360 8135 gene locus_tag LOCUS_08070 10360 8135 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_08070 11094 10372 gene locus_tag LOCUS_08080 11094 10372 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_08080 12872 11166 gene locus_tag LOCUS_08090 12872 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 12934 14181 gene locus_tag LOCUS_08100 gene glgC 12934 14181 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 protein_id gnl|my_center|LOCUS_08100 14390 16222 gene locus_tag LOCUS_08110 gene uvrC 14390 16222 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_08110 16260 17006 gene locus_tag LOCUS_08120 16260 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 17026 17325 gene locus_tag LOCUS_08130 17026 17325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 17322 17798 gene locus_tag LOCUS_08140 gene sixA 17322 17798 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_08140 19029 18067 gene locus_tag LOCUS_08150 gene yhdJ 19029 18067 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258883.1 protein_id gnl|my_center|LOCUS_08150 22368 19030 gene locus_tag LOCUS_08160 22368 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22557 23738 gene locus_tag LOCUS_08170 22557 23738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 23861 24127 gene locus_tag LOCUS_08180 23861 24127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 24197 24730 gene locus_tag LOCUS_08190 24197 24730 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_08190 24768 25139 gene locus_tag LOCUS_08200 24768 25139 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_08200 25178 27157 gene locus_tag LOCUS_08210 25178 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 27358 27879 gene locus_tag LOCUS_08220 27358 27879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 27980 29413 gene locus_tag LOCUS_08230 27980 29413 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_08230 29457 29834 gene locus_tag LOCUS_08240 29457 29834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 29905 31122 gene locus_tag LOCUS_08250 29905 31122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 31212 32771 gene locus_tag LOCUS_08260 gene citF 31212 32771 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_08260 33025 33516 gene locus_tag LOCUS_08270 33025 33516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 33954 34781 gene locus_tag LOCUS_08280 33954 34781 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_08280 36129 34852 gene locus_tag LOCUS_08290 36129 34852 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_08290 37593 36148 gene locus_tag LOCUS_08300 37593 36148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 38560 37601 gene locus_tag LOCUS_08310 38560 37601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 40653 38557 gene locus_tag LOCUS_08320 40653 38557 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839622.1 protein_id gnl|my_center|LOCUS_08320 41792 41193 gene locus_tag LOCUS_08330 41792 41193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 42402 41785 gene locus_tag LOCUS_08340 42402 41785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 42973 42554 gene locus_tag LOCUS_08350 42973 42554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 43780 43208 gene locus_tag LOCUS_08360 43780 43208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 44948 43788 gene locus_tag LOCUS_08370 44948 43788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 46885 44996 gene locus_tag LOCUS_08380 gene acs 46885 44996 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_08380 49216 47384 gene locus_tag LOCUS_08390 49216 47384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 49357 50379 gene locus_tag LOCUS_08400 49357 50379 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189850.1 protein_id gnl|my_center|LOCUS_08400 51996 50428 gene locus_tag LOCUS_08410 51996 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 52547 54361 gene locus_tag LOCUS_08420 gene typA 52547 54361 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_08420 56851 54575 gene locus_tag LOCUS_08430 56851 54575 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_08430 57783 56881 gene locus_tag LOCUS_08440 57783 56881 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 protein_id gnl|my_center|LOCUS_08440 59123 58122 gene locus_tag LOCUS_08450 59123 58122 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_08450 60895 59270 gene locus_tag LOCUS_08460 60895 59270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 63023 61392 gene locus_tag LOCUS_08470 63023 61392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence012 471 1856 gene locus_tag LOCUS_08480 471 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2020 3027 gene locus_tag LOCUS_08490 2020 3027 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_08490 3058 4044 gene locus_tag LOCUS_08500 3058 4044 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_08500 4038 4985 gene locus_tag LOCUS_08510 4038 4985 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_08510 4975 5970 gene locus_tag LOCUS_08520 4975 5970 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_08520 5970 7010 gene locus_tag LOCUS_08530 5970 7010 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_08530 7017 7760 gene locus_tag LOCUS_08540 7017 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7760 9559 gene locus_tag LOCUS_08550 7760 9559 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_08550 9562 10320 gene locus_tag LOCUS_08560 9562 10320 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_08560 11134 10385 gene locus_tag LOCUS_08570 11134 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11349 12386 gene locus_tag LOCUS_08580 11349 12386 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582595.1 protein_id gnl|my_center|LOCUS_08580 12383 13093 gene locus_tag LOCUS_08590 12383 13093 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_08590 13093 13386 gene locus_tag LOCUS_08600 gene gatC 13093 13386 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_08600 13386 14189 gene locus_tag LOCUS_08610 gene kdsB 13386 14189 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08610 14186 15142 gene locus_tag LOCUS_08620 14186 15142 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082912.1 protein_id gnl|my_center|LOCUS_08620 15256 15687 gene locus_tag LOCUS_08630 15256 15687 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980230.1 protein_id gnl|my_center|LOCUS_08630 15680 16090 gene locus_tag LOCUS_08640 15680 16090 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888664.1 protein_id gnl|my_center|LOCUS_08640 16132 19404 gene locus_tag LOCUS_08650 16132 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 19408 20172 gene locus_tag LOCUS_08660 19408 20172 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_08660 22079 20241 gene locus_tag LOCUS_08670 22079 20241 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_08670 22426 24057 gene locus_tag LOCUS_08680 gene pruA 22426 24057 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_08680 24172 25389 gene locus_tag LOCUS_08690 gene sucC 24172 25389 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_08690 25566 26981 gene locus_tag LOCUS_08700 25566 26981 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_08700 27003 27875 gene locus_tag LOCUS_08710 gene aroE 27003 27875 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933469.1 protein_id gnl|my_center|LOCUS_08710 28429 27920 gene locus_tag LOCUS_08720 28429 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 28775 28700 gene locus_tag LOCUS_t00120 28775 28700 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 28925 28852 gene locus_tag LOCUS_t00130 28925 28852 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29502 28987 gene locus_tag LOCUS_08730 29502 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 33293 29670 gene locus_tag LOCUS_08740 33293 29670 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_08740 33428 34072 gene locus_tag LOCUS_08750 gene pdxH 33428 34072 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_08750 35030 34170 gene locus_tag LOCUS_08760 35030 34170 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_08760 35115 35750 gene locus_tag LOCUS_08770 35115 35750 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_08770 35738 36829 gene locus_tag LOCUS_08780 35738 36829 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_08780 36829 37815 gene locus_tag LOCUS_08790 36829 37815 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143760.1 protein_id gnl|my_center|LOCUS_08790 37812 38648 gene locus_tag LOCUS_08800 37812 38648 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933461.1 protein_id gnl|my_center|LOCUS_08800 38648 39661 gene locus_tag LOCUS_08810 38648 39661 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_08810 39718 40524 gene locus_tag LOCUS_08820 39718 40524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 40521 42080 gene locus_tag LOCUS_08830 40521 42080 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_08830 42077 43078 gene locus_tag LOCUS_08840 42077 43078 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840096.1 protein_id gnl|my_center|LOCUS_08840 43102 44016 gene locus_tag LOCUS_08850 43102 44016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 44137 45108 gene locus_tag LOCUS_08860 44137 45108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 45248 46330 gene locus_tag LOCUS_08870 45248 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 46456 47208 gene locus_tag LOCUS_08880 46456 47208 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_08880 47211 48236 gene locus_tag LOCUS_08890 47211 48236 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 protein_id gnl|my_center|LOCUS_08890 48233 49363 gene locus_tag LOCUS_08900 48233 49363 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990085.1 protein_id gnl|my_center|LOCUS_08900 49439 50326 gene locus_tag LOCUS_08910 49439 50326 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_08910 50323 50805 gene locus_tag LOCUS_08920 gene folA 50323 50805 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_08920 50805 52655 gene locus_tag LOCUS_08930 gene mutL 50805 52655 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_08930 52696 54351 gene locus_tag LOCUS_08940 52696 54351 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_08940 54351 55229 gene locus_tag LOCUS_08950 54351 55229 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_08950 55232 55684 gene locus_tag LOCUS_08960 55232 55684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 55993 57126 gene locus_tag LOCUS_08970 gene tgt 55993 57126 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_08970 57145 57450 gene locus_tag LOCUS_08980 gene yajC 57145 57450 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_08980 57615 57699 gene locus_tag LOCUS_t00140 57615 57699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57731 60151 gene locus_tag LOCUS_08990 57731 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence013 1405 836 gene locus_tag LOCUS_09000 1405 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1914 1492 gene locus_tag LOCUS_09010 1914 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2076 4067 gene locus_tag LOCUS_09020 2076 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4895 4083 gene locus_tag LOCUS_09030 4895 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5052 4888 gene locus_tag LOCUS_09040 5052 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6335 5925 gene locus_tag LOCUS_09050 6335 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8323 6506 gene locus_tag LOCUS_09060 8323 6506 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_09060 10107 8344 gene locus_tag LOCUS_09070 10107 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 10270 12207 gene locus_tag LOCUS_09080 10270 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13710 12277 gene locus_tag LOCUS_09090 13710 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14776 13772 gene locus_tag LOCUS_09100 gene porV 14776 13772 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_09100 18350 14787 gene locus_tag LOCUS_09110 18350 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 21161 18369 gene locus_tag LOCUS_09120 21161 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 21860 21483 gene locus_tag LOCUS_09130 21860 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 22116 21874 gene locus_tag LOCUS_09140 22116 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 22384 22139 gene locus_tag LOCUS_09150 22384 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 22941 22381 gene locus_tag LOCUS_09160 22941 22381 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_09160 23104 25029 gene locus_tag LOCUS_09170 23104 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 25042 25956 gene locus_tag LOCUS_09180 gene miaA 25042 25956 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_09180 26029 27312 gene locus_tag LOCUS_09190 26029 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 27313 28797 gene locus_tag LOCUS_09200 27313 28797 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_09200 29718 31466 gene locus_tag LOCUS_09210 29718 31466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 31489 32211 gene locus_tag LOCUS_09220 31489 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 32287 33180 gene locus_tag LOCUS_09230 32287 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 34952 33543 gene locus_tag LOCUS_09240 gene cysS 34952 33543 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_09240 36059 35079 gene locus_tag LOCUS_09250 36059 35079 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_09250 36717 36022 gene locus_tag LOCUS_09260 36717 36022 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403182.1 protein_id gnl|my_center|LOCUS_09260 37532 36759 gene locus_tag LOCUS_09270 37532 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 40702 37556 gene locus_tag LOCUS_09280 gene ileS 40702 37556 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932003.1 protein_id gnl|my_center|LOCUS_09280 41350 40730 gene locus_tag LOCUS_09290 41350 40730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 42171 41350 gene locus_tag LOCUS_09300 42171 41350 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_09300 42704 42168 gene locus_tag LOCUS_09310 42704 42168 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_09310 43402 42701 gene locus_tag LOCUS_09320 43402 42701 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_09320 43865 44842 gene locus_tag LOCUS_09330 gene pta 43865 44842 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_09330 45056 47281 gene locus_tag LOCUS_09340 45056 47281 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_09340 47461 48345 gene locus_tag LOCUS_09350 gene yut 47461 48345 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443655.1 protein_id gnl|my_center|LOCUS_09350 49656 48445 gene locus_tag LOCUS_09360 49656 48445 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_09360 51371 49938 gene locus_tag LOCUS_09370 51371 49938 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_09370 52191 51550 gene locus_tag LOCUS_09380 52191 51550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 54865 52346 gene locus_tag LOCUS_09390 gene mgtA 54865 52346 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_09390 55877 55239 gene locus_tag LOCUS_09400 55877 55239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 57511 56132 gene locus_tag LOCUS_09410 57511 56132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 58298 57690 gene locus_tag LOCUS_09420 58298 57690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence014 1299 439 gene locus_tag LOCUS_09430 1299 439 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_09430 2840 1440 gene locus_tag LOCUS_09440 2840 1440 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_09440 5227 2906 gene locus_tag LOCUS_09450 5227 2906 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060991347.1 protein_id gnl|my_center|LOCUS_09450 6065 5220 gene locus_tag LOCUS_09460 gene dat 6065 5220 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 protein_id gnl|my_center|LOCUS_09460 6110 6472 gene locus_tag LOCUS_09470 6110 6472 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_09470 6555 6914 gene locus_tag LOCUS_09480 6555 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 7075 8058 gene locus_tag LOCUS_09490 7075 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 8094 10139 gene locus_tag LOCUS_09500 8094 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 10339 12414 gene locus_tag LOCUS_09510 10339 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12503 13234 gene locus_tag LOCUS_09520 12503 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 13235 13741 gene locus_tag LOCUS_09530 gene resA 13235 13741 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_09530 13813 15354 gene locus_tag LOCUS_09540 13813 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 15902 16645 gene locus_tag LOCUS_09550 15902 16645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 16676 19660 gene locus_tag LOCUS_09560 16676 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 19721 22903 gene locus_tag LOCUS_09570 19721 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 22972 24012 gene locus_tag LOCUS_09580 gene porV 22972 24012 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_09580 24202 26100 gene locus_tag LOCUS_09590 24202 26100 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_09590 27523 26168 gene locus_tag LOCUS_09600 27523 26168 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_09600 28123 27581 gene locus_tag LOCUS_09610 28123 27581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 28238 28867 gene locus_tag LOCUS_09620 28238 28867 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 protein_id gnl|my_center|LOCUS_09620 30104 28851 gene locus_tag LOCUS_09630 30104 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 30289 30873 gene locus_tag LOCUS_09640 30289 30873 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_09640 30888 32597 gene locus_tag LOCUS_09650 30888 32597 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_09650 35965 32708 gene locus_tag LOCUS_09660 35965 32708 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_09660 37678 36350 gene locus_tag LOCUS_09670 37678 36350 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_09670 39105 37882 gene locus_tag LOCUS_09680 39105 37882 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871823.1 protein_id gnl|my_center|LOCUS_09680 40081 39119 gene locus_tag LOCUS_09690 40081 39119 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_09690 40828 40382 gene locus_tag LOCUS_09700 40828 40382 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872160.1 protein_id gnl|my_center|LOCUS_09700 42431 40908 gene locus_tag LOCUS_09710 gene malQ 42431 40908 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_09710 43174 42647 gene locus_tag LOCUS_09720 43174 42647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 44560 43295 gene locus_tag LOCUS_09730 44560 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 44907 45521 gene locus_tag LOCUS_09740 44907 45521 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_09740 45541 46005 gene locus_tag LOCUS_09750 45541 46005 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_09750 46011 46379 gene locus_tag LOCUS_09760 46011 46379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 46388 47032 gene locus_tag LOCUS_09770 46388 47032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 48564 47116 gene locus_tag LOCUS_09780 48564 47116 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_09780 49868 48561 gene locus_tag LOCUS_09790 49868 48561 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_09790 50542 50018 gene locus_tag LOCUS_09800 50542 50018 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_09800 51165 51875 gene locus_tag LOCUS_09810 51165 51875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842884.1 protein_id gnl|my_center|LOCUS_09810 51886 52059 gene locus_tag LOCUS_09820 51886 52059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 52052 52270 gene locus_tag LOCUS_09830 52052 52270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 52332 53153 gene locus_tag LOCUS_09840 52332 53153 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_09840 54661 53201 gene locus_tag LOCUS_09850 54661 53201 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202873.1 protein_id gnl|my_center|LOCUS_09850 54761 55660 gene locus_tag LOCUS_09860 54761 55660 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_09860 56454 55885 gene locus_tag LOCUS_09870 56454 55885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence015 1750 176 gene locus_tag LOCUS_09880 1750 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3491 1881 gene locus_tag LOCUS_09890 3491 1881 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083167.1 protein_id gnl|my_center|LOCUS_09890 3596 4363 gene locus_tag LOCUS_09900 3596 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4364 5017 gene locus_tag LOCUS_09910 gene rpe 4364 5017 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933334.1 protein_id gnl|my_center|LOCUS_09910 5070 5903 gene locus_tag LOCUS_09920 gene folP 5070 5903 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_09920 5910 6728 gene locus_tag LOCUS_09930 gene cdaA 5910 6728 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_09930 6703 7383 gene locus_tag LOCUS_09940 6703 7383 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_09940 7401 8078 gene locus_tag LOCUS_09950 7401 8078 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_09950 8141 8914 gene locus_tag LOCUS_09960 8141 8914 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_09960 8917 9864 gene locus_tag LOCUS_09970 8917 9864 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933510.1 protein_id gnl|my_center|LOCUS_09970 9881 10330 gene locus_tag LOCUS_09980 9881 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11490 12005 gene locus_tag LOCUS_09990 11490 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 12026 12298 gene locus_tag LOCUS_10000 12026 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 12295 12723 gene locus_tag LOCUS_10010 gene aroQ 12295 12723 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986444.1 protein_id gnl|my_center|LOCUS_10010 12857 13255 gene locus_tag LOCUS_10020 12857 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 13259 13333 gene locus_tag LOCUS_t00150 13259 13333 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13962 15239 gene locus_tag LOCUS_10030 13962 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 15268 16647 gene locus_tag LOCUS_10040 15268 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 16680 17156 gene locus_tag LOCUS_10050 16680 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 17354 17614 gene locus_tag LOCUS_10060 17354 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 17627 20440 gene locus_tag LOCUS_10070 17627 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 20495 21340 gene locus_tag LOCUS_10080 20495 21340 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023319.1 protein_id gnl|my_center|LOCUS_10080 21337 22140 gene locus_tag LOCUS_10090 21337 22140 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064844.1 protein_id gnl|my_center|LOCUS_10090 24439 22304 gene locus_tag LOCUS_10100 24439 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 24856 25992 gene locus_tag LOCUS_10110 24856 25992 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_10110 27539 26649 gene locus_tag LOCUS_10120 27539 26649 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187713770.1 protein_id gnl|my_center|LOCUS_10120 27734 27661 gene locus_tag LOCUS_t00160 27734 27661 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29414 27897 gene locus_tag LOCUS_10130 29414 27897 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_10130 30174 29788 gene locus_tag LOCUS_10140 30174 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 30667 31035 gene locus_tag LOCUS_10150 30667 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 31211 31384 gene locus_tag LOCUS_10160 31211 31384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 32596 31448 gene locus_tag LOCUS_10170 32596 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 33094 34038 gene locus_tag LOCUS_10180 33094 34038 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 protein_id gnl|my_center|LOCUS_10180 34951 34172 gene locus_tag LOCUS_10190 34951 34172 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053836.1 protein_id gnl|my_center|LOCUS_10190 35820 35239 gene locus_tag LOCUS_10200 35820 35239 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_10200 36783 35914 gene locus_tag LOCUS_10210 36783 35914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_10210 38928 36874 gene locus_tag LOCUS_10220 38928 36874 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_10220 40617 38986 gene locus_tag LOCUS_10230 40617 38986 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_10230 40819 41805 gene locus_tag LOCUS_10240 40819 41805 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583585.1 protein_id gnl|my_center|LOCUS_10240 42062 42223 gene locus_tag LOCUS_10250 42062 42223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 43573 42284 gene locus_tag LOCUS_10260 43573 42284 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_10260 45202 43598 gene locus_tag LOCUS_10270 45202 43598 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_10270 46211 45192 gene locus_tag LOCUS_10280 46211 45192 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261546.1 protein_id gnl|my_center|LOCUS_10280 46828 46226 gene locus_tag LOCUS_10290 46828 46226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 47006 47314 gene locus_tag LOCUS_10300 47006 47314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 47406 48146 gene locus_tag LOCUS_10310 47406 48146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 48827 49114 gene locus_tag LOCUS_10320 48827 49114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 50740 49181 gene locus_tag LOCUS_10330 50740 49181 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110052.1 protein_id gnl|my_center|LOCUS_10330 51379 52368 gene locus_tag LOCUS_10340 51379 52368 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_10340 52731 53162 gene locus_tag LOCUS_10350 52731 53162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 53437 53856 gene locus_tag LOCUS_10360 53437 53856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 54925 53951 gene locus_tag LOCUS_10370 54925 53951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 55702 55124 gene locus_tag LOCUS_10380 55702 55124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence016 1335 73 gene locus_tag LOCUS_10390 1335 73 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_10390 2309 1335 gene locus_tag LOCUS_10400 2309 1335 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_10400 3480 2299 gene locus_tag LOCUS_10410 3480 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4247 3480 gene locus_tag LOCUS_10420 4247 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5136 4231 gene locus_tag LOCUS_10430 5136 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6094 5123 gene locus_tag LOCUS_10440 6094 5123 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_10440 6633 6109 gene locus_tag LOCUS_10450 6633 6109 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_10450 7386 6634 gene locus_tag LOCUS_10460 7386 6634 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_10460 7991 7383 gene locus_tag LOCUS_10470 7991 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9117 8131 gene locus_tag LOCUS_10480 gene dusB 9117 8131 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_10480 10306 9206 gene locus_tag LOCUS_10490 10306 9206 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_10490 10624 10433 gene locus_tag LOCUS_10500 10624 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12653 10653 gene locus_tag LOCUS_10510 12653 10653 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_10510 13501 12671 gene locus_tag LOCUS_10520 13501 12671 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_10520 14169 14933 gene locus_tag LOCUS_10530 gene hisA 14169 14933 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404311.1 protein_id gnl|my_center|LOCUS_10530 14943 15500 gene locus_tag LOCUS_10540 14943 15500 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_10540 15484 15963 gene locus_tag LOCUS_10550 15484 15963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 17001 16027 gene locus_tag LOCUS_10560 17001 16027 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_10560 17765 17004 gene locus_tag LOCUS_10570 17765 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 19070 17775 gene locus_tag LOCUS_10580 19070 17775 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_10580 20398 19166 gene locus_tag LOCUS_10590 20398 19166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838376.1 protein_id gnl|my_center|LOCUS_10590 21674 20427 gene locus_tag