>Feature sequence001 116 191 gene locus_tag LOCUS_t00010 116 191 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1863 184 gene locus_tag LOCUS_00010 1863 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2247 2041 gene locus_tag LOCUS_00020 2247 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2811 2251 gene locus_tag LOCUS_00030 2811 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3297 2821 gene locus_tag LOCUS_00040 3297 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5116 3341 gene locus_tag LOCUS_00050 5116 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5658 5113 gene locus_tag LOCUS_00060 5658 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7100 5655 gene locus_tag LOCUS_00070 7100 5655 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_00070 7966 7136 gene locus_tag LOCUS_00080 7966 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8102 9796 gene locus_tag LOCUS_00090 8102 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11269 9800 gene locus_tag LOCUS_00100 11269 9800 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029051.1 protein_id gnl|my_center|LOCUS_00100 12640 11273 gene locus_tag LOCUS_00110 12640 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12991 12671 gene locus_tag LOCUS_00120 12991 12671 CDS product DUF6112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029048.1 protein_id gnl|my_center|LOCUS_00120 13407 13141 gene locus_tag LOCUS_00130 13407 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15023 13407 gene locus_tag LOCUS_00140 15023 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15727 15035 gene locus_tag LOCUS_00150 15727 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235933774.1 protein_id gnl|my_center|LOCUS_00150 16761 15763 gene locus_tag LOCUS_00160 16761 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17633 16758 gene locus_tag LOCUS_00170 17633 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18130 17720 gene locus_tag LOCUS_00180 18130 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18816 18127 gene locus_tag LOCUS_00190 18816 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19748 18816 gene locus_tag LOCUS_00200 19748 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20836 19748 gene locus_tag LOCUS_00210 20836 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21148 21579 gene locus_tag LOCUS_00220 21148 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21640 22104 gene locus_tag LOCUS_00230 21640 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22101 23108 gene locus_tag LOCUS_00240 22101 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23105 24241 gene locus_tag LOCUS_00250 23105 24241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804986.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 24377 24577 gene locus_tag LOCUS_00260 24377 24577 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_00260 24668 28270 gene locus_tag LOCUS_00270 24668 28270 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_00270 28267 31101 gene locus_tag LOCUS_00280 28267 31101 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_00280 31105 32223 gene locus_tag LOCUS_00290 31105 32223 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_00290 32285 35686 gene locus_tag LOCUS_00300 32285 35686 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_00300 35689 37083 gene locus_tag LOCUS_00310 35689 37083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37089 38153 gene locus_tag LOCUS_00320 37089 38153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 38762 38121 gene locus_tag LOCUS_00330 38762 38121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40210 38897 gene locus_tag LOCUS_00340 40210 38897 CDS product ISL3-like element ISAar39 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141270575.1 protein_id gnl|my_center|LOCUS_00340 40649 40272 gene locus_tag LOCUS_00350 40649 40272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40950 44546 gene locus_tag LOCUS_00360 gene mobF 40950 44546 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 protein_id gnl|my_center|LOCUS_00360 44754 45551 gene locus_tag LOCUS_00370 44754 45551 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_00370 45551 47281 gene locus_tag LOCUS_00380 45551 47281 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_00380 47271 48122 gene locus_tag LOCUS_00390 47271 48122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48119 49393 gene locus_tag LOCUS_00400 48119 49393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_00400 49390 50148 gene locus_tag LOCUS_00410 49390 50148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50438 50812 gene locus_tag LOCUS_00420 50438 50812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51731 50847 gene locus_tag LOCUS_00430 51731 50847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 51651 51902 gene locus_tag LOCUS_00440 51651 51902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52396 51932 gene locus_tag LOCUS_00450 52396 51932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence002 1805 588 gene locus_tag LOCUS_00460 1805 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 2638 1952 gene locus_tag LOCUS_00470 2638 1952 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_00470 4569 2638 gene locus_tag LOCUS_00480 4569 2638 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_00480 5180 4569 gene locus_tag LOCUS_00490 5180 4569 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_00490 6371 5232 gene locus_tag LOCUS_00500 gene ftsW 6371 5232 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_00500 8293 6368 gene locus_tag LOCUS_00510 gene mrdA 8293 6368 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_00510 8793 8290 gene locus_tag LOCUS_00520 8793 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 9518 8790 gene locus_tag LOCUS_00530 9518 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 10561 9521 gene locus_tag LOCUS_00540 10561 9521 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_00540 11056 10646 gene locus_tag LOCUS_00550 gene ndk 11056 10646 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_00550 11567 11253 gene locus_tag LOCUS_00560 11567 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 12895 11570 gene locus_tag LOCUS_00570 12895 11570 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_00570 12978 14552 gene locus_tag LOCUS_00580 12978 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 14605 17133 gene locus_tag LOCUS_00590 gene valS 14605 17133 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804592.1 protein_id gnl|my_center|LOCUS_00590 17192 18175 gene locus_tag LOCUS_00600 17192 18175 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_00600 18256 19026 gene locus_tag LOCUS_00610 18256 19026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 19322 19023 gene locus_tag LOCUS_00620 19322 19023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 20590 19319 gene locus_tag LOCUS_00630 gene clpX 20590 19319 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_00630 21326 20700 gene locus_tag LOCUS_00640 21326 20700 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_00640 21943 21326 gene locus_tag LOCUS_00650 21943 21326 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_00650 23465 22044 gene locus_tag LOCUS_00660 gene tig 23465 22044 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_00660 23601 23528 gene locus_tag LOCUS_t00020 23601 23528 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23630 23701 gene locus_tag LOCUS_t00030 23630 23701 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24165 23905 gene locus_tag LOCUS_00670 24165 23905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 24801 24205 gene locus_tag LOCUS_00680 24801 24205 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926062.1 protein_id gnl|my_center|LOCUS_00680 25681 24938 gene locus_tag LOCUS_00690 25681 24938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_00690 25959 25681 gene locus_tag LOCUS_00700 25959 25681 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_00700 26364 25960 gene locus_tag LOCUS_00710 26364 25960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 27133 26396 gene locus_tag LOCUS_00720 gene rpiA 27133 26396 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_00720 27177 29735 gene locus_tag LOCUS_00730 gene pepN 27177 29735 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_00730 32006 29943 gene locus_tag LOCUS_00740 gene malQ 32006 29943 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729252.1 protein_id gnl|my_center|LOCUS_00740 33406 32003 gene locus_tag LOCUS_00750 33406 32003 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_00750 33714 33403 gene locus_tag LOCUS_00760 33714 33403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 33772 34695 gene locus_tag LOCUS_00770 33772 34695 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_00770 34735 35151 gene locus_tag LOCUS_00780 34735 35151 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_00780 35148 36695 gene locus_tag LOCUS_00790 35148 36695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862091.1 protein_id gnl|my_center|LOCUS_00790 36739 37644 gene locus_tag LOCUS_00800 36739 37644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 37987 37634 gene locus_tag LOCUS_00810 37987 37634 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_00810 39711 38023 gene locus_tag LOCUS_00820 gene ettA 39711 38023 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_00820 40106 39753 gene locus_tag LOCUS_00830 40106 39753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 40303 41037 gene locus_tag LOCUS_00840 40303 41037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 41761 41018 gene locus_tag LOCUS_00850 41761 41018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 42156 41794 gene locus_tag LOCUS_00860 42156 41794 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_00860 42361 42639 gene locus_tag LOCUS_00870 42361 42639 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013354.1 protein_id gnl|my_center|LOCUS_00870 42661 42993 gene locus_tag LOCUS_00880 42661 42993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 42993 44429 gene locus_tag LOCUS_00890 42993 44429 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_00890 44437 44790 gene locus_tag LOCUS_00900 44437 44790 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_00900 44797 45552 gene locus_tag LOCUS_00910 44797 45552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 45618 46502 gene locus_tag LOCUS_00920 45618 46502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 46515 47300 gene locus_tag LOCUS_00930 46515 47300 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284395.1 protein_id gnl|my_center|LOCUS_00930 48443 47304 gene locus_tag LOCUS_00940 48443 47304 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence003 3 146 gene locus_tag LOCUS_00950 3 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 143 1099 gene locus_tag LOCUS_00960 gene galE 143 1099 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_00960 1304 2653 gene locus_tag LOCUS_00970 1304 2653 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_00970 2708 2926 gene locus_tag LOCUS_00980 2708 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3052 3753 gene locus_tag LOCUS_00990 3052 3753 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518747.1 protein_id gnl|my_center|LOCUS_00990 4218 3733 gene locus_tag LOCUS_01000 4218 3733 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111791.1 protein_id gnl|my_center|LOCUS_01000 4242 4709 gene locus_tag LOCUS_01010 4242 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 4788 5654 gene locus_tag LOCUS_01020 4788 5654 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_01020 5659 6327 gene locus_tag LOCUS_01030 gene purQ 5659 6327 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_01030 6331 8562 gene locus_tag LOCUS_01040 gene purL 6331 8562 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_01040 8562 9158 gene locus_tag LOCUS_01050 8562 9158 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529746.1 protein_id gnl|my_center|LOCUS_01050 9193 10875 gene locus_tag LOCUS_01060 9193 10875 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229258.1 protein_id gnl|my_center|LOCUS_01060 10872 11162 gene locus_tag LOCUS_01070 10872 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12681 11152 gene locus_tag LOCUS_01080 12681 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12822 14402 gene locus_tag LOCUS_01090 gene purF 12822 14402 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_01090 14399 15454 gene locus_tag LOCUS_01100 gene purM 14399 15454 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_01100 15589 16275 gene locus_tag LOCUS_01110 15589 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16301 16981 gene locus_tag LOCUS_01120 16301 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17076 17774 gene locus_tag LOCUS_01130 17076 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 17781 18473 gene locus_tag LOCUS_01140 17781 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 18744 18502 gene locus_tag LOCUS_01150 gene bldC 18744 18502 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_01150 18979 19167 gene locus_tag LOCUS_01160 18979 19167 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230732.1 protein_id gnl|my_center|LOCUS_01160 19321 19503 gene locus_tag LOCUS_01170 19321 19503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 19856 19500 gene locus_tag LOCUS_01180 gene trxA 19856 19500 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_01180 19964 21322 gene locus_tag LOCUS_01190 19964 21322 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_01190 21976 21425 gene locus_tag LOCUS_01200 21976 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 22169 23152 gene locus_tag LOCUS_01210 22169 23152 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_01210 23149 23949 gene locus_tag LOCUS_01220 23149 23949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_01220 26854 24119 gene locus_tag LOCUS_01230 26854 24119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 28976 26868 gene locus_tag LOCUS_01240 28976 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 29271 29726 gene locus_tag LOCUS_01250 29271 29726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 29723 30586 gene locus_tag LOCUS_01260 29723 30586 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_01260 32389 30653 gene locus_tag LOCUS_01270 32389 30653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 32482 33207 gene locus_tag LOCUS_01280 32482 33207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 33366 35222 gene locus_tag LOCUS_01290 33366 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 35228 36469 gene locus_tag LOCUS_01300 35228 36469 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_01300 37190 36522 gene locus_tag LOCUS_01310 37190 36522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 37311 38192 gene locus_tag LOCUS_01320 37311 38192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 38323 38799 gene locus_tag LOCUS_01330 38323 38799 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_01330 38807 39766 gene locus_tag LOCUS_01340 38807 39766 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_01340 40484 39735 gene locus_tag LOCUS_01350 gene fabG 40484 39735 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_01350 40585 41205 gene locus_tag LOCUS_01360 40585 41205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 41090 42247 gene locus_tag LOCUS_01370 41090 42247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 43454 42255 gene locus_tag LOCUS_01380 43454 42255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 protein_id gnl|my_center|LOCUS_01380 45292 43640 gene locus_tag LOCUS_01390 45292 43640 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090032.1 protein_id gnl|my_center|LOCUS_01390 45396 45539 gene locus_tag LOCUS_01400 45396 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 47115 45541 gene locus_tag LOCUS_01410 47115 45541 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 protein_id gnl|my_center|LOCUS_01410 47167 47892 gene locus_tag LOCUS_01420 gene budA 47167 47892 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068896.1 protein_id gnl|my_center|LOCUS_01420 48026 47889 gene locus_tag LOCUS_01430 48026 47889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 <48650 48064 gene locus_tag LOCUS_01440 <48650 48064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966314.1:GGDEF domain-containing protein >Feature sequence004 1172 1963 gene locus_tag LOCUS_01450 1172 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091309276.1 protein_id gnl|my_center|LOCUS_01450 1960 2406 gene locus_tag LOCUS_01460 1960 2406 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224980.1 protein_id gnl|my_center|LOCUS_01460 2403 2906 gene locus_tag LOCUS_01470 2403 2906 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224979.1 protein_id gnl|my_center|LOCUS_01470 3943 2981 gene locus_tag LOCUS_01480 3943 2981 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_01480 4395 3955 gene locus_tag LOCUS_01490 4395 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4541 5110 gene locus_tag LOCUS_01500 4541 5110 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_01500 5158 6363 gene locus_tag LOCUS_01510 5158 6363 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_01510 6383 7552 gene locus_tag LOCUS_01520 6383 7552 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975556.1 protein_id gnl|my_center|LOCUS_01520 7577 9814 gene locus_tag LOCUS_01530 7577 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10033 11256 gene locus_tag LOCUS_01540 10033 11256 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_01540 12194 11427 gene locus_tag LOCUS_01550 12194 11427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259269.1 protein_id gnl|my_center|LOCUS_01550 12248 13195 gene locus_tag LOCUS_01560 12248 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 13131 13140 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13153 13506 gene locus_tag LOCUS_01570 13153 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13503 14723 gene locus_tag LOCUS_01580 13503 14723 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726802.1 protein_id gnl|my_center|LOCUS_01580 14720 15598 gene locus_tag LOCUS_01590 14720 15598 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_01590 15634 17250 gene locus_tag LOCUS_01600 15634 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17247 18863 gene locus_tag LOCUS_01610 17247 18863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 18860 19525 gene locus_tag LOCUS_01620 18860 19525 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389717.1 protein_id gnl|my_center|LOCUS_01620 19695 19943 gene locus_tag LOCUS_01630 19695 19943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 20000 20377 gene locus_tag LOCUS_01640 20000 20377 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169809.1 protein_id gnl|my_center|LOCUS_01640 21278 20541 gene locus_tag LOCUS_01650 21278 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 21291 21429 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21492 21914 gene locus_tag LOCUS_01660 21492 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 22030 22704 gene locus_tag LOCUS_01670 22030 22704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22704 23171 gene locus_tag LOCUS_01680 gene dtd 22704 23171 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112231.1 protein_id gnl|my_center|LOCUS_01680 23191 23946 gene locus_tag LOCUS_01690 23191 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 23946 24317 gene locus_tag LOCUS_01700 23946 24317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 24555 25871 gene locus_tag LOCUS_01710 24555 25871 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_01710 25875 26981 gene locus_tag LOCUS_01720 25875 26981 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229667.1 protein_id gnl|my_center|LOCUS_01720 26992 27375 gene locus_tag LOCUS_01730 26992 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 27905 27372 gene locus_tag LOCUS_01740 27905 27372 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_01740 28674 27916 gene locus_tag LOCUS_01750 28674 27916 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_01750 29496 28726 gene locus_tag LOCUS_01760 29496 28726 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_01760 29703 31199 gene locus_tag LOCUS_01770 gene glpK 29703 31199 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_01770 31945 31292 gene locus_tag LOCUS_01780 31945 31292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 32981 31992 gene locus_tag LOCUS_01790 32981 31992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 33042 33941 gene locus_tag LOCUS_01800 33042 33941 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_01800 34020 35225 gene locus_tag LOCUS_01810 34020 35225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 35238 37526 gene locus_tag LOCUS_01820 35238 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 38218 37523 gene locus_tag LOCUS_01830 38218 37523 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_01830 39106 38219 gene locus_tag LOCUS_01840 39106 38219 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_01840 39544 39116 gene locus_tag LOCUS_01850 39544 39116 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226504.1 protein_id gnl|my_center|LOCUS_01850 39760 40689 gene locus_tag LOCUS_01860 39760 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 41258 40686 gene locus_tag LOCUS_01870 41258 40686 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_01870 41862 41251 gene locus_tag LOCUS_01880 gene recR 41862 41251 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_01880 43683 41866 gene locus_tag LOCUS_01890 43683 41866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 43588 43597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 990 142 gene locus_tag LOCUS_01900 990 142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727900.1 protein_id gnl|my_center|LOCUS_01900 1477 1025 gene locus_tag LOCUS_01910 1477 1025 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317797.1 protein_id gnl|my_center|LOCUS_01910 1978 1490 gene locus_tag LOCUS_01920 1978 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2102 3604 gene locus_tag LOCUS_01930 2102 3604 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104247.1 protein_id gnl|my_center|LOCUS_01930 3626 4564 gene locus_tag LOCUS_01940 3626 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4474 5061 gene locus_tag LOCUS_01950 4474 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6231 5020 gene locus_tag LOCUS_01960 6231 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6554 6228 gene locus_tag LOCUS_01970 6554 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7690 6551 gene locus_tag LOCUS_01980 7690 6551 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523309.1 protein_id gnl|my_center|LOCUS_01980 9222 7660 gene locus_tag LOCUS_01990 gene rfaE1 9222 7660 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387884.1 protein_id gnl|my_center|LOCUS_01990 10109 9219 gene locus_tag LOCUS_02000 10109 9219 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 protein_id gnl|my_center|LOCUS_02000 10789 10100 gene locus_tag LOCUS_02010 10789 10100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_02010 11979 10768 gene locus_tag LOCUS_02020 11979 10768 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226118.1 protein_id gnl|my_center|LOCUS_02020 11884 12231 gene locus_tag LOCUS_02030 11884 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 12806 12171 gene locus_tag LOCUS_02040 12806 12171 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_02040 14032 12806 gene locus_tag LOCUS_02050 14032 12806 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_02050 14985 14032 gene locus_tag LOCUS_02060 14985 14032 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_02060 15989 14982 gene locus_tag LOCUS_02070 15989 14982 