LOCUS_10600 21674 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 22864 21674 gene locus_tag LOCUS_10610 22864 21674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 23437 22865 gene locus_tag LOCUS_10620 gene gmhB 23437 22865 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966334.1 protein_id gnl|my_center|LOCUS_10620 24938 23442 gene locus_tag LOCUS_10630 24938 23442 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_10630 25153 25722 gene locus_tag LOCUS_10640 25153 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 25722 26966 gene locus_tag LOCUS_10650 gene hutI 25722 26966 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_10650 28765 27092 gene locus_tag LOCUS_10660 28765 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 30042 28993 gene locus_tag LOCUS_10670 gene mltG 30042 28993 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_10670 30805 30224 gene locus_tag LOCUS_10680 30805 30224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 31777 31088 gene locus_tag LOCUS_10690 31777 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 32996 31980 gene locus_tag LOCUS_10700 gene tsaD 32996 31980 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_10700 33898 32993 gene locus_tag LOCUS_10710 33898 32993 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_10710 34654 34070 gene locus_tag LOCUS_10720 gene coaE 34654 34070 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546225.1 protein_id gnl|my_center|LOCUS_10720 36259 34697 gene locus_tag LOCUS_10730 gene rny 36259 34697 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_10730 36812 36492 gene locus_tag LOCUS_10740 36812 36492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 37155 36832 gene locus_tag LOCUS_10750 37155 36832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 39561 37156 gene locus_tag LOCUS_10760 gene pheT 39561 37156 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_10760 40588 39575 gene locus_tag LOCUS_10770 gene pheS 40588 39575 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933784.1 protein_id gnl|my_center|LOCUS_10770 41006 40659 gene locus_tag LOCUS_10780 gene rplT 41006 40659 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933783.1 protein_id gnl|my_center|LOCUS_10780 41213 41022 gene locus_tag LOCUS_10790 gene rpmI 41213 41022 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_10790 41399 41220 gene locus_tag LOCUS_10800 41399 41220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 43734 41797 gene locus_tag LOCUS_10810 gene thrS 43734 41797 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933780.1 protein_id gnl|my_center|LOCUS_10810 43865 43791 gene locus_tag LOCUS_t00170 43865 43791 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 44269 44181 gene locus_tag LOCUS_t00180 44269 44181 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44588 44992 gene locus_tag LOCUS_10820 gene mce 44588 44992 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_10820 45105 46634 gene locus_tag LOCUS_10830 45105 46634 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_10830 46647 47057 gene locus_tag LOCUS_10840 46647 47057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 47070 47513 gene locus_tag LOCUS_10850 47070 47513 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_10850 47516 48679 gene locus_tag LOCUS_10860 47516 48679 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_10860 50145 48808 gene locus_tag LOCUS_10870 50145 48808 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_10870 50443 51786 gene locus_tag LOCUS_10880 gene wbpA 50443 51786 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_10880 51844 52809 gene locus_tag LOCUS_10890 51844 52809 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_10890 52886 53473 gene locus_tag LOCUS_10900 52886 53473 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_10900 53977 55092 gene locus_tag LOCUS_10910 53977 55092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence017 526 1758 gene locus_tag LOCUS_10920 526 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2136 2564 gene locus_tag LOCUS_10930 gene ndhC 2136 2564 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_10930 2564 3055 gene locus_tag LOCUS_10940 2564 3055 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_10940 3052 3540 gene locus_tag LOCUS_10950 3052 3540 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_10950 3543 4694 gene locus_tag LOCUS_10960 3543 4694 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_10960 4691 5770 gene locus_tag LOCUS_10970 gene nuoH 4691 5770 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_10970 5779 6354 gene locus_tag LOCUS_10980 5779 6354 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_10980 6359 6853 gene locus_tag LOCUS_10990 6359 6853 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_10990 6853 7161 gene locus_tag LOCUS_11000 gene nuoK 6853 7161 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_11000 7164 9236 gene locus_tag LOCUS_11010 gene nuoL 7164 9236 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_11010 9319 10872 gene locus_tag LOCUS_11020 9319 10872 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_11020 10891 12390 gene locus_tag LOCUS_11030 10891 12390 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_11030 12460 12867 gene locus_tag LOCUS_11040 12460 12867 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932212.1 protein_id gnl|my_center|LOCUS_11040 12910 13224 gene locus_tag LOCUS_11050 12910 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 13278 13616 gene locus_tag LOCUS_11060 13278 13616 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_11060 13643 14362 gene locus_tag LOCUS_11070 gene sodA 13643 14362 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_11070 14450 15070 gene locus_tag LOCUS_11080 14450 15070 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_11080 16567 15101 gene locus_tag LOCUS_11090 16567 15101 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_11090 17706 16564 gene locus_tag LOCUS_11100 17706 16564 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_11100 19061 17847 gene locus_tag LOCUS_11110 19061 17847 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022106.1 protein_id gnl|my_center|LOCUS_11110 19468 19058 gene locus_tag LOCUS_11120 19468 19058 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_11120 22385 19506 gene locus_tag LOCUS_11130 22385 19506 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546856.1 protein_id gnl|my_center|LOCUS_11130 23052 22645 gene locus_tag LOCUS_11140 gene atpC 23052 22645 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405147.1 protein_id gnl|my_center|LOCUS_11140 24464 23052 gene locus_tag LOCUS_11150 gene atpD 24464 23052 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_11150 27877 24614 gene locus_tag LOCUS_11160 27877 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 28962 27874 gene locus_tag LOCUS_11170 28962 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 29997 29017 gene locus_tag LOCUS_11180 gene porV 29997 29017 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_11180 32883 30019 gene locus_tag LOCUS_11190 32883 30019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 34457 32880 gene locus_tag LOCUS_11200 34457 32880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 36757 34511 gene locus_tag LOCUS_11210 36757 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 38889 36778 gene locus_tag LOCUS_11220 38889 36778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 40818 39154 gene locus_tag LOCUS_11230 gene sucB 40818 39154 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421581.1 protein_id gnl|my_center|LOCUS_11230 42985 40880 gene locus_tag LOCUS_11240 42985 40880 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_11240 44434 43031 gene locus_tag LOCUS_11250 gene lpdA 44434 43031 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_11250 45206 46549 gene locus_tag LOCUS_11260 45206 46549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 46602 47603 gene locus_tag LOCUS_11270 46602 47603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 48181 47684 gene locus_tag LOCUS_11280 48181 47684 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_11280 49001 48288 gene locus_tag LOCUS_11290 49001 48288 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_11290 49065 50420 gene locus_tag LOCUS_11300 gene glmM 49065 50420 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11300 51314 50406 gene locus_tag LOCUS_11310 51314 50406 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_11310 51814 51311 gene locus_tag LOCUS_11320 51814 51311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 54905 51945 gene locus_tag LOCUS_11330 54905 51945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence018 1071 127 gene locus_tag LOCUS_11340 1071 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2158 1052 gene locus_tag LOCUS_11350 2158 1052 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_11350 2299 2165 gene locus_tag LOCUS_11360 2299 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3022 2363 gene locus_tag LOCUS_11370 3022 2363 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_11370 3545 3009 gene locus_tag LOCUS_11380 gene folK 3545 3009 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948528.1 protein_id gnl|my_center|LOCUS_11380 3922 3545 gene locus_tag LOCUS_11390 gene folB 3922 3545 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_11390 4841 4074 gene locus_tag LOCUS_11400 gene pgeF 4841 4074 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_11400 4939 5712 gene locus_tag LOCUS_11410 gene surE 4939 5712 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933221.1 protein_id gnl|my_center|LOCUS_11410 5724 7862 gene locus_tag LOCUS_11420 5724 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_11420 7985 8563 gene locus_tag LOCUS_11430 7985 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10193 8565 gene locus_tag LOCUS_11440 gene argS 10193 8565 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_11440 10631 10206 gene locus_tag LOCUS_11450 gene rsfS 10631 10206 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_11450 11140 10634 gene locus_tag LOCUS_11460 11140 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 11656 11144 gene locus_tag LOCUS_11470 11656 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 12260 11805 gene locus_tag LOCUS_11480 12260 11805 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092109.1 protein_id gnl|my_center|LOCUS_11480 12331 13134 gene locus_tag LOCUS_11490 gene mazG 12331 13134 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_11490 14094 13138 gene locus_tag LOCUS_11500 14094 13138 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932928.1 protein_id gnl|my_center|LOCUS_11500 14840 14166 gene locus_tag LOCUS_11510 14840 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 15156 14881 gene locus_tag LOCUS_11520 15156 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 15981 15301 gene locus_tag LOCUS_11530 gene radC 15981 15301 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_11530 17720 15996 gene locus_tag LOCUS_11540 17720 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 18536 17946 gene locus_tag LOCUS_11550 18536 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 20078 18537 gene locus_tag LOCUS_11560 gene guaA 20078 18537 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_11560 20529 20149 gene locus_tag LOCUS_11570 gene gcvH 20529 20149 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_11570 21903 20566 gene locus_tag LOCUS_11580 gene accC 21903 20566 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_11580 22390 21923 gene locus_tag LOCUS_11590 gene accB 22390 21923 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 protein_id gnl|my_center|LOCUS_11590 22968 22405 gene locus_tag LOCUS_11600 gene efp 22968 22405 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_11600 23793 23107 gene locus_tag LOCUS_11610 23793 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 25181 24126 gene locus_tag LOCUS_11620 25181 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 25528 25454 gene locus_tag LOCUS_t00190 25528 25454 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26061 25654 gene locus_tag LOCUS_11630 26061 25654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 26476 26045 gene locus_tag LOCUS_11640 26476 26045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 28296 26530 gene locus_tag LOCUS_11650 28296 26530 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110084.1 protein_id gnl|my_center|LOCUS_11650 29731 28271 gene locus_tag LOCUS_11660 29731 28271 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_11660 30562 29786 gene locus_tag LOCUS_11670 30562 29786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 32945 30567 gene locus_tag LOCUS_11680 32945 30567 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_11680 33847 33305 gene locus_tag LOCUS_11690 33847 33305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 34167 33916 gene locus_tag LOCUS_11700 34167 33916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 34542 34171 gene locus_tag LOCUS_11710 34542 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 35509 34553 gene locus_tag LOCUS_11720 gene trxB 35509 34553 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_11720 36072 35728 gene locus_tag LOCUS_11730 36072 35728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 36362 36090 gene locus_tag LOCUS_11740 gene groES 36362 36090 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_11740 36624 36373 gene locus_tag LOCUS_11750 36624 36373 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_11750 37793 36747 gene locus_tag LOCUS_11760 37793 36747 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_11760 38518 37919 gene locus_tag LOCUS_11770 38518 37919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 39148 38843 gene locus_tag LOCUS_11780 39148 38843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 40029 39163 gene locus_tag LOCUS_11790 gene dapF 40029 39163 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_11790 40529 40173 gene locus_tag LOCUS_11800 40529 40173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 40890 40522 gene locus_tag LOCUS_11810 40890 40522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 41143 42378 gene locus_tag LOCUS_11820 41143 42378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_11820 43193 44719 gene locus_tag LOCUS_11830 43193 44719 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_11830 44968 45420 gene locus_tag LOCUS_11840 44968 45420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 45625 45344 gene locus_tag LOCUS_11850 45625 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 47205 45799 gene locus_tag LOCUS_11860 47205 45799 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_11860 48233 47277 gene locus_tag LOCUS_11870 48233 47277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 48458 48270 gene locus_tag LOCUS_11880 48458 48270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 49475 49116 gene locus_tag LOCUS_tm00010 49475 49116 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 50064 49516 gene locus_tag LOCUS_11890 50064 49516 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_11890 51168 50068 gene locus_tag LOCUS_11900 51168 50068 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_11900 52119 51244 gene locus_tag LOCUS_11910 52119 51244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 53607 52243 gene locus_tag LOCUS_11920 53607 52243 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence019 139 1929 gene locus_tag LOCUS_11930 139 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3686 2127 gene locus_tag LOCUS_11940 3686 2127 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_11940 3878 4513 gene locus_tag LOCUS_11950 3878 4513 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832147.1 protein_id gnl|my_center|LOCUS_11950 4686 6203 gene locus_tag LOCUS_11960 4686 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6384 6214 gene locus_tag LOCUS_11970 6384 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6383 7588 gene locus_tag LOCUS_11980 6383 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 7604 10450 gene locus_tag LOCUS_11990 7604 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 10628 12058 gene locus_tag LOCUS_12000 10628 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 12059 12511 gene locus_tag LOCUS_12010 12059 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 12502 14397 gene locus_tag LOCUS_12020 12502 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14411 15985 gene locus_tag LOCUS_12030 14411 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16057 17271 gene locus_tag LOCUS_12040 16057 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 17286 20732 gene locus_tag LOCUS_12050 17286 20732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 20870 21493 gene locus_tag LOCUS_12060 gene lexA 20870 21493 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_12060 21493 22380 gene locus_tag LOCUS_12070 21493 22380 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_12070 22471 23661 gene locus_tag LOCUS_12080 gene dinB 22471 23661 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836448.1 protein_id gnl|my_center|LOCUS_12080 23711 23902 gene locus_tag LOCUS_12090 23711 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 23899 24156 gene locus_tag LOCUS_12100 23899 24156 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922754.1 protein_id gnl|my_center|LOCUS_12100 24504 24160 gene locus_tag LOCUS_12110 gene hinT 24504 24160 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 protein_id gnl|my_center|LOCUS_12110 25859 24504 gene locus_tag LOCUS_12120 25859 24504 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_12120 26356 25856 gene locus_tag LOCUS_12130 26356 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 26595 28406 gene locus_tag LOCUS_12140 26595 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 28437 29090 gene locus_tag LOCUS_12150 gene lnrK 28437 29090 CDS product two-component system response regulator LnrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242530.1 protein_id gnl|my_center|LOCUS_12150 30750 29095 gene locus_tag LOCUS_12160 30750 29095 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_12160 31911 30754 gene locus_tag LOCUS_12170 31911 30754 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_12170 32876 31923 gene locus_tag LOCUS_12180 gene meaB 32876 31923 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_12180 33800 32880 gene locus_tag LOCUS_12190 33800 32880 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_12190 34382 33801 gene locus_tag LOCUS_12200 gene nadD 34382 33801 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_12200 35068 34379 gene locus_tag LOCUS_12210 35068 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 35986 35072 gene locus_tag LOCUS_12220 35986 35072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 36074 36226 gene locus_tag LOCUS_12230 36074 36226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 36337 36843 gene locus_tag LOCUS_12240 36337 36843 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_12240 36864 37043 gene locus_tag LOCUS_12250 gene rpmF 36864 37043 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699811.1 protein_id gnl|my_center|LOCUS_12250 37061 38089 gene locus_tag LOCUS_12260 gene plsX 37061 38089 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_12260 38103 39101 gene locus_tag LOCUS_12270 38103 39101 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402830.1 protein_id gnl|my_center|LOCUS_12270 39125 40039 gene locus_tag LOCUS_12280 gene fabD 39125 40039 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_12280 40039 40644 gene locus_tag LOCUS_12290 40039 40644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 40637 41413 gene locus_tag LOCUS_12300 gene fabG 40637 41413 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_12300 41506 41739 gene locus_tag LOCUS_12310 41506 41739 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_12310 41822 43069 gene locus_tag LOCUS_12320 gene fabF 41822 43069 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12320 43072 43854 gene locus_tag LOCUS_12330 gene rnc 43072 43854 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838732.1 protein_id gnl|my_center|LOCUS_12330 43962 46841 gene locus_tag LOCUS_12340 gene gcvP 43962 46841 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_12340 46880 48226 gene locus_tag LOCUS_12350 46880 48226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 48279 48905 gene locus_tag LOCUS_12360 48279 48905 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456176.1 protein_id gnl|my_center|LOCUS_12360 48910 49335 gene locus_tag LOCUS_12370 48910 49335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 49693 49364 gene locus_tag LOCUS_12380 49693 49364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 49770 50693 gene locus_tag LOCUS_12390 49770 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 50707 51804 gene locus_tag LOCUS_12400 50707 51804 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_12400 51854 51928 gene locus_tag LOCUS_t00200 51854 51928 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 1576 1388 gene locus_tag LOCUS_12410 1576 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3088 1895 gene locus_tag LOCUS_12420 3088 1895 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_12420 3407 4747 gene locus_tag LOCUS_12430 gene gdhA 3407 4747 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_12430 5382 6446 gene locus_tag LOCUS_12440 5382 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6934 9654 gene locus_tag LOCUS_12450 6934 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9986 9708 gene locus_tag LOCUS_12460 9986 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 10296 13889 gene locus_tag LOCUS_12470 gene nifJ 10296 13889 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_12470 13977 14966 gene locus_tag LOCUS_12480 13977 14966 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_12480 18993 15139 gene locus_tag LOCUS_12490 18993 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 19792 19022 gene locus_tag LOCUS_12500 19792 19022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_12500 19970 20539 gene locus_tag LOCUS_12510 19970 20539 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_12510 20541 21995 gene locus_tag LOCUS_12520 gene rpoN 20541 21995 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_12520 21996 22628 gene locus_tag LOCUS_12530 21996 22628 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_12530 22752 23291 gene locus_tag LOCUS_12540 gene hslV 22752 23291 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_12540 23294 24694 gene locus_tag LOCUS_12550 gene hslU 23294 24694 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_12550 24751 26952 gene locus_tag LOCUS_12560 24751 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27394 30369 gene locus_tag LOCUS_12570 27394 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 30727 30497 gene locus_tag LOCUS_12580 30727 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 30985 31908 gene locus_tag LOCUS_12590 30985 31908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 33050 31905 gene locus_tag LOCUS_12600 33050 31905 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_12600 34620 33196 gene locus_tag LOCUS_12610 34620 33196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 38252 34896 gene locus_tag LOCUS_12620 38252 34896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 39651 38311 gene locus_tag LOCUS_12630 39651 38311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 40684 39683 gene locus_tag LOCUS_12640 40684 39683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 41152 40769 gene locus_tag LOCUS_12650 41152 40769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 42524 41211 gene locus_tag LOCUS_12660 42524 41211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 43617 42598 gene locus_tag LOCUS_12670 43617 42598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 44668 43652 gene locus_tag LOCUS_12680 44668 43652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 47809 44702 gene locus_tag LOCUS_12690 47809 44702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 50411 47823 gene locus_tag LOCUS_12700 50411 47823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 <51318 50565 gene locus_tag LOCUS_12710 <51318 50565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence021 148 630 gene locus_tag LOCUS_12720 148 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 640 2172 gene locus_tag LOCUS_12730 640 2172 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_12730 2413 3138 gene locus_tag LOCUS_12740 2413 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5210 3135 gene locus_tag LOCUS_12750 5210 3135 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_12750 5355 5915 gene locus_tag LOCUS_12760 5355 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7266 5959 gene locus_tag LOCUS_12770 gene purB 7266 5959 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_12770 8453 7266 gene locus_tag LOCUS_12780 8453 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 9072 8446 gene locus_tag LOCUS_12790 gene plsY 9072 8446 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986658.1 protein_id gnl|my_center|LOCUS_12790 9224 9150 gene locus_tag LOCUS_t00210 9224 9150 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9335 9262 gene locus_tag LOCUS_t00220 9335 9262 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11221 9458 gene locus_tag LOCUS_12800 11221 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11873 11355 gene locus_tag LOCUS_12810 11873 11355 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830398.1 protein_id gnl|my_center|LOCUS_12810 11958 12596 gene locus_tag LOCUS_12820 11958 12596 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986876.1 protein_id gnl|my_center|LOCUS_12820 12584 13513 gene locus_tag LOCUS_12830 gene miaA 12584 13513 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_12830 13497 14864 gene locus_tag LOCUS_12840 13497 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 14865 15188 gene locus_tag LOCUS_12850 14865 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_12850 15364 16302 gene locus_tag LOCUS_12860 gene prfB 15364 16302 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12860 17062 16796 gene locus_tag LOCUS_12870 17062 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 17529 17837 gene locus_tag LOCUS_12880 17529 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 18855 17845 gene locus_tag LOCUS_12890 18855 17845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 18930 19298 gene locus_tag LOCUS_12900 18930 19298 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404905.1 protein_id gnl|my_center|LOCUS_12900 20274 19351 gene locus_tag LOCUS_12910 20274 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 20747 20274 gene locus_tag LOCUS_12920 20747 20274 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461601.1 protein_id gnl|my_center|LOCUS_12920 21157 22794 gene locus_tag LOCUS_12930 21157 22794 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_12930 22901 24748 gene locus_tag LOCUS_12940 22901 24748 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_12940 24738 25775 gene locus_tag LOCUS_12950 24738 25775 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_12950 25861 26844 gene locus_tag LOCUS_12960 25861 26844 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_12960 26859 28367 gene locus_tag LOCUS_12970 26859 28367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 28864 30132 gene locus_tag LOCUS_12980 28864 30132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 31167 30475 gene locus_tag LOCUS_12990 31167 30475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_12990 32404 31172 gene locus_tag LOCUS_13000 32404 31172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_13000 33618 32404 gene locus_tag LOCUS_13010 33618 32404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_13010 33868 33943 gene locus_tag LOCUS_t00230 33868 33943 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33973 34047 gene locus_tag LOCUS_t00240 33973 34047 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34655 34729 gene locus_tag LOCUS_t00250 34655 34729 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 34769 34841 gene locus_tag LOCUS_t00260 34769 34841 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34929 35306 gene locus_tag LOCUS_13020 gene crcB 34929 35306 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_13020 35310 35660 gene locus_tag LOCUS_13030 35310 35660 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_13030 36517 35687 gene locus_tag LOCUS_13040 36517 35687 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207936.1 protein_id gnl|my_center|LOCUS_13040 37474 36596 gene locus_tag LOCUS_13050 37474 36596 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_13050 38022 37492 gene locus_tag LOCUS_13060 38022 37492 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_13060 38828 38016 gene locus_tag LOCUS_13070 38828 38016 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_13070 40171 38831 gene locus_tag LOCUS_13080 40171 38831 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_13080 40884 40183 gene locus_tag LOCUS_13090 40884 40183 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_13090 40790 40984 gene locus_tag LOCUS_13100 40790 40984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 42056 40989 gene locus_tag LOCUS_13110 42056 40989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_13110 42287 43228 gene locus_tag LOCUS_13120 42287 43228 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_13120 44060 43221 gene locus_tag LOCUS_13130 gene ispE 44060 43221 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_13130 46077 44047 gene locus_tag LOCUS_13140 46077 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 47256 46219 gene locus_tag LOCUS_13150 gene waaF 47256 46219 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_13150 50057 47277 gene locus_tag LOCUS_13160 gene polA 50057 47277 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933331.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence022 922 2538 gene locus_tag LOCUS_13170 922 2538 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 protein_id gnl|my_center|LOCUS_13170 2541 2891 gene locus_tag LOCUS_13180 2541 2891 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_13180 2896 3336 gene locus_tag LOCUS_13190 gene rsbW 2896 3336 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_13190 3323 5002 gene locus_tag LOCUS_13200 3323 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 5020 7596 gene locus_tag LOCUS_13210 5020 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7684 9267 gene locus_tag LOCUS_13220 7684 9267 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_13220 9465 9827 gene locus_tag LOCUS_13230 9465 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 9840 9983 gene locus_tag LOCUS_13240 9840 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 9980 10783 gene locus_tag LOCUS_13250 9980 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 10761 12032 gene locus_tag LOCUS_13260 10761 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 12029 12883 gene locus_tag LOCUS_13270 12029 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 13023 15965 gene locus_tag LOCUS_13280 13023 15965 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_13280 15958 16272 gene locus_tag LOCUS_13290 15958 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 16606 20616 gene locus_tag LOCUS_13300 16606 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 20807 22600 gene locus_tag LOCUS_13310 20807 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 24354 22681 gene locus_tag LOCUS_13320 24354 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 25111 24407 gene locus_tag LOCUS_13330 25111 24407 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_13330 26517 25111 gene locus_tag LOCUS_13340 26517 25111 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_13340 26752 26534 gene locus_tag LOCUS_13350 26752 26534 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426908.1 protein_id gnl|my_center|LOCUS_13350 27143 26745 gene locus_tag LOCUS_13360 27143 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 28883 27369 gene locus_tag LOCUS_13370 28883 27369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 30193 28886 gene locus_tag LOCUS_13380 30193 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 33962 30306 gene locus_tag LOCUS_13390 33962 30306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 34546 34061 gene locus_tag LOCUS_13400 34546 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 36202 34817 gene locus_tag LOCUS_13410 36202 34817 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_13410 39779 36177 gene locus_tag LOCUS_13420 39779 36177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 40762 39803 gene locus_tag LOCUS_13430 40762 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 41973 41053 gene locus_tag LOCUS_13440 41973 41053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_13440 42158 42868 gene locus_tag LOCUS_13450 42158 42868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_13450 42865 43686 gene locus_tag LOCUS_13460 42865 43686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205674.1 protein_id gnl|my_center|LOCUS_13460 43655 44131 gene locus_tag LOCUS_13470 gene ybaK 43655 44131 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868926.1 protein_id gnl|my_center|LOCUS_13470 44896 47328 gene locus_tag LOCUS_13480 44896 47328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence023 2578 2171 gene locus_tag LOCUS_13490 2578 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3020 2640 gene locus_tag LOCUS_13500 3020 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4711 4496 gene locus_tag LOCUS_13510 4711 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5171 4968 gene locus_tag LOCUS_13520 5171 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5971 5168 gene locus_tag LOCUS_13530 5971 5168 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013747453.1 protein_id gnl|my_center|LOCUS_13530 6793 5972 gene locus_tag LOCUS_13540 6793 5972 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_13540 7309 7473 gene locus_tag LOCUS_13550 7309 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 8393 8175 gene locus_tag LOCUS_13560 8393 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8892 8665 gene locus_tag LOCUS_13570 8892 8665 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546684.1 protein_id gnl|my_center|LOCUS_13570 9522 9755 gene locus_tag LOCUS_13580 9522 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 9752 10057 gene locus_tag LOCUS_13590 9752 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 11994 10435 gene locus_tag LOCUS_13600 11994 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365927.1 protein_id gnl|my_center|LOCUS_13600 14991 13213 gene locus_tag LOCUS_13610 gene aspS 14991 13213 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830852.1 protein_id gnl|my_center|LOCUS_13610 15109 15354 gene locus_tag LOCUS_13620 15109 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 16011 16754 gene locus_tag LOCUS_13630 16011 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16765 18810 gene locus_tag LOCUS_13640 16765 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 18826 20130 gene locus_tag LOCUS_13650 18826 20130 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680036.1 protein_id gnl|my_center|LOCUS_13650 20273 21664 gene locus_tag LOCUS_13660 20273 21664 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_13660 22941 21730 gene locus_tag LOCUS_13670 22941 21730 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_13670 24840 23065 gene locus_tag LOCUS_13680 24840 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 26735 25026 gene locus_tag LOCUS_13690 26735 25026 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_13690 28929 26830 gene locus_tag LOCUS_13700 28929 26830 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_13700 29225 28944 gene locus_tag LOCUS_13710 29225 28944 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084925.1 protein_id gnl|my_center|LOCUS_13710 29836 29222 gene locus_tag LOCUS_13720 29836 29222 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_13720 30567 29833 gene locus_tag LOCUS_13730 30567 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 30740 33157 gene locus_tag LOCUS_13740 30740 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 36725 33195 gene locus_tag LOCUS_13750 36725 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 37217 36876 gene locus_tag LOCUS_13760 37217 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 37836 37210 gene locus_tag LOCUS_13770 37836 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 38580 37849 gene locus_tag LOCUS_13780 38580 37849 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_13780 39713 38910 gene locus_tag LOCUS_13790 39713 38910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 40365 39838 gene locus_tag LOCUS_13800 40365 39838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 40924 40625 gene locus_tag LOCUS_13810 40924 40625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 41791 41093 gene locus_tag LOCUS_13820 41791 41093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 42210 41797 gene locus_tag LOCUS_13830 42210 41797 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259362.1 protein_id gnl|my_center|LOCUS_13830 42387 42235 gene locus_tag LOCUS_13840 42387 42235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 44410 42392 gene locus_tag LOCUS_13850 gene tkt 44410 42392 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_13850 44895 46190 gene locus_tag LOCUS_13860 44895 46190 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_13860 46183 46818 gene locus_tag LOCUS_13870 46183 46818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence024 688 1098 gene locus_tag LOCUS_13880 688 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3645 1165 gene locus_tag LOCUS_13890 3645 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 6467 4185 gene locus_tag LOCUS_13900 6467 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 8526 7084 gene locus_tag LOCUS_13910 8526 7084 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_13910 9344 9102 gene locus_tag LOCUS_13920 9344 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 11490 9370 gene locus_tag LOCUS_13930 11490 9370 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_13930 11951 11490 gene locus_tag LOCUS_13940 11951 11490 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_13940 12283 15381 gene locus_tag LOCUS_13950 12283 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 17191 15500 gene locus_tag LOCUS_13960 17191 15500 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_13960 17951 17247 gene locus_tag LOCUS_13970 17951 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 18353 19285 gene locus_tag LOCUS_13980 gene porQ 18353 19285 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_13980 20856 19720 gene locus_tag LOCUS_13990 20856 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 22774 21155 gene locus_tag LOCUS_14000 22774 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 24686 23193 gene locus_tag LOCUS_14010 24686 23193 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405055.1 protein_id gnl|my_center|LOCUS_14010 24841 25449 gene locus_tag LOCUS_14020 24841 25449 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_14020 25460 26455 gene locus_tag LOCUS_14030 25460 26455 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_14030 27420 26605 gene locus_tag LOCUS_14040 27420 26605 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583860.1 protein_id gnl|my_center|LOCUS_14040 27979 27422 gene locus_tag LOCUS_14050 gene amrA 27979 27422 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_14050 28842 28018 gene locus_tag LOCUS_14060 28842 28018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 30333 28957 gene locus_tag LOCUS_14070 30333 28957 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_14070 30489 30911 gene locus_tag LOCUS_14080 30489 30911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 30908 31105 gene locus_tag LOCUS_14090 30908 31105 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_14090 31107 31451 gene locus_tag LOCUS_14100 31107 31451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 31535 32350 gene locus_tag LOCUS_14110 31535 32350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 34128 32431 gene locus_tag LOCUS_14120 34128 32431 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_14120 36660 34192 gene locus_tag LOCUS_14130 gene priA 36660 34192 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_14130 37202 36660 gene locus_tag LOCUS_14140 37202 36660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 38314 37262 gene locus_tag LOCUS_14150 38314 37262 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_14150 39878 38439 gene locus_tag LOCUS_14160 39878 38439 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_14160 42051 39994 gene locus_tag LOCUS_14170 42051 39994 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_14170 44135 42276 gene locus_tag LOCUS_14180 44135 42276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 46021 44477 gene locus_tag LOCUS_14190 46021 44477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence025 236 916 gene locus_tag LOCUS_14200 236 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 929 1396 gene locus_tag LOCUS_14210 929 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1465 1923 gene locus_tag LOCUS_14220 gene smpB 1465 1923 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_14220 2051 3265 gene locus_tag LOCUS_14230 gene tyrS 2051 3265 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932250.1 protein_id gnl|my_center|LOCUS_14230 3289 3834 gene locus_tag LOCUS_14240 3289 3834 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_14240 3850 4776 gene locus_tag LOCUS_14250 3850 4776 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_14250 6009 4732 gene locus_tag LOCUS_14260 6009 4732 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_14260 6778 6116 gene locus_tag LOCUS_14270 6778 6116 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_14270 9249 6781 gene locus_tag LOCUS_14280 9249 6781 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_14280 12068 9420 gene locus_tag LOCUS_14290 12068 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 13724 12180 gene locus_tag LOCUS_14300 13724 12180 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_14300 14394 13744 gene locus_tag LOCUS_14310 14394 13744 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_14310 15608 14400 gene locus_tag LOCUS_14320 gene aroC 15608 14400 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545839.1 protein_id gnl|my_center|LOCUS_14320 17176 15689 gene locus_tag LOCUS_14330 17176 15689 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404792.1 protein_id gnl|my_center|LOCUS_14330 18004 17264 gene locus_tag LOCUS_14340 18004 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 19008 18001 gene locus_tag LOCUS_14350 gene mtnA 19008 18001 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460451.1 protein_id gnl|my_center|LOCUS_14350 20122 19211 gene locus_tag LOCUS_14360 20122 19211 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_14360 20700 20239 gene locus_tag LOCUS_14370 20700 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 24268 20843 gene locus_tag LOCUS_14380 24268 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_14380 24736 27096 gene locus_tag LOCUS_14390 24736 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 27169 28635 gene locus_tag LOCUS_14400 gene gltX 27169 28635 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931991.1 protein_id gnl|my_center|LOCUS_14400 30496 28796 gene locus_tag LOCUS_14410 30496 28796 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_14410 30816 30607 gene locus_tag LOCUS_14420 30816 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 31024 30833 gene locus_tag LOCUS_14430 31024 30833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 31257 31343 gene locus_tag LOCUS_t00270 31257 31343 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31424 31984 gene locus_tag LOCUS_14440 31424 31984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 31989 32426 gene locus_tag LOCUS_14450 31989 32426 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_14450 34033 32423 gene locus_tag LOCUS_14460 34033 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 34984 34109 gene locus_tag LOCUS_14470 34984 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 36081 34981 gene locus_tag LOCUS_14480 gene mvk 36081 34981 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870599.1 protein_id gnl|my_center|LOCUS_14480 37740 36094 gene locus_tag LOCUS_14490 37740 36094 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_14490 37905 37768 gene locus_tag LOCUS_14500 37905 37768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 39362 37947 gene locus_tag LOCUS_14510 39362 37947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_14510 40786 39506 gene locus_tag LOCUS_14520 gene purD 40786 39506 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_14520 42072 40786 gene locus_tag LOCUS_14530 42072 40786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_14530 43553 42081 gene locus_tag LOCUS_14540 gene guaB 43553 42081 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404245.1 protein_id gnl|my_center|LOCUS_14540 44744 43575 gene locus_tag LOCUS_14550 44744 43575 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_14550 44973 45063 gene locus_tag LOCUS_t00280 44973 45063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence026 <1 732 gene locus_tag LOCUS_14560 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443944.1:NADH-quinone oxidoreductase subunit NuoF 931 1923 gene locus_tag LOCUS_14570 gene gap 931 1923 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_14570 1992 3191 gene locus_tag LOCUS_14580 1992 3191 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_14580 3205 4131 gene locus_tag LOCUS_14590 3205 4131 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_14590 4128 4493 gene locus_tag LOCUS_14600 4128 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7020 4429 gene locus_tag LOCUS_14610 7020 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7452 8390 gene locus_tag LOCUS_14620 7452 8390 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14620 8411 9607 gene locus_tag LOCUS_14630 8411 9607 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_14630 9668 10459 gene locus_tag LOCUS_14640 9668 10459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_14640 10980 10573 gene locus_tag LOCUS_14650 10980 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11204 12073 gene locus_tag LOCUS_14660 gene hpnC 11204 12073 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_14660 12045 12887 gene locus_tag LOCUS_14670 gene hpnD 12045 12887 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225224.1 protein_id gnl|my_center|LOCUS_14670 12888 14171 gene locus_tag LOCUS_14680 gene hpnE 12888 14171 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_14680 14180 14674 gene locus_tag LOCUS_14690 14180 14674 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_14690 14944 21831 gene locus_tag LOCUS_14700 gene sprA 14944 21831 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_14700 21881 23452 gene locus_tag LOCUS_14710 21881 23452 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_14710 23452 23877 gene locus_tag LOCUS_14720 gene tsaE 23452 23877 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_14720 23874 24545 gene locus_tag LOCUS_14730 gene tsaB 23874 24545 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_14730 24542 25258 gene locus_tag LOCUS_14740 24542 25258 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_14740 25261 26100 gene locus_tag LOCUS_14750 gene accD 25261 26100 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933219.1 protein_id gnl|my_center|LOCUS_14750 26899 26126 gene locus_tag LOCUS_14760 26899 26126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 27151 29067 gene locus_tag LOCUS_14770 gene dnaK 27151 29067 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_14770 29176 30273 gene locus_tag LOCUS_14780 29176 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 30275 31297 gene locus_tag LOCUS_14790 gene ruvB 30275 31297 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_14790 31313 33190 gene locus_tag LOCUS_14800 31313 33190 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_14800 33422 34606 gene locus_tag LOCUS_14810 33422 34606 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_14810 34673 36022 gene locus_tag LOCUS_14820 34673 36022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 36319 38046 gene locus_tag LOCUS_14830 36319 38046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 38046 38867 gene locus_tag LOCUS_14840 38046 38867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 38977 41586 gene locus_tag LOCUS_14850 38977 41586 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_14850 41651 42028 gene locus_tag LOCUS_14860 41651 42028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 42314 42240 gene locus_tag LOCUS_t00290 42314 42240 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 150 1775 gene locus_tag LOCUS_14870 150 1775 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_14870 1790 3298 gene locus_tag LOCUS_14880 1790 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3371 3979 gene locus_tag LOCUS_14890 gene purN 3371 3979 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_14890 4011 5528 gene locus_tag LOCUS_14900 gene purH 4011 5528 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932012.1 protein_id gnl|my_center|LOCUS_14900 5537 6565 gene locus_tag LOCUS_14910 5537 6565 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_14910 6565 7398 gene locus_tag LOCUS_14920 gene mreC 6565 7398 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546337.1 protein_id gnl|my_center|LOCUS_14920 7395 7886 gene locus_tag LOCUS_14930 7395 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7883 9697 gene locus_tag LOCUS_14940 gene mrdA 7883 9697 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_14940 9687 10916 gene locus_tag LOCUS_14950 gene rodA 9687 10916 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_14950 10923 11720 gene locus_tag LOCUS_14960 gene pyrF 10923 11720 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931823.1 protein_id gnl|my_center|LOCUS_14960 11816 13303 gene locus_tag LOCUS_14970 11816 13303 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_14970 13874 13287 gene locus_tag LOCUS_14980 13874 13287 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_14980 14859 13891 gene locus_tag LOCUS_14990 14859 13891 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_14990 15620 14868 gene locus_tag LOCUS_15000 15620 14868 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_15000 15763 16053 gene locus_tag LOCUS_15010 15763 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 16447 16046 gene locus_tag LOCUS_15020 16447 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 16823 17356 gene locus_tag LOCUS_15030 16823 17356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 17398 18663 gene locus_tag LOCUS_15040 17398 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 18674 19876 gene locus_tag LOCUS_15050 18674 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 19877 20812 gene locus_tag LOCUS_15060 19877 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 22081 21044 gene locus_tag LOCUS_15070 22081 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 25668 22123 gene locus_tag LOCUS_15080 25668 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 28533 25690 gene locus_tag LOCUS_15090 28533 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 30634 28715 gene locus_tag LOCUS_15100 30634 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 31097 31010 gene locus_tag LOCUS_t00300 31097 31010 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31719 31630 gene locus_tag LOCUS_t00310 31719 31630 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32129 31767 gene locus_tag LOCUS_15110 32129 31767 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_15110 32301 32981 gene locus_tag LOCUS_15120 32301 32981 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_15120 32987 33706 gene locus_tag LOCUS_15130 32987 33706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 33699 34592 gene locus_tag LOCUS_15140 33699 34592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 35623 34589 gene locus_tag LOCUS_15150 35623 34589 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_15150 35742 35957 gene locus_tag LOCUS_15160 35742 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 36077 37429 gene locus_tag LOCUS_15170 36077 37429 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_15170 38178 37426 gene locus_tag LOCUS_15180 38178 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 39883 38162 gene locus_tag LOCUS_15190 39883 38162 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404191.1 protein_id gnl|my_center|LOCUS_15190 40772 39915 gene locus_tag LOCUS_15200 40772 39915 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_15200 41439 40774 gene locus_tag LOCUS_15210 41439 40774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence028 3672 1561 gene locus_tag LOCUS_15220 3672 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5750 3669 gene locus_tag LOCUS_15230 5750 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6987 5821 gene locus_tag LOCUS_15240 6987 5821 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_15240 7457 7074 gene locus_tag LOCUS_15250 7457 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7741 7511 gene locus_tag LOCUS_15260 7741 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 9796 7769 gene locus_tag LOCUS_15270 gene dnaG 9796 7769 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_15270 9767 11761 gene locus_tag LOCUS_15280 9767 11761 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_15280 11871 13055 gene locus_tag LOCUS_15290 11871 13055 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_15290 13067 13801 gene locus_tag LOCUS_15300 13067 13801 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_15300 14413 16137 gene locus_tag LOCUS_15310 gene recJ 14413 16137 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_15310 16147 16869 gene locus_tag LOCUS_15320 16147 16869 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_15320 16946 17485 gene locus_tag LOCUS_15330 gene ruvC 16946 17485 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405380.1 protein_id gnl|my_center|LOCUS_15330 17543 17917 gene locus_tag LOCUS_15340 17543 17917 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180982954.1 protein_id gnl|my_center|LOCUS_15340 17960 18538 gene locus_tag LOCUS_15350 gene ruvA 17960 18538 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_15350 19195 18539 gene locus_tag LOCUS_15360 19195 18539 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_15360 20437 19256 gene locus_tag LOCUS_15370 20437 19256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_15370 21899 20649 gene locus_tag LOCUS_15380 gene clpX 21899 20649 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932095.1 protein_id gnl|my_center|LOCUS_15380 23746 21908 gene locus_tag LOCUS_15390 23746 21908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 24510 23935 gene locus_tag LOCUS_15400 24510 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 24963 26048 gene locus_tag LOCUS_15410 24963 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 26188 27333 gene locus_tag LOCUS_15420 26188 27333 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_15420 27465 27797 gene locus_tag LOCUS_15430 27465 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 27948 29303 gene locus_tag LOCUS_15440 gene rseP 27948 29303 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_15440 29558 30682 gene locus_tag LOCUS_15450 29558 30682 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_15450 30679 31398 gene locus_tag LOCUS_15460 30679 31398 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_15460 33409 31472 gene locus_tag LOCUS_15470 33409 31472 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 protein_id gnl|my_center|LOCUS_15470 33634 33918 gene locus_tag LOCUS_15480 33634 33918 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_15480 33989 34402 gene locus_tag LOCUS_15490 33989 34402 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_15490 34525 36906 gene locus_tag LOCUS_15500 34525 36906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 36920 38248 gene locus_tag LOCUS_15510 36920 38248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_15510 38266 39369 gene locus_tag LOCUS_15520 38266 39369 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099154.1 protein_id gnl|my_center|LOCUS_15520 40814 39471 gene locus_tag LOCUS_15530 40814 39471 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932503.