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_02070 16525 15986 gene locus_tag LOCUS_02080 16525 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 18464 16695 gene locus_tag LOCUS_02090 18464 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 19192 18668 gene locus_tag LOCUS_02100 19192 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 19589 19239 gene locus_tag LOCUS_02110 19589 19239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 19783 19586 gene locus_tag LOCUS_02120 19783 19586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 19766 20128 gene locus_tag LOCUS_02130 19766 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 21346 20273 gene locus_tag LOCUS_02140 gene cydB 21346 20273 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_02140 22757 21357 gene locus_tag LOCUS_02150 22757 21357 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_02150 23027 24541 gene locus_tag LOCUS_02160 23027 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 25750 24575 gene locus_tag LOCUS_02170 gene cobA 25750 24575 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414535.1 protein_id gnl|my_center|LOCUS_02170 25895 26458 gene locus_tag LOCUS_02180 25895 26458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27919 26561 gene locus_tag LOCUS_02190 27919 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 28729 28001 gene locus_tag LOCUS_02200 28729 28001 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_02200 28996 28811 gene locus_tag LOCUS_02210 28996 28811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 29154 29738 gene locus_tag LOCUS_02220 29154 29738 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 protein_id gnl|my_center|LOCUS_02220 29735 30442 gene locus_tag LOCUS_02230 29735 30442 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112978.1 protein_id gnl|my_center|LOCUS_02230 30439 31302 gene locus_tag LOCUS_02240 30439 31302 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728945.1 protein_id gnl|my_center|LOCUS_02240 32744 31374 gene locus_tag LOCUS_02250 gene xylB 32744 31374 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_02250 33913 32741 gene locus_tag LOCUS_02260 gene xylA 33913 32741 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_02260 34973 33927 gene locus_tag LOCUS_02270 34973 33927 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_02270 36238 34982 gene locus_tag LOCUS_02280 36238 34982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_02280 37087 36242 gene locus_tag LOCUS_02290 37087 36242 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_02290 37372 37088 gene locus_tag LOCUS_02300 37372 37088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 37999 37433 gene locus_tag LOCUS_02310 37999 37433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 38430 38011 gene locus_tag LOCUS_02320 38430 38011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 38499 39956 gene locus_tag LOCUS_02330 38499 39956 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_02330 39961 40107 gene locus_tag LOCUS_02340 39961 40107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 40343 40822 gene locus_tag LOCUS_02350 40343 40822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence006 409 708 gene locus_tag LOCUS_02360 409 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 714 3386 gene locus_tag LOCUS_02370 gene alaS 714 3386 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_02370 3386 3844 gene locus_tag LOCUS_02380 gene ruvX 3386 3844 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_02380 3841 4935 gene locus_tag LOCUS_02390 gene mltG 3841 4935 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_02390 4932 5735 gene locus_tag LOCUS_02400 4932 5735 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_02400 5787 6851 gene locus_tag LOCUS_02410 5787 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6858 7730 gene locus_tag LOCUS_02420 6858 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7727 9391 gene locus_tag LOCUS_02430 7727 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 9573 10820 gene locus_tag LOCUS_02440 9573 10820 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_02440 10817 12040 gene locus_tag LOCUS_02450 10817 12040 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_02450 13307 12147 gene locus_tag LOCUS_02460 13307 12147 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729039.1 protein_id gnl|my_center|LOCUS_02460 13540 13806 gene locus_tag LOCUS_02470 13540 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 13884 14345 gene locus_tag LOCUS_02480 13884 14345 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_02480 14393 15052 gene locus_tag LOCUS_02490 14393 15052 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259190.1 protein_id gnl|my_center|LOCUS_02490 15249 15668 gene locus_tag LOCUS_02500 15249 15668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 16997 15774 gene locus_tag LOCUS_02510 16997 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 18175 16994 gene locus_tag LOCUS_02520 18175 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18369 18815 gene locus_tag LOCUS_02530 18369 18815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 18999 19409 gene locus_tag LOCUS_02540 18999 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 19497 20846 gene locus_tag LOCUS_02550 19497 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 20843 21553 gene locus_tag LOCUS_02560 20843 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 21564 23684 gene locus_tag LOCUS_02570 21564 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 23741 24508 gene locus_tag LOCUS_02580 23741 24508 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226289.1 protein_id gnl|my_center|LOCUS_02580 24575 25618 gene locus_tag LOCUS_02590 24575 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 25696 26367 gene locus_tag LOCUS_02600 25696 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 26364 27071 gene locus_tag LOCUS_02610 26364 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 27068 27766 gene locus_tag LOCUS_02620 27068 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 27781 28959 gene locus_tag LOCUS_02630 gene aroC 27781 28959 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_02630 28956 29459 gene locus_tag LOCUS_02640 28956 29459 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_02640 29441 30535 gene locus_tag LOCUS_02650 gene aroB 29441 30535 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_02650 30532 30966 gene locus_tag LOCUS_02660 gene aroQ 30532 30966 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_02660 30963 32045 gene locus_tag LOCUS_02670 30963 32045 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082355.1 protein_id gnl|my_center|LOCUS_02670 32056 32619 gene locus_tag LOCUS_02680 gene efp 32056 32619 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_02680 32619 33032 gene locus_tag LOCUS_02690 gene nusB 32619 33032 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_02690 33207 35030 gene locus_tag LOCUS_02700 33207 35030 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222107.1 protein_id gnl|my_center|LOCUS_02700 35057 35830 gene locus_tag LOCUS_02710 35057 35830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 35915 35839 gene locus_tag LOCUS_t00040 35915 35839 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35982 36560 gene locus_tag LOCUS_02720 35982 36560 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 protein_id gnl|my_center|LOCUS_02720 36711 37997 gene locus_tag LOCUS_02730 36711 37997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence007 355 1440 gene locus_tag LOCUS_02740 355 1440 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_02740 2632 1424 gene locus_tag LOCUS_02750 2632 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2676 3857 gene locus_tag LOCUS_02760 2676 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3927 4796 gene locus_tag LOCUS_02770 3927 4796 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029901.1 protein_id gnl|my_center|LOCUS_02770 5008 6453 gene locus_tag LOCUS_02780 5008 6453 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_02780 7732 6455 gene locus_tag LOCUS_02790 7732 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 7972 8745 gene locus_tag LOCUS_02800 7972 8745 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_02800 8742 9092 gene locus_tag LOCUS_02810 8742 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 9309 10241 gene locus_tag LOCUS_02820 9309 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10286 10867 gene locus_tag LOCUS_02830 10286 10867 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_02830 10864 11940 gene locus_tag LOCUS_02840 10864 11940 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_02840 11940 12929 gene locus_tag LOCUS_02850 11940 12929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_02850 13543 13812 gene locus_tag LOCUS_02860 13543 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 13816 14937 gene locus_tag LOCUS_02870 13816 14937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 15988 14981 gene locus_tag LOCUS_02880 15988 14981 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_02880 17422 16073 gene locus_tag LOCUS_02890 17422 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 17524 18351 gene locus_tag LOCUS_02900 17524 18351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 18352 19560 gene locus_tag LOCUS_02910 18352 19560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_02910 19647 21716 gene locus_tag LOCUS_02920 19647 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 21848 22555 gene locus_tag LOCUS_02930 21848 22555 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533115.1 protein_id gnl|my_center|LOCUS_02930 22552 23385 gene locus_tag LOCUS_02940 22552 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 23382 24566 gene locus_tag LOCUS_02950 23382 24566 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_02950 27389 24576 gene locus_tag LOCUS_02960 27389 24576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 27483 28604 gene locus_tag LOCUS_02970 27483 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 29683 28607 gene locus_tag LOCUS_02980 29683 28607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 32724 29770 gene locus_tag LOCUS_02990 32724 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 33520 32639 gene locus_tag LOCUS_03000 33520 32639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 34389 33517 gene locus_tag LOCUS_03010 gene rfbA 34389 33517 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_03010 34458 35435 gene locus_tag LOCUS_03020 gene rfbB 34458 35435 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_03020 35432 36274 gene locus_tag LOCUS_03030 gene rfbD 35432 36274 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_03030 36876 36271 gene locus_tag LOCUS_03040 36876 36271 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_03040 37103 37112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence008 <1 1702 gene locus_tag LOCUS_03050 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224267.1:vitamin B12-dependent ribonucleotide reductase 1832 3349 gene locus_tag LOCUS_03060 gene jefA 1832 3349 CDS product multidrug efflux pump JefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412642.1 protein_id gnl|my_center|LOCUS_03060 3415 7011 gene locus_tag LOCUS_03070 3415 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 7928 6975 gene locus_tag LOCUS_03080 7928 6975 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_03080 8004 8489 gene locus_tag LOCUS_03090 8004 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9281 8613 gene locus_tag LOCUS_03100 9281 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 10607 9291 gene locus_tag LOCUS_03110 10607 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10953 12419 gene locus_tag LOCUS_03120 10953 12419 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674607.1 protein_id gnl|my_center|LOCUS_03120 12472 13422 gene locus_tag LOCUS_03130 12472 13422 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_03130 13435 14244 gene locus_tag LOCUS_03140 13435 14244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_03140 14312 15142 gene locus_tag LOCUS_03150 14312 15142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_03150 15148 15618 gene locus_tag LOCUS_03160 15148 15618 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_03160 15631 16443 gene locus_tag LOCUS_03170 15631 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 18227 16434 gene locus_tag LOCUS_03180 18227 16434 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_03180 19969 18227 gene locus_tag LOCUS_03190 19969 18227 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391151.1 protein_id gnl|my_center|LOCUS_03190 20092 21081 gene locus_tag LOCUS_03200 20092 21081 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 protein_id gnl|my_center|LOCUS_03200 21736 21209 gene locus_tag LOCUS_03210 21736 21209 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03210 21792 23378 gene locus_tag LOCUS_03220 21792 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 23469 24200 gene locus_tag LOCUS_03230 23469 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 24280 25044 gene locus_tag LOCUS_03240 24280 25044 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_03240 25783 25034 gene locus_tag LOCUS_03250 25783 25034 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_03250 26433 25816 gene locus_tag LOCUS_03260 26433 25816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_03260 26321 26536 gene locus_tag LOCUS_03270 26321 26536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 26545 27411 gene locus_tag LOCUS_03280 26545 27411 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_03280 28380 27427 gene locus_tag LOCUS_03290 28380 27427 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_03290 28490 28771 gene locus_tag LOCUS_03300 28490 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 28783 30009 gene locus_tag LOCUS_03310 28783 30009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 30029 31444 gene locus_tag LOCUS_03320 30029 31444 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908420.1 protein_id gnl|my_center|LOCUS_03320 31471 32994 gene locus_tag LOCUS_03330 31471 32994 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_03330 34305 32998 gene locus_tag LOCUS_03340 34305 32998 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_03340 34433 35527 gene locus_tag LOCUS_03350 34433 35527 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_03350 35834 35529 gene locus_tag LOCUS_03360 35834 35529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence009 2500 560 gene locus_tag LOCUS_03370 2500 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3727 2567 gene locus_tag LOCUS_03380 3727 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3776 4399 gene locus_tag LOCUS_03390 3776 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_03390 4794 4396 gene locus_tag LOCUS_03400 4794 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5594 4815 gene locus_tag LOCUS_03410 5594 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6259 5591 gene locus_tag LOCUS_03420 6259 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6367 7041 gene locus_tag LOCUS_03430 6367 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8524 7034 gene locus_tag LOCUS_03440 8524 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8572 10377 gene locus_tag LOCUS_03450 8572 10377 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970120.1 protein_id gnl|my_center|LOCUS_03450 11204 10440 gene locus_tag LOCUS_03460 11204 10440 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_03460 11804 11235 gene locus_tag LOCUS_03470 11804 11235 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_03470 12733 11804 gene locus_tag LOCUS_03480 12733 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 13412 12783 gene locus_tag LOCUS_03490 13412 12783 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_03490 14216 13479 gene locus_tag LOCUS_03500 14216 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 14217 14420 gene locus_tag LOCUS_03510 14217 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14469 15674 gene locus_tag LOCUS_03520 14469 15674 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112649.1 protein_id gnl|my_center|LOCUS_03520 17369 15678 gene locus_tag LOCUS_03530 17369 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 20231 17397 gene locus_tag LOCUS_03540 20231 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 21405 20314 gene locus_tag LOCUS_03550 21405 20314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_03550 21450 21737 gene locus_tag LOCUS_03560 21450 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 21734 22129 gene locus_tag LOCUS_03570 21734 22129 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414064.1 protein_id gnl|my_center|LOCUS_03570 23605 22124 gene locus_tag LOCUS_03580 23605 22124 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104378.1 protein_id gnl|my_center|LOCUS_03580 23753 24655 gene locus_tag LOCUS_03590 23753 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24652 24993 gene locus_tag LOCUS_03600 24652 24993 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 protein_id gnl|my_center|LOCUS_03600 25362 24997 gene locus_tag LOCUS_03610 25362 24997 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_03610 25505 25359 gene locus_tag LOCUS_03620 25505 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 27279 25879 gene locus_tag LOCUS_03630 27279 25879 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_03630 28130 27351 gene locus_tag LOCUS_03640 gene istB 28130 27351 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_03640 29653 28127 gene locus_tag LOCUS_03650 29653 28127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 29828 30268 gene locus_tag LOCUS_03660 29828 30268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence010 155 526 gene locus_tag LOCUS_03670 155 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 981 715 gene locus_tag LOCUS_03680 981 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1192 983 gene locus_tag LOCUS_03690 1192 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2431 1535 gene locus_tag LOCUS_03700 2431 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2610 2428 gene locus_tag LOCUS_03710 2610 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 2771 4327 gene locus_tag LOCUS_03720 2771 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4490 4807 gene locus_tag LOCUS_03730 4490 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 5740 4826 gene locus_tag LOCUS_03740 5740 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5818 6156 gene locus_tag LOCUS_03750 5818 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7457 6225 gene locus_tag LOCUS_03760 7457 6225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263462.1 protein_id gnl|my_center|LOCUS_03760 8112 7555 gene locus_tag LOCUS_03770 8112 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 8186 9184 gene locus_tag LOCUS_03780 8186 9184 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_03780 9651 9364 gene locus_tag LOCUS_03790 9651 9364 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221419030.1 protein_id gnl|my_center|LOCUS_03790 9710 10384 gene locus_tag LOCUS_03800 9710 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10456 10740 gene locus_tag LOCUS_03810 10456 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 11229 10708 gene locus_tag LOCUS_03820 11229 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 13045 11339 gene locus_tag LOCUS_03830 gene istA 13045 11339 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 protein_id gnl|my_center|LOCUS_03830 13156 13353 gene locus_tag LOCUS_03840 13156 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 14399 13407 gene locus_tag LOCUS_03850 14399 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 16408 14402 gene locus_tag LOCUS_03860 16408 14402 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_03860 16908 16408 gene locus_tag LOCUS_03870 16908 16408 CDS product DUF6521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204896.1 protein_id gnl|my_center|LOCUS_03870 18134 16905 gene locus_tag LOCUS_03880 18134 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_03880 18295 19584 gene locus_tag LOCUS_03890 18295 19584 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727856.1 protein_id gnl|my_center|LOCUS_03890 19680 20144 gene locus_tag LOCUS_03900 19680 20144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 20141 21094 gene locus_tag LOCUS_03910 20141 21094 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_03910 21091 22134 gene locus_tag LOCUS_03920 21091 22134 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054866.1 protein_id gnl|my_center|LOCUS_03920 22840 22175 gene locus_tag LOCUS_03930 22840 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 23160 22834 gene locus_tag LOCUS_03940 23160 22834 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_03940 23465 23127 gene locus_tag LOCUS_03950 23465 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 23567 24544 gene locus_tag LOCUS_03960 23567 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence011 470 258 gene locus_tag LOCUS_03970 470 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1010 495 gene locus_tag LOCUS_03980 1010 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1166 2350 gene locus_tag LOCUS_03990 1166 2350 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_03990 4294 2504 gene locus_tag LOCUS_04000 gene sulP 4294 2504 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085632.1 protein_id gnl|my_center|LOCUS_04000 7495 4346 gene locus_tag LOCUS_04010 7495 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7676 8233 gene locus_tag LOCUS_04020 7676 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 8318 16180 gene locus_tag LOCUS_04030 8318 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 16292 17137 gene locus_tag LOCUS_04040 16292 17137 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466677.1 protein_id gnl|my_center|LOCUS_04040 18019 17183 gene locus_tag LOCUS_04050 18019 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 19539 18016 gene locus_tag LOCUS_04060 19539 18016 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_04060 19914 19600 gene locus_tag LOCUS_04070 19914 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 19971 21074 gene locus_tag LOCUS_04080 19971 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 22644 21259 gene locus_tag LOCUS_04090 22644 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 23585 22641 gene locus_tag LOCUS_04100 23585 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 25324 23582 gene locus_tag LOCUS_04110 25324 23582 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_04110 25701 25321 gene locus_tag LOCUS_04120 25701 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 26628 25864 gene locus_tag LOCUS_04130 26628 25864 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_04130 27795 26665 gene locus_tag LOCUS_04140 27795 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 27910 28884 gene locus_tag LOCUS_04150 27910 28884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 28898 29263 gene locus_tag LOCUS_04160 28898 29263 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929878.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence012 3 911 gene locus_tag LOCUS_04170 3 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 908 1996 gene locus_tag LOCUS_04180 908 1996 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_04180 1993 2586 gene locus_tag LOCUS_04190 gene hisB 1993 2586 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_04190 2583 3218 gene locus_tag LOCUS_04200 gene hisH 2583 3218 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_04200 2910 2919 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3390 3752 gene locus_tag LOCUS_04210 gene trxA 3390 3752 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_04210 3793 4518 gene locus_tag LOCUS_04220 gene thyX 3793 4518 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_04220 4539 5423 gene locus_tag LOCUS_04230 gene dapA 4539 5423 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_04230 5416 7083 gene locus_tag LOCUS_04240 5416 7083 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_04240 7483 7070 gene locus_tag LOCUS_04250 7483 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7813 10068 gene locus_tag LOCUS_04260 7813 10068 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_04260 10065 11396 gene locus_tag LOCUS_04270 gene rimO 10065 11396 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_04270 11393 12040 gene locus_tag LOCUS_04280 gene pgsA 11393 12040 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_04280 12024 12512 gene locus_tag LOCUS_04290 12024 12512 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_04290 12592 12831 gene locus_tag LOCUS_04300 12592 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 17175 12832 gene locus_tag LOCUS_04310 17175 12832 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_04310 17273 17467 gene locus_tag LOCUS_04320 17273 17467 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_04320 17614 18705 gene locus_tag LOCUS_04330 gene recA 17614 18705 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_04330 18702 19199 gene locus_tag LOCUS_04340 gene recX 18702 19199 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_04340 19226 20650 gene locus_tag LOCUS_04350 gene miaB 19226 20650 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_04350 21242 20616 gene locus_tag LOCUS_04360 21242 20616 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_04360 21547 21248 gene locus_tag LOCUS_04370 21547 21248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 21577 22476 gene locus_tag LOCUS_04380 gene miaA 21577 22476 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_04380 22473 23282 gene locus_tag LOCUS_04390 gene dapF 22473 23282 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_04390 23279 24631 gene locus_tag LOCUS_04400 gene hflX 23279 24631 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_04400 24685 26592 gene locus_tag LOCUS_04410 24685 26592 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_04410 27290 26589 gene locus_tag LOCUS_04420 gene lexA 27290 26589 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_04420 27465 27920 gene locus_tag LOCUS_04430 27465 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 28149 28688 gene locus_tag LOCUS_04440 gene nrdR 28149 28688 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908068.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence013 322 331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 380 628 gene locus_tag LOCUS_04450 380 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 650 2203 gene locus_tag LOCUS_04460 gene dacB 650 2203 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279147.1 protein_id gnl|my_center|LOCUS_04460 3273 2200 gene locus_tag LOCUS_04470 3273 2200 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641745.1 protein_id gnl|my_center|LOCUS_04470 3272 4552 gene locus_tag LOCUS_04480 gene lysA 3272 4552 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296430.1 protein_id gnl|my_center|LOCUS_04480 4872 5030 gene locus_tag LOCUS_04490 4872 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 6544 5045 gene locus_tag LOCUS_04500 6544 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6961 6629 gene locus_tag LOCUS_04510 6961 6629 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_04510 8813 6951 gene locus_tag LOCUS_04520 8813 6951 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_04520 8967 10172 gene locus_tag LOCUS_04530 8967 10172 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074038115.1 protein_id gnl|my_center|LOCUS_04530 10313 10936 gene locus_tag LOCUS_04540 10313 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 10949 11680 gene locus_tag LOCUS_04550 10949 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 11847 12050 gene locus_tag LOCUS_04560 11847 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 12034 12456 gene locus_tag LOCUS_04570 12034 12456 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403137.1 protein_id gnl|my_center|LOCUS_04570 12540 12992 gene locus_tag LOCUS_04580 12540 12992 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224983.1 protein_id gnl|my_center|LOCUS_04580 13703 12999 gene locus_tag LOCUS_04590 13703 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 14075 13725 gene locus_tag LOCUS_04600 14075 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 14138 15514 gene locus_tag LOCUS_04610 gene hemY 14138 15514 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740655.1 protein_id gnl|my_center|LOCUS_04610 15511 16644 gene locus_tag LOCUS_04620 15511 16644 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_04620 17521 16646 gene locus_tag LOCUS_04630 17521 16646 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206870.1 protein_id gnl|my_center|LOCUS_04630 17812 17597 gene locus_tag LOCUS_04640 17812 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 19326 17908 gene locus_tag LOCUS_04650 19326 17908 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_04650 19304 21916 gene locus_tag LOCUS_04660 19304 21916 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116485.1 protein_id gnl|my_center|LOCUS_04660 22567 21929 gene locus_tag LOCUS_04670 22567 21929 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225259.1 protein_id gnl|my_center|LOCUS_04670 22658 24004 gene locus_tag LOCUS_04680 22658 24004 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_04680 24001 24816 gene locus_tag LOCUS_04690 24001 24816 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837128.1 protein_id gnl|my_center|LOCUS_04690 26382 24820 gene locus_tag LOCUS_04700 26382 24820 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229211.1 protein_id gnl|my_center|LOCUS_04700 28596 26431 gene locus_tag LOCUS_04710 28596 26431 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_04710 28677 29267 gene locus_tag LOCUS_04720 28677 29267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence014 1705 386 gene locus_tag LOCUS_04730 1705 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2199 1702 gene locus_tag LOCUS_04740 2199 1702 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 protein_id gnl|my_center|LOCUS_04740 2299 3309 gene locus_tag LOCUS_04750 2299 3309 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_04750 4418 3456 gene locus_tag LOCUS_04760 4418 3456 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_04760 5156 4452 gene locus_tag LOCUS_04770 5156 4452 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_04770 5833 5156 gene locus_tag LOCUS_04780 5833 5156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 protein_id gnl|my_center|LOCUS_04780 5942 6889 gene locus_tag LOCUS_04790 5942 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 7191 6907 gene locus_tag LOCUS_04800 7191 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 7701 7201 gene locus_tag LOCUS_04810 7701 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8186 7698 gene locus_tag LOCUS_04820 gene folK 8186 7698 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_04820 8536 8183 gene locus_tag LOCUS_04830 8536 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 9339 8533 gene locus_tag LOCUS_04840 gene folP 9339 8533 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_04840 9938 9336 gene locus_tag LOCUS_04850 gene folE 9938 9336 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_04850 10064 10411 gene locus_tag LOCUS_04860 10064 10411 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084459.1 protein_id gnl|my_center|LOCUS_04860 12294 10348 gene locus_tag LOCUS_04870 gene ftsH 12294 10348 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_04870 12974 12423 gene locus_tag LOCUS_04880 gene hpt 12974 12423 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_04880 13923 12964 gene locus_tag LOCUS_04890 gene tilS 13923 12964 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_04890 14951 13935 gene locus_tag LOCUS_04900 14951 13935 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_04900 15789 14983 gene locus_tag LOCUS_04910 15789 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 15821 16015 gene locus_tag LOCUS_04920 15821 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 15999 19028 gene locus_tag LOCUS_04930 gene ebgA 15999 19028 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_04930 19116 19730 gene locus_tag LOCUS_04940 19116 19730 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_04940 19727 20437 gene locus_tag LOCUS_04950 19727 20437 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_04950 22376 21021 gene locus_tag LOCUS_04960 22376 21021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110111.1 protein_id gnl|my_center|LOCUS_04960 22379 23662 gene locus_tag LOCUS_04970 22379 23662 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_04970 23764 24696 gene locus_tag LOCUS_04980 23764 24696 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_04980 25184 24660 gene locus_tag LOCUS_04990 25184 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04990 25948 25184 gene locus_tag LOCUS_05000 gene amrB 25948 25184 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_05000 27276 25945 gene locus_tag LOCUS_05010 27276 25945 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_05010 28526 27417 gene locus_tag LOCUS_05020 gene amrS 28526 27417 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence015 <1 919 gene locus_tag LOCUS_05030 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763529.1:S8 family peptidase 1038 2285 gene locus_tag LOCUS_05040 1038 2285 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404586.1 protein_id gnl|my_center|LOCUS_05040 2282 3484 gene locus_tag LOCUS_05050 gene ilvA 2282 3484 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229835.1 protein_id gnl|my_center|LOCUS_05050 3893 3486 gene locus_tag LOCUS_05060 3893 3486 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975554.1 protein_id gnl|my_center|LOCUS_05060 3958 4341 gene locus_tag LOCUS_05070 3958 4341 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228235.1 protein_id gnl|my_center|LOCUS_05070 4833 4351 gene locus_tag LOCUS_05080 gene greA 4833 4351 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_05080 5190 6020 gene locus_tag LOCUS_05090 gene mca 5190 6020 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_05090 6142 6333 gene locus_tag LOCUS_05100 6142 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6333 6590 gene locus_tag LOCUS_05110 6333 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6590 6940 gene locus_tag LOCUS_05120 6590 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 6950 7738 gene locus_tag LOCUS_05130 6950 7738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266510.1 protein_id gnl|my_center|LOCUS_05130 7740 8522 gene locus_tag LOCUS_05140 7740 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 8592 9353 gene locus_tag LOCUS_05150 8592 9353 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_05150 9679 10980 gene locus_tag LOCUS_05160 9679 10980 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_05160 11060 11626 gene locus_tag LOCUS_05170 11060 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11659 12339 gene locus_tag LOCUS_05180 11659 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 12408 14564 gene locus_tag LOCUS_05190 12408 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 14925 14614 gene locus_tag LOCUS_05200 14925 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 14815 16008 gene locus_tag LOCUS_05210 14815 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 16120 16635 gene locus_tag LOCUS_05220 16120 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 18525 16858 gene locus_tag LOCUS_05230 18525 16858 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_05230 18602 19381 gene locus_tag LOCUS_05240 18602 19381 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056876.1 protein_id gnl|my_center|LOCUS_05240 19378 19890 gene locus_tag LOCUS_05250 19378 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 19887 21101 gene locus_tag LOCUS_05260 gene xseA 19887 21101 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776296.1 protein_id gnl|my_center|LOCUS_05260 21094 21318 gene locus_tag LOCUS_05270 21094 21318 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_05270 21328 22278 gene locus_tag LOCUS_05280 21328 22278 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_05280 22761 22279 gene locus_tag LOCUS_05290 22761 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 23933 22824 gene locus_tag LOCUS_05300 23933 22824 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_05300 23950 25062 gene locus_tag LOCUS_05310 gene ychF 23950 25062 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_05310 25079 25432 gene locus_tag LOCUS_05320 25079 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 25506 25904 gene locus_tag LOCUS_05330 25506 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 26079 26468 gene locus_tag LOCUS_05340 26079 26468 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_05340 26729 26514 gene locus_tag LOCUS_05350 26729 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 27142 26738 gene locus_tag LOCUS_05360 27142 26738 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228109.1 protein_id gnl|my_center|LOCUS_05360 28078 27215 gene locus_tag LOCUS_05370 28078 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_05370 27367 27418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence016 <1 2857 gene locus_tag LOCUS_05380 <1 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028707.1:NAD-glutamate dehydrogenase 3481 2867 gene locus_tag LOCUS_05390 3481 2867 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_05390 3480 4607 gene locus_tag LOCUS_05400 3480 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4926 4546 gene locus_tag LOCUS_05410 4926 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 4925 5161 gene locus_tag LOCUS_05420 4925 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5193 6305 gene locus_tag LOCUS_05430 gene prfB 5193 6305 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_05430 6608 7303 gene locus_tag LOCUS_05440 gene ftsE 6608 7303 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_05440 7300 8208 gene locus_tag LOCUS_05450 gene ftsX 7300 8208 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_05450 8223 9482 gene locus_tag LOCUS_05460 8223 9482 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_05460 9487 9963 gene locus_tag LOCUS_05470 gene smpB 9487 9963 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_05470 9920 10825 gene locus_tag LOCUS_05480 9920 10825 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079681.1 protein_id gnl|my_center|LOCUS_05480 12306 10822 gene locus_tag LOCUS_05490 12306 10822 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084144.1 protein_id gnl|my_center|LOCUS_05490 12453 12817 gene locus_tag LOCUS_tm00010 12453 12817 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12914 13633 gene locus_tag LOCUS_05500 12914 13633 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136101.1 protein_id gnl|my_center|LOCUS_05500 15654 13615 gene locus_tag LOCUS_05510 15654 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 15835 16752 gene locus_tag LOCUS_05520 15835 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682355.1 protein_id gnl|my_center|LOCUS_05520 16603 16612 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16791 17177 gene locus_tag LOCUS_05530 16791 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 17265 18788 gene locus_tag LOCUS_05540 17265 18788 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091631.1 protein_id gnl|my_center|LOCUS_05540 19790 18789 gene locus_tag LOCUS_05550 19790 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 19864 20472 gene locus_tag LOCUS_05560 19864 20472 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078016.1 protein_id gnl|my_center|LOCUS_05560 20811 20455 gene locus_tag LOCUS_05570 20811 20455 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_05570 20962 21561 gene locus_tag LOCUS_05580 20962 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21561 22799 gene locus_tag LOCUS_05590 21561 22799 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728278.1 protein_id gnl|my_center|LOCUS_05590 23480 22788 gene locus_tag LOCUS_05600 23480 22788 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_05600 23504 24274 gene locus_tag LOCUS_05610 23504 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 24274 24741 gene locus_tag LOCUS_05620 24274 24741 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877784.1 protein_id gnl|my_center|LOCUS_05620 24828 25316 gene locus_tag LOCUS_05630 24828 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 <25988 25348 gene locus_tag LOCUS_05640 <25988 25348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225685.1:HNH endonuclease signature motif containing protein >Feature sequence017 323 580 gene locus_tag LOCUS_05650 323 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 577 1281 gene locus_tag LOCUS_05660 577 1281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228141.1 protein_id gnl|my_center|LOCUS_05660 1271 2677 gene locus_tag LOCUS_05670 1271 2677 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228142.1 protein_id gnl|my_center|LOCUS_05670 2829 3203 gene locus_tag LOCUS_05680 2829 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3246 4052 gene locus_tag LOCUS_05690 gene trpC 3246 4052 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_05690 4065 5255 gene locus_tag LOCUS_05700 gene trpB 4065 5255 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_05700 5252 6067 gene locus_tag LOCUS_05710 gene trpA 5252 6067 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805093.1 protein_id gnl|my_center|LOCUS_05710 6064 6579 gene locus_tag LOCUS_05720 6064 6579 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_05720 6584 7360 gene locus_tag LOCUS_05730 6584 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7357 7734 gene locus_tag LOCUS_05740 7357 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 7941 8180 gene locus_tag LOCUS_05750 7941 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 9113 8253 gene locus_tag LOCUS_05760 9113 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9216 13817 gene locus_tag LOCUS_05770 gene gltB 9216 13817 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_05770 13810 15261 gene locus_tag LOCUS_05780 13810 15261 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_05780 15417 16874 gene locus_tag LOCUS_05790 gene pyk 15417 16874 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_05790 17494 17006 gene locus_tag LOCUS_05800 gene bldD 17494 17006 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_05800 17671 18216 gene locus_tag LOCUS_05810 gene pyrR 17671 18216 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_05810 18216 19148 gene locus_tag LOCUS_05820 18216 19148 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_05820 19145 20434 gene locus_tag LOCUS_05830 19145 20434 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_05830 20434 20967 gene locus_tag LOCUS_05840 20434 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 20964 22052 gene locus_tag LOCUS_05850 gene carA 20964 22052 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_05850 22052 25336 gene locus_tag LOCUS_05860 gene carB 22052 25336 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence018 1985 1332 gene locus_tag LOCUS_05870 1985 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2876 2034 gene locus_tag LOCUS_05880 gene rsmI 2876 2034 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_05880 2984 4402 gene locus_tag LOCUS_05890 2984 4402 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_05890 4743 4668 gene locus_tag LOCUS_t00050 4743 4668 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5556 4768 gene locus_tag LOCUS_05900 5556 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6221 5562 gene locus_tag LOCUS_05910 6221 5562 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_05910 7405 6218 gene locus_tag LOCUS_05920 7405 6218 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_05920 8301 7405 gene locus_tag LOCUS_05930 gene galU 8301 7405 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_05930 9074 8352 gene locus_tag LOCUS_05940 9074 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9991 9074 gene locus_tag LOCUS_05950 9991 9074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_05950 10137 10439 gene locus_tag LOCUS_05960 10137 10439 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896874.1 protein_id gnl|my_center|LOCUS_05960 10491 11066 gene locus_tag LOCUS_05970 10491 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 11076 11612 gene locus_tag LOCUS_05980 11076 11612 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897831.1 protein_id gnl|my_center|LOCUS_05980 11860 12687 gene locus_tag LOCUS_05990 11860 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13490 12726 gene locus_tag LOCUS_06000 13490 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13663 14643 gene locus_tag LOCUS_06010 13663 14643 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_06010 14787 14860 gene locus_tag LOCUS_t00060 14787 14860 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14973 15518 gene locus_tag LOCUS_06020 14973 15518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 16294 15527 gene locus_tag LOCUS_06030 16294 15527 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225542.1 protein_id gnl|my_center|LOCUS_06030 16707 16291 gene locus_tag LOCUS_06040 16707 16291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 18111 16711 gene locus_tag LOCUS_06050 18111 16711 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225544.1 protein_id gnl|my_center|LOCUS_06050 18500 18108 gene locus_tag LOCUS_06060 18500 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 18618 19238 gene locus_tag LOCUS_06070 18618 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 19258 20151 gene locus_tag LOCUS_06080 19258 20151 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_06080 20191 20781 gene locus_tag LOCUS_06090 20191 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 21114 20782 gene locus_tag LOCUS_06100 21114 20782 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028770.1 protein_id gnl|my_center|LOCUS_06100 21407 22495 gene locus_tag LOCUS_06110 21407 22495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 22585 22986 gene locus_tag LOCUS_06120 22585 22986 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_06120 23424 23056 gene locus_tag LOCUS_06130 23424 23056 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223040.1 protein_id gnl|my_center|LOCUS_06130 24691 23426 gene locus_tag LOCUS_06140 24691 23426 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_06140 25469 24723 gene locus_tag LOCUS_06150 25469 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 25485 25494 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25586 25658 gene locus_tag LOCUS_t00070 25586 25658 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 651 1913 gene locus_tag LOCUS_06160 651 1913 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_06160 1924 3015 gene locus_tag LOCUS_06170 1924 3015 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_06170 3050 3514 gene locus_tag LOCUS_06180 3050 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3511 3807 gene locus_tag LOCUS_06190 3511 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3807 4613 gene locus_tag LOCUS_06200 gene atpB 3807 4613 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_06200 4676 4912 gene locus_tag LOCUS_06210 gene atpE 4676 4912 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_06210 4925 5473 gene locus_tag LOCUS_06220 4925 5473 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_06220 5473 6291 gene locus_tag LOCUS_06230 5473 6291 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_06230 