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence029 110 562 gene locus_tag LOCUS_15540 110 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 814 1191 gene locus_tag LOCUS_15550 814 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1561 2823 gene locus_tag LOCUS_15560 1561 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3342 3034 gene locus_tag LOCUS_15570 3342 3034 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_15570 3601 3329 gene locus_tag LOCUS_15580 3601 3329 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461031.1 protein_id gnl|my_center|LOCUS_15580 3922 4006 gene locus_tag LOCUS_t00320 3922 4006 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4045 4806 gene locus_tag LOCUS_15590 4045 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4861 5490 gene locus_tag LOCUS_15600 4861 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5699 8665 gene locus_tag LOCUS_15610 5699 8665 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838961.1 protein_id gnl|my_center|LOCUS_15610 8662 10257 gene locus_tag LOCUS_15620 8662 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10269 12344 gene locus_tag LOCUS_15630 10269 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 12363 13019 gene locus_tag LOCUS_15640 12363 13019 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_15640 13028 13432 gene locus_tag LOCUS_15650 13028 13432 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263091.1 protein_id gnl|my_center|LOCUS_15650 13435 14136 gene locus_tag LOCUS_15660 13435 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 14407 14108 gene locus_tag LOCUS_15670 14407 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 14922 14416 gene locus_tag LOCUS_15680 14922 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 15158 14919 gene locus_tag LOCUS_15690 15158 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 16244 15396 gene locus_tag LOCUS_15700 16244 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 16469 17185 gene locus_tag LOCUS_15710 16469 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 17892 18515 gene locus_tag LOCUS_15720 17892 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 18764 18837 gene locus_tag LOCUS_t00330 18764 18837 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19029 19271 gene locus_tag LOCUS_15730 19029 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 19415 19657 gene locus_tag LOCUS_15740 19415 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 19692 19766 gene locus_tag LOCUS_t00340 19692 19766 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19818 20165 gene locus_tag LOCUS_15750 19818 20165 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181227.1 protein_id gnl|my_center|LOCUS_15750 20149 20802 gene locus_tag LOCUS_15760 gene nth 20149 20802 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_15760 20805 21368 gene locus_tag LOCUS_15770 20805 21368 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_15770 21620 25600 gene locus_tag LOCUS_15780 gene porU 21620 25600 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_15780 25699 26898 gene locus_tag LOCUS_15790 gene porV 25699 26898 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_15790 26905 29949 gene locus_tag LOCUS_15800 26905 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 29977 33117 gene locus_tag LOCUS_15810 29977 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 33130 33999 gene locus_tag LOCUS_15820 33130 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 34095 35405 gene locus_tag LOCUS_15830 gene der 34095 35405 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_15830 35415 36044 gene locus_tag LOCUS_15840 gene upp 35415 36044 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404039.1 protein_id gnl|my_center|LOCUS_15840 36031 37059 gene locus_tag LOCUS_15850 36031 37059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 37153 39324 gene locus_tag LOCUS_15860 37153 39324 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_15860 39321 39803 gene locus_tag LOCUS_15870 gene ruvX 39321 39803 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869779.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence030 184 2271 gene locus_tag LOCUS_15880 184 2271 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_15880 2346 3908 gene locus_tag LOCUS_15890 2346 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 5466 4051 gene locus_tag LOCUS_15900 gene lpdA 5466 4051 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_15900 5907 5482 gene locus_tag LOCUS_15910 5907 5482 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146390657.1 protein_id gnl|my_center|LOCUS_15910 7586 5925 gene locus_tag LOCUS_15920 gene aceF 7586 5925 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 protein_id gnl|my_center|LOCUS_15920 8043 7672 gene locus_tag LOCUS_15930 8043 7672 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_15930 10771 8099 gene locus_tag LOCUS_15940 gene aceE 10771 8099 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_15940 11202 11834 gene locus_tag LOCUS_15950 11202 11834 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_15950 11838 12194 gene locus_tag LOCUS_15960 11838 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 12438 13382 gene locus_tag LOCUS_15970 12438 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 13845 13465 gene locus_tag LOCUS_15980 13845 13465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 15487 14093 gene locus_tag LOCUS_15990 15487 14093 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_15990 16614 15514 gene locus_tag LOCUS_16000 16614 15514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 16740 17507 gene locus_tag LOCUS_16010 16740 17507 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_16010 18373 17504 gene locus_tag LOCUS_16020 18373 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 18606 19850 gene locus_tag LOCUS_16030 18606 19850 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_16030 19838 20623 gene locus_tag LOCUS_16040 19838 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 20640 21818 gene locus_tag LOCUS_16050 20640 21818 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838751.1 protein_id gnl|my_center|LOCUS_16050 21865 22749 gene locus_tag LOCUS_16060 21865 22749 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838999.1 protein_id gnl|my_center|LOCUS_16060 22799 23266 gene locus_tag LOCUS_16070 22799 23266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 24606 23419 gene locus_tag LOCUS_16080 24606 23419 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_16080 25068 24616 gene locus_tag LOCUS_16090 25068 24616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 26134 25073 gene locus_tag LOCUS_16100 26134 25073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 27195 26140 gene locus_tag LOCUS_16110 27195 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 29651 27444 gene locus_tag LOCUS_16120 gene recG 29651 27444 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_16120 31226 29748 gene locus_tag LOCUS_16130 31226 29748 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_16130 31894 31490 gene locus_tag LOCUS_16140 31894 31490 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_16140 33903 31891 gene locus_tag LOCUS_16150 33903 31891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 37470 33913 gene locus_tag LOCUS_16160 37470 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence031 442 215 gene locus_tag LOCUS_16170 442 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 462 755 gene locus_tag LOCUS_16180 462 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1288 839 gene locus_tag LOCUS_16190 1288 839 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_16190 1594 1307 gene locus_tag LOCUS_16200 1594 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1800 1594 gene locus_tag LOCUS_16210 1800 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3343 2093 gene locus_tag LOCUS_16220 3343 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4586 3423 gene locus_tag LOCUS_16230 4586 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6005 4683 gene locus_tag LOCUS_16240 6005 4683 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_16240 6176 7639 gene locus_tag LOCUS_16250 6176 7639 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_16250 8377 7823 gene locus_tag LOCUS_16260 8377 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9063 8413 gene locus_tag LOCUS_16270 9063 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9875 9084 gene locus_tag LOCUS_16280 9875 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10643 9990 gene locus_tag LOCUS_16290 10643 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 11193 10663 gene locus_tag LOCUS_16300 11193 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 12531 11392 gene locus_tag LOCUS_16310 12531 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 17157 12985 gene locus_tag LOCUS_16320 17157 12985 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_16320 18939 17182 gene locus_tag LOCUS_16330 18939 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 21363 18967 gene locus_tag LOCUS_16340 21363 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 21549 22343 gene locus_tag LOCUS_16350 21549 22343 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023319.1 protein_id gnl|my_center|LOCUS_16350 22349 23155 gene locus_tag LOCUS_16360 22349 23155 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860303.1 protein_id gnl|my_center|LOCUS_16360 24431 23190 gene locus_tag LOCUS_16370 24431 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 24615 25388 gene locus_tag LOCUS_16380 24615 25388 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_16380 25888 25382 gene locus_tag LOCUS_16390 25888 25382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 27116 26190 gene locus_tag LOCUS_16400 27116 26190 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_16400 27290 28066 gene locus_tag LOCUS_16410 27290 28066 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_16410 28101 30179 gene locus_tag LOCUS_16420 28101 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 30320 32272 gene locus_tag LOCUS_16430 30320 32272 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_16430 32350 32721 gene locus_tag LOCUS_16440 32350 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 32732 34192 gene locus_tag LOCUS_16450 32732 34192 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_16450 34365 35723 gene locus_tag LOCUS_16460 34365 35723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_16460 35770 36390 gene locus_tag LOCUS_16470 35770 36390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 36351 36548 gene locus_tag LOCUS_16480 36351 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 36626 37591 gene locus_tag LOCUS_16490 36626 37591 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_16490 37968 37597 gene locus_tag LOCUS_16500 37968 37597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 38171 37965 gene locus_tag LOCUS_16510 38171 37965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence032 206 1303 gene locus_tag LOCUS_16520 206 1303 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_16520 1305 1640 gene locus_tag LOCUS_16530 1305 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1644 3302 gene locus_tag LOCUS_16540 gene hutU 1644 3302 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_16540 3346 3711 gene locus_tag LOCUS_16550 3346 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 3826 5028 gene locus_tag LOCUS_16560 3826 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5272 6444 gene locus_tag LOCUS_16570 5272 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7207 6446 gene locus_tag LOCUS_16580 7207 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7596 7252 gene locus_tag LOCUS_16590 gene rplS 7596 7252 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_16590 8279 7593 gene locus_tag LOCUS_16600 gene trmD 8279 7593 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_16600 8781 8269 gene locus_tag LOCUS_16610 8781 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 9029 8796 gene locus_tag LOCUS_16620 9029 8796 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_16620 9565 9161 gene locus_tag LOCUS_16630 gene rpsP 9565 9161 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932838.1 protein_id gnl|my_center|LOCUS_16630 10920 9598 gene locus_tag LOCUS_16640 gene ffh 10920 9598 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404376.1 protein_id gnl|my_center|LOCUS_16640 11828 10950 gene locus_tag LOCUS_16650 11828 10950 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_16650 13385 11844 gene locus_tag LOCUS_16660 gene atpA 13385 11844 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_16660 13969 13415 gene locus_tag LOCUS_16670 13969 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 14541 13972 gene locus_tag LOCUS_16680 14541 13972 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_16680 14802 14584 gene locus_tag LOCUS_16690 gene atpE 14802 14584 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403674.1 protein_id gnl|my_center|LOCUS_16690 15685 14843 gene locus_tag LOCUS_16700 15685 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 16318 16064 gene locus_tag LOCUS_16710 16318 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 16699 16322 gene locus_tag LOCUS_16720 16699 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 17524 16709 gene locus_tag LOCUS_16730 17524 16709 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_16730 18174 17539 gene locus_tag LOCUS_16740 18174 17539 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_16740 19195 18161 gene locus_tag LOCUS_16750 19195 18161 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_16750 20065 19196 gene locus_tag LOCUS_16760 20065 19196 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_16760 21535 20168 gene locus_tag LOCUS_16770 21535 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 22627 21611 gene locus_tag LOCUS_16780 22627 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 26260 22685 gene locus_tag LOCUS_16790 26260 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 29190 26296 gene locus_tag LOCUS_16800 29190 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 31134 29317 gene locus_tag LOCUS_16810 31134 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 32906 31323 gene locus_tag LOCUS_16820 gene serA 32906 31323 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_16820 33263 32943 gene locus_tag LOCUS_16830 gene trxA 33263 32943 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_16830 34127 33291 gene locus_tag LOCUS_16840 34127 33291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_16840 37679 34218 gene locus_tag LOCUS_16850 gene dnaE 37679 34218 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence033 1021 326 gene locus_tag LOCUS_16860 1021 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1879 1025 gene locus_tag LOCUS_16870 1879 1025 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16870 2398 1994 gene locus_tag LOCUS_16880 2398 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2558 2376 gene locus_tag LOCUS_16890 2558 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3714 2551 gene locus_tag LOCUS_16900 3714 2551 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_16900 5612 3747 gene locus_tag LOCUS_16910 5612 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6278 5694 gene locus_tag LOCUS_16920 gene yihA 6278 5694 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830838.1 protein_id gnl|my_center|LOCUS_16920 6827 6339 gene locus_tag LOCUS_16930 6827 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 7840 6845 gene locus_tag LOCUS_16940 7840 6845 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_16940 8499 7873 gene locus_tag LOCUS_16950 gene rpsD 8499 7873 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_16950 8904 8518 gene locus_tag LOCUS_16960 gene rpsK 8904 8518 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933817.1 protein_id gnl|my_center|LOCUS_16960 9313 8930 gene locus_tag LOCUS_16970 gene rpsM 9313 8930 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_16970 9675 9457 gene locus_tag LOCUS_16980 gene infA 9675 9457 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_16980 10437 9676 gene locus_tag LOCUS_16990 gene map 10437 9676 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_16990 11781 10444 gene locus_tag LOCUS_17000 gene secY 11781 10444 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_17000 12252 11791 gene locus_tag LOCUS_17010 gene rplO 12252 11791 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_17010 12447 12262 gene locus_tag LOCUS_17020 gene rpmD 12447 12262 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_17020 12967 12455 gene locus_tag LOCUS_17030 gene rpsE 12967 12455 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_17030 13087 13014 gene locus_tag LOCUS_t00350 13087 13014 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13456 13091 gene locus_tag LOCUS_17040 gene rplR 13456 13091 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_17040 14019 13480 gene locus_tag LOCUS_17050 gene rplF 14019 13480 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_17050 14435 14040 gene locus_tag LOCUS_17060 gene rpsH 14435 14040 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894501.1 protein_id gnl|my_center|LOCUS_17060 14717 14448 gene locus_tag LOCUS_17070 gene rpsN 14717 14448 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233455.1 protein_id gnl|my_center|LOCUS_17070 15383 14736 gene locus_tag LOCUS_17080 gene rplE 15383 14736 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 protein_id gnl|my_center|LOCUS_17080 15734 15408 gene locus_tag LOCUS_17090 gene rplX 15734 15408 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_17090 16116 15748 gene locus_tag LOCUS_17100 gene rplN 16116 15748 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403805.1 protein_id gnl|my_center|LOCUS_17100 16388 16131 gene locus_tag LOCUS_17110 gene rpsQ 16388 16131 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_17110 16623 16390 gene locus_tag LOCUS_17120 gene rpmC 16623 16390 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_17120 17057 16641 gene locus_tag LOCUS_17130 gene rplP 17057 16641 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_17130 17719 17078 gene locus_tag LOCUS_17140 gene rpsC 17719 17078 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_17140 18080 17736 gene locus_tag LOCUS_17150 gene rplV 18080 17736 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933837.1 protein_id gnl|my_center|LOCUS_17150 18383 18099 gene locus_tag LOCUS_17160 gene rpsS 18383 18099 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_17160 19225 18401 gene locus_tag LOCUS_17170 gene rplB 19225 18401 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_17170 19543 19247 gene locus_tag LOCUS_17180 gene rplW 19543 19247 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_17180 20198 19545 gene locus_tag LOCUS_17190 gene rplD 20198 19545 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933841.1 protein_id gnl|my_center|LOCUS_17190 20835 20212 gene locus_tag LOCUS_17200 gene rplC 20835 20212 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_17200 21161 20853 gene locus_tag LOCUS_17210 gene rpsJ 21161 20853 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_17210 22441 21236 gene locus_tag LOCUS_17220 gene tuf 22441 21236 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_17220 24583 22487 gene locus_tag LOCUS_17230 gene fusA 24583 22487 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_17230 25071 24604 gene locus_tag LOCUS_17240 gene rpsG 25071 24604 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403791.1 protein_id gnl|my_center|LOCUS_17240 25455 25075 gene locus_tag LOCUS_17250 gene rpsL 25455 25075 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_17250 29862 25603 gene locus_tag LOCUS_17260 gene rpoC 29862 25603 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404501.1 protein_id gnl|my_center|LOCUS_17260 33661 29903 gene locus_tag LOCUS_17270 gene rpoB 33661 29903 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_17270 34172 33792 gene locus_tag LOCUS_17280 gene rplL 34172 33792 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_17280 34727 34206 gene locus_tag LOCUS_17290 gene rplJ 34727 34206 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_17290 35495 34800 gene locus_tag LOCUS_17300 gene rplA 35495 34800 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931846.1 protein_id gnl|my_center|LOCUS_17300 35962 35537 gene locus_tag LOCUS_17310 gene rplK 35962 35537 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_17310 36527 35991 gene locus_tag LOCUS_17320 gene nusG 36527 35991 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404507.1 protein_id gnl|my_center|LOCUS_17320 36721 36539 gene locus_tag LOCUS_17330 gene secE 36721 36539 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728078.1 protein_id gnl|my_center|LOCUS_17330 36815 36741 gene locus_tag LOCUS_t00360 36815 36741 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36985 36821 gene locus_tag LOCUS_17340 gene rpmG 36985 36821 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_17340 37131 37058 gene locus_tag LOCUS_t00370 37131 37058 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37261 37187 gene locus_tag LOCUS_t00380 37261 37187 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37395 37311 gene locus_tag LOCUS_t00390 37395 37311 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 26 2375 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaattccactatggttcgattaaaac 4396 2696 gene locus_tag LOCUS_17350 4396 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4707 4414 gene locus_tag LOCUS_17360 gene cas2 4707 4414 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023576.1 protein_id gnl|my_center|LOCUS_17360 5701 4685 gene locus_tag LOCUS_17370 gene cas1b 5701 4685 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_17370 6101 5856 gene locus_tag LOCUS_17380 6101 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 6481 6155 gene locus_tag LOCUS_17390 6481 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 7767 6679 gene locus_tag LOCUS_17400 gene csm6 7767 6679 CDS product CRISPR-associated ring nuclease Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546577.1 protein_id gnl|my_center|LOCUS_17400 8804 7764 gene locus_tag LOCUS_17410 8804 7764 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_17410 10033 8801 gene locus_tag LOCUS_17420 10033 8801 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876700.1 protein_id gnl|my_center|LOCUS_17420 10748 10104 gene locus_tag LOCUS_17430 10748 10104 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_17430 12412 10814 gene locus_tag LOCUS_17440 gene csm5 12412 10814 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_17440 13481 12402 gene locus_tag LOCUS_17450 gene csm4 13481 12402 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582982.1 protein_id gnl|my_center|LOCUS_17450 14139 13450 gene locus_tag LOCUS_17460 gene csm3 14139 13450 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582983.1 protein_id gnl|my_center|LOCUS_17460 14621 14139 gene locus_tag LOCUS_17470 14621 14139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 17115 14614 gene locus_tag LOCUS_17480 gene cas10 17115 14614 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582985.1 protein_id gnl|my_center|LOCUS_17480 18079 17285 gene locus_tag LOCUS_17490 gene cas6 18079 17285 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_17490 18576 20339 gene locus_tag LOCUS_17500 18576 20339 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_17500 20484 21206 gene locus_tag LOCUS_17510 20484 21206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_17510 21939 21325 gene locus_tag LOCUS_17520 21939 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 24425 22164 gene locus_tag LOCUS_17530 24425 22164 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_17530 26172 24814 gene locus_tag LOCUS_17540 26172 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 27443 26307 gene locus_tag LOCUS_17550 27443 26307 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_17550 28425 27436 gene locus_tag LOCUS_17560 28425 27436 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_17560 29445 28429 gene locus_tag LOCUS_17570 29445 28429 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_17570 29592 31220 gene locus_tag LOCUS_17580 gene bshC 29592 31220 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_17580 32539 31259 gene locus_tag LOCUS_17590 gene aroA 32539 31259 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093191255.1 protein_id gnl|my_center|LOCUS_17590 33130 32540 gene locus_tag LOCUS_17600 33130 32540 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_17600 33357 33136 gene locus_tag LOCUS_17610 33357 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 34130 33357 gene locus_tag LOCUS_17620 gene deoC 34130 33357 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448021.1 protein_id gnl|my_center|LOCUS_17620 35008 34127 gene locus_tag LOCUS_17630 35008 34127 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_17630 36000 35005 gene locus_tag LOCUS_17640 36000 35005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 36808 35972 gene locus_tag LOCUS_17650 36808 35972 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence035 536 198 gene locus_tag LOCUS_17660 gene gldC 536 198 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_17660 679 1182 gene locus_tag LOCUS_17670 679 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1952 1233 gene locus_tag LOCUS_17680 1952 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3448 2057 gene locus_tag LOCUS_17690 gene fumC 3448 2057 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_17690 4238 4651 gene locus_tag LOCUS_17700 4238 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4776 5816 gene locus_tag LOCUS_17710 gene tdh 4776 5816 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646007.1 protein_id gnl|my_center|LOCUS_17710 7146 6016 gene locus_tag LOCUS_17720 7146 6016 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_17720 7618 8808 gene locus_tag LOCUS_17730 gene kbl 7618 8808 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 protein_id gnl|my_center|LOCUS_17730 8821 9240 gene locus_tag LOCUS_17740 8821 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 9650 10159 gene locus_tag LOCUS_17750 9650 10159 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_17750 11411 10281 gene locus_tag LOCUS_17760 11411 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 12471 11542 gene locus_tag LOCUS_17770 12471 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 13954 12701 gene locus_tag LOCUS_17780 13954 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17780 15707 13977 gene locus_tag LOCUS_17790 15707 13977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 18241 15776 gene locus_tag LOCUS_17800 18241 15776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 20150 18270 gene locus_tag LOCUS_17810 20150 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 21226 20246 gene locus_tag LOCUS_17820 21226 20246 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_17820 21950 21234 gene locus_tag LOCUS_17830 21950 21234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 22947 21952 gene locus_tag LOCUS_17840 22947 21952 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_17840 23906 22980 gene locus_tag LOCUS_17850 23906 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 24712 23903 gene locus_tag LOCUS_17860 24712 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 25138 27588 gene locus_tag LOCUS_17870 25138 27588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 27629 28309 gene locus_tag LOCUS_17880 27629 28309 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_17880 28905 28339 gene locus_tag LOCUS_17890 28905 28339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 30481 28892 gene locus_tag LOCUS_17900 30481 28892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 31179 30502 gene locus_tag LOCUS_17910 31179 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 31683 31303 gene locus_tag LOCUS_17920 31683 31303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 32286 31837 gene locus_tag LOCUS_17930 32286 31837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 32706 32299 gene locus_tag LOCUS_17940 32706 32299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 33235 32726 gene locus_tag LOCUS_17950 33235 32726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 33668 33267 gene locus_tag LOCUS_17960 33668 33267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 33935 34276 gene locus_tag LOCUS_17970 33935 34276 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_17970 36629 34614 gene locus_tag LOCUS_17980 36629 34614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence036 229 1707 gene locus_tag LOCUS_17990 229 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1784 2230 gene locus_tag LOCUS_18000 1784 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2239 3144 gene locus_tag LOCUS_18010 2239 3144 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_18010 3185 3901 gene locus_tag LOCUS_18020 3185 3901 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_18020 6974 3981 gene locus_tag LOCUS_18030 6974 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7126 9714 gene locus_tag LOCUS_18040 gene alaS 7126 9714 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_18040 9714 11060 gene locus_tag LOCUS_18050 gene radA 9714 11060 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_18050 11270 11509 gene locus_tag LOCUS_18060 11270 11509 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582790.1 protein_id gnl|my_center|LOCUS_18060 11588 12910 gene locus_tag LOCUS_18070 11588 12910 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_18070 12999 13700 gene locus_tag LOCUS_18080 12999 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 13709 14899 gene locus_tag LOCUS_18090 13709 14899 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186581.1 protein_id gnl|my_center|LOCUS_18090 15047 15403 gene locus_tag LOCUS_18100 15047 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 15503 15724 gene locus_tag LOCUS_18110 15503 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 15969 15763 gene locus_tag LOCUS_18120 15969 15763 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933349.1 protein_id gnl|my_center|LOCUS_18120 16461 16153 gene locus_tag LOCUS_18130 16461 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 16691 16619 gene locus_tag LOCUS_t00400 16691 16619 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16763 18139 gene locus_tag LOCUS_18140 16763 18139 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459135.1 protein_id gnl|my_center|LOCUS_18140 18145 20130 gene locus_tag LOCUS_18150 18145 20130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 20814 20122 gene locus_tag LOCUS_18160 20814 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 24340 20816 gene locus_tag LOCUS_18170 24340 20816 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079042.1 protein_id gnl|my_center|LOCUS_18170 24709 24347 gene locus_tag LOCUS_18180 24709 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 25945 24719 gene locus_tag LOCUS_18190 25945 24719 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404032.1 protein_id gnl|my_center|LOCUS_18190 26847 25960 gene locus_tag LOCUS_18200 26847 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 28391 26844 gene locus_tag LOCUS_18210 28391 26844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 29621 28395 gene locus_tag LOCUS_18220 29621 28395 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838690.1 protein_id gnl|my_center|LOCUS_18220 31552 29759 gene locus_tag LOCUS_18230 31552 29759 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404025.1 protein_id gnl|my_center|LOCUS_18230 33483 32107 gene locus_tag LOCUS_18240 33483 32107 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840114.