6315 7949 gene locus_tag LOCUS_06240 gene atpA 6315 7949 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_06240 7953 8897 gene locus_tag LOCUS_06250 7953 8897 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_06250 8903 10348 gene locus_tag LOCUS_06260 gene atpD 8903 10348 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_06260 10351 10728 gene locus_tag LOCUS_06270 10351 10728 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_06270 11660 10911 gene locus_tag LOCUS_06280 11660 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 12496 11933 gene locus_tag LOCUS_06290 12496 11933 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_06290 12517 14559 gene locus_tag LOCUS_06300 12517 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 15024 14692 gene locus_tag LOCUS_06310 15024 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14817 14826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14914 15270 gene locus_tag LOCUS_06320 14914 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 15362 16621 gene locus_tag LOCUS_06330 gene murA 15362 16621 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_06330 16931 16605 gene locus_tag LOCUS_06340 16931 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 16990 17835 gene locus_tag LOCUS_06350 16990 17835 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_06350 17832 18269 gene locus_tag LOCUS_06360 17832 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 18269 18940 gene locus_tag LOCUS_06370 gene nucS 18269 18940 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_06370 19762 18968 gene locus_tag LOCUS_06380 19762 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 19685 20359 gene locus_tag LOCUS_06390 19685 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 20283 20312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20374 21510 gene locus_tag LOCUS_06400 20374 21510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 21567 21812 gene locus_tag LOCUS_06410 21567 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730194.1 protein_id gnl|my_center|LOCUS_06410 22213 21806 gene locus_tag LOCUS_06420 22213 21806 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_06420 22316 23263 gene locus_tag LOCUS_06430 22316 23263 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870317.1 protein_id gnl|my_center|LOCUS_06430 23286 24182 gene locus_tag LOCUS_06440 23286 24182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence020 <1 543 gene locus_tag LOCUS_06450 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742174.1:transcriptional regulator 540 1946 gene locus_tag LOCUS_06460 gene sufB 540 1946 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_06460 1946 3070 gene locus_tag LOCUS_06470 gene sufD 1946 3070 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_06470 3070 3399 gene locus_tag LOCUS_06480 3070 3399 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_06480 3396 4160 gene locus_tag LOCUS_06490 gene sufC 3396 4160 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_06490 4157 5407 gene locus_tag LOCUS_06500 4157 5407 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_06500 5404 5850 gene locus_tag LOCUS_06510 5404 5850 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_06510 5847 6158 gene locus_tag LOCUS_06520 5847 6158 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_06520 6253 7875 gene locus_tag LOCUS_06530 6253 7875 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_06530 7943 8155 gene locus_tag LOCUS_06540 7943 8155 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_06540 8359 8165 gene locus_tag LOCUS_06550 8359 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8256 10097 gene locus_tag LOCUS_06560 8256 10097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_06560 10868 10089 gene locus_tag LOCUS_06570 10868 10089 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_06570 11632 10883 gene locus_tag LOCUS_06580 11632 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 11851 11639 gene locus_tag LOCUS_06590 11851 11639 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_06590 13674 11875 gene locus_tag LOCUS_06600 13674 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_06600 13722 14036 gene locus_tag LOCUS_06610 13722 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 14713 14039 gene locus_tag LOCUS_06620 14713 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06620 15366 14710 gene locus_tag LOCUS_06630 15366 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 14873 14882 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16856 15363 gene locus_tag LOCUS_06640 16856 15363 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411929.1 protein_id gnl|my_center|LOCUS_06640 16795 18390 gene locus_tag LOCUS_06650 16795 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 21112 18395 gene locus_tag LOCUS_06660 gene cphA 21112 18395 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_06660 22090 21143 gene locus_tag LOCUS_06670 22090 21143 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_06670 22171 22668 gene locus_tag LOCUS_06680 22171 22668 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_06680 23833 22682 gene locus_tag LOCUS_06690 gene serB 23833 22682 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_06690 24489 23830 gene locus_tag LOCUS_06700 24489 23830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence021 677 141 gene locus_tag LOCUS_06710 677 141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228181.1 protein_id gnl|my_center|LOCUS_06710 835 674 gene locus_tag LOCUS_06720 835 674 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893232.1 protein_id gnl|my_center|LOCUS_06720 2150 1005 gene locus_tag LOCUS_06730 2150 1005 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_06730 2226 2903 gene locus_tag LOCUS_06740 2226 2903 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867343.1 protein_id gnl|my_center|LOCUS_06740 3668 3000 gene locus_tag LOCUS_06750 3668 3000 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_06750 3724 5256 gene locus_tag LOCUS_06760 3724 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 5258 6781 gene locus_tag LOCUS_06770 5258 6781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 protein_id gnl|my_center|LOCUS_06770 6778 8133 gene locus_tag LOCUS_06780 6778 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_06780 9145 8171 gene locus_tag LOCUS_06790 9145 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9919 9149 gene locus_tag LOCUS_06800 9919 9149 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_06800 10024 10194 gene locus_tag LOCUS_06810 10024 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 11186 10191 gene locus_tag LOCUS_06820 11186 10191 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 protein_id gnl|my_center|LOCUS_06820 11068 11298 gene locus_tag LOCUS_06830 11068 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11379 12011 gene locus_tag LOCUS_06840 11379 12011 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_06840 12442 12071 gene locus_tag LOCUS_06850 12442 12071 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_06850 12518 13027 gene locus_tag LOCUS_06860 12518 13027 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730741.1 protein_id gnl|my_center|LOCUS_06860 13220 15133 gene locus_tag LOCUS_06870 13220 15133 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_06870 16040 15201 gene locus_tag LOCUS_06880 16040 15201 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 protein_id gnl|my_center|LOCUS_06880 16163 18580 gene locus_tag LOCUS_06890 16163 18580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 17115 17124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19302 18577 gene locus_tag LOCUS_06900 19302 18577 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_06900 20985 19339 gene locus_tag LOCUS_06910 20985 19339 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529422.1 protein_id gnl|my_center|LOCUS_06910 23305 21074 gene locus_tag LOCUS_06920 23305 21074 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence022 1780 599 gene locus_tag LOCUS_06930 1780 599 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776408.1 protein_id gnl|my_center|LOCUS_06930 2961 2077 gene locus_tag LOCUS_06940 gene sucD 2961 2077 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_06940 4149 2977 gene locus_tag LOCUS_06950 gene sucC 4149 2977 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_06950 4631 4224 gene locus_tag LOCUS_06960 4631 4224 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_06960 4872 5873 gene locus_tag LOCUS_06970 4872 5873 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_06970 6518 5883 gene locus_tag LOCUS_06980 6518 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7045 6533 gene locus_tag LOCUS_06990 7045 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7326 7156 gene locus_tag LOCUS_07000 7326 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9561 7354 gene locus_tag LOCUS_07010 gene pcrA 9561 7354 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_07010 11314 9584 gene locus_tag LOCUS_07020 11314 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 13268 11712 gene locus_tag LOCUS_07030 gene guaA 13268 11712 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_07030 14484 13291 gene locus_tag LOCUS_07040 14484 13291 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_07040 14547 15635 gene locus_tag LOCUS_07050 14547 15635 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_07050 15632 16378 gene locus_tag LOCUS_07060 15632 16378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_07060 16380 17216 gene locus_tag LOCUS_07070 16380 17216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223442.1 protein_id gnl|my_center|LOCUS_07070 17227 17742 gene locus_tag LOCUS_07080 17227 17742 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_07080 19440 17749 gene locus_tag LOCUS_07090 19440 17749 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_07090 21011 19440 gene locus_tag LOCUS_07100 21011 19440 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_07100 21287 22126 gene locus_tag LOCUS_07110 21287 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 23141 22134 gene locus_tag LOCUS_07120 23141 22134 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence023 1227 313 gene locus_tag LOCUS_07130 1227 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1359 2120 gene locus_tag LOCUS_07140 1359 2120 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063739.1 protein_id gnl|my_center|LOCUS_07140 2117 2566 gene locus_tag LOCUS_07150 2117 2566 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_07150 3565 2567 gene locus_tag LOCUS_07160 3565 2567 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 protein_id gnl|my_center|LOCUS_07160 4323 3562 gene locus_tag LOCUS_07170 4323 3562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_07170 4380 4853 gene locus_tag LOCUS_07180 4380 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4853 5614 gene locus_tag LOCUS_07190 4853 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5595 6128 gene locus_tag LOCUS_07200 5595 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6118 6696 gene locus_tag LOCUS_07210 gene dcd 6118 6696 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_07210 6834 7748 gene locus_tag LOCUS_07220 gene cysD 6834 7748 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970896.1 protein_id gnl|my_center|LOCUS_07220 7748 9592 gene locus_tag LOCUS_07230 gene cysN 7748 9592 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_07230 9642 11759 gene locus_tag LOCUS_07240 9642 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 12001 11768 gene locus_tag LOCUS_07250 12001 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 14489 12243 gene locus_tag LOCUS_07260 14489 12243 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_07260 15612 14557 gene locus_tag LOCUS_07270 15612 14557 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776121.1 protein_id gnl|my_center|LOCUS_07270 15698 16513 gene locus_tag LOCUS_07280 gene ppk2 15698 16513 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 protein_id gnl|my_center|LOCUS_07280 16716 17234 gene locus_tag LOCUS_07290 16716 17234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 17270 17812 gene locus_tag LOCUS_07300 17270 17812 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776436.1 protein_id gnl|my_center|LOCUS_07300 17802 19799 gene locus_tag LOCUS_07310 17802 19799 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_07310 19796 20431 gene locus_tag LOCUS_07320 19796 20431 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_07320 20451 20996 gene locus_tag LOCUS_07330 20451 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 21087 21629 gene locus_tag LOCUS_07340 21087 21629 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731368.1 protein_id gnl|my_center|LOCUS_07340 22167 22194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence024 415 1215 gene locus_tag LOCUS_07350 415 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1284 3596 gene locus_tag LOCUS_07360 1284 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3596 4483 gene locus_tag LOCUS_07370 3596 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4518 4991 gene locus_tag LOCUS_07380 4518 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5001 5309 gene locus_tag LOCUS_07390 5001 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5309 6082 gene locus_tag LOCUS_07400 5309 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6110 7279 gene locus_tag LOCUS_07410 6110 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7282 7677 gene locus_tag LOCUS_07420 7282 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 7693 8673 gene locus_tag LOCUS_07430 7693 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8687 9229 gene locus_tag LOCUS_07440 8687 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 9336 9617 gene locus_tag LOCUS_07450 9336 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 9617 10099 gene locus_tag LOCUS_07460 9617 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10099 10578 gene locus_tag LOCUS_07470 10099 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 10575 10850 gene locus_tag LOCUS_07480 10575 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10847 11281 gene locus_tag LOCUS_07490 10847 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 11343 11837 gene locus_tag LOCUS_07500 11343 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11872 12270 gene locus_tag LOCUS_07510 11872 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 12291 12611 gene locus_tag LOCUS_07520 12291 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 12611 18745 gene locus_tag LOCUS_07530 12611 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 18742 19248 gene locus_tag LOCUS_07540 18742 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 19245 19745 gene locus_tag LOCUS_07550 19245 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 19738 20766 gene locus_tag LOCUS_07560 19738 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence025 <1 576 gene locus_tag LOCUS_07570 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742086.1:SGNH/GDSL hydrolase family protein 385 394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 747 1031 gene locus_tag LOCUS_07580 747 1031 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_07580 1028 1423 gene locus_tag LOCUS_07590 1028 1423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_07590 2556 1420 gene locus_tag LOCUS_07600 2556 1420 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_07600 2687 4144 gene locus_tag LOCUS_07610 2687 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4184 4549 gene locus_tag LOCUS_07620 4184 4549 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_07620 5138 4542 gene locus_tag LOCUS_07630 5138 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5239 7353 gene locus_tag LOCUS_07640 5239 7353 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_07640 8338 7355 gene locus_tag LOCUS_07650 8338 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9325 8357 gene locus_tag LOCUS_07660 9325 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9449 9760 gene locus_tag LOCUS_07670 9449 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10769 9765 gene locus_tag LOCUS_07680 10769 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10983 12317 gene locus_tag LOCUS_07690 10983 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 13130 12321 gene locus_tag LOCUS_07700 13130 12321 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973698.1 protein_id gnl|my_center|LOCUS_07700 13173 13829 gene locus_tag LOCUS_07710 13173 13829 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776561.1 protein_id gnl|my_center|LOCUS_07710 13839 14462 gene locus_tag LOCUS_07720 13839 14462 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_07720 15438 14530 gene locus_tag LOCUS_07730 15438 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15749 16315 gene locus_tag LOCUS_07740 15749 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 17129 16302 gene locus_tag LOCUS_07750 17129 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17222 17788 gene locus_tag LOCUS_07760 17222 17788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 18928 17789 gene locus_tag LOCUS_07770 18928 17789 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304720.1 protein_id gnl|my_center|LOCUS_07770 19039 19941 gene locus_tag LOCUS_07780 19039 19941 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_07780 20302 19934 gene locus_tag LOCUS_07790 20302 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 22071 20299 gene locus_tag LOCUS_07800 22071 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence026 235 894 gene locus_tag LOCUS_07810 235 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_07810 939 2459 gene locus_tag LOCUS_07820 939 2459 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139558.1 protein_id gnl|my_center|LOCUS_07820 3791 2604 gene locus_tag LOCUS_07830 3791 2604 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_07830 3901 4590 gene locus_tag LOCUS_07840 3901 4590 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_07840 4620 5285 gene locus_tag LOCUS_07850 4620 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 5583 5945 gene locus_tag LOCUS_07860 5583 5945 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_07860 5947 6501 gene locus_tag LOCUS_07870 5947 6501 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_07870 6498 7202 gene locus_tag LOCUS_07880 6498 7202 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_07880 7199 8536 gene locus_tag LOCUS_07890 7199 8536 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_07890 8536 9186 gene locus_tag LOCUS_07900 8536 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 9186 10487 gene locus_tag LOCUS_07910 gene nuoF 9186 10487 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_07910 10484 12916 gene locus_tag LOCUS_07920 10484 12916 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_07920 12913 14193 gene locus_tag LOCUS_07930 gene nuoH 12913 14193 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_07930 14186 14740 gene locus_tag LOCUS_07940 gene nuoI 14186 14740 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_07940 14737 15561 gene locus_tag LOCUS_07950 14737 15561 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_07950 15558 15857 gene locus_tag LOCUS_07960 gene nuoK 15558 15857 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_07960 15857 17782 gene locus_tag LOCUS_07970 gene nuoL 15857 17782 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110664.1 protein_id gnl|my_center|LOCUS_07970 17783 19339 gene locus_tag LOCUS_07980 17783 19339 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_07980 19336 20883 gene locus_tag LOCUS_07990 gene nuoN 19336 20883 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_07990 20893 21879 gene locus_tag LOCUS_08000 20893 21879 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence027 2349 4883 gene locus_tag LOCUS_08010 gene clpB 2349 4883 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_08010 5084 6190 gene locus_tag LOCUS_08020 5084 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7837 6191 gene locus_tag LOCUS_08030 7837 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8367 7876 gene locus_tag LOCUS_08040 8367 7876 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_08040 9731 8367 gene locus_tag LOCUS_08050 9731 8367 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 protein_id gnl|my_center|LOCUS_08050 10167 9820 gene locus_tag LOCUS_08060 10167 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 10278 11207 gene locus_tag LOCUS_08070 gene lnrL 10278 11207 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_08070 11207 12355 gene locus_tag LOCUS_08080 11207 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 12352 13491 gene locus_tag LOCUS_08090 12352 13491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_08090 14665 13496 gene locus_tag LOCUS_08100 14665 13496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728358.1 protein_id gnl|my_center|LOCUS_08100 15324 14662 gene locus_tag LOCUS_08110 15324 14662 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_08110 16454 15321 gene locus_tag LOCUS_08120 16454 15321 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_08120 17820 16660 gene locus_tag LOCUS_08130 17820 16660 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_08130 17880 18611 gene locus_tag LOCUS_08140 17880 18611 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284395.1 protein_id gnl|my_center|LOCUS_08140 18611 19633 gene locus_tag LOCUS_08150 18611 19633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_08150 20112 19621 gene locus_tag LOCUS_08160 20112 19621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 20703 20176 gene locus_tag LOCUS_08170 gene pyrE 20703 20176 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401894.1 protein_id gnl|my_center|LOCUS_08170 20764 21408 gene locus_tag LOCUS_08180 20764 21408 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence028 752 291 gene locus_tag LOCUS_08190 752 291 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_08190 1697 777 gene locus_tag LOCUS_08200 1697 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1990 1685 gene locus_tag LOCUS_08210 1990 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2214 1987 gene locus_tag LOCUS_08220 2214 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2437 2303 gene locus_tag LOCUS_08230 gene rpmH 2437 2303 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 protein_id gnl|my_center|LOCUS_08230 2773 4167 gene locus_tag LOCUS_08240 gene dnaA 2773 4167 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079124.1 protein_id gnl|my_center|LOCUS_08240 5745 4270 gene locus_tag LOCUS_08250 5745 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 6247 7374 gene locus_tag LOCUS_08260 gene dnaN 6247 7374 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_08260 7371 8492 gene locus_tag LOCUS_08270 gene recF 7371 8492 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_08270 8492 8989 gene locus_tag LOCUS_08280 8492 8989 CDS product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726604.1 protein_id gnl|my_center|LOCUS_08280 9167 11110 gene locus_tag LOCUS_08290 gene gyrB 9167 11110 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_08290 11123 13672 gene locus_tag LOCUS_08300 gene gyrA 11123 13672 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_08300 13676 14062 gene locus_tag LOCUS_08310 13676 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14104 14179 gene locus_tag LOCUS_t00080 14104 14179 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14180 14305 gene locus_tag LOCUS_08320 14180 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 14311 14384 gene locus_tag LOCUS_t00090 14311 14384 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14385 14795 gene locus_tag LOCUS_08330 14385 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 14923 15561 gene locus_tag LOCUS_08340 14923 15561 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_08340 15575 16087 gene locus_tag LOCUS_08350 15575 16087 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_08350 16183 16929 gene locus_tag LOCUS_08360 16183 16929 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_08360 16973 18121 gene locus_tag LOCUS_08370 16973 18121 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 protein_id gnl|my_center|LOCUS_08370 18498 18253 gene locus_tag LOCUS_08380 18498 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 18532 19257 gene locus_tag LOCUS_08390 18532 19257 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_08390 19254 19868 gene locus_tag LOCUS_08400 19254 19868 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_08400 19918 20763 gene locus_tag LOCUS_08410 19918 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 20414 20465 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence029 242 922 gene locus_tag LOCUS_08420 gene phoU 242 922 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_08420 1174 2436 gene locus_tag LOCUS_08430 gene mshA 1174 2436 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_08430 2433 2909 gene locus_tag LOCUS_08440 2433 2909 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086244.1 protein_id gnl|my_center|LOCUS_08440 2958 3701 gene locus_tag LOCUS_08450 2958 3701 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_08450 3742 4056 gene locus_tag LOCUS_08460 3742 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6649 4064 gene locus_tag LOCUS_08470 6649 4064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966619.1 protein_id gnl|my_center|LOCUS_08470 6940 8220 gene locus_tag LOCUS_08480 6940 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8426 10051 gene locus_tag LOCUS_08490 gene groL 8426 10051 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_08490 11504 10176 gene locus_tag LOCUS_08500 gene wecB 11504 10176 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_08500 11719 12321 gene locus_tag LOCUS_08510 11719 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12375 14144 gene locus_tag LOCUS_08520 12375 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028490829.1 protein_id gnl|my_center|LOCUS_08520 14148 15443 gene locus_tag LOCUS_08530 14148 15443 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222277.1 protein_id gnl|my_center|LOCUS_08530 15629 16963 gene locus_tag LOCUS_08540 15629 16963 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_08540 17377 17054 gene locus_tag LOCUS_08550 17377 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 19122 17488 gene locus_tag LOCUS_08560 19122 17488 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_08560 <20989 19115 gene locus_tag LOCUS_08570 <20989 19115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404512.1:helicase-associated domain-containing protein >Feature sequence030 1446 463 gene locus_tag LOCUS_08580 1446 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1608 2174 gene locus_tag LOCUS_08590 1608 2174 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_08590 2396 3241 gene locus_tag LOCUS_08600 2396 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 4036 3275 gene locus_tag LOCUS_08610 4036 3275 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_08610 5376 4033 gene locus_tag LOCUS_08620 5376 4033 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_08620 5779 5405 gene locus_tag LOCUS_08630 5779 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6507 5776 gene locus_tag LOCUS_08640 gene dapB 6507 5776 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_08640 7784 6504 gene locus_tag LOCUS_08650 7784 6504 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_08650 9985 7781 gene locus_tag LOCUS_08660 9985 7781 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_08660 10407 10144 gene locus_tag LOCUS_08670 gene rpsO 10407 10144 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_08670 11903 10575 gene locus_tag LOCUS_08680 11903 10575 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_08680 13144 12119 gene locus_tag LOCUS_08690 13144 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 14214 13162 gene locus_tag LOCUS_08700 14214 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15637 14267 gene locus_tag LOCUS_08710 15637 14267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 15792 16991 gene locus_tag LOCUS_08720 15792 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 16991 18265 gene locus_tag LOCUS_08730 16991 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 18262 19254 gene locus_tag LOCUS_08740 18262 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 20441 19248 gene locus_tag LOCUS_08750 20441 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence031 696 1391 gene locus_tag LOCUS_08760 696 1391 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_08760 2625 1396 gene locus_tag LOCUS_08770 gene glgC 2625 1396 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 protein_id gnl|my_center|LOCUS_08770 2656 3822 gene locus_tag LOCUS_08780 gene glgA 2656 3822 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226306.1 protein_id gnl|my_center|LOCUS_08780 4504 3917 gene locus_tag LOCUS_08790 4504 3917 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227150.1 protein_id gnl|my_center|LOCUS_08790 5594 4545 gene locus_tag LOCUS_08800 5594 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6498 5620 gene locus_tag LOCUS_08810 6498 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6597 7148 gene locus_tag LOCUS_08820 6597 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_08820 7145 8110 gene locus_tag LOCUS_08830 7145 8110 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_08830 8183 8596 gene locus_tag LOCUS_08840 8183 8596 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_08840 8596 9087 gene locus_tag LOCUS_08850 8596 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10036 9284 gene locus_tag LOCUS_08860 10036 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_08860 10302 10033 gene locus_tag LOCUS_08870 10302 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10613 10401 gene locus_tag LOCUS_08880 10613 10401 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_08880 11972 10740 gene locus_tag LOCUS_08890 gene thrC 11972 10740 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_08890 12136 13080 gene locus_tag LOCUS_08900 12136 13080 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_08900 13080 13511 gene locus_tag LOCUS_08910 13080 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 13692 13450 gene locus_tag LOCUS_08920 13692 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08920 14348 13695 gene locus_tag LOCUS_08930 14348 13695 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_08930 14508 15431 gene locus_tag LOCUS_08940 14508 15431 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_08940 16860 15376 gene locus_tag LOCUS_08950 16860 15376 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_08950 17516 16872 gene locus_tag LOCUS_08960 17516 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 19435 17555 gene locus_tag LOCUS_08970 19435 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 19867 20208 gene locus_tag LOCUS_08980 19867 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence032 290 1366 gene locus_tag LOCUS_08990 gene mnmA 290 1366 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_08990 1994 1335 gene locus_tag LOCUS_09000 1994 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2671 1991 gene locus_tag LOCUS_09010 2671 1991 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188612.1 protein_id gnl|my_center|LOCUS_09010 2813 3718 gene locus_tag LOCUS_09020 2813 3718 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_09020 3718 5820 gene locus_tag LOCUS_09030 gene ligA 3718 5820 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_09030 6589 5831 gene locus_tag LOCUS_09040 6589 5831 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528511.1 protein_id gnl|my_center|LOCUS_09040 7230 6586 gene locus_tag LOCUS_09050 7230 6586 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804238.1 protein_id gnl|my_center|LOCUS_09050 7344 7640 gene locus_tag LOCUS_09060 gene gatC 7344 7640 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_09060 7645 9105 gene locus_tag LOCUS_09070 gene gatA 7645 9105 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_09070 9087 10589 gene locus_tag LOCUS_09080 gene gatB 9087 10589 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_09080 10605 11117 gene locus_tag LOCUS_09090 10605 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 11186 12331 gene locus_tag LOCUS_09100 11186 12331 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776705.1 protein_id gnl|my_center|LOCUS_09100 12328 15255 gene locus_tag LOCUS_09110 12328 15255 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776704.1 protein_id gnl|my_center|LOCUS_09110 15252 15599 gene locus_tag LOCUS_09120 15252 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 15619 15969 gene locus_tag LOCUS_09130 15619 15969 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_09130 16007 16765 gene locus_tag LOCUS_09140 16007 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 16762 17130 gene locus_tag LOCUS_09150 16762 17130 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_09150 17889 17134 gene locus_tag LOCUS_09160 17889 17134 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_09160 18678 17896 gene locus_tag LOCUS_09170 18678 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111012.1 protein_id gnl|my_center|LOCUS_09170 18762 19220 gene locus_tag LOCUS_09180 18762 19220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence033 2204 1182 gene locus_tag LOCUS_09190 2204 1182 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_09190 2407 3018 gene locus_tag LOCUS_09200 2407 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3034 3531 gene locus_tag LOCUS_09210 3034 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_09210 6270 3733 gene locus_tag LOCUS_09220 6270 3733 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_09220 8185 6290 gene locus_tag LOCUS_09230 8185 6290 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_09230 8325 9590 gene locus_tag LOCUS_09240 8325 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9956 9657 gene locus_tag LOCUS_09250 9956 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 11002 10049 gene locus_tag LOCUS_09260 gene hemB 11002 10049 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776657.1 protein_id gnl|my_center|LOCUS_09260 12585 10999 gene locus_tag LOCUS_09270 12585 10999 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_09270 13172 12582 gene locus_tag LOCUS_09280 13172 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 13405 13169 gene locus_tag LOCUS_09290 13405 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 14693 13398 gene locus_tag LOCUS_09300 14693 13398 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_09300 15355 14690 gene locus_tag LOCUS_09310 15355 14690 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_09310 15797 15609 gene locus_tag LOCUS_09320 15797 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 17335 15845 gene locus_tag LOCUS_09330 17335 15845 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_09330 17378 18223 gene locus_tag LOCUS_09340 17378 18223 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_09340 19341 18334 gene locus_tag LOCUS_09350 19341 18334 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_09350 <19881 19334 gene locus_tag LOCUS_09360 <19881 19334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975510.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence034 744 61 gene locus_tag LOCUS_09370 744 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1429 824 gene locus_tag LOCUS_09380 1429 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2152 1550 gene locus_tag LOCUS_09390 2152 1550 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_09390 2551 2156 gene locus_tag LOCUS_09400 2551 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2649 3995 gene locus_tag LOCUS_09410 2649 3995 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_09410 4200 4126 gene locus_tag LOCUS_t00100 4200 4126 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4623 4222 gene locus_tag LOCUS_09420 4623 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4698 5126 gene locus_tag LOCUS_09430 4698 5126 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_09430 5911 5123 gene locus_tag LOCUS_09440 5911 5123 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_09440 6945 5950 gene locus_tag LOCUS_09450 6945 5950 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_09450 7037 7110 gene locus_tag LOCUS_t00110 7037 7110 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7130 7201 gene locus_tag LOCUS_t00120 7130 7201 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7210 7284 gene locus_tag LOCUS_t00130 7210 7284 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7347 7490 gene locus_tag LOCUS_09460 7347 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8277 7594 gene locus_tag LOCUS_09470 8277 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 9569 8274 gene locus_tag LOCUS_09480 9569 8274 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_09480 9614 10141 gene locus_tag LOCUS_09490 gene thpR 9614 10141 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 protein_id gnl|my_center|LOCUS_09490 10170 10258 gene locus_tag LOCUS_t00140 10170 10258 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10318 12099 gene locus_tag LOCUS_09500 10318 12099 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_09500 12405 13712 gene locus_tag LOCUS_09510 12405 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13806 14078 gene locus_tag LOCUS_09520 13806 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 14088 14825 gene locus_tag LOCUS_09530 14088 14825 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941418.1 protein_id gnl|my_center|LOCUS_09530 15357 14827 gene locus_tag LOCUS_09540 15357 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 16856 15435 gene locus_tag LOCUS_09550 16856 15435 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_09550 17041 17508 gene locus_tag LOCUS_09560 17041 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 17610 18173 gene locus_tag LOCUS_09570 gene ahpC 17610 18173 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence035 397 1479 gene locus_tag LOCUS_09580 397 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1538 2476 gene locus_tag LOCUS_09590 1538 2476 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_09590 2473 3231 gene locus_tag LOCUS_09600 2473 3231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_09600 3231 5774 gene locus_tag LOCUS_09610 3231 5774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_09610 6350 5736 gene locus_tag LOCUS_09620 6350 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 9855 6394 gene locus_tag LOCUS_09630 gene metH 9855 6394 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_09630 11642 10023 gene locus_tag LOCUS_09640 gene pgi 11642 10023 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_09640 11756 12790 gene locus_tag LOCUS_09650 gene gnd 11756 12790 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_09650 14120 12900 gene locus_tag LOCUS_09660 gene mshC 14120 12900 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_09660 14915 14163 gene locus_tag LOCUS_09670 14915 14163 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_09670 15469 14912 gene locus_tag LOCUS_09680 15469 14912 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_09680 16157 15480 gene locus_tag LOCUS_09690 16157 15480 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086562.1 protein_id gnl|my_center|LOCUS_09690 16169 17203 gene locus_tag LOCUS_09700 gene corA 16169 17203 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_09700 18191 17361 gene locus_tag LOCUS_09710 18191 17361 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_09710 19237 18191 gene locus_tag LOCUS_09720 19237 18191 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence036 616 131 gene locus_tag LOCUS_09730 gene rimM 616 131 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_09730 879 628 gene locus_tag LOCUS_09740 879 628 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_09740 1390 872 gene locus_tag LOCUS_09750 1390 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3138 1615 gene locus_tag LOCUS_09760 gene ffh 3138 1615 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_09760 5509 3209 gene locus_tag LOCUS_09770 5509 3209 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_09770 5945 5607 gene locus_tag LOCUS_09780 5945 5607 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056967.1 protein_id gnl|my_center|LOCUS_09780 7261 5942 gene locus_tag LOCUS_09790 7261 5942 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_09790 8714 7575 gene locus_tag LOCUS_09800 gene ftsY 8714 7575 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_09800 11551 8801 gene locus_tag LOCUS_09810 gene smc 11551 8801 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 11619 11831 gene locus_tag LOCUS_09820 11619 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 12525 12346 gene locus_tag LOCUS_09830 12525 12346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 13446 12625 gene locus_tag LOCUS_09840 gene mutM 13446 12625 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_09840 14143 13439 gene locus_tag LOCUS_09850 gene rnc 14143 13439 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_09850 14333 14160 gene locus_tag LOCUS_09860 gene rpmF 14333 14160 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_09860 14888 14334 gene locus_tag LOCUS_09870 14888 14334 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_09870 15670 14990 gene locus_tag LOCUS_09880 15670 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 16171 15689 gene locus_tag LOCUS_09890 gene coaD 16171 15689 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_09890 16755 16204 gene locus_tag LOCUS_09900 gene rsmD 16755 16204 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_09900 <18759 16752 gene locus_tag LOCUS_09910 <18759 16752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973428.1:ATP-dependent DNA helicase RecG >Feature sequence037 39 1574 gene locus_tag LOCUS_09920 gene purH 39 1574 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_09920 1715 2566 gene locus_tag LOCUS_09930 1715 2566 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_09930 2616 2969 gene locus_tag LOCUS_09940 2616 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3063 4013 gene locus_tag LOCUS_09950 gene mdh 3063 4013 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_09950 4024 5238 gene locus_tag LOCUS_09960 4024 5238 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_09960 5238 5987 gene locus_tag LOCUS_09970 5238 5987 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893063.1 protein_id gnl|my_center|LOCUS_09970 6051 7352 gene locus_tag LOCUS_09980 6051 7352 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113973.1 protein_id gnl|my_center|LOCUS_09980 7923 7360 gene locus_tag LOCUS_09990 7923 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7935 8996 gene locus_tag LOCUS_10000 gene trpS 7935 8996 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_10000 8993 9508 gene locus_tag LOCUS_10010 8993 9508 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_10010 10949 9435 gene locus_tag LOCUS_10020 10949 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11083 11478 gene locus_tag LOCUS_10030 11083 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 12348 11611 gene locus_tag LOCUS_10040 12348 11611 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776150.1 protein_id gnl|my_center|LOCUS_10040 14096 12348 gene locus_tag LOCUS_10050 gene sdhA 14096 12348 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222763.1 protein_id gnl|my_center|LOCUS_10050 14506 14105 gene locus_tag LOCUS_10060 14506 14105 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_10060 14898 14503 gene locus_tag LOCUS_10070 gene sdhC 14898 14503 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_10070 15233 16321 gene locus_tag LOCUS_10080 15233 16321 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_10080 16390 17892 gene locus_tag LOCUS_10090 16390 17892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776143.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence038 <1 567 gene locus_tag LOCUS_10100 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030832.1:DUF2252 domain-containing protein 570 1142 gene locus_tag LOCUS_10110 570 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1220 2455 gene locus_tag LOCUS_10120 1220 2455 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_10120 2865 2452 gene locus_tag LOCUS_10130 2865 2452 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114401.1 protein_id gnl|my_center|LOCUS_10130 2889 3950 gene locus_tag LOCUS_10140 2889 3950 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_10140 3998 5335 gene locus_tag LOCUS_10150 3998 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5530 6549 gene locus_tag LOCUS_10160 5530 6549 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230597.1 protein_id gnl|my_center|LOCUS_10160 8696 6558 gene locus_tag LOCUS_10170 8696 6558 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_10170 8800 9333 gene locus_tag LOCUS_10180 8800 9333 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_10180 9994 9335 gene locus_tag LOCUS_10190 9994 9335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_10190 10021 10305 gene locus_tag LOCUS_10200 10021 10305 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776328.1 protein_id gnl|my_center|LOCUS_10200 10319 10909 gene locus_tag LOCUS_10210 10319 10909 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_10210 11657 10884 gene locus_tag LOCUS_10220 11657 10884 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_10220 13437 11713 gene locus_tag LOCUS_10230 13437 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 13824 13438 gene locus_tag LOCUS_10240 13824 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14036 14278 gene locus_tag LOCUS_10250 14036 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14241 15410 gene locus_tag LOCUS_10260 14241 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 15403 16302 gene locus_tag LOCUS_10270 15403 16302 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_10270 16364 17587 gene locus_tag LOCUS_10280 16364 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 18401 17613 gene locus_tag LOCUS_10290 18401 17613 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243773.