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence037 348 1049 gene locus_tag LOCUS_18250 348 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1054 3072 gene locus_tag LOCUS_18260 1054 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3077 3835 gene locus_tag LOCUS_18270 3077 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4134 5369 gene locus_tag LOCUS_18280 gene eutH 4134 5369 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512370.1 protein_id gnl|my_center|LOCUS_18280 5411 6514 gene locus_tag LOCUS_18290 5411 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6536 7792 gene locus_tag LOCUS_18300 6536 7792 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_18300 7874 9286 gene locus_tag LOCUS_18310 gene eutA 7874 9286 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097523.1 protein_id gnl|my_center|LOCUS_18310 9304 10665 gene locus_tag LOCUS_18320 9304 10665 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_18320 10681 11580 gene locus_tag LOCUS_18330 gene eutC 10681 11580 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372351.1 protein_id gnl|my_center|LOCUS_18330 11597 12268 gene locus_tag LOCUS_18340 gene eutL 11597 12268 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016126.1 protein_id gnl|my_center|LOCUS_18340 12280 12831 gene locus_tag LOCUS_18350 12280 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 12828 13586 gene locus_tag LOCUS_18360 12828 13586 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_18360 13586 13945 gene locus_tag LOCUS_18370 gene eutS 13586 13945 CDS product ethanolamine utilization microcompartment protein EutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356955.1 protein_id gnl|my_center|LOCUS_18370 13945 14397 gene locus_tag LOCUS_18380 gene eutP 13945 14397 CDS product ethanolamine utilization acetate kinase EutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820764.1 protein_id gnl|my_center|LOCUS_18380 14433 15128 gene locus_tag LOCUS_18390 gene eutQ 14433 15128 CDS product ethanolamine utilization acetate kinase EutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733932.1 protein_id gnl|my_center|LOCUS_18390 15141 15971 gene locus_tag LOCUS_18400 gene eutT 15141 15971 CDS product ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651289.1 protein_id gnl|my_center|LOCUS_18400 15968 16948 gene locus_tag LOCUS_18410 gene pta 15968 16948 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582987.1 protein_id gnl|my_center|LOCUS_18410 16997 17278 gene locus_tag LOCUS_18420 gene eutM 16997 17278 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_18420 17303 17590 gene locus_tag LOCUS_18430 gene eutM 17303 17590 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_18430 17663 17968 gene locus_tag LOCUS_18440 17663 17968 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_18440 17972 19381 gene locus_tag LOCUS_18450 17972 19381 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 protein_id gnl|my_center|LOCUS_18450 19387 20214 gene locus_tag LOCUS_18460 gene eutJ 19387 20214 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 protein_id gnl|my_center|LOCUS_18460 20230 21570 gene locus_tag LOCUS_18470 20230 21570 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_18470 21584 22132 gene locus_tag LOCUS_18480 21584 22132 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816702.1 protein_id gnl|my_center|LOCUS_18480 22164 22688 gene locus_tag LOCUS_18490 22164 22688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_18490 22724 23887 gene locus_tag LOCUS_18500 22724 23887 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_18500 24148 27924 gene locus_tag LOCUS_18510 24148 27924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 28058 29230 gene locus_tag LOCUS_18520 gene pgsB 28058 29230 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020724.1 protein_id gnl|my_center|LOCUS_18520 29231 29683 gene locus_tag LOCUS_18530 gene pgsC 29231 29683 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_18530 29713 30855 gene locus_tag LOCUS_18540 29713 30855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 30879 31790 gene locus_tag LOCUS_18550 30879 31790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 31793 32923 gene locus_tag LOCUS_18560 31793 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 32947 33945 gene locus_tag LOCUS_18570 32947 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence038 828 1511 gene locus_tag LOCUS_18580 828 1511 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_18580 1515 2345 gene locus_tag LOCUS_18590 1515 2345 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_18590 2642 4777 gene locus_tag LOCUS_18600 2642 4777 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_18600 4789 6744 gene locus_tag LOCUS_18610 4789 6744 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_18610 7718 6741 gene locus_tag LOCUS_18620 gene glcK 7718 6741 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_18620 7842 8630 gene locus_tag LOCUS_18630 gene rsmA 7842 8630 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020263.1 protein_id gnl|my_center|LOCUS_18630 8645 9595 gene locus_tag LOCUS_18640 8645 9595 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_18640 9601 10284 gene locus_tag LOCUS_18650 gene ubiE 9601 10284 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926864.1 protein_id gnl|my_center|LOCUS_18650 11046 10285 gene locus_tag LOCUS_18660 11046 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 11618 11043 gene locus_tag LOCUS_18670 11618 11043 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_18670 13049 11712 gene locus_tag LOCUS_18680 13049 11712 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_18680 13408 13046 gene locus_tag LOCUS_18690 13408 13046 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_18690 14210 13539 gene locus_tag LOCUS_18700 14210 13539 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_18700 15424 14318 gene locus_tag LOCUS_18710 15424 14318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 17736 15547 gene locus_tag LOCUS_18720 17736 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 18221 17733 gene locus_tag LOCUS_18730 18221 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 18497 18300 gene locus_tag LOCUS_18740 18497 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 19035 18505 gene locus_tag LOCUS_18750 19035 18505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 19969 19028 gene locus_tag LOCUS_18760 19969 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 21947 20160 gene locus_tag LOCUS_18770 21947 20160 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_18770 22319 23065 gene locus_tag LOCUS_18780 22319 23065 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_18780 23073 23900 gene locus_tag LOCUS_18790 23073 23900 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_18790 26811 23986 gene locus_tag LOCUS_18800 gene uvrA 26811 23986 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_18800 26918 27541 gene locus_tag LOCUS_18810 26918 27541 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_18810 27628 28074 gene locus_tag LOCUS_18820 27628 28074 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900138.1 protein_id gnl|my_center|LOCUS_18820 28505 28080 gene locus_tag LOCUS_18830 28505 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 29143 28502 gene locus_tag LOCUS_18840 29143 28502 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389090.1 protein_id gnl|my_center|LOCUS_18840 31193 29214 gene locus_tag LOCUS_18850 31193 29214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 32097 31255 gene locus_tag LOCUS_18860 gene lepB 32097 31255 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_18860 33908 32118 gene locus_tag LOCUS_18870 gene lepA 33908 32118 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence039 294 2720 gene locus_tag LOCUS_18880 294 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3301 2792 gene locus_tag LOCUS_18890 3301 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 5774 3321 gene locus_tag LOCUS_18900 5774 3321 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065180.1 protein_id gnl|my_center|LOCUS_18900 8692 6035 gene locus_tag LOCUS_18910 8692 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 8882 9232 gene locus_tag LOCUS_18920 gene arsC 8882 9232 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946009.1 protein_id gnl|my_center|LOCUS_18920 10101 9235 gene locus_tag LOCUS_18930 10101 9235 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_18930 10419 11645 gene locus_tag LOCUS_18940 10419 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 12315 11704 gene locus_tag LOCUS_18950 12315 11704 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210965.1 protein_id gnl|my_center|LOCUS_18950 12998 12360 gene locus_tag LOCUS_18960 12998 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 13225 13437 gene locus_tag LOCUS_18970 13225 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 13524 14102 gene locus_tag LOCUS_18980 13524 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 14111 15640 gene locus_tag LOCUS_18990 14111 15640 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986824.1 protein_id gnl|my_center|LOCUS_18990 15835 17088 gene locus_tag LOCUS_19000 15835 17088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 17552 17091 gene locus_tag LOCUS_19010 17552 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 18502 17699 gene locus_tag LOCUS_19020 18502 17699 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963894.1 protein_id gnl|my_center|LOCUS_19020 18678 18499 gene locus_tag LOCUS_19030 18678 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 19039 18650 gene locus_tag LOCUS_19040 19039 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 22034 19044 gene locus_tag LOCUS_19050 22034 19044 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_19050 23313 22231 gene locus_tag LOCUS_19060 gene ychF 23313 22231 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_19060 23707 25074 gene locus_tag LOCUS_19070 23707 25074 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_19070 25215 26018 gene locus_tag LOCUS_19080 25215 26018 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_19080 27081 26149 gene locus_tag LOCUS_19090 gene argF 27081 26149 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_19090 28095 27145 gene locus_tag LOCUS_19100 gene arcC 28095 27145 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_19100 28211 28813 gene locus_tag LOCUS_19110 gene aat 28211 28813 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403591.1 protein_id gnl|my_center|LOCUS_19110 33270 28810 gene locus_tag LOCUS_19120 33270 28810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence040 3090 1420 gene locus_tag LOCUS_19130 3090 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3541 3278 gene locus_tag LOCUS_19140 3541 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 4092 3772 gene locus_tag LOCUS_19150 4092 3772 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_19150 4350 4093 gene locus_tag LOCUS_19160 4350 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4987 4559 gene locus_tag LOCUS_19170 4987 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5394 4987 gene locus_tag LOCUS_19180 5394 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 6757 5639 gene locus_tag LOCUS_19190 6757 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 7444 6974 gene locus_tag LOCUS_19200 7444 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 7749 7459 gene locus_tag LOCUS_19210 7749 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 7960 7775 gene locus_tag LOCUS_19220 7960 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 9939 8446 gene locus_tag LOCUS_19230 gene glmU 9939 8446 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775275.1 protein_id gnl|my_center|LOCUS_19230 10080 10538 gene locus_tag LOCUS_19240 10080 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12597 10531 gene locus_tag LOCUS_19250 12597 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 14455 12590 gene locus_tag LOCUS_19260 14455 12590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_19260 15481 14468 gene locus_tag LOCUS_19270 15481 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 16371 15481 gene locus_tag LOCUS_19280 gene xerD 16371 15481 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_19280 18569 16371 gene locus_tag LOCUS_19290 18569 16371 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_19290 19421 18573 gene locus_tag LOCUS_19300 19421 18573 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948820.1 protein_id gnl|my_center|LOCUS_19300 21171 19423 gene locus_tag LOCUS_19310 21171 19423 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_19310 22761 21316 gene locus_tag LOCUS_19320 22761 21316 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_19320 23106 22762 gene locus_tag LOCUS_19330 23106 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 23646 23116 gene locus_tag LOCUS_19340 23646 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 25673 23649 gene locus_tag LOCUS_19350 gene ligA 25673 23649 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_19350 26602 25673 gene locus_tag LOCUS_19360 26602 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 28071 26620 gene locus_tag LOCUS_19370 gene rsmB 28071 26620 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_19370 29325 28072 gene locus_tag LOCUS_19380 29325 28072 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_19380 32637 29572 gene locus_tag LOCUS_19390 32637 29572 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_19390 33592 32651 gene locus_tag LOCUS_19400 33592 32651 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence041 459 1697 gene locus_tag LOCUS_19410 459 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 3926 1770 gene locus_tag LOCUS_19420 3926 1770 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_19420 4409 4089 gene locus_tag LOCUS_19430 4409 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4593 5939 gene locus_tag LOCUS_19440 4593 5939 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208062.1 protein_id gnl|my_center|LOCUS_19440 6573 5980 gene locus_tag LOCUS_19450 6573 5980 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_19450 7681 6554 gene locus_tag LOCUS_19460 7681 6554 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_19460 7764 10277 gene locus_tag LOCUS_19470 7764 10277 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_19470 10277 11713 gene locus_tag LOCUS_19480 gene pyk 10277 11713 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_19480 11715 12737 gene locus_tag LOCUS_19490 gene amrS 11715 12737 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_19490 12756 13529 gene locus_tag LOCUS_19500 12756 13529 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_19500 14148 13537 gene locus_tag LOCUS_19510 14148 13537 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_19510 14470 14709 gene locus_tag LOCUS_19520 gene rpmB 14470 14709 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_19520 15223 14780 gene locus_tag LOCUS_19530 gene rplI 15223 14780 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_19530 15477 15247 gene locus_tag LOCUS_19540 15477 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 15967 15461 gene locus_tag LOCUS_19550 gene ssb 15967 15461 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927163.1 protein_id gnl|my_center|LOCUS_19550 16421 15999 gene locus_tag LOCUS_19560 16421 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 18720 16516 gene locus_tag LOCUS_19570 18720 16516 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_19570 19338 18742 gene locus_tag LOCUS_19580 gene pth 19338 18742 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082100.1 protein_id gnl|my_center|LOCUS_19580 19979 19344 gene locus_tag LOCUS_19590 19979 19344 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_19590 20942 19998 gene locus_tag LOCUS_19600 20942 19998 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_19600 21598 21038 gene locus_tag LOCUS_19610 21598 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 21797 22081 gene locus_tag LOCUS_19620 21797 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 25274 22098 gene locus_tag LOCUS_19630 25274 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 27382 25277 gene locus_tag LOCUS_19640 gene rnr 27382 25277 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_19640 31872 27382 gene locus_tag LOCUS_19650 31872 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 32351 31878 gene locus_tag LOCUS_19660 gene rfaE2 32351 31878 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_19660 33349 32348 gene locus_tag LOCUS_19670 gene rfaE1 33349 32348 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence042 2044 125 gene locus_tag LOCUS_19680 2044 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2913 2461 gene locus_tag LOCUS_19690 2913 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 5351 2913 gene locus_tag LOCUS_19700 5351 2913 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_19700 6460 5498 gene locus_tag LOCUS_19710 6460 5498 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_19710 7083 6478 gene locus_tag LOCUS_19720 7083 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8074 7085 gene locus_tag LOCUS_19730 8074 7085 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932671.1 protein_id gnl|my_center|LOCUS_19730 9300 8080 gene locus_tag LOCUS_19740 9300 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 10852 9443 gene locus_tag LOCUS_19750 10852 9443 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_19750 11145 10861 gene locus_tag LOCUS_19760 11145 10861 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_19760 12314 11169 gene locus_tag LOCUS_19770 12314 11169 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_19770 12580 14232 gene locus_tag LOCUS_19780 12580 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14273 15571 gene locus_tag LOCUS_19790 14273 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 15624 17378 gene locus_tag LOCUS_19800 15624 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 17589 18857 gene locus_tag LOCUS_19810 17589 18857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 18854 20548 gene locus_tag LOCUS_19820 18854 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 21291 20914 gene locus_tag LOCUS_19830 21291 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19830 24648 21670 gene locus_tag LOCUS_19840 24648 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 27454 24914 gene locus_tag LOCUS_19850 27454 24914 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_19850 28888 27539 gene locus_tag LOCUS_19860 28888 27539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 29980 28964 gene locus_tag LOCUS_19870 gene aroF 29980 28964 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_19870 30618 29977 gene locus_tag LOCUS_19880 30618 29977 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_19880 33205 30611 gene locus_tag LOCUS_19890 gene mutS 33205 30611 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence043 2287 1067 gene locus_tag LOCUS_19900 2287 1067 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_19900 2707 2955 gene locus_tag LOCUS_19910 2707 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3104 3391 gene locus_tag LOCUS_19920 3104 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3415 4536 gene locus_tag LOCUS_19930 gene dprA 3415 4536 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_19930 5848 4553 gene locus_tag LOCUS_19940 5848 4553 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_19940 6183 5887 gene locus_tag LOCUS_19950 6183 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7181 6180 gene locus_tag LOCUS_19960 7181 6180 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_19960 7888 7235 gene locus_tag LOCUS_19970 7888 7235 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_19970 8868 7867 gene locus_tag LOCUS_19980 8868 7867 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_19980 9823 8873 gene locus_tag LOCUS_19990 gene metF 9823 8873 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_19990 12260 9891 gene locus_tag LOCUS_20000 12260 9891 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_20000 13403 12621 gene locus_tag LOCUS_20010 13403 12621 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_20010 14077 16272 gene locus_tag LOCUS_20020 14077 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 16605 16435 gene locus_tag LOCUS_20030 16605 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 17342 17007 gene locus_tag LOCUS_20040 17342 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 17961 17581 gene locus_tag LOCUS_20050 17961 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 18145 17948 gene locus_tag LOCUS_20060 18145 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 18832 18368 gene locus_tag LOCUS_20070 gene tnpA 18832 18368 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_20070 21185 18972 gene locus_tag LOCUS_20080 21185 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 21797 21204 gene locus_tag LOCUS_20090 21797 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 22135 22023 gene locus_tag LOCUS_r00010 22135 22023 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25209 22208 gene locus_tag LOCUS_r00020 25209 22208 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 25427 25354 gene locus_tag LOCUS_t00410 25427 25354 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25557 25483 gene locus_tag LOCUS_t00420 25557 25483 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 27225 25689 gene locus_tag LOCUS_r00030 27225 25689 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 28832 27489 gene locus_tag LOCUS_20100 28832 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 29937 28921 gene locus_tag LOCUS_20110 gene rfbB 29937 28921 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_20110 30665 29940 gene locus_tag LOCUS_20120 30665 29940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 30793 31662 gene locus_tag LOCUS_20130 gene rfbD 30793 31662 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_20130 32012 31722 gene locus_tag LOCUS_20140 32012 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 32645 32145 gene locus_tag LOCUS_20150 32645 32145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence044 118 585 gene locus_tag LOCUS_20160 118 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 840 3437 gene locus_tag LOCUS_20170 840 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3443 7039 gene locus_tag LOCUS_20180 gene smc 3443 7039 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092731919.1 protein_id gnl|my_center|LOCUS_20180 7093 9024 gene locus_tag LOCUS_20190 7093 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 9024 9746 gene locus_tag LOCUS_20200 gene mtnX 9024 9746 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_20200 9750 10349 gene locus_tag LOCUS_20210 gene lmtA 9750 10349 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_20210 10349 11500 gene locus_tag LOCUS_20220 gene lpxB 10349 11500 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931972.1 protein_id gnl|my_center|LOCUS_20220 11481 12137 gene locus_tag LOCUS_20230 11481 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 12163 13197 gene locus_tag LOCUS_20240 gene lpxK 12163 13197 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881075.1 protein_id gnl|my_center|LOCUS_20240 13187 16060 gene locus_tag LOCUS_20250 gene ppdK 13187 16060 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_20250 16179 17213 gene locus_tag LOCUS_20260 gene queA 16179 17213 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932985.1 protein_id gnl|my_center|LOCUS_20260 17210 17887 gene locus_tag LOCUS_20270 gene ispD 17210 17887 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_20270 18076 18210 gene locus_tag LOCUS_20280 18076 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 18212 18712 gene locus_tag LOCUS_20290 18212 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 18714 19793 gene locus_tag LOCUS_20300 18714 19793 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224940.1 protein_id gnl|my_center|LOCUS_20300 19965 20153 gene locus_tag LOCUS_20310 19965 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 20193 20396 gene locus_tag LOCUS_20320 20193 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 20912 23401 gene locus_tag LOCUS_20330 20912 23401 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_20330 23416 23907 gene locus_tag LOCUS_20340 23416 23907 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_20340 23911 24369 gene locus_tag LOCUS_20350 23911 24369 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481270.1 protein_id gnl|my_center|LOCUS_20350 24969 24382 gene locus_tag LOCUS_20360 24969 24382 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_20360 25292 24993 gene locus_tag LOCUS_20370 25292 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250284.1 protein_id gnl|my_center|LOCUS_20370 27050 25491 gene locus_tag LOCUS_20380 27050 25491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 27680 29806 gene locus_tag LOCUS_20390 27680 29806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 30026 30868 gene locus_tag LOCUS_20400 30026 30868 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence045 239 4273 gene locus_tag LOCUS_20410 239 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4410 4724 gene locus_tag LOCUS_20420 4410 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 4763 7240 gene locus_tag LOCUS_20430 4763 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 7614 8342 gene locus_tag LOCUS_20440 7614 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 8367 9182 gene locus_tag LOCUS_20450 8367 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 9854 9309 gene locus_tag LOCUS_20460 9854 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 10902 10183 gene locus_tag LOCUS_20470 10902 10183 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_20470 11769 11329 gene locus_tag LOCUS_20480 gene tnpA 11769 11329 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_20480 14496 11881 gene locus_tag LOCUS_20490 gene clpB 14496 11881 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_20490 14878 14585 gene locus_tag LOCUS_20500 14878 14585 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_20500 16838 14931 gene locus_tag LOCUS_20510 gene htpG 16838 14931 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939912.1 protein_id gnl|my_center|LOCUS_20510 17798 16863 gene locus_tag LOCUS_20520 17798 16863 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_20520 18415 17951 gene locus_tag LOCUS_20530 18415 17951 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_20530 18732 20084 gene locus_tag LOCUS_20540 gene mnmE 18732 20084 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_20540 20165 22042 gene locus_tag LOCUS_20550 gene mnmG 20165 22042 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_20550 22061 22747 gene locus_tag LOCUS_20560 22061 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 22784 23569 gene locus_tag LOCUS_20570 22784 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 23577 26978 gene locus_tag LOCUS_20580 gene mfd 23577 26978 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_20580 27156 27611 gene locus_tag LOCUS_20590 27156 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 27806 29278 gene locus_tag LOCUS_20600 27806 29278 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_20600 29480 30400 gene locus_tag LOCUS_20610 29480 30400 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_20610 30743 30441 gene locus_tag LOCUS_20620 30743 30441 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_20620 31621 30740 gene locus_tag LOCUS_20630 31621 30740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence046 461 1711 gene locus_tag LOCUS_20640 461 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1962 2408 gene locus_tag LOCUS_20650 1962 2408 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_20650 2618 4048 gene locus_tag LOCUS_20660 gene glnA 2618 4048 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_20660 4760 4419 gene locus_tag LOCUS_20670 4760 4419 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_20670 5493 6614 gene locus_tag LOCUS_20680 5493 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6621 8177 gene locus_tag LOCUS_20690 6621 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 8392 10506 gene locus_tag LOCUS_20700 8392 10506 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_20700 10508 10837 gene locus_tag LOCUS_20710 gene sugE 10508 10837 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 protein_id gnl|my_center|LOCUS_20710 13840 11030 gene locus_tag LOCUS_20720 13840 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 14651 13842 gene locus_tag LOCUS_20730 14651 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 15799 15146 gene locus_tag LOCUS_20740 15799 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 15839 16816 gene locus_tag LOCUS_20750 15839 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 16845 17351 gene locus_tag LOCUS_20760 16845 17351 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_20760 18573 17353 gene locus_tag LOCUS_20770 18573 17353 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765419.1 protein_id gnl|my_center|LOCUS_20770 19631 18630 gene locus_tag LOCUS_20780 19631 18630 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_20780 19748 20011 gene locus_tag LOCUS_20790 19748 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 21092 20067 gene locus_tag LOCUS_20800 gene fbp 21092 20067 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_20800 22906 21116 gene locus_tag LOCUS_20810 22906 21116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_20810 24677 22929 gene locus_tag LOCUS_20820 24677 22929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933167.1 protein_id gnl|my_center|LOCUS_20820 26132 24855 gene locus_tag LOCUS_20830 gene serS 26132 24855 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932293.1 protein_id gnl|my_center|LOCUS_20830 28774 26309 gene locus_tag LOCUS_20840 gene leuS 28774 26309 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963965.