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence039 1470 2333 gene locus_tag LOCUS_10300 1470 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3177 2776 gene locus_tag LOCUS_10310 3177 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3485 3192 gene locus_tag LOCUS_10320 3485 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3788 5104 gene locus_tag LOCUS_10330 3788 5104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957028.1 protein_id gnl|my_center|LOCUS_10330 5101 6843 gene locus_tag LOCUS_10340 5101 6843 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_10340 7709 6849 gene locus_tag LOCUS_10350 7709 6849 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_10350 9536 7893 gene locus_tag LOCUS_10360 9536 7893 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_10360 10532 9537 gene locus_tag LOCUS_10370 gene porB 10532 9537 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_10370 11791 10529 gene locus_tag LOCUS_10380 gene porA 11791 10529 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_10380 12371 11784 gene locus_tag LOCUS_10390 12371 11784 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_10390 12442 12930 gene locus_tag LOCUS_10400 12442 12930 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092530.1 protein_id gnl|my_center|LOCUS_10400 12927 13589 gene locus_tag LOCUS_10410 12927 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 13583 14338 gene locus_tag LOCUS_10420 13583 14338 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_10420 14371 15411 gene locus_tag LOCUS_10430 14371 15411 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_10430 16162 15425 gene locus_tag LOCUS_10440 16162 15425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 16237 17709 gene locus_tag LOCUS_10450 gene crtI 16237 17709 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence040 22 237 gene locus_tag LOCUS_10460 22 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 311 706 gene locus_tag LOCUS_10470 311 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1970 693 gene locus_tag LOCUS_10480 1970 693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_10480 2033 2524 gene locus_tag LOCUS_10490 2033 2524 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089471.1 protein_id gnl|my_center|LOCUS_10490 2524 2967 gene locus_tag LOCUS_10500 2524 2967 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_10500 3208 2981 gene locus_tag LOCUS_10510 3208 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3369 3998 gene locus_tag LOCUS_10520 3369 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4997 3999 gene locus_tag LOCUS_10530 4997 3999 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_10530 5037 5591 gene locus_tag LOCUS_10540 5037 5591 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_10540 5853 6296 gene locus_tag LOCUS_10550 5853 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7286 6330 gene locus_tag LOCUS_10560 7286 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7408 7857 gene locus_tag LOCUS_10570 7408 7857 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031504.1 protein_id gnl|my_center|LOCUS_10570 8026 9195 gene locus_tag LOCUS_10580 8026 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 10743 9304 gene locus_tag LOCUS_10590 gene fumC 10743 9304 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990844.1 protein_id gnl|my_center|LOCUS_10590 10791 11198 gene locus_tag LOCUS_10600 gene arr 10791 11198 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_10600 11834 11214 gene locus_tag LOCUS_10610 11834 11214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_10610 13084 11831 gene locus_tag LOCUS_10620 13084 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 13754 13206 gene locus_tag LOCUS_10630 13754 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 14197 13772 gene locus_tag LOCUS_10640 14197 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 14290 14784 gene locus_tag LOCUS_10650 14290 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 15303 14791 gene locus_tag LOCUS_10660 15303 14791 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022592.1 protein_id gnl|my_center|LOCUS_10660 16275 15340 gene locus_tag LOCUS_10670 16275 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 16466 16906 gene locus_tag LOCUS_10680 16466 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 17105 17305 gene locus_tag LOCUS_10690 17105 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 17428 17486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence041 1303 2343 gene locus_tag LOCUS_10700 1303 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2340 3149 gene locus_tag LOCUS_10710 2340 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3140 3472 gene locus_tag LOCUS_10720 3140 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3846 3469 gene locus_tag LOCUS_10730 3846 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3922 4239 gene locus_tag LOCUS_10740 3922 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4365 4928 gene locus_tag LOCUS_10750 gene infC 4365 4928 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_10750 4946 5143 gene locus_tag LOCUS_10760 gene rpmI 4946 5143 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_10760 5157 5522 gene locus_tag LOCUS_10770 gene rplT 5157 5522 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_10770 5524 6261 gene locus_tag LOCUS_10780 5524 6261 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_10780 7325 6393 gene locus_tag LOCUS_10790 7325 6393 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_10790 7380 8489 gene locus_tag LOCUS_10800 gene pheS 7380 8489 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_10800 8489 10921 gene locus_tag LOCUS_10810 gene pheT 8489 10921 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_10810 12698 11049 gene locus_tag LOCUS_10820 12698 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 12772 13779 gene locus_tag LOCUS_10830 gene argC 12772 13779 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_10830 13776 14921 gene locus_tag LOCUS_10840 gene argJ 13776 14921 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_10840 14918 15763 gene locus_tag LOCUS_10850 gene argB 14918 15763 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_10850 15760 16899 gene locus_tag LOCUS_10860 15760 16899 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence042 1170 394 gene locus_tag LOCUS_10870 1170 394 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_10870 1226 1819 gene locus_tag LOCUS_10880 gene cofC 1226 1819 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908475.1 protein_id gnl|my_center|LOCUS_10880 2539 1829 gene locus_tag LOCUS_10890 2539 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3208 2621 gene locus_tag LOCUS_10900 gene leuD 3208 2621 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_10900 4610 3210 gene locus_tag LOCUS_10910 gene leuC 4610 3210 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_10910 4660 5343 gene locus_tag LOCUS_10920 gene ndgR 4660 5343 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_10920 5657 5584 gene locus_tag LOCUS_t00150 5657 5584 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5750 5678 gene locus_tag LOCUS_t00160 5750 5678 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5922 7061 gene locus_tag LOCUS_10930 5922 7061 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_10930 7058 8917 gene locus_tag LOCUS_10940 7058 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 10368 8914 gene locus_tag LOCUS_10950 gene gltX 10368 8914 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775887.1 protein_id gnl|my_center|LOCUS_10950 11141 10365 gene locus_tag LOCUS_10960 11141 10365 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_10960 12186 11161 gene locus_tag LOCUS_10970 12186 11161 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897959.1 protein_id gnl|my_center|LOCUS_10970 16648 12176 gene locus_tag LOCUS_10980 16648 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence043 817 317 gene locus_tag LOCUS_10990 817 317 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111582.1 protein_id gnl|my_center|LOCUS_10990 1605 817 gene locus_tag LOCUS_11000 1605 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2225 1590 gene locus_tag LOCUS_11010 2225 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2297 2965 gene locus_tag LOCUS_11020 2297 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2962 4197 gene locus_tag LOCUS_11030 2962 4197 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_11030 4197 4901 gene locus_tag LOCUS_11040 4197 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4905 5219 gene locus_tag LOCUS_11050 4905 5219 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_11050 5229 5750 gene locus_tag LOCUS_11060 5229 5750 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_11060 5818 6129 gene locus_tag LOCUS_11070 5818 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6475 7716 gene locus_tag LOCUS_11080 6475 7716 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11080 8241 7819 gene locus_tag LOCUS_11090 gene sodN 8241 7819 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_11090 8340 8585 gene locus_tag LOCUS_11100 8340 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 8973 8578 gene locus_tag LOCUS_11110 8973 8578 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_11110 8996 9385 gene locus_tag LOCUS_11120 8996 9385 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_11120 10377 9373 gene locus_tag LOCUS_11130 10377 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 10994 10374 gene locus_tag LOCUS_11140 10994 10374 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973054.1 protein_id gnl|my_center|LOCUS_11140 11915 11115 gene locus_tag LOCUS_11150 11915 11115 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_11150 12391 12041 gene locus_tag LOCUS_11160 12391 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 12975 12445 gene locus_tag LOCUS_11170 12975 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 13787 12975 gene locus_tag LOCUS_11180 13787 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 14451 13852 gene locus_tag LOCUS_11190 14451 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 14574 15173 gene locus_tag LOCUS_11200 14574 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 15174 16478 gene locus_tag LOCUS_11210 15174 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence044 575 1300 gene locus_tag LOCUS_11220 575 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1490 1816 gene locus_tag LOCUS_11230 1490 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1813 6528 gene locus_tag LOCUS_11240 1813 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7652 6555 gene locus_tag LOCUS_11250 7652 6555 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 protein_id gnl|my_center|LOCUS_11250 8344 7649 gene locus_tag LOCUS_11260 8344 7649 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 protein_id gnl|my_center|LOCUS_11260 8631 8371 gene locus_tag LOCUS_11270 8631 8371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8800 10377 gene locus_tag LOCUS_11280 8800 10377 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113065.1 protein_id gnl|my_center|LOCUS_11280 10203 10212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10377 10883 gene locus_tag LOCUS_11290 10377 10883 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_11290 11648 10995 gene locus_tag LOCUS_11300 gene msrA 11648 10995 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309948.1 protein_id gnl|my_center|LOCUS_11300 11696 12916 gene locus_tag LOCUS_11310 11696 12916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_11310 12903 13556 gene locus_tag LOCUS_11320 12903 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence045 247 368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 764 528 gene locus_tag LOCUS_11330 764 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_11330 930 2603 gene locus_tag LOCUS_11340 930 2603 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_11340 3624 2581 gene locus_tag LOCUS_11350 gene trpD 3624 2581 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_11350 4104 3700 gene locus_tag LOCUS_11360 4104 3700 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_11360 4310 4900 gene locus_tag LOCUS_11370 4310 4900 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_11370 4912 5727 gene locus_tag LOCUS_11380 4912 5727 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_11380 5724 6764 gene locus_tag LOCUS_11390 5724 6764 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_11390 6761 8458 gene locus_tag LOCUS_11400 6761 8458 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_11400 8547 9092 gene locus_tag LOCUS_11410 8547 9092 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242928.1 protein_id gnl|my_center|LOCUS_11410 9228 10091 gene locus_tag LOCUS_11420 9228 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 10088 12334 gene locus_tag LOCUS_11430 10088 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 13781 12582 gene locus_tag LOCUS_11440 13781 12582 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_11440 14437 14042 gene locus_tag LOCUS_11450 14437 14042 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907986.1 protein_id gnl|my_center|LOCUS_11450 16185 14434 gene locus_tag LOCUS_11460 gene ctaD 16185 14434 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence046 641 4030 gene locus_tag LOCUS_11470 641 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4014 5465 gene locus_tag LOCUS_11480 4014 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5498 6643 gene locus_tag LOCUS_11490 5498 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6655 7770 gene locus_tag LOCUS_11500 6655 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9153 7846 gene locus_tag LOCUS_11510 9153 7846 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776617.1 protein_id gnl|my_center|LOCUS_11510 9855 9163 gene locus_tag LOCUS_11520 9855 9163 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_11520 10014 11771 gene locus_tag LOCUS_11530 10014 11771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 12004 11783 gene locus_tag LOCUS_11540 12004 11783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 14027 12612 gene locus_tag LOCUS_11550 14027 12612 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence047 743 426 gene locus_tag LOCUS_11560 743 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 818 1204 gene locus_tag LOCUS_11570 818 1204 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 protein_id gnl|my_center|LOCUS_11570 1201 2043 gene locus_tag LOCUS_11580 1201 2043 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184599.1 protein_id gnl|my_center|LOCUS_11580 3175 2246 gene locus_tag LOCUS_11590 gene cysK 3175 2246 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_11590 4172 3219 gene locus_tag LOCUS_11600 4172 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4990 4169 gene locus_tag LOCUS_11610 4990 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5283 4987 gene locus_tag LOCUS_11620 5283 4987 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_11620 5336 6916 gene locus_tag LOCUS_11630 5336 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 7309 6923 gene locus_tag LOCUS_11640 7309 6923 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_11640 8647 7343 gene locus_tag LOCUS_11650 8647 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8360 8434 gene locus_tag LOCUS_t00170 8360 8434 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8873 9619 gene locus_tag LOCUS_11660 8873 9619 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079427.1 protein_id gnl|my_center|LOCUS_11660 11466 9622 gene locus_tag LOCUS_11670 gene typA 11466 9622 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_11670 11489 11965 gene locus_tag LOCUS_11680 11489 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14342 11967 gene locus_tag LOCUS_11690 14342 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence048 1101 2561 gene locus_tag LOCUS_11700 1101 2561 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_11700 2778 5396 gene locus_tag LOCUS_11710 gene topA 2778 5396 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_11710 5618 6223 gene locus_tag LOCUS_11720 gene tmk 5618 6223 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051604.1 protein_id gnl|my_center|LOCUS_11720 6193 7386 gene locus_tag LOCUS_11730 6193 7386 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_11730 7424 8377 gene locus_tag LOCUS_11740 7424 8377 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_11740 8439 9275 gene locus_tag LOCUS_11750 8439 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 9291 11366 gene locus_tag LOCUS_11760 9291 11366 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_11760 12275 11367 gene locus_tag LOCUS_11770 12275 11367 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_11770 12335 13840 gene locus_tag LOCUS_11780 12335 13840 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_11780 14137 14349 gene locus_tag LOCUS_11790 14137 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 14351 15535 gene locus_tag LOCUS_11800 14351 15535 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088477.1 protein_id gnl|my_center|LOCUS_11800 15757 16068 gene locus_tag LOCUS_11810 15757 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 16044 16400 gene locus_tag LOCUS_11820 16044 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence049 382 17 gene locus_tag LOCUS_11830 382 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4773 673 gene locus_tag LOCUS_11840 4773 673 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_11840 5534 4770 gene locus_tag LOCUS_11850 5534 4770 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_11850 5609 6805 gene locus_tag LOCUS_11860 5609 6805 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_11860 6930 6790 gene locus_tag LOCUS_11870 6930 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 8762 7044 gene locus_tag LOCUS_11880 8762 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229290.1 protein_id gnl|my_center|LOCUS_11880 9012 8767 gene locus_tag LOCUS_11890 9012 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9543 9643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12787 10118 gene locus_tag LOCUS_11900 gene polA 12787 10118 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_11900 12857 13228 gene locus_tag LOCUS_11910 12857 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13760 13197 gene locus_tag LOCUS_11920 13760 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 13928 15187 gene locus_tag LOCUS_11930 13928 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 15191 16174 gene locus_tag LOCUS_11940 15191 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 16014 16023 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence050 889 491 gene locus_tag LOCUS_11950 889 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1587 973 gene locus_tag LOCUS_11960 1587 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1487 1690 gene locus_tag LOCUS_11970 1487 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2360 1683 gene locus_tag LOCUS_11980 2360 1683 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027478.1 protein_id gnl|my_center|LOCUS_11980 3233 2400 gene locus_tag LOCUS_11990 3233 2400 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_11990 3357 6155 gene locus_tag LOCUS_12000 3357 6155 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_12000 6155 8638 gene locus_tag LOCUS_12010 6155 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 8649 9212 gene locus_tag LOCUS_12020 gene orn 8649 9212 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_12020 9383 9517 gene locus_tag LOCUS_12030 9383 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 10618 9584 gene locus_tag LOCUS_12040 10618 9584 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_12040 10756 11862 gene locus_tag LOCUS_12050 10756 11862 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309888.1 protein_id gnl|my_center|LOCUS_12050 11936 12973 gene locus_tag LOCUS_12060 11936 12973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974316.1 protein_id gnl|my_center|LOCUS_12060 12975 13790 gene locus_tag LOCUS_12070 12975 13790 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338643.1 protein_id gnl|my_center|LOCUS_12070 13787 14719 gene locus_tag LOCUS_12080 13787 14719 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence051 1726 572 gene locus_tag LOCUS_12090 1726 572 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115731595.1 protein_id gnl|my_center|LOCUS_12090 2217 1735 gene locus_tag LOCUS_12100 2217 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2540 2208 gene locus_tag LOCUS_12110 2540 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4398 2440 gene locus_tag LOCUS_12120 4398 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2725 2734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5312 4401 gene locus_tag LOCUS_12130 5312 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6250 5309 gene locus_tag LOCUS_12140 6250 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6816 6247 gene locus_tag LOCUS_12150 6816 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6969 8045 gene locus_tag LOCUS_12160 6969 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8988 8062 gene locus_tag LOCUS_12170 8988 8062 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222953.1 protein_id gnl|my_center|LOCUS_12170 9997 8993 gene locus_tag LOCUS_12180 9997 8993 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803945.1 protein_id gnl|my_center|LOCUS_12180 10049 10939 gene locus_tag LOCUS_12190 10049 10939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112141.1 protein_id gnl|my_center|LOCUS_12190 10939 12072 gene locus_tag LOCUS_12200 10939 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 12112 12534 gene locus_tag LOCUS_12210 12112 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 13577 12531 gene locus_tag LOCUS_12220 13577 12531 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620874.1 protein_id gnl|my_center|LOCUS_12220 14605 13577 gene locus_tag LOCUS_12230 14605 13577 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620877.1 protein_id gnl|my_center|LOCUS_12230 <15687 14602 gene locus_tag LOCUS_12240 <15687 14602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108522916.1:GMC family oxidoreductase >Feature sequence052 922 329 gene locus_tag LOCUS_12250 922 329 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895202.1 protein_id gnl|my_center|LOCUS_12250 1593 931 gene locus_tag LOCUS_12260 1593 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3278 1590 gene locus_tag LOCUS_12270 3278 1590 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_12270 3724 3275 gene locus_tag LOCUS_12280 3724 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5262 3715 gene locus_tag LOCUS_12290 5262 3715 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230126.1 protein_id gnl|my_center|LOCUS_12290 6061 5255 gene locus_tag LOCUS_12300 6061 5255 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_12300 8046 6037 gene locus_tag LOCUS_12310 8046 6037 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_12310 8169 10022 gene locus_tag LOCUS_12320 8169 10022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_12320 10026 11093 gene locus_tag LOCUS_12330 10026 11093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_12330 11093 12016 gene locus_tag LOCUS_12340 11093 12016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_12340 12018 12989 gene locus_tag LOCUS_12350 12018 12989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12350 12986 13963 gene locus_tag LOCUS_12360 12986 13963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_12360 15058 13970 gene locus_tag LOCUS_12370 15058 13970 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_12370 15382 15391 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence053 1224 493 gene locus_tag LOCUS_12380 1224 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1955 1221 gene locus_tag LOCUS_12390 1955 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1992 2378 gene locus_tag LOCUS_12400 1992 2378 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026896.1 protein_id gnl|my_center|LOCUS_12400 2378 2731 gene locus_tag LOCUS_12410 2378 2731 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_12410 2753 4048 gene locus_tag LOCUS_12420 2753 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3379 3388 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5256 4075 gene locus_tag LOCUS_12430 5256 4075 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227064.1 protein_id gnl|my_center|LOCUS_12430 6111 5395 gene locus_tag LOCUS_12440 6111 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 6311 7945 gene locus_tag LOCUS_12450 6311 7945 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_12450 8689 7946 gene locus_tag LOCUS_12460 8689 7946 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015860.1 protein_id gnl|my_center|LOCUS_12460 9182 8751 gene locus_tag LOCUS_12470 gene cadI 9182 8751 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_12470 9263 9598 gene locus_tag LOCUS_12480 9263 9598 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031196.1 protein_id gnl|my_center|LOCUS_12480 10070 9591 gene locus_tag LOCUS_12490 10070 