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence047 1472 345 gene locus_tag LOCUS_20850 gene gmd 1472 345 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_20850 1851 1510 gene locus_tag LOCUS_20860 1851 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2834 1869 gene locus_tag LOCUS_20870 2834 1869 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_20870 4492 2840 gene locus_tag LOCUS_20880 4492 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 5668 4502 gene locus_tag LOCUS_20890 5668 4502 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_20890 6240 5692 gene locus_tag LOCUS_20900 gene rfbC 6240 5692 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100804.1 protein_id gnl|my_center|LOCUS_20900 7126 6245 gene locus_tag LOCUS_20910 gene rfbA 7126 6245 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_20910 8598 7219 gene locus_tag LOCUS_20920 gene mgtE 8598 7219 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_20920 8739 9875 gene locus_tag LOCUS_20930 gene pdxB 8739 9875 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699116.1 protein_id gnl|my_center|LOCUS_20930 10703 9894 gene locus_tag LOCUS_20940 10703 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 11283 10741 gene locus_tag LOCUS_20950 11283 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 11380 12210 gene locus_tag LOCUS_20960 11380 12210 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_20960 13156 12269 gene locus_tag LOCUS_20970 13156 12269 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290916.1 protein_id gnl|my_center|LOCUS_20970 15328 13391 gene locus_tag LOCUS_20980 15328 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 16362 15592 gene locus_tag LOCUS_20990 gene xth 16362 15592 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_20990 17815 16391 gene locus_tag LOCUS_21000 17815 16391 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_21000 18674 17871 gene locus_tag LOCUS_21010 18674 17871 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249525.1 protein_id gnl|my_center|LOCUS_21010 19694 18681 gene locus_tag LOCUS_21020 19694 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 20362 19703 gene locus_tag LOCUS_21030 20362 19703 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21030 21145 20612 gene locus_tag LOCUS_21040 gene cobO 21145 20612 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_21040 21522 21181 gene locus_tag LOCUS_21050 21522 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21050 22118 21519 gene locus_tag LOCUS_21060 22118 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21060 22232 22501 gene locus_tag LOCUS_21070 22232 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 23253 22513 gene locus_tag LOCUS_21080 gene cobB 23253 22513 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_21080 24121 23339 gene locus_tag LOCUS_21090 24121 23339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 25141 24140 gene locus_tag LOCUS_21100 25141 24140 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_21100 26493 25162 gene locus_tag LOCUS_21110 26493 25162 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_21110 28133 26544 gene locus_tag LOCUS_21120 28133 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 29921 28362 gene locus_tag LOCUS_21130 29921 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence048 1205 747 gene locus_tag LOCUS_21140 gene dut 1205 747 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_21140 2603 1206 gene locus_tag LOCUS_21150 2603 1206 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_21150 3166 2756 gene locus_tag LOCUS_21160 3166 2756 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_21160 4306 3356 gene locus_tag LOCUS_21170 4306 3356 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_21170 6289 4310 gene locus_tag LOCUS_21180 6289 4310 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_21180 7023 6301 gene locus_tag LOCUS_21190 7023 6301 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_21190 8513 7218 gene locus_tag LOCUS_21200 8513 7218 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_21200 10583 9450 gene locus_tag LOCUS_21210 10583 9450 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880300.1 protein_id gnl|my_center|LOCUS_21210 11775 10660 gene locus_tag LOCUS_21220 11775 10660 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_21220 12706 11879 gene locus_tag LOCUS_21230 12706 11879 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_21230 13509 12703 gene locus_tag LOCUS_21240 13509 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 14457 13543 gene locus_tag LOCUS_21250 14457 13543 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_21250 15674 14454 gene locus_tag LOCUS_21260 15674 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 16458 15661 gene locus_tag LOCUS_21270 16458 15661 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_21270 17823 16465 gene locus_tag LOCUS_21280 17823 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 19108 17939 gene locus_tag LOCUS_21290 19108 17939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 20537 19368 gene locus_tag LOCUS_21300 20537 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 21736 22131 gene locus_tag LOCUS_21310 21736 22131 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_21310 22133 22708 gene locus_tag LOCUS_21320 22133 22708 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_21320 22714 24072 gene locus_tag LOCUS_21330 22714 24072 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_21330 24072 24893 gene locus_tag LOCUS_21340 24072 24893 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_21340 26054 27988 gene locus_tag LOCUS_21350 gene secD 26054 27988 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_21350 28014 29156 gene locus_tag LOCUS_21360 28014 29156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence049 3084 139 gene locus_tag LOCUS_21370 3084 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4227 3148 gene locus_tag LOCUS_21380 4227 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5022 4267 gene locus_tag LOCUS_21390 5022 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5795 5019 gene locus_tag LOCUS_21400 gene lpxA 5795 5019 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933664.1 protein_id gnl|my_center|LOCUS_21400 7209 5797 gene locus_tag LOCUS_21410 7209 5797 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_21410 8340 7300 gene locus_tag LOCUS_21420 gene lpxD 8340 7300 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_21420 8855 8343 gene locus_tag LOCUS_21430 8855 8343 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_21430 9461 8955 gene locus_tag LOCUS_21440 9461 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12019 9518 gene locus_tag LOCUS_21450 gene bamA 12019 9518 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_21450 12815 12039 gene locus_tag LOCUS_21460 12815 12039 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_21460 13463 13032 gene locus_tag LOCUS_21470 13463 13032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 13721 13473 gene locus_tag LOCUS_21480 13721 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 14381 13734 gene locus_tag LOCUS_21490 gene lexA 14381 13734 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654116.1 protein_id gnl|my_center|LOCUS_21490 15666 14578 gene locus_tag LOCUS_21500 15666 14578 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_21500 16540 15767 gene locus_tag LOCUS_21510 16540 15767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_21510 16836 20207 gene locus_tag LOCUS_21520 16836 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 22265 20241 gene locus_tag LOCUS_21530 22265 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 22751 22422 gene locus_tag LOCUS_21540 22751 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 23087 24304 gene locus_tag LOCUS_21550 gene megL 23087 24304 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_21550 25303 24620 gene locus_tag LOCUS_21560 25303 24620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 27251 25398 gene locus_tag LOCUS_21570 27251 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence050 817 119 gene locus_tag LOCUS_21580 817 119 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_21580 2426 819 gene locus_tag LOCUS_21590 2426 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3098 3553 gene locus_tag LOCUS_21600 3098 3553 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826748.1 protein_id gnl|my_center|LOCUS_21600 3570 4817 gene locus_tag LOCUS_21610 gene nusA 3570 4817 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_21610 4840 7485 gene locus_tag LOCUS_21620 gene infB 4840 7485 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931933.1 protein_id gnl|my_center|LOCUS_21620 7512 7886 gene locus_tag LOCUS_21630 gene rbfA 7512 7886 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_21630 7846 8562 gene locus_tag LOCUS_21640 gene truB 7846 8562 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_21640 8674 9612 gene locus_tag LOCUS_21650 8674 9612 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_21650 9665 9928 gene locus_tag LOCUS_21660 gene rpsO 9665 9928 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_21660 9938 12073 gene locus_tag LOCUS_21670 gene pnp 9938 12073 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_21670 12344 13903 gene locus_tag LOCUS_21680 12344 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 13922 14569 gene locus_tag LOCUS_21690 gene fsa 13922 14569 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_21690 14597 15679 gene locus_tag LOCUS_21700 gene gcvT 14597 15679 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_21700 15688 16416 gene locus_tag LOCUS_21710 15688 16416 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966508.1 protein_id gnl|my_center|LOCUS_21710 16433 18895 gene locus_tag LOCUS_21720 16433 18895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 19006 19533 gene locus_tag LOCUS_21730 gene lolA 19006 19533 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946715.1 protein_id gnl|my_center|LOCUS_21730 19520 20575 gene locus_tag LOCUS_21740 19520 20575 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_21740 20572 21204 gene locus_tag LOCUS_21750 20572 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 21214 22062 gene locus_tag LOCUS_21760 21214 22062 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_21760 22073 22642 gene locus_tag LOCUS_21770 22073 22642 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_21770 22698 23708 gene locus_tag LOCUS_21780 22698 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 23804 24388 gene locus_tag LOCUS_21790 23804 24388 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_21790 24395 25099 gene locus_tag LOCUS_21800 24395 25099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 25177 25425 gene locus_tag LOCUS_21810 25177 25425 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_21810 25651 28233 gene locus_tag LOCUS_21820 25651 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence051 145 1197 gene locus_tag LOCUS_21830 145 1197 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328062.1 protein_id gnl|my_center|LOCUS_21830 1758 1303 gene locus_tag LOCUS_21840 1758 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939911.1 protein_id gnl|my_center|LOCUS_21840 1943 2929 gene locus_tag LOCUS_21850 1943 2929 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_21850 3307 2972 gene locus_tag LOCUS_21860 3307 2972 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_21860 3931 3443 gene locus_tag LOCUS_21870 3931 3443 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015890.1 protein_id gnl|my_center|LOCUS_21870 4127 5341 gene locus_tag LOCUS_21880 gene lhgO 4127 5341 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_21880 5347 6384 gene locus_tag LOCUS_21890 5347 6384 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_21890 6381 7022 gene locus_tag LOCUS_21900 6381 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111525078.1 protein_id gnl|my_center|LOCUS_21900 7078 7368 gene locus_tag LOCUS_21910 7078 7368 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_21910 7564 8256 gene locus_tag LOCUS_21920 7564 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 8253 9620 gene locus_tag LOCUS_21930 8253 9620 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_21930 9733 11043 gene locus_tag LOCUS_21940 9733 11043 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_21940 11696 11112 gene locus_tag LOCUS_21950 11696 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 12546 11659 gene locus_tag LOCUS_21960 12546 11659 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_21960 12838 17616 gene locus_tag LOCUS_21970 12838 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 17633 18313 gene locus_tag LOCUS_21980 17633 18313 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_21980 18573 19031 gene locus_tag LOCUS_21990 18573 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 19045 21378 gene locus_tag LOCUS_22000 19045 21378 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_22000 21703 22578 gene locus_tag LOCUS_22010 21703 22578 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_22010 22586 23098 gene locus_tag LOCUS_22020 22586 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 23115 23315 gene locus_tag LOCUS_22030 23115 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 23427 23879 gene locus_tag LOCUS_22040 23427 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 23880 25130 gene locus_tag LOCUS_22050 23880 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 25962 25186 gene locus_tag LOCUS_22060 25962 25186 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_22060 26306 26857 gene locus_tag LOCUS_22070 gene msrA 26306 26857 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence052 2662 179 gene locus_tag LOCUS_22080 gene gyrA 2662 179 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_22080 4669 2693 gene locus_tag LOCUS_22090 gene gyrB 4669 2693 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_22090 4992 4702 gene locus_tag LOCUS_22100 4992 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 6091 4985 gene locus_tag LOCUS_22110 6091 4985 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402853.1 protein_id gnl|my_center|LOCUS_22110 7202 6093 gene locus_tag LOCUS_22120 gene dnaN 7202 6093 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_22120 7776 7369 gene locus_tag LOCUS_22130 7776 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9574 8156 gene locus_tag LOCUS_22140 gene dnaA 9574 8156 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_22140 10065 10211 gene locus_tag LOCUS_22150 gene rpmH 10065 10211 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_22150 10217 10615 gene locus_tag LOCUS_22160 gene rnpA 10217 10615 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_22160 10703 12556 gene locus_tag LOCUS_22170 gene yidC 10703 12556 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_22170 12618 15302 gene locus_tag LOCUS_22180 12618 15302 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927267.1 protein_id gnl|my_center|LOCUS_22180 19846 16733 gene locus_tag LOCUS_22190 19846 16733 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_22190 21324 19861 gene locus_tag LOCUS_22200 21324 19861 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_22200 21661 22053 gene locus_tag LOCUS_22210 21661 22053 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_22210 22056 22844 gene locus_tag LOCUS_22220 22056 22844 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_22220 23313 22909 gene locus_tag LOCUS_22230 23313 22909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_22230 24622 23549 gene locus_tag LOCUS_22240 24622 23549 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_22240 26311 24920 gene locus_tag LOCUS_22250 26311 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 26752 26321 gene locus_tag LOCUS_22260 26752 26321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence053 357 1118 gene locus_tag LOCUS_22270 gene gyaR 357 1118 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22270 1188 2309 gene locus_tag LOCUS_22280 gene ald 1188 2309 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_22280 2347 3702 gene locus_tag LOCUS_22290 2347 3702 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_22290 3709 4416 gene locus_tag LOCUS_22300 3709 4416 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_22300 4547 5014 gene locus_tag LOCUS_22310 4547 5014 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_22310 5217 5855 gene locus_tag LOCUS_22320 5217 5855 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080648.1 protein_id gnl|my_center|LOCUS_22320 5858 7351 gene locus_tag LOCUS_22330 5858 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7539 9014 gene locus_tag LOCUS_22340 7539 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 10352 9072 gene locus_tag LOCUS_22350 10352 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11476 10757 gene locus_tag LOCUS_22360 11476 10757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_22360 13827 11533 gene locus_tag LOCUS_22370 13827 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 15600 13963 gene locus_tag LOCUS_22380 gene groL 15600 13963 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_22380 15926 15627 gene locus_tag LOCUS_22390 gene groES 15926 15627 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_22390 16078 16863 gene locus_tag LOCUS_22400 16078 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 16872 17588 gene locus_tag LOCUS_22410 16872 17588 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_22410 18474 17665 gene locus_tag LOCUS_22420 18474 17665 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_22420 19097 18687 gene locus_tag LOCUS_22430 19097 18687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 19461 23228 gene locus_tag LOCUS_22440 19461 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 23442 25412 gene locus_tag LOCUS_22450 23442 25412 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence054 175 1557 gene locus_tag LOCUS_22460 175 1557 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_22460 1567 1905 gene locus_tag LOCUS_22470 1567 1905 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_22470 1948 3513 gene locus_tag LOCUS_22480 1948 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4589 3510 gene locus_tag LOCUS_22490 gene prfA 4589 3510 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_22490 4728 5960 gene locus_tag LOCUS_22500 4728 5960 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_22500 6935 5985 gene locus_tag LOCUS_22510 6935 5985 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_22510 7080 8222 gene locus_tag LOCUS_22520 gene metK 7080 8222 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_22520 8318 9646 gene locus_tag LOCUS_22530 gene ahcY 8318 9646 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_22530 10601 9687 gene locus_tag LOCUS_22540 10601 9687 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931825.1 protein_id gnl|my_center|LOCUS_22540 10955 12088 gene locus_tag LOCUS_22550 10955 12088 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_22550 12128 13249 gene locus_tag LOCUS_22560 12128 13249 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_22560 13286 14095 gene locus_tag LOCUS_22570 13286 14095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_22570 14124 16679 gene locus_tag LOCUS_22580 14124 16679 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_22580 16814 18112 gene locus_tag LOCUS_22590 16814 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 18220 19734 gene locus_tag LOCUS_22600 18220 19734 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_22600 19740 21173 gene locus_tag LOCUS_22610 19740 21173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 22432 21194 gene locus_tag LOCUS_22620 22432 21194 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947961.1 protein_id gnl|my_center|LOCUS_22620 22900 22433 gene locus_tag LOCUS_22630 22900 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 23991 22897 gene locus_tag LOCUS_22640 gene rfbE 23991 22897 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_22640 24893 23988 gene locus_tag LOCUS_22650 24893 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence055 3298 2000 gene locus_tag LOCUS_22660 3298 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4939 3791 gene locus_tag LOCUS_22670 4939 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5143 7185 gene locus_tag LOCUS_22680 5143 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 7264 8073 gene locus_tag LOCUS_22690 7264 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 8252 9937 gene locus_tag LOCUS_22700 gene ettA 8252 9937 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_22700 11514 10120 gene locus_tag LOCUS_22710 gene gatD 11514 10120 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_22710 13259 11514 gene locus_tag LOCUS_22720 gene gatE 13259 11514 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_22720 15446 14784 gene locus_tag LOCUS_22730 15446 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 16729 15506 gene locus_tag LOCUS_22740 16729 15506 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_22740 17155 16892 gene locus_tag LOCUS_22750 17155 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 18326 17184 gene locus_tag LOCUS_22760 18326 17184 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_22760 18969 18499 gene locus_tag LOCUS_22770 18969 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 19925 19173 gene locus_tag LOCUS_22780 19925 19173 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966689.1 protein_id gnl|my_center|LOCUS_22780 20067 19912 gene locus_tag LOCUS_22790 20067 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 20290 21180 gene locus_tag LOCUS_22800 20290 21180 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_22800 21237 22394 gene locus_tag LOCUS_22810 21237 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence056 2017 1244 gene locus_tag LOCUS_22820 2017 1244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275323.1 protein_id gnl|my_center|LOCUS_22820 2181 3800 gene locus_tag LOCUS_22830 2181 3800 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_22830 3797 4381 gene locus_tag LOCUS_22840 3797 4381 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_22840 5839 4451 gene locus_tag LOCUS_22850 5839 4451 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_22850 6814 6017 gene locus_tag LOCUS_22860 6814 6017 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_22860 7563 6823 gene locus_tag LOCUS_22870 7563 6823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 protein_id gnl|my_center|LOCUS_22870 8450 7560 gene locus_tag LOCUS_22880 8450 7560 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437720.1 protein_id gnl|my_center|LOCUS_22880 9247 8447 gene locus_tag LOCUS_22890 gene lgt 9247 8447 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_22890 11725 9383 gene locus_tag LOCUS_22900 gene topA 11725 9383 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_22900 12046 12303 gene locus_tag LOCUS_22910 gene yidD 12046 12303 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_22910 12384 13118 gene locus_tag LOCUS_22920 gene mtgA 12384 13118 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_22920 13456 14034 gene locus_tag LOCUS_22930 13456 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 16990 14231 gene locus_tag LOCUS_22940 16990 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 17592 19484 gene locus_tag LOCUS_22950 17592 19484 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_22950 19883 19796 gene locus_tag LOCUS_t00430 19883 19796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20321 21082 gene locus_tag LOCUS_22960 gene hisN 20321 21082 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_22960 21840 21079 gene locus_tag LOCUS_22970 21840 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence057 39 2555 gene locus_tag LOCUS_22980 39 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3980 2685 gene locus_tag LOCUS_22990 3980 2685 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_22990 7499 4104 gene locus_tag LOCUS_23000 7499 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7685 8260 gene locus_tag LOCUS_23010 7685 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 8257 9594 gene locus_tag LOCUS_23020 8257 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 10090 9566 gene locus_tag LOCUS_23030 10090 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 11013 10090 gene locus_tag LOCUS_23040 gene rocF 11013 10090 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_23040 11291 12643 gene locus_tag LOCUS_23050 11291 12643 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_23050 12681 13790 gene locus_tag LOCUS_23060 12681 13790 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_23060 13795 14796 gene locus_tag LOCUS_23070 13795 14796 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_23070 15042 17948 gene locus_tag LOCUS_23080 15042 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 18245 21106 gene locus_tag LOCUS_23090 18245 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 21162 21638 gene locus_tag LOCUS_23100 21162 21638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence058 3365 108 gene locus_tag LOCUS_23110 3365 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3776 4627 gene locus_tag LOCUS_23120 3776 4627 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_23120 6267 4747 gene locus_tag LOCUS_23130 6267 4747 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_23130 6434 8470 gene locus_tag LOCUS_23140 gene metG 6434 8470 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_23140 8489 10477 gene locus_tag LOCUS_23150 8489 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 10595 12568 gene locus_tag LOCUS_23160 10595 12568 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_23160 12588 13361 gene locus_tag LOCUS_23170 12588 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 13358 14629 gene locus_tag LOCUS_23180 13358 14629 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_23180 14649 15650 gene locus_tag LOCUS_23190 14649 15650 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_23190 16709 15657 gene locus_tag LOCUS_23200 16709 15657 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_23200 16947 16711 gene locus_tag LOCUS_23210 16947 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 18310 17042 gene locus_tag LOCUS_23220 18310 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 19512 18406 gene locus_tag LOCUS_23230 gene apbC 19512 18406 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_23230 21719 19590 gene locus_tag LOCUS_23240 gene ppk1 21719 19590 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence059 4346 2439 gene locus_tag LOCUS_23250 4346 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 5252 4761 gene locus_tag LOCUS_23260 gene purE 5252 4761 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_23260 7665 5266 gene locus_tag LOCUS_23270 7665 5266 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_23270 8561 7656 gene locus_tag LOCUS_23280 8561 7656 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578515.1 protein_id gnl|my_center|LOCUS_23280 9022 8558 gene locus_tag LOCUS_23290 gene dtd 9022 8558 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_23290 9870 9019 gene locus_tag LOCUS_23300 9870 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 10597 9875 gene locus_tag LOCUS_23310 10597 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 11615 10581 gene locus_tag LOCUS_23320 11615 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 14536 11723 gene locus_tag LOCUS_23330 14536 11723 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_23330 15590 14556 gene locus_tag LOCUS_23340 15590 14556 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_23340 17359 15593 gene locus_tag LOCUS_23350 gene ptsP 17359 15593 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_23350 17622 17356 gene locus_tag LOCUS_23360 17622 17356 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933864.1 protein_id gnl|my_center|LOCUS_23360 18617 17622 gene locus_tag LOCUS_23370 18617 17622 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_23370 19657 18614 gene locus_tag LOCUS_23380 gene fni 19657 18614 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931949.1 protein_id gnl|my_center|LOCUS_23380 19830 21332 gene locus_tag LOCUS_23390 19830 21332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_23390 21779 21567 gene locus_tag LOCUS_23400 21779 21567 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391951.