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9976 10362 gene locus_tag LOCUS_12500 9976 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 10427 11437 gene locus_tag LOCUS_12510 10427 11437 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_12510 11524 11451 gene locus_tag LOCUS_t00180 11524 11451 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13327 11600 gene locus_tag LOCUS_12520 13327 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14430 13324 gene locus_tag LOCUS_12530 14430 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 14514 14810 gene locus_tag LOCUS_12540 14514 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence054 1687 611 gene locus_tag LOCUS_12550 1687 611 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_12550 2299 1697 gene locus_tag LOCUS_12560 2299 1697 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_12560 2481 3662 gene locus_tag LOCUS_12570 2481 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3723 4229 gene locus_tag LOCUS_12580 3723 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4294 6453 gene locus_tag LOCUS_12590 4294 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 7838 6498 gene locus_tag LOCUS_12600 7838 6498 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_12600 9163 7835 gene locus_tag LOCUS_12610 9163 7835 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_12610 10405 9284 gene locus_tag LOCUS_12620 gene femX 10405 9284 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_12620 10957 10511 gene locus_tag LOCUS_12630 10957 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 11174 11461 gene locus_tag LOCUS_12640 gene rpsF 11174 11461 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_12640 11515 12000 gene locus_tag LOCUS_12650 11515 12000 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_12650 12058 12303 gene locus_tag LOCUS_12660 gene rpsR 12058 12303 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811758.1 protein_id gnl|my_center|LOCUS_12660 12312 12758 gene locus_tag LOCUS_12670 gene rplI 12312 12758 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_12670 12839 13297 gene locus_tag LOCUS_12680 12839 13297 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence055 1543 950 gene locus_tag LOCUS_12690 1543 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1520 2734 gene locus_tag LOCUS_12700 1520 2734 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_12700 2753 3307 gene locus_tag LOCUS_12710 2753 3307 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_12710 4067 3309 gene locus_tag LOCUS_12720 4067 3309 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384273.1 protein_id gnl|my_center|LOCUS_12720 4139 4618 gene locus_tag LOCUS_12730 4139 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4615 6849 gene locus_tag LOCUS_12740 4615 6849 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_12740 7768 6836 gene locus_tag LOCUS_12750 7768 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7701 8735 gene locus_tag LOCUS_12760 7701 8735 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 protein_id gnl|my_center|LOCUS_12760 9676 8750 gene locus_tag LOCUS_12770 9676 8750 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227180.1 protein_id gnl|my_center|LOCUS_12770 10420 9722 gene locus_tag LOCUS_12780 10420 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10603 11421 gene locus_tag LOCUS_12790 10603 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 11717 11316 gene locus_tag LOCUS_12800 11717 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11707 11934 gene locus_tag LOCUS_12810 11707 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 12840 11992 gene locus_tag LOCUS_12820 12840 11992 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_12820 13108 13035 gene locus_tag LOCUS_t00190 13108 13035 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence056 3622 1994 gene locus_tag LOCUS_12830 gene pruA 3622 1994 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 protein_id gnl|my_center|LOCUS_12830 4032 3661 gene locus_tag LOCUS_12840 4032 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5030 4029 gene locus_tag LOCUS_12850 5030 4029 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_12850 6525 5101 gene locus_tag LOCUS_12860 6525 5101 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_12860 7294 6647 gene locus_tag LOCUS_12870 7294 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8311 7304 gene locus_tag LOCUS_12880 8311 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8375 8593 gene locus_tag LOCUS_12890 8375 8593 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_12890 9040 8558 gene locus_tag LOCUS_12900 9040 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9132 9530 gene locus_tag LOCUS_12910 9132 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12318 9532 gene locus_tag LOCUS_12920 gene secA 12318 9532 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_12920 12357 13151 gene locus_tag LOCUS_12930 12357 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13685 13152 gene locus_tag LOCUS_12940 13685 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14398 13751 gene locus_tag LOCUS_12950 gene raiA 14398 13751 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776077.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence057 923 72 gene locus_tag LOCUS_12960 923 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 1022 2059 gene locus_tag LOCUS_12970 1022 2059 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898118.1 protein_id gnl|my_center|LOCUS_12970 2159 2680 gene locus_tag LOCUS_12980 2159 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2588 2597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2616 3632 gene locus_tag LOCUS_12990 2616 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3687 3896 gene locus_tag LOCUS_13000 3687 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3911 4483 gene locus_tag LOCUS_13010 3911 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4526 5590 gene locus_tag LOCUS_13020 4526 5590 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947883.1 protein_id gnl|my_center|LOCUS_13020 5587 6849 gene locus_tag LOCUS_13030 5587 6849 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_13030 6922 7653 gene locus_tag LOCUS_13040 6922 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8074 7562 gene locus_tag LOCUS_13050 8074 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13050 7606 7633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7989 8309 gene locus_tag LOCUS_13060 7989 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8081 8111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9044 8394 gene locus_tag LOCUS_13070 9044 8394 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 protein_id gnl|my_center|LOCUS_13070 9545 9108 gene locus_tag LOCUS_13080 9545 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080796943.1 protein_id gnl|my_center|LOCUS_13080 10869 9643 gene locus_tag LOCUS_13090 10869 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 11005 12009 gene locus_tag LOCUS_13100 11005 12009 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_13100 12089 13381 gene locus_tag LOCUS_13110 12089 13381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 13388 14077 gene locus_tag LOCUS_13120 13388 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence058 276 1061 gene locus_tag LOCUS_13130 276 1061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_13130 1058 1789 gene locus_tag LOCUS_13140 1058 1789 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728148.1 protein_id gnl|my_center|LOCUS_13140 1792 2580 gene locus_tag LOCUS_13150 1792 2580 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_13150 3956 2562 gene locus_tag LOCUS_13160 3956 2562 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_13160 4021 4629 gene locus_tag LOCUS_13170 4021 4629 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_13170 4794 5693 gene locus_tag LOCUS_13180 4794 5693 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_13180 5716 6651 gene locus_tag LOCUS_13190 5716 6651 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_13190 6648 7418 gene locus_tag LOCUS_13200 6648 7418 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_13200 7588 8931 gene locus_tag LOCUS_13210 7588 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8984 10516 gene locus_tag LOCUS_13220 gene hutH 8984 10516 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_13220 10522 12195 gene locus_tag LOCUS_13230 10522 12195 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727477.1 protein_id gnl|my_center|LOCUS_13230 12282 13385 gene locus_tag LOCUS_13240 gene hutI 12282 13385 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence059 651 322 gene locus_tag LOCUS_13250 651 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2040 739 gene locus_tag LOCUS_13260 2040 739 CDS product IS256-like element ISRba9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120088.1 protein_id gnl|my_center|LOCUS_13260 2311 2496 gene locus_tag LOCUS_13270 2311 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2507 3079 gene locus_tag LOCUS_13280 2507 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3237 3596 gene locus_tag LOCUS_13290 3237 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3671 4723 gene locus_tag LOCUS_13300 3671 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 4720 4887 gene locus_tag LOCUS_13310 4720 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5228 4824 gene locus_tag LOCUS_13320 5228 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5275 5532 gene locus_tag LOCUS_13330 5275 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6375 7283 gene locus_tag LOCUS_13340 6375 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7299 7466 gene locus_tag LOCUS_13350 7299 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 7576 7740 gene locus_tag LOCUS_13360 7576 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 7997 7743 gene locus_tag LOCUS_13370 7997 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8265 9494 gene locus_tag LOCUS_13380 8265 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 9653 10072 gene locus_tag LOCUS_13390 9653 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 11119 10250 gene locus_tag LOCUS_13400 11119 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 11327 11683 gene locus_tag LOCUS_13410 11327 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 12032 12472 gene locus_tag LOCUS_13420 12032 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 12780 13154 gene locus_tag LOCUS_13430 12780 13154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13596 13141 gene locus_tag LOCUS_13440 13596 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence060 <1 802 gene locus_tag LOCUS_13450 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028369.1:deoxyguanosinetriphosphate triphosphohydrolase 890 2746 gene locus_tag LOCUS_13460 gene dnaG 890 2746 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_13460 2743 3198 gene locus_tag LOCUS_13470 2743 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3256 3906 gene locus_tag LOCUS_13480 3256 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5655 3913 gene locus_tag LOCUS_13490 5655 3913 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705581.1 protein_id gnl|my_center|LOCUS_13490 5790 8054 gene locus_tag LOCUS_13500 5790 8054 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_13500 9550 8276 gene locus_tag LOCUS_13510 9550 8276 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_13510 10249 9551 gene locus_tag LOCUS_13520 10249 9551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_13520 11169 10261 gene locus_tag LOCUS_13530 11169 10261 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227736.1 protein_id gnl|my_center|LOCUS_13530 11312 11647 gene locus_tag LOCUS_13540 11312 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 11948 11652 gene locus_tag LOCUS_13550 11948 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 12223 12747 gene locus_tag LOCUS_13560 12223 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 12752 13783 gene locus_tag LOCUS_13570 12752 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence061 <1 768 gene locus_tag LOCUS_13580 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406604.1:sensor domain-containing diguanylate cyclase 1132 770 gene locus_tag LOCUS_13590 1132 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_13590 2487 1465 gene locus_tag LOCUS_13600 gene tsaD 2487 1465 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_13600 2900 2484 gene locus_tag LOCUS_13610 gene rimI 2900 2484 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_13610 3475 2921 gene locus_tag LOCUS_13620 gene tsaB 3475 2921 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418038.1 protein_id gnl|my_center|LOCUS_13620 3930 3472 gene locus_tag LOCUS_13630 gene tsaE 3930 3472 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_13630 4894 3890 gene locus_tag LOCUS_13640 4894 3890 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_13640 6009 4891 gene locus_tag LOCUS_13650 gene alr 6009 4891 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_13650 7488 6127 gene locus_tag LOCUS_13660 7488 6127 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_13660 8804 7527 gene locus_tag LOCUS_13670 gene eno 8804 7527 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_13670 9519 8878 gene locus_tag LOCUS_13680 9519 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 10121 9516 gene locus_tag LOCUS_13690 10121 9516 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_13690 13678 10250 gene locus_tag LOCUS_13700 gene mfd 13678 10250 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence062 1179 2222 gene locus_tag LOCUS_13710 1179 2222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_13710 2219 3022 gene locus_tag LOCUS_13720 2219 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13720 3019 3873 gene locus_tag LOCUS_13730 3019 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 3870 4454 gene locus_tag LOCUS_13740 3870 4454 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_13740 4507 5085 gene locus_tag LOCUS_13750 4507 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6209 5058 gene locus_tag LOCUS_13760 6209 5058 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229361.1 protein_id gnl|my_center|LOCUS_13760 6311 7066 gene locus_tag LOCUS_13770 6311 7066 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419689.1 protein_id gnl|my_center|LOCUS_13770 8364 7093 gene locus_tag LOCUS_13780 8364 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_13780 8474 8510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8580 9068 gene locus_tag LOCUS_13790 8580 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9121 10110 gene locus_tag LOCUS_13800 gene ppk2 9121 10110 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_13800 10107 10544 gene locus_tag LOCUS_13810 10107 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11837 10521 gene locus_tag LOCUS_13820 11837 10521 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030570.1 protein_id gnl|my_center|LOCUS_13820 12453 11848 gene locus_tag LOCUS_13830 12453 11848 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878216.1 protein_id gnl|my_center|LOCUS_13830 13169 12426 gene locus_tag LOCUS_13840 13169 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 <13748 13175 gene locus_tag LOCUS_13850 <13748 13175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922349.1:pyrophosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence063 619 221 gene locus_tag LOCUS_13860 619 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2043 619 gene locus_tag LOCUS_13870 2043 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3383 2040 gene locus_tag LOCUS_13880 3383 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3982 3383 gene locus_tag LOCUS_13890 3982 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5670 3979 gene locus_tag LOCUS_13900 5670 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7669 5684 gene locus_tag LOCUS_13910 7669 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8845 9396 gene locus_tag LOCUS_13920 8845 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9396 9764 gene locus_tag LOCUS_13930 9396 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9757 10500 gene locus_tag LOCUS_13940 9757 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 11373 11011 gene locus_tag LOCUS_13950 11373 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11508 12206 gene locus_tag LOCUS_13960 11508 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13960 12194 12481 gene locus_tag LOCUS_13970 12194 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 12739 13500 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccgctgtacgcccctcgcgacagcgaatagaaac >Feature sequence064 31 1203 gene locus_tag LOCUS_13980 31 1203 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402810.1 protein_id gnl|my_center|LOCUS_13980 1208 2011 gene locus_tag LOCUS_13990 1208 2011 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_13990 5046 1978 gene locus_tag LOCUS_14000 5046 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8144 5043 gene locus_tag LOCUS_14010 8144 5043 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_14010 8235 10898 gene locus_tag LOCUS_14020 8235 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 12088 10916 gene locus_tag LOCUS_14030 gene moeZ 12088 10916 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_14030 12167 12889 gene locus_tag LOCUS_14040 12167 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence065 1 234 gene locus_tag LOCUS_14050 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 375 791 gene locus_tag LOCUS_14060 375 791 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_14060 1031 837 gene locus_tag LOCUS_14070 1031 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2302 1445 gene locus_tag LOCUS_14080 2302 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_14080 2406 3029 gene locus_tag LOCUS_14090 2406 3029 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918344.1 protein_id gnl|my_center|LOCUS_14090 3096 3584 gene locus_tag LOCUS_14100 3096 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3677 4012 gene locus_tag LOCUS_14110 3677 4012 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_14110 4056 4346 gene locus_tag LOCUS_14120 4056 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5907 4351 gene locus_tag LOCUS_14130 5907 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6215 7849 gene locus_tag LOCUS_14140 6215 7849 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_14140 8025 8957 gene locus_tag LOCUS_14150 8025 8957 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_14150 8950 9918 gene locus_tag LOCUS_14160 8950 9918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_14160 9923 10924 gene locus_tag LOCUS_14170 9923 10924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_14170 10899 11951 gene locus_tag LOCUS_14180 10899 11951 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_14180 <13137 11962 gene locus_tag LOCUS_14190 <13137 11962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030068.1:prolyl oligopeptidase family serine peptidase >Feature sequence066 1731 625 gene locus_tag LOCUS_14200 1731 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1655 1873 gene locus_tag LOCUS_14210 1655 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2658 2035 gene locus_tag LOCUS_14220 2658 2035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_14220 3941 2655 gene locus_tag LOCUS_14230 3941 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4708 3959 gene locus_tag LOCUS_14240 4708 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5270 4800 gene locus_tag LOCUS_14250 5270 4800 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101517.1 protein_id gnl|my_center|LOCUS_14250 5363 5992 gene locus_tag LOCUS_14260 5363 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6034 8298 gene locus_tag LOCUS_14270 6034 8298 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_14270 9190 8285 gene locus_tag LOCUS_14280 9190 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 9214 9696 gene locus_tag LOCUS_14290 9214 9696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030124.1 protein_id gnl|my_center|LOCUS_14290 9764 10372 gene locus_tag LOCUS_14300 9764 10372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 10375 10689 gene locus_tag LOCUS_14310 10375 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12184 10691 gene locus_tag LOCUS_14320 12184 10691 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_14320 <13106 12239 gene locus_tag LOCUS_14330 <13106 12239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730652.1:acetyl-CoA acetyltransferase >Feature sequence067 1899 2477 gene locus_tag LOCUS_14340 1899 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3140 2502 gene locus_tag LOCUS_14350 3140 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3590 3147 gene locus_tag LOCUS_14360 3590 3147 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_14360 6502 3662 gene locus_tag LOCUS_14370 gene uvrA 6502 3662 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_14370 6576 7292 gene locus_tag LOCUS_14380 6576 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7289 7942 gene locus_tag LOCUS_14390 7289 7942 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_14390 7939 9237 gene locus_tag LOCUS_14400 7939 9237 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_14400 10534 9203 gene locus_tag LOCUS_14410 gene clcA 10534 9203 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 protein_id gnl|my_center|LOCUS_14410 11554 10562 gene locus_tag LOCUS_14420 11554 10562 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812727.1 protein_id gnl|my_center|LOCUS_14420 <12745 11551 gene locus_tag LOCUS_14430 <12745 11551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895262.1:excinuclease ABC subunit UvrB >Feature sequence068 <1 609 gene locus_tag LOCUS_14440 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296638.