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence060 <1 788 gene locus_tag LOCUS_23410 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964234.1:site-specific integrase 2655 892 gene locus_tag LOCUS_23420 2655 892 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_23420 3953 2799 gene locus_tag LOCUS_23430 3953 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 4584 4222 gene locus_tag LOCUS_23440 4584 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 5025 4642 gene locus_tag LOCUS_23450 5025 4642 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_23450 5261 5025 gene locus_tag LOCUS_23460 5261 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 5626 5237 gene locus_tag LOCUS_23470 5626 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 7053 5773 gene locus_tag LOCUS_23480 7053 5773 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_23480 7470 7958 gene locus_tag LOCUS_23490 7470 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8245 9576 gene locus_tag LOCUS_23500 gene rsxC 8245 9576 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_23500 9610 10644 gene locus_tag LOCUS_23510 9610 10644 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_23510 10641 11207 gene locus_tag LOCUS_23520 10641 11207 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_23520 11204 11896 gene locus_tag LOCUS_23530 11204 11896 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_23530 11898 12470 gene locus_tag LOCUS_23540 gene rsxA 11898 12470 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_23540 12622 13350 gene locus_tag LOCUS_23550 12622 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 13492 14499 gene locus_tag LOCUS_23560 13492 14499 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_23560 14577 15431 gene locus_tag LOCUS_23570 14577 15431 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_23570 15491 15937 gene locus_tag LOCUS_23580 15491 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 17104 15974 gene locus_tag LOCUS_23590 17104 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 18989 17322 gene locus_tag LOCUS_23600 18989 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 19183 21066 gene locus_tag LOCUS_23610 gene pepF 19183 21066 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_23610 21531 21208 gene locus_tag LOCUS_23620 21531 21208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence061 3007 386 gene locus_tag LOCUS_23630 3007 386 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_23630 3695 3075 gene locus_tag LOCUS_23640 3695 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4179 5474 gene locus_tag LOCUS_23650 4179 5474 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084102.1 protein_id gnl|my_center|LOCUS_23650 5645 5863 gene locus_tag LOCUS_23660 5645 5863 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_23660 5866 6192 gene locus_tag LOCUS_23670 5866 6192 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_23670 6185 7123 gene locus_tag LOCUS_23680 6185 7123 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_23680 7732 7184 gene locus_tag LOCUS_23690 7732 7184 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017204.1 protein_id gnl|my_center|LOCUS_23690 8690 7845 gene locus_tag LOCUS_23700 8690 7845 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_23700 9603 8806 gene locus_tag LOCUS_23710 9603 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 9762 11009 gene locus_tag LOCUS_23720 9762 11009 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437079.1 protein_id gnl|my_center|LOCUS_23720 11065 11979 gene locus_tag LOCUS_23730 11065 11979 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_23730 12168 12437 gene locus_tag LOCUS_23740 12168 12437 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_23740 12430 12648 gene locus_tag LOCUS_23750 12430 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 12680 13783 gene locus_tag LOCUS_23760 gene serC 12680 13783 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_23760 13908 14327 gene locus_tag LOCUS_23770 13908 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15753 14329 gene locus_tag LOCUS_23780 15753 14329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_23780 16433 15762 gene locus_tag LOCUS_23790 16433 15762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_23790 16840 16499 gene locus_tag LOCUS_23800 16840 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 17268 16972 gene locus_tag LOCUS_23810 17268 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 17849 17457 gene locus_tag LOCUS_23820 17849 17457 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_23820 18032 18631 gene locus_tag LOCUS_23830 18032 18631 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_23830 18839 21181 gene locus_tag LOCUS_23840 18839 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence062 210 1511 gene locus_tag LOCUS_23850 210 1511 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_23850 1516 2070 gene locus_tag LOCUS_23860 1516 2070 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_23860 4946 2166 gene locus_tag LOCUS_23870 gene acnA 4946 2166 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 protein_id gnl|my_center|LOCUS_23870 5179 5685 gene locus_tag LOCUS_23880 5179 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 5925 8060 gene locus_tag LOCUS_23890 5925 8060 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367546.1 protein_id gnl|my_center|LOCUS_23890 8038 9048 gene locus_tag LOCUS_23900 gene rhuM 8038 9048 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_23900 9035 11974 gene locus_tag LOCUS_23910 9035 11974 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 protein_id gnl|my_center|LOCUS_23910 12154 13188 gene locus_tag LOCUS_23920 12154 13188 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972216.1 protein_id gnl|my_center|LOCUS_23920 14759 13245 gene locus_tag LOCUS_23930 14759 13245 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_23930 15909 14881 gene locus_tag LOCUS_23940 15909 14881 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980662.1 protein_id gnl|my_center|LOCUS_23940 16179 16847 gene locus_tag LOCUS_23950 16179 16847 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787510.1 protein_id gnl|my_center|LOCUS_23950 17762 16917 gene locus_tag LOCUS_23960 17762 16917 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071310.1 protein_id gnl|my_center|LOCUS_23960 18352 17843 gene locus_tag LOCUS_23970 18352 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 19561 18671 gene locus_tag LOCUS_23980 19561 18671 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_23980 20555 19809 gene locus_tag LOCUS_23990 20555 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 20974 20624 gene locus_tag LOCUS_24000 20974 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence063 209 448 gene locus_tag LOCUS_24010 209 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 666 1397 gene locus_tag LOCUS_24020 666 1397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_24020 1588 2013 gene locus_tag LOCUS_24030 1588 2013 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979875.1 protein_id gnl|my_center|LOCUS_24030 5275 2078 gene locus_tag LOCUS_24040 gene carB 5275 2078 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_24040 6363 5287 gene locus_tag LOCUS_24050 gene carA 6363 5287 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107319.1 protein_id gnl|my_center|LOCUS_24050 6581 8650 gene locus_tag LOCUS_24060 6581 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 8841 10208 gene locus_tag LOCUS_24070 8841 10208 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_24070 10218 11039 gene locus_tag LOCUS_24080 10218 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927025.1 protein_id gnl|my_center|LOCUS_24080 11059 11511 gene locus_tag LOCUS_24090 11059 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 11628 12134 gene locus_tag LOCUS_24100 11628 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 12131 13180 gene locus_tag LOCUS_24110 gene mnmA 12131 13180 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_24110 13373 13167 gene locus_tag LOCUS_24120 13373 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 14467 13433 gene locus_tag LOCUS_24130 14467 13433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 16133 14562 gene locus_tag LOCUS_24140 16133 14562 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383078.1 protein_id gnl|my_center|LOCUS_24140 17740 16253 gene locus_tag LOCUS_24150 17740 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 18758 17778 gene locus_tag LOCUS_24160 18758 17778 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_24160 20506 18821 gene locus_tag LOCUS_24170 20506 18821 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545094.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence064 207 1346 gene locus_tag LOCUS_24180 207 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2170 1391 gene locus_tag LOCUS_24190 2170 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3479 2151 gene locus_tag LOCUS_24200 gene mtaB 3479 2151 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_24200 5369 3552 gene locus_tag LOCUS_24210 gene rpsA 5369 3552 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_24210 6146 5469 gene locus_tag LOCUS_24220 gene cmk 6146 5469 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_24220 7894 6218 gene locus_tag LOCUS_24230 gene dnaX 7894 6218 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932993.1 protein_id gnl|my_center|LOCUS_24230 8388 7900 gene locus_tag LOCUS_24240 8388 7900 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_24240 10826 8388 gene locus_tag LOCUS_24250 gene lon 10826 8388 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_24250 11307 13487 gene locus_tag LOCUS_24260 11307 13487 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_24260 13521 14882 gene locus_tag LOCUS_24270 gene pfp 13521 14882 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_24270 14979 15872 gene locus_tag LOCUS_24280 14979 15872 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_24280 15929 16975 gene locus_tag LOCUS_24290 15929 16975 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_24290 17162 18955 gene locus_tag LOCUS_24300 17162 18955 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 protein_id gnl|my_center|LOCUS_24300 19462 19064 gene locus_tag LOCUS_24310 gene mscL 19462 19064 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022450.1 protein_id gnl|my_center|LOCUS_24310 <20311 19596 gene locus_tag LOCUS_24320 <20311 19596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein >Feature sequence065 1347 571 gene locus_tag LOCUS_24330 1347 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2316 1945 gene locus_tag LOCUS_24340 2316 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3111 2467 gene locus_tag LOCUS_24350 3111 2467 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_24350 6408 3166 gene locus_tag LOCUS_24360 6408 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 7427 6564 gene locus_tag LOCUS_24370 7427 6564 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_24370 8873 7431 gene locus_tag LOCUS_24380 gene dnaB 8873 7431 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_24380 9527 8982 gene locus_tag LOCUS_24390 9527 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 10287 9511 gene locus_tag LOCUS_24400 10287 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 10688 10398 gene locus_tag LOCUS_24410 10688 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 11266 10694 gene locus_tag LOCUS_24420 gene gmk 11266 10694 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_24420 12147 11269 gene locus_tag LOCUS_24430 12147 11269 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402820.1 protein_id gnl|my_center|LOCUS_24430 14301 12235 gene locus_tag LOCUS_24440 14301 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 14875 14351 gene locus_tag LOCUS_24450 14875 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 15632 14952 gene locus_tag LOCUS_24460 15632 14952 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072219.1 protein_id gnl|my_center|LOCUS_24460 16299 15745 gene locus_tag LOCUS_24470 gene frr 16299 15745 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_24470 17046 16330 gene locus_tag LOCUS_24480 gene pyrH 17046 16330 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_24480 17979 17116 gene locus_tag LOCUS_24490 gene tsf 17979 17116 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402823.1 protein_id gnl|my_center|LOCUS_24490 18856 18020 gene locus_tag LOCUS_24500 gene rpsB 18856 18020 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_24500 19405 19019 gene locus_tag LOCUS_24510 gene rpsI 19405 19019 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_24510 19854 19405 gene locus_tag LOCUS_24520 gene rplM 19854 19405 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544931.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence066 197 1168 gene locus_tag LOCUS_24530 197 1168 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_24530 2054 1236 gene locus_tag LOCUS_24540 gene murI 2054 1236 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_24540 4645 2072 gene locus_tag LOCUS_24550 gene glnD 4645 2072 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_24550 5088 4657 gene locus_tag LOCUS_24560 5088 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 5330 5085 gene locus_tag LOCUS_24570 5330 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 6360 5314 gene locus_tag LOCUS_24580 6360 5314 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870969.1 protein_id gnl|my_center|LOCUS_24580 7940 6360 gene locus_tag LOCUS_24590 7940 6360 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_24590 8635 7943 gene locus_tag LOCUS_24600 gene queC 8635 7943 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_24600 9816 8788 gene locus_tag LOCUS_24610 9816 8788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 protein_id gnl|my_center|LOCUS_24610 10033 10788 gene locus_tag LOCUS_24620 10033 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 11091 12239 gene locus_tag LOCUS_24630 11091 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 12723 12457 gene locus_tag LOCUS_24640 12723 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 12845 13873 gene locus_tag LOCUS_24650 12845 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 14310 15536 gene locus_tag LOCUS_24660 14310 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 15567 19022 gene locus_tag LOCUS_24670 15567 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 19168 19374 gene locus_tag LOCUS_24680 19168 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence067 <1 650 gene locus_tag LOCUS_24690 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 2697 751 gene locus_tag LOCUS_24700 2697 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5467 2702 gene locus_tag LOCUS_24710 gene glnE 5467 2702 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038017669.1 protein_id gnl|my_center|LOCUS_24710 5553 6341 gene locus_tag LOCUS_24720 gene blaOXA 5553 6341 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_24720 6456 9494 gene locus_tag LOCUS_24730 gene secA 6456 9494 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_24730 9510 9848 gene locus_tag LOCUS_24740 9510 9848 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_24740 9894 12290 gene locus_tag LOCUS_24750 9894 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 12338 12970 gene locus_tag LOCUS_24760 12338 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 13532 12954 gene locus_tag LOCUS_24770 13532 12954 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_24770 14646 13534 gene locus_tag LOCUS_24780 gene rlmN 14646 13534 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_24780 14800 15945 gene locus_tag LOCUS_24790 14800 15945 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_24790 15932 16399 gene locus_tag LOCUS_24800 15932 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 16396 17241 gene locus_tag LOCUS_24810 16396 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 17225 18064 gene locus_tag LOCUS_24820 17225 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 18178 18786 gene locus_tag LOCUS_24830 18178 18786 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence068 218 2551 gene locus_tag LOCUS_24840 gene nagB 218 2551 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074422.1 protein_id gnl|my_center|LOCUS_24840 2563 3693 gene locus_tag LOCUS_24850 2563 3693 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_24850 6633 3775 gene locus_tag LOCUS_24860 6633 3775 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_24860 9166 6800 gene locus_tag LOCUS_24870 9166 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 10575 9292 gene locus_tag LOCUS_24880 10575 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 11825 10623 gene locus_tag LOCUS_24890 11825 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 12863 11847 gene locus_tag LOCUS_24900 12863 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 13860 12907 gene locus_tag LOCUS_24910 13860 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 15950 13866 gene locus_tag LOCUS_24920 15950 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 19139 15981 gene locus_tag LOCUS_24930 19139 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence069 298 699 gene locus_tag LOCUS_24940 298 699 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_24940 803 1237 gene locus_tag LOCUS_24950 803 1237 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 protein_id gnl|my_center|LOCUS_24950 2448 1288 gene locus_tag LOCUS_24960 2448 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3304 2492 gene locus_tag LOCUS_24970 3304 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5172 3304 gene locus_tag LOCUS_24980 5172 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6393 5242 gene locus_tag LOCUS_24990 6393 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 7634 6390 gene locus_tag LOCUS_25000 gene hybB 7634 6390 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941449.1 protein_id gnl|my_center|LOCUS_25000 8539 7631 gene locus_tag LOCUS_25010 8539 7631 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545831.1 protein_id gnl|my_center|LOCUS_25010 9118 9378 gene locus_tag LOCUS_25020 9118 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 9413 10084 gene locus_tag LOCUS_25030 9413 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 10100 10858 gene locus_tag LOCUS_25040 10100 10858 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_25040 10848 12056 gene locus_tag LOCUS_25050 gene hybB 10848 12056 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_25050 12061 12780 gene locus_tag LOCUS_25060 12061 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 12932 14524 gene locus_tag LOCUS_25070 12932 14524 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_25070 14534 15889 gene locus_tag LOCUS_25080 14534 15889 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_25080 15889 16419 gene locus_tag LOCUS_25090 15889 16419 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_25090 17680 16460 gene locus_tag LOCUS_25100 gene htpX 17680 16460 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_25100 18256 17699 gene locus_tag LOCUS_25110 18256 17699 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_25110 18672 18298 gene locus_tag LOCUS_25120 18672 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence070 346 765 gene locus_tag LOCUS_25130 346 765 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_25130 935 3943 gene locus_tag LOCUS_25140 935 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 3989 4612 gene locus_tag LOCUS_25150 3989 4612 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_25150 4787 6052 gene locus_tag LOCUS_25160 4787 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6258 7019 gene locus_tag LOCUS_25170 6258 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7673 7251 gene locus_tag LOCUS_25180 7673 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 8049 7825 gene locus_tag LOCUS_25190 8049 7825 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 protein_id gnl|my_center|LOCUS_25190 8594 8046 gene locus_tag LOCUS_25200 8594 8046 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_25200 9348 8782 gene locus_tag LOCUS_25210 9348 8782 CDS product SMUG2 DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990078.1 protein_id gnl|my_center|LOCUS_25210 9841 10284 gene locus_tag LOCUS_25220 9841 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 10292 11731 gene locus_tag LOCUS_25230 10292 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 11701 12456 gene locus_tag LOCUS_25240 11701 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 13698 12511 gene locus_tag LOCUS_25250 13698 12511 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_25250 14128 13745 gene locus_tag LOCUS_25260 14128 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 15489 14242 gene locus_tag LOCUS_25270 gene pepT 15489 14242 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_25270 16009 18357 gene locus_tag LOCUS_25280 16009 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence071 225 1673 gene locus_tag LOCUS_25290 225 1673 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_25290 2121 2255 gene locus_tag LOCUS_25300 2121 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2722 3846 gene locus_tag LOCUS_25310 2722 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3926 5452 gene locus_tag LOCUS_25320 3926 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 5854 5501 gene locus_tag LOCUS_25330 5854 5501 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_25330 7316 5928 gene locus_tag LOCUS_25340 7316 5928 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_25340 8728 7385 gene locus_tag LOCUS_25350 gene trkA 8728 7385 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_25350 10315 9272 gene locus_tag LOCUS_25360 10315 9272 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_25360 10419 10643 gene locus_tag LOCUS_25370 10419 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 10660 11028 gene locus_tag LOCUS_25380 10660 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 12079 11042 gene locus_tag LOCUS_25390 12079 11042 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_25390 12150 12884 gene locus_tag LOCUS_25400 12150 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 13835 12900 gene locus_tag LOCUS_25410 13835 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 14754 13801 gene locus_tag LOCUS_25420 14754 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582727.1 protein_id gnl|my_center|LOCUS_25420 14896 15753 gene locus_tag LOCUS_25430 14896 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 16438 18309 gene locus_tag LOCUS_25440 16438 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence072 2485 758 gene locus_tag LOCUS_25450 2485 758 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_25450 4595 2613 gene locus_tag LOCUS_25460 gene nuoF 4595 2613 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_25460 5071 4592 gene locus_tag LOCUS_25470 gene nuoE 5071 4592 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_25470 6555 5344 gene locus_tag LOCUS_25480 gene hydF 6555 5344 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392791.1 protein_id gnl|my_center|LOCUS_25480 7506 6838 gene locus_tag LOCUS_25490 gene ppaX 7506 6838 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_25490 7745 8164 gene locus_tag LOCUS_25500 7745 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 8267 8821 gene locus_tag LOCUS_25510 8267 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8996 9334 gene locus_tag LOCUS_25520 8996 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 9337 11349 gene locus_tag LOCUS_25530 gene uvrB 9337 11349 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_25530 12263 11400 gene locus_tag LOCUS_25540 gene truA 12263 11400 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_25540 13516 12272 gene locus_tag LOCUS_25550 13516 12272 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879797.1 protein_id gnl|my_center|LOCUS_25550 13948 13532 gene locus_tag LOCUS_25560 gene queD 13948 13532 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_25560 14904 14263 gene locus_tag LOCUS_25570 gene queE 14904 14263 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_25570 15056 15319 gene locus_tag LOCUS_25580 gene rpsT 15056 15319 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence073 2504 255 gene locus_tag LOCUS_25590 2504 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3827 2526 gene locus_tag LOCUS_25600 3827 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4610 6673 gene locus_tag LOCUS_25610 4610 6673 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_25610 6820 6892 gene locus_tag LOCUS_t00440 6820 6892 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7400 8593 gene locus_tag LOCUS_25620 7400 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 11885 8787 gene locus_tag LOCUS_25630 11885 8787 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_25630 13015 11900 gene locus_tag LOCUS_25640 gene vmeC 13015 11900 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_25640 14342 13017 gene locus_tag LOCUS_25650 14342 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 15372 14677 gene locus_tag LOCUS_25660 15372 14677 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962918.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence074 280 780 gene locus_tag LOCUS_25670 280 780 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_25670 1645 815 gene locus_tag LOCUS_25680 1645 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2461 1988 gene locus_tag LOCUS_25690 2461 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2946 2545 gene locus_tag LOCUS_25700 2946 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 6022 3014 gene locus_tag LOCUS_25710 6022 3014 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_25710 6947 6027 gene locus_tag LOCUS_25720 6947 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 8223 6949 gene locus_tag LOCUS_25730 8223 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 9478 8234 gene locus_tag LOCUS_25740 9478 8234 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_25740 10152 9475 gene locus_tag LOCUS_25750 10152 9475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_25750 11680 10334 gene locus_tag LOCUS_25760 11680 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 12637 11837 gene locus_tag LOCUS_25770 12637 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 13627 12698 gene locus_tag LOCUS_25780 13627 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 <14423 13744 gene locus_tag LOCUS_25790 <14423 13744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence075 198 2651 gene locus_tag LOCUS_25800 198 2651 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_25800 2660 4216 gene locus_tag LOCUS_25810 2660 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4235 4924 gene locus_tag LOCUS_25820 gene walR 4235 4924 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971872.1 protein_id gnl|my_center|LOCUS_25820 5113 5550 gene locus_tag LOCUS_25830 5113 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 6783 5572 gene locus_tag LOCUS_25840 6783 5572 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_25840 7049 7996 gene locus_tag LOCUS_25850 7049 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 8877 7993 gene locus_tag LOCUS_25860 8877 7993 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831470.1 protein_id gnl|my_center|LOCUS_25860 8950 10635 gene locus_tag LOCUS_25870 8950 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 10814 12076 gene locus_tag LOCUS_25880 10814 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 12602 12081 gene locus_tag LOCUS_25890 12602 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_25890 12734 13051 gene locus_tag LOCUS_25900 12734 13051 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_25900 13069 13878 gene locus_tag LOCUS_25910 13069 13878 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence076 221 1441 gene locus_tag LOCUS_25920 gene rocD 221 1441 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_25920 4159 1535 gene locus_tag LOCUS_25930 4159 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4257 4847 gene locus_tag LOCUS_25940 4257 4847 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_25940 4849 5583 gene locus_tag LOCUS_25950 4849 5583 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932758.1 protein_id gnl|my_center|LOCUS_25950 5586 6053 gene locus_tag LOCUS_25960 5586 6053 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_25960 6178 7437 gene locus_tag LOCUS_25970 gene fabF 6178 7437 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405457.1 protein_id gnl|my_center|LOCUS_25970 8228 7518 gene locus_tag LOCUS_25980 8228 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 9064 8225 gene locus_tag LOCUS_25990 9064 8225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_25990 9984 9064 gene locus_tag LOCUS_26000 9984 9064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948828.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence077 4413 244 gene locus_tag LOCUS_26010 4413 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 4935 4723 gene locus_tag LOCUS_26020 4935 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 5278 4985 gene locus_tag LOCUS_26030 5278 4985 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_26030 6106 7080 gene locus_tag LOCUS_26040 gene rfaD 6106 7080 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_26040 7453 7136 gene locus_tag LOCUS_26050 7453 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 7639 8103 gene locus_tag LOCUS_26060 7639 8103 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_26060 8300 9466 gene locus_tag LOCUS_26070 8300 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 9636 11264 gene locus_tag LOCUS_26080 9636 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 11317 11577 gene locus_tag LOCUS_26090 11317 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 11677 12021 gene locus_tag LOCUS_26100 11677 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 12178 12708 gene locus_tag LOCUS_26110 12178 12708 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_26110 12985 13335 gene locus_tag LOCUS_26120 12985 13335 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_26120 13332 13640 gene locus_tag LOCUS_26130 13332 13640 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence078 2228 45 gene locus_tag LOCUS_26140 2228 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 4819 2249 gene locus_tag LOCUS_26150 4819 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5394 6140 gene locus_tag LOCUS_26160 gene gpmA 5394 6140 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_26160 6292 7329 gene locus_tag LOCUS_26170 6292 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_26170 7954 7415 gene locus_tag LOCUS_26180 7954 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8193 7969 gene locus_tag LOCUS_26190 8193 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 9785 8304 gene locus_tag LOCUS_26200 9785 8304 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_26200 10213 11199 gene locus_tag LOCUS_26210 10213 11199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 11212 12159 gene locus_tag LOCUS_26220 11212 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 12184 13356 gene locus_tag LOCUS_26230 12184 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence079 611 952 gene locus_tag LOCUS_26240 611 952 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_26240 1974 1090 gene locus_tag LOCUS_26250 1974 1090 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_26250 3537 2155 gene locus_tag LOCUS_26260 gene glnA 3537 2155 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_26260 4968 3673 gene locus_tag LOCUS_26270 gene eno 4968 3673 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_26270 5210 7357 gene locus_tag LOCUS_26280 5210 7357 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142384.1 protein_id gnl|my_center|LOCUS_26280 7416 7721 gene locus_tag LOCUS_26290 7416 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 9738 8131 gene locus_tag LOCUS_26300 9738 8131 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932499.1 protein_id gnl|my_center|LOCUS_26300 11543 9888 gene locus_tag LOCUS_26310 11543 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 11949 11536 gene locus_tag LOCUS_26320 11949 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 12664 12110 gene locus_tag LOCUS_26330 12664 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence080 765 547 gene locus_tag LOCUS_26340 765 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1054 1680 gene locus_tag LOCUS_26350 1054 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1746 2504 gene locus_tag LOCUS_26360 gene bamD 1746 2504 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926787.1 protein_id gnl|my_center|LOCUS_26360 2504 2974 gene locus_tag LOCUS_26370 2504 2974 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_26370 2925 5051 gene locus_tag LOCUS_26380 2925 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5051 6745 gene locus_tag LOCUS_26390 5051 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 6738 7370 gene locus_tag LOCUS_26400 gene ccmA 6738 7370 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_26400 7387 8052 gene locus_tag LOCUS_26410 7387 8052 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_26410 8085 8789 gene locus_tag LOCUS_26420 8085 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 8791 8940 gene locus_tag LOCUS_26430 8791 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 8930 9319 gene locus_tag LOCUS_26440 8930 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 9609 12011 gene locus_tag LOCUS_26450 gene ccsA 9609 12011 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence081 170 2101 gene locus_tag LOCUS_26460 170 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2179 3747 gene locus_tag LOCUS_26470 2179 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3894 4178 gene locus_tag LOCUS_26480 3894 4178 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_26480 4175 4486 gene locus_tag LOCUS_26490 4175 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 4473 5057 gene locus_tag LOCUS_26500 gene pyrE 4473 5057 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_26500 5146 6417 gene locus_tag LOCUS_26510 5146 6417 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_26510 6429 7661 gene locus_tag LOCUS_26520 6429 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 7674 9038 gene locus_tag LOCUS_26530 7674 9038 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_26530 12146 9039 gene locus_tag LOCUS_26540 12146 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence082 <1 1174 gene locus_tag LOCUS_26550 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N 1220 2776 gene locus_tag LOCUS_26560 1220 2776 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_26560 2868 3203 gene locus_tag LOCUS_26570 2868 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3292 3951 gene locus_tag LOCUS_26580 3292 3951 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_26580 4217 4876 gene locus_tag LOCUS_26590 4217 4876 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838193.1 protein_id gnl|my_center|LOCUS_26590 5509 6024 gene locus_tag LOCUS_26600 5509 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 6042 6536 gene locus_tag LOCUS_26610 gene nusB 6042 6536 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_26610 6526 7749 gene locus_tag LOCUS_26620 6526 7749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_26620 8741 7734 gene locus_tag LOCUS_26630 8741 7734 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_26630 9896 8742 gene locus_tag LOCUS_26640 9896 8742 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_26640 11416 9905 gene locus_tag LOCUS_26650 11416 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence083 126 401 gene locus_tag LOCUS_26660 126 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1140 451 gene locus_tag LOCUS_26670 1140 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3552 1363 gene locus_tag LOCUS_26680 3552 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 4679 4963 gene locus_tag LOCUS_26690 4679 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 5072 5905 gene locus_tag LOCUS_26700 5072 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 5895 6986 gene locus_tag LOCUS_26710 5895 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 6997 7479 gene locus_tag LOCUS_26720 6997 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7483 10272 gene locus_tag LOCUS_26730 7483 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence084 331 621 gene locus_tag LOCUS_26740 331 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 770 2059 gene locus_tag LOCUS_26750 770 2059 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107140.1 protein_id gnl|my_center|LOCUS_26750 2341 8205 gene locus_tag LOCUS_26760 2341 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 8223 10322 gene locus_tag LOCUS_26770 8223 10322 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence085 3510 175 gene locus_tag LOCUS_26780 3510 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8709 3577 gene locus_tag LOCUS_26790 8709 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9097 8837 gene locus_tag LOCUS_26800 9097 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 10106 9195 gene locus_tag LOCUS_26810 10106 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence086 340 1296 gene locus_tag LOCUS_26820 340 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_26820 1312 2424 gene locus_tag LOCUS_26830 1312 2424 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_26830 2472 3305 gene locus_tag LOCUS_26840 2472 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 3307 4488 gene locus_tag LOCUS_26850 3307 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4602 8306 gene locus_tag LOCUS_26860 4602 8306 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_26860 8327 10018 gene locus_tag LOCUS_26870 8327 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence087 1871 309 gene locus_tag LOCUS_26880 1871 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 2461 1868 gene locus_tag LOCUS_26890 2461 1868 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_26890 2628 2966 gene locus_tag LOCUS_26900 2628 2966 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_26900 3061 4335 gene locus_tag LOCUS_26910 3061 4335 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933807.1 protein_id gnl|my_center|LOCUS_26910 4412 5623 gene locus_tag LOCUS_26920 4412 5623 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_26920 7142 6048 gene locus_tag LOCUS_26930 gene aroB 7142 6048 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 protein_id gnl|my_center|LOCUS_26930 7680 7126 gene locus_tag LOCUS_26940 7680 7126 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933072.1 protein_id gnl|my_center|LOCUS_26940 8442 7729 gene locus_tag LOCUS_26950 8442 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 <10021 8546 gene locus_tag LOCUS_26960 <10021 8546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016194724.1:SurA N-terminal domain-containing protein >Feature sequence088 2086 1223 gene locus_tag LOCUS_26970 2086 1223 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546092.1 protein_id gnl|my_center|LOCUS_26970 2335 2096 gene locus_tag LOCUS_26980 2335 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3182 2598 gene locus_tag LOCUS_26990 3182 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3994 3398 gene locus_tag LOCUS_27000 gene recR 3994 3398 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_27000 4321 3995 gene locus_tag LOCUS_27010 4321 3995 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_27010 4456 5133 gene locus_tag LOCUS_27020 4456 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5133 5777 gene locus_tag LOCUS_27030 5133 5777 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933279.1 protein_id gnl|my_center|LOCUS_27030 5838 6500 gene locus_tag LOCUS_27040 gene pssA 5838 6500 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_27040 6504 6776 gene locus_tag LOCUS_27050 gene purS 6504 6776 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058019.1 protein_id gnl|my_center|LOCUS_27050 6773 7474 gene locus_tag LOCUS_27060 gene purQ 6773 7474 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_27060 7485 7679 gene locus_tag LOCUS_27070 gene tatA 7485 7679 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_27070 9696 7852 gene locus_tag LOCUS_27080 9696 7852 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence089 910 107 gene locus_tag LOCUS_27090 910 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2191 1088 gene locus_tag LOCUS_27100 2191 1088 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_27100 2862 2194 gene locus_tag LOCUS_27110 2862 2194 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868332.1 protein_id gnl|my_center|LOCUS_27110 4898 2865 gene locus_tag LOCUS_27120 gene ftsH 4898 2865 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_27120 5464 4907 gene locus_tag LOCUS_27130 gene hpt 5464 4907 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_27130 6818 5457 gene locus_tag LOCUS_27140 gene tilS 6818 5457 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_27140 7450 6818 gene locus_tag LOCUS_27150 7450 6818 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_27150 8020 7544 gene locus_tag LOCUS_27160 gene greA 8020 7544 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_27160 8316 9074 gene locus_tag LOCUS_27170 8316 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 9123 9635 gene locus_tag LOCUS_27180 9123 9635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence090 551 1009 gene locus_tag LOCUS_27190 551 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1034 2761 gene locus_tag LOCUS_27200 1034 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2782 3237 gene locus_tag LOCUS_27210 2782 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3243 3773 gene locus_tag LOCUS_27220 3243 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3775 5325 gene locus_tag LOCUS_27230 3775 5325 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_27230 5342 5659 gene locus_tag LOCUS_27240 5342 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 5661 6635 gene locus_tag LOCUS_27250 5661 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 6928 6659 gene locus_tag LOCUS_27260 6928 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 7146 8285 gene locus_tag LOCUS_27270 7146 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 8606 8959 gene locus_tag LOCUS_27280 8606 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence091 252 818 gene locus_tag LOCUS_27290 gene def 252 818 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404043.1 protein_id gnl|my_center|LOCUS_27290 826 1728 gene locus_tag LOCUS_27300 gene fmt 826 1728 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_27300 2213 1818 gene locus_tag LOCUS_27310 2213 1818 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_27310 2332 3177 gene locus_tag LOCUS_27320 2332 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 3258 4091 gene locus_tag LOCUS_27330 3258 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 4097 5278 gene locus_tag LOCUS_27340 gene xseA 4097 5278 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_27340 5278 5505 gene locus_tag LOCUS_27350 5278 5505 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_27350 5531 7450 gene locus_tag LOCUS_27360 gene dxs 5531 7450 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932029.1 protein_id gnl|my_center|LOCUS_27360 7450 8451 gene locus_tag LOCUS_27370 7450 8451 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_27370 8687 8995 gene locus_tag LOCUS_27380 8687 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence092 93 971 gene locus_tag LOCUS_27390 93 971 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_27390 1025 2227 gene locus_tag LOCUS_27400 1025 2227 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962613.1 protein_id gnl|my_center|LOCUS_27400 2208 2924 gene locus_tag LOCUS_27410 2208 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2929 3429 gene locus_tag LOCUS_27420 2929 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3832 3506 gene locus_tag LOCUS_27430 3832 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 4014 5138 gene locus_tag LOCUS_27440 gene corA 4014 5138 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_27440 5398 6423 gene locus_tag LOCUS_27450 5398 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 6812 7309 gene locus_tag LOCUS_27460 6812 7309 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_27460 7482 8042 gene locus_tag LOCUS_27470 7482 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 8474 8073 gene locus_tag LOCUS_27480 8474 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence093 2452 866 gene locus_tag LOCUS_27490 2452 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4488 2836 gene locus_tag LOCUS_27500 gene pckA 4488 2836 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_27500 5702 4485 gene locus_tag LOCUS_27510 5702 4485 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_27510 5852 6457 gene locus_tag LOCUS_27520 5852 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6454 8397 gene locus_tag LOCUS_27530 6454 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence094 3621 1171 gene locus_tag LOCUS_27540 3621 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 6310 4241 gene locus_tag LOCUS_27550 6310 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence095 213 482 gene locus_tag LOCUS_27560 213 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 907 479 gene locus_tag LOCUS_27570 907 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1492 908 gene locus_tag LOCUS_27580 gene hisH 1492 908 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_27580 1790 2716 gene locus_tag LOCUS_27590 1790 2716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_27590 3743 2784 gene locus_tag LOCUS_27600 3743 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3999 3754 gene locus_tag LOCUS_27610 3999 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 4265 5071 gene locus_tag LOCUS_27620 4265 5071 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931878.1 protein_id gnl|my_center|LOCUS_27620 5031 5879 gene locus_tag LOCUS_27630 5031 5879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931877.1 protein_id gnl|my_center|LOCUS_27630 5934 6920 gene locus_tag LOCUS_27640 5934 6920 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_27640 7356 6931 gene locus_tag LOCUS_27650 7356 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 7875 7420 gene locus_tag LOCUS_27660 7875 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence096 188 916 gene locus_tag LOCUS_27670 gene truA 188 916 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_27670 994 1431 gene locus_tag LOCUS_27680 994 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1568 2068 gene locus_tag LOCUS_27690 1568 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2080 2862 gene locus_tag LOCUS_27700 2080 2862 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_27700 2874 3890 gene locus_tag LOCUS_27710 2874 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 5257 3893 gene locus_tag LOCUS_27720 5257 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 6523 5258 gene locus_tag LOCUS_27730 6523 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 7808 6588 gene locus_tag LOCUS_27740 7808 6588 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence097 1222 179 gene locus_tag LOCUS_27750 1222 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2272 1235 gene locus_tag LOCUS_27760 2272 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 4697 2886 gene locus_tag LOCUS_27770 4697 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 4880 6919 gene locus_tag LOCUS_27780 4880 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence098 1291 326 gene locus_tag LOCUS_27790 gene mdh 1291 326 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942112.1 protein_id gnl|my_center|LOCUS_27790 1850 1440 gene locus_tag LOCUS_27800 gene spoIIAB 1850 1440 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_27800 3798 1900 gene locus_tag LOCUS_27810 3798 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 4011 4388 gene locus_tag LOCUS_27820 4011 4388 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_27820 4379 4900 gene locus_tag LOCUS_27830 4379 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4903 5391 gene locus_tag LOCUS_27840 4903 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 5397 6647 gene locus_tag LOCUS_27850 gene nuoD 5397 6647 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_27850 6650 7123 gene locus_tag LOCUS_27860 gene nuoE 6650 7123 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence099 1297 110 gene locus_tag LOCUS_27870 1297 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4787 1404 gene locus_tag LOCUS_27880 4787 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_27880 5447 4788 gene locus_tag LOCUS_27890 5447 4788 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_27890 6133 5675 gene locus_tag LOCUS_27900 6133 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 6446 6156 gene locus_tag LOCUS_27910 6446 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence100 357 2030 gene locus_tag LOCUS_27920 357 2030 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_27920 2065 3120 gene locus_tag LOCUS_27930 gene nuoH 2065 3120 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_27930 3172 3681 gene locus_tag LOCUS_27940 3172 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3754 5292 gene locus_tag LOCUS_27950 3754 5292 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_27950 6019 5339 gene locus_tag LOCUS_27960 6019 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence101 1879 122 gene locus_tag LOCUS_27970 1879 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2942 1929 gene locus_tag LOCUS_27980 2942 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 4852 2978 gene locus_tag LOCUS_27990 4852 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 5574 5386 gene locus_tag LOCUS_28000 5574 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 5872 5615 gene locus_tag LOCUS_28010 5872 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 5892 6086 gene locus_tag LOCUS_28020 5892 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence102 <1 3330 gene locus_tag LOCUS_28030 <1 3330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930982.1:fibronectin type III domain-containing protein 3623 5749 gene locus_tag LOCUS_28040 3623 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence103 448 681 gene locus_tag LOCUS_28050 448 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 839 3814 gene locus_tag LOCUS_28060 839 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 3949 5013 gene locus_tag LOCUS_28070 3949 5013 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_28070 5662 5123 gene locus_tag LOCUS_28080 5662 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence104 291 473 gene locus_tag LOCUS_28090 291 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 826 2100 gene locus_tag LOCUS_28100 826 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2508 3551 gene locus_tag LOCUS_28110 2508 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3907 5403 gene locus_tag LOCUS_28120 3907 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence105 731 189 gene locus_tag LOCUS_28130 731 189 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949045.1 protein_id gnl|my_center|LOCUS_28130 3066 865 gene locus_tag LOCUS_28140 3066 865 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_28140 5275 3323 gene locus_tag LOCUS_28150 5275 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence106 409 1323 gene locus_tag LOCUS_28160 409 1323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_28160 1313 2578 gene locus_tag LOCUS_28170 1313 2578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_28170 2699 5170 gene locus_tag LOCUS_28180 2699 5170 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence107 3084 1537 gene locus_tag LOCUS_28190 3084 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 <4697 3099 gene locus_tag LOCUS_28200 <4697 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119815.1:ferritin-like domain-containing protein >Feature sequence108 227 1369 gene locus_tag LOCUS_28210 227 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1376 1702 gene locus_tag LOCUS_28220 1376 1702 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_28220 2873 1791 gene locus_tag LOCUS_28230 2873 1791 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276589.1 protein_id gnl|my_center|LOCUS_28230 4149 2857 gene locus_tag LOCUS_28240 4149 2857 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence109 288 2027 gene locus_tag LOCUS_28250 288 2027 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_28250 2044 3537 gene locus_tag LOCUS_28260 2044 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence110 3813 982 gene locus_tag LOCUS_28270 3813 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence111 836 144 gene locus_tag LOCUS_28280 836 144 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_28280 1899 829 gene locus_tag LOCUS_28290 1899 829 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_28290 3719 1902 gene locus_tag LOCUS_28300 3719 1902 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943122.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence112 1350 406 gene locus_tag LOCUS_28310 1350 406 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418432.1 protein_id gnl|my_center|LOCUS_28310 1805 1371 gene locus_tag LOCUS_28320 1805 1371 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 protein_id gnl|my_center|LOCUS_28320 3162 1876 gene locus_tag LOCUS_28330 3162 1876 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_28330 3793 3512 gene locus_tag LOCUS_28340 3793 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence113 1949 264 gene locus_tag LOCUS_28350 1949 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 <3744 2112 gene locus_tag LOCUS_28360 <3744 2112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein >Feature sequence114 2341 89 gene locus_tag LOCUS_28370 2341 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3099 2341 gene locus_tag LOCUS_28380 3099 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3585 3190 gene locus_tag LOCUS_28390 3585 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence115 <3651 2683 gene locus_tag LOCUS_28400 <3651 2683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence116 >Feature sequence117 250 987 gene locus_tag LOCUS_28410 250 987 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_28410 1666 980 gene locus_tag LOCUS_28420 gene rsmI 1666 980 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_28420 3106 1739 gene locus_tag LOCUS_28430 gene lat 3106 1739 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_28430