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 606 1472 gene locus_tag LOCUS_14450 gene truB 606 1472 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804656.1 protein_id gnl|my_center|LOCUS_14450 1493 2368 gene locus_tag LOCUS_14460 1493 2368 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_14460 2365 3165 gene locus_tag LOCUS_14470 2365 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4436 3156 gene locus_tag LOCUS_14480 4436 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5542 4433 gene locus_tag LOCUS_14490 5542 4433 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_14490 5702 6691 gene locus_tag LOCUS_14500 5702 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 7980 6634 gene locus_tag LOCUS_14510 7980 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 9095 7977 gene locus_tag LOCUS_14520 9095 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 10602 9226 gene locus_tag LOCUS_14530 10602 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12169 10712 gene locus_tag LOCUS_14540 12169 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 12202 12212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 1539 160 gene locus_tag LOCUS_14550 1539 160 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_14550 1656 4157 gene locus_tag LOCUS_14560 1656 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4163 4963 gene locus_tag LOCUS_14570 4163 4963 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_14570 5477 5043 gene locus_tag LOCUS_14580 5477 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5394 6209 gene locus_tag LOCUS_14590 5394 6209 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_14590 8154 6193 gene locus_tag LOCUS_14600 8154 6193 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088605.1 protein_id gnl|my_center|LOCUS_14600 8737 8195 gene locus_tag LOCUS_14610 8737 8195 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_14610 8784 10130 gene locus_tag LOCUS_14620 8784 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 10237 11457 gene locus_tag LOCUS_14630 10237 11457 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206612254.1 protein_id gnl|my_center|LOCUS_14630 12275 11538 gene locus_tag LOCUS_14640 12275 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence070 13 615 gene locus_tag LOCUS_14650 gene pdxT 13 615 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_14650 612 1364 gene locus_tag LOCUS_14660 612 1364 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_14660 1437 3149 gene locus_tag LOCUS_14670 1437 3149 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730024.1 protein_id gnl|my_center|LOCUS_14670 3252 3746 gene locus_tag LOCUS_14680 gene ruvC 3252 3746 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_14680 3743 4354 gene locus_tag LOCUS_14690 gene ruvA 3743 4354 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_14690 4351 5397 gene locus_tag LOCUS_14700 gene ruvB 4351 5397 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_14700 5411 5674 gene locus_tag LOCUS_14710 5411 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5678 7363 gene locus_tag LOCUS_14720 gene secD 5678 7363 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805000.1 protein_id gnl|my_center|LOCUS_14720 7363 8505 gene locus_tag LOCUS_14730 gene secF 7363 8505 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_14730 8612 10891 gene locus_tag LOCUS_14740 gene relA 8612 10891 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_14740 12170 10905 gene locus_tag LOCUS_14750 12170 10905 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence071 304 1248 gene locus_tag LOCUS_14760 304 1248 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112346.1 protein_id gnl|my_center|LOCUS_14760 1269 2084 gene locus_tag LOCUS_14770 1269 2084 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222956.1 protein_id gnl|my_center|LOCUS_14770 2087 3970 gene locus_tag LOCUS_14780 2087 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731073.1 protein_id gnl|my_center|LOCUS_14780 4095 5471 gene locus_tag LOCUS_14790 4095 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5275 5284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5483 6028 gene locus_tag LOCUS_14800 5483 6028 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 protein_id gnl|my_center|LOCUS_14800 6747 6010 gene locus_tag LOCUS_14810 6747 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7324 6803 gene locus_tag LOCUS_14820 7324 6803 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272425.1 protein_id gnl|my_center|LOCUS_14820 7373 7879 gene locus_tag LOCUS_14830 7373 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14830 7714 7746 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7834 8718 gene locus_tag LOCUS_14840 7834 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 9222 8791 gene locus_tag LOCUS_14850 gene rnhA 9222 8791 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390802.1 protein_id gnl|my_center|LOCUS_14850 10418 9219 gene locus_tag LOCUS_14860 gene rocD 10418 9219 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_14860 11556 10732 gene locus_tag LOCUS_14870 11556 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11569 11729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence072 2 1048 gene locus_tag LOCUS_14880 2 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 993 1445 gene locus_tag LOCUS_14890 993 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1445 2362 gene locus_tag LOCUS_14900 1445 2362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_14900 3560 2373 gene locus_tag LOCUS_14910 3560 2373 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_14910 4212 3586 gene locus_tag LOCUS_14920 4212 3586 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_14920 4901 4209 gene locus_tag LOCUS_14930 4901 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5043 5516 gene locus_tag LOCUS_14940 5043 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5568 6242 gene locus_tag LOCUS_14950 5568 6242 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_14950 6247 7077 gene locus_tag LOCUS_14960 6247 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14960 7180 7419 gene locus_tag LOCUS_14970 7180 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8443 7610 gene locus_tag LOCUS_14980 8443 7610 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_14980 9147 8440 gene locus_tag LOCUS_14990 9147 8440 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_14990 9602 9147 gene locus_tag LOCUS_15000 9602 9147 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_15000 9754 9599 gene locus_tag LOCUS_15010 9754 9599 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_15010 9828 10823 gene locus_tag LOCUS_15020 9828 10823 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence073 314 1348 gene locus_tag LOCUS_15030 314 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15030 1345 2124 gene locus_tag LOCUS_15040 1345 2124 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_15040 2382 2729 gene locus_tag LOCUS_15050 2382 2729 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_15050 3509 2739 gene locus_tag LOCUS_15060 3509 2739 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_15060 5000 3519 gene locus_tag LOCUS_15070 gene lnt 5000 3519 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_15070 5701 4997 gene locus_tag LOCUS_15080 5701 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6821 5712 gene locus_tag LOCUS_15090 6821 5712 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_15090 7969 6818 gene locus_tag LOCUS_15100 7969 6818 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_15100 7968 8855 gene locus_tag LOCUS_15110 7968 8855 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_15110 11258 8844 gene locus_tag LOCUS_15120 11258 8844 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_15120 11538 11239 gene locus_tag LOCUS_15130 11538 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 11298 11307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 1555 2436 gene locus_tag LOCUS_15140 1555 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2769 2593 gene locus_tag LOCUS_15150 2769 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3075 2854 gene locus_tag LOCUS_15160 3075 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4563 3088 gene locus_tag LOCUS_15170 4563 3088 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084295.1 protein_id gnl|my_center|LOCUS_15170 4871 5083 gene locus_tag LOCUS_15180 4871 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5090 5860 gene locus_tag LOCUS_15190 5090 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5977 6933 gene locus_tag LOCUS_15200 5977 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15200 6859 6868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6930 7346 gene locus_tag LOCUS_15210 6930 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15210 8252 7476 gene locus_tag LOCUS_15220 8252 7476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202612.1 protein_id gnl|my_center|LOCUS_15220 9355 8249 gene locus_tag LOCUS_15230 9355 8249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373458.1 protein_id gnl|my_center|LOCUS_15230 10512 9352 gene locus_tag LOCUS_15240 10512 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 10562 11029 gene locus_tag LOCUS_15250 10562 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 11364 11179 gene locus_tag LOCUS_15260 11364 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence075 280 1719 gene locus_tag LOCUS_15270 gene dacB 280 1719 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972790.1 protein_id gnl|my_center|LOCUS_15270 2355 1726 gene locus_tag LOCUS_15280 2355 1726 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_15280 2734 2462 gene locus_tag LOCUS_15290 2734 2462 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_15290 3017 2745 gene locus_tag LOCUS_15300 3017 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3114 3488 gene locus_tag LOCUS_15310 3114 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3740 3534 gene locus_tag LOCUS_15320 3740 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4601 3762 gene locus_tag LOCUS_15330 4601 3762 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_15330 6339 4702 gene locus_tag LOCUS_15340 6339 4702 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 protein_id gnl|my_center|LOCUS_15340 6612 7844 gene locus_tag LOCUS_15350 6612 7844 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_15350 7915 8919 gene locus_tag LOCUS_15360 7915 8919 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970089.1 protein_id gnl|my_center|LOCUS_15360 10183 8969 gene locus_tag LOCUS_15370 10183 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 10209 11372 gene locus_tag LOCUS_15380 10209 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence076 469 1389 gene locus_tag LOCUS_15390 469 1389 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_15390 1431 3068 gene locus_tag LOCUS_15400 gene arc 1431 3068 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_15400 3901 3116 gene locus_tag LOCUS_15410 3901 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 5569 4046 gene locus_tag LOCUS_15420 gene dop 5569 4046 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_15420 5469 5861 gene locus_tag LOCUS_15430 5469 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5858 6691 gene locus_tag LOCUS_15440 gene prcB 5858 6691 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_15440 6688 7383 gene locus_tag LOCUS_15450 gene prcA 6688 7383 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_15450 7394 8017 gene locus_tag LOCUS_15460 7394 8017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 7915 8763 gene locus_tag LOCUS_15470 7915 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15470 8784 9320 gene locus_tag LOCUS_15480 8784 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15480 9317 9673 gene locus_tag LOCUS_15490 9317 9673 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 protein_id gnl|my_center|LOCUS_15490 9868 10185 gene locus_tag LOCUS_15500 9868 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 10233 10508 gene locus_tag LOCUS_15510 gene tatA 10233 10508 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226712.1 protein_id gnl|my_center|LOCUS_15510 10511 11341 gene locus_tag LOCUS_15520 gene tatC 10511 11341 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence077 1181 474 gene locus_tag LOCUS_15530 1181 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1835 1212 gene locus_tag LOCUS_15540 1835 1212 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_15540 1930 3354 gene locus_tag LOCUS_15550 1930 3354 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_15550 4436 3375 gene locus_tag LOCUS_15560 4436 3375 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930079.1 protein_id gnl|my_center|LOCUS_15560 4478 4867 gene locus_tag LOCUS_15570 4478 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850002.1 protein_id gnl|my_center|LOCUS_15570 6110 4917 gene locus_tag LOCUS_15580 gene metK 6110 4917 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_15580 6774 6226 gene locus_tag LOCUS_15590 6774 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 8243 6816 gene locus_tag LOCUS_15600 gene ahcY 8243 6816 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_15600 8464 9726 gene locus_tag LOCUS_15610 8464 9726 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_15610 9950 9729 gene locus_tag LOCUS_15620 9950 9729 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083281.1 protein_id gnl|my_center|LOCUS_15620 10932 9952 gene locus_tag LOCUS_15630 gene moaA 10932 9952 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_15630 <11492 10923 gene locus_tag LOCUS_15640 <11492 10923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230247.1:molybdenum cofactor biosynthesis protein MoaE >Feature sequence078 <1 964 gene locus_tag LOCUS_15650 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805040.1:DNA topoisomerase IV subunit B 1062 2171 gene locus_tag LOCUS_15660 1062 2171 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_15660 2665 2168 gene locus_tag LOCUS_15670 2665 2168 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262519.1 protein_id gnl|my_center|LOCUS_15670 3662 2682 gene locus_tag LOCUS_15680 3662 2682 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_15680 4204 3659 gene locus_tag LOCUS_15690 4204 3659 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_15690 4620 5315 gene locus_tag LOCUS_15700 4620 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6665 5316 gene locus_tag LOCUS_15710 6665 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9168 6751 gene locus_tag LOCUS_15720 9168 6751 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_15720 9384 9232 gene locus_tag LOCUS_15730 9384 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 11102 11189 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence079 163 1326 gene locus_tag LOCUS_15740 163 1326 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 protein_id gnl|my_center|LOCUS_15740 1358 1633 gene locus_tag LOCUS_15750 1358 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2256 1630 gene locus_tag LOCUS_15760 2256 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2572 2213 gene locus_tag LOCUS_15770 2572 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2618 3397 gene locus_tag LOCUS_15780 2618 3397 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_15780 4169 3399 gene locus_tag LOCUS_15790 4169 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4190 5176 gene locus_tag LOCUS_15800 4190 5176 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267273.1 protein_id gnl|my_center|LOCUS_15800 5192 5671 gene locus_tag LOCUS_15810 5192 5671 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_15810 5677 6579 gene locus_tag LOCUS_15820 5677 6579 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 protein_id gnl|my_center|LOCUS_15820 7077 6583 gene locus_tag LOCUS_15830 7077 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8628 7138 gene locus_tag LOCUS_15840 8628 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8743 8898 gene locus_tag LOCUS_15850 8743 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9725 10597 gene locus_tag LOCUS_15860 9725 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 10927 10962 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence080 1598 681 gene locus_tag LOCUS_15870 1598 681 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_15870 2755 1598 gene locus_tag LOCUS_15880 2755 1598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_15880 3953 2760 gene locus_tag LOCUS_15890 3953 2760 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_15890 5465 3987 gene locus_tag LOCUS_15900 5465 3987 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_15900 5723 6214 gene locus_tag LOCUS_15910 5723 6214 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_15910 6895 6224 gene locus_tag LOCUS_15920 6895 6224 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_15920 7876 6905 gene locus_tag LOCUS_15930 gene lipA 7876 6905 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_15930 8744 7818 gene locus_tag LOCUS_15940 8744 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 9292 8741 gene locus_tag LOCUS_15950 gene lipB 9292 8741 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411458.1 protein_id gnl|my_center|LOCUS_15950 9248 9469 gene locus_tag LOCUS_15960 9248 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 9603 10016 gene locus_tag LOCUS_15970 9603 10016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10900 10013 gene locus_tag LOCUS_15980 10900 10013 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence081 165 1958 gene locus_tag LOCUS_15990 165 1958 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 protein_id gnl|my_center|LOCUS_15990 1951 3387 gene locus_tag LOCUS_16000 1951 3387 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 protein_id gnl|my_center|LOCUS_16000 5133 3544 gene locus_tag LOCUS_16010 5133 3544 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110566.1 protein_id gnl|my_center|LOCUS_16010 5219 6322 gene locus_tag LOCUS_16020 5219 6322 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 protein_id gnl|my_center|LOCUS_16020 6315 6791 gene locus_tag LOCUS_16030 6315 6791 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_16030 6911 8179 gene locus_tag LOCUS_16040 gene serS 6911 8179 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_16040 8179 8889 gene locus_tag LOCUS_16050 8179 8889 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974366.1 protein_id gnl|my_center|LOCUS_16050 9180 9785 gene locus_tag LOCUS_16060 9180 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10010 10681 gene locus_tag LOCUS_16070 gene larB 10010 10681 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence082 618 304 gene locus_tag LOCUS_16080 618 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 821 615 gene locus_tag LOCUS_16090 821 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2233 818 gene locus_tag LOCUS_16100 2233 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3300 2230 gene locus_tag LOCUS_16110 3300 2230 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112777.1 protein_id gnl|my_center|LOCUS_16110 5486 3300 gene locus_tag LOCUS_16120 5486 3300 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_16120 6244 5483 gene locus_tag LOCUS_16130 6244 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6699 7106 gene locus_tag LOCUS_16140 6699 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 10196 7098 gene locus_tag LOCUS_16150 10196 7098 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_16150 <11026 10200 gene locus_tag LOCUS_16160 <11026 10200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918507.1:restriction endonuclease subunit S >Feature sequence083 3393 1414 gene locus_tag LOCUS_16170 3393 1414 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395243.1 protein_id gnl|my_center|LOCUS_16170 4557 3400 gene locus_tag LOCUS_16180 4557 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6179 4680 gene locus_tag LOCUS_16190 6179 4680 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_16190 6499 6302 gene locus_tag LOCUS_16200 6499 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 6644 8302 gene locus_tag LOCUS_16210 gene sirA 6644 8302 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_16210 8430 9179 gene locus_tag LOCUS_16220 8430 9179 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_16220 9301 10089 gene locus_tag LOCUS_16230 9301 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence084 2083 5634 gene locus_tag LOCUS_16240 2083 5634 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727628.1 protein_id gnl|my_center|LOCUS_16240 5698 9654 gene locus_tag LOCUS_16250 5698 9654 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892756.1 protein_id gnl|my_center|LOCUS_16250 10613 9735 gene locus_tag LOCUS_16260 10613 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179691.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence085 <1 648 gene locus_tag LOCUS_16270 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027756.1:MerR family transcriptional regulator 699 1208 gene locus_tag LOCUS_16280 699 1208 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_16280 1332 1895 gene locus_tag LOCUS_16290 1332 1895 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_16290 1988 4687 gene locus_tag LOCUS_16300 gene gcvP 1988 4687 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_16300 4712 6271 gene locus_tag LOCUS_16310 4712 6271 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085748.1 protein_id gnl|my_center|LOCUS_16310 6780 6286 gene locus_tag LOCUS_16320 6780 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_16320 6827 7279 gene locus_tag LOCUS_16330 6827 7279 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_16330 7379 9331 gene locus_tag LOCUS_16340 gene thrS 7379 9331 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_16340 9331 9846 gene locus_tag LOCUS_16350 9331 9846 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_16350 10614 10024 gene locus_tag LOCUS_16360 10614 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence086 827 54 gene locus_tag LOCUS_16370 gene narI 827 54 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_16370 1444 824 gene locus_tag LOCUS_16380 1444 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3117 1441 gene locus_tag LOCUS_16390 gene narH 3117 1441 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_16390 6862 3188 gene locus_tag LOCUS_16400 6862 3188 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_16400 7611 6859 gene locus_tag LOCUS_16410 7611 6859 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929996.1 protein_id gnl|my_center|LOCUS_16410 7695 9062 gene locus_tag LOCUS_16420 7695 9062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_16420 9059 10384 gene locus_tag LOCUS_16430 9059 10384 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence087 393 1205 gene locus_tag LOCUS_16440 393 1205 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_16440 1202 1594 gene locus_tag LOCUS_16450 1202 1594 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_16450 1648 2364 gene locus_tag LOCUS_16460 1648 2364 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_16460 2508 2921 gene locus_tag LOCUS_16470 2508 2921 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227025.1 protein_id gnl|my_center|LOCUS_16470 3693 2977 gene locus_tag LOCUS_16480 3693 2977 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876820.1 protein_id gnl|my_center|LOCUS_16480 3760 4845 gene locus_tag LOCUS_16490 3760 4845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229652.1 protein_id gnl|my_center|LOCUS_16490 4848 5672 gene locus_tag LOCUS_16500 4848 5672 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230843.1 protein_id gnl|my_center|LOCUS_16500 5691 6227 gene locus_tag LOCUS_16510 5691 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6877 6248 gene locus_tag LOCUS_16520 6877 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7718 6903 gene locus_tag LOCUS_16530 7718 6903 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_16530 7837 9378 gene locus_tag LOCUS_16540 7837 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10305 9544 gene locus_tag LOCUS_16550 10305 9544 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738376.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence088 262 137 gene locus_tag LOCUS_16560 262 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 289 358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1615 698 gene locus_tag LOCUS_16570 1615 698 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_16570 2124 1612 gene locus_tag LOCUS_16580 2124 1612 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_16580 2599 2111 gene locus_tag LOCUS_16590 2599 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3361 2627 gene locus_tag LOCUS_16600 3361 2627 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_16600 5320 3473 gene locus_tag LOCUS_16610 gene glmS 5320 3473 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_16610 6403 5408 gene locus_tag LOCUS_16620 6403 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6746 6387 gene locus_tag LOCUS_16630 6746 6387 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327415.1 protein_id gnl|my_center|LOCUS_16630 8129 6795 gene locus_tag LOCUS_16640 gene glmM 8129 6795 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_16640 8583 8140 gene locus_tag LOCUS_16650 gene rpsI 8583 8140 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_16650 9046 8603 gene locus_tag LOCUS_16660 gene rplM 9046 8603 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_16660 10183 9254 gene locus_tag LOCUS_16670 gene arcC 10183 9254 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967361.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence089 <1 999 gene locus_tag LOCUS_16680 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974477.1:cytochrome c biogenesis protein CcdA 1044 2519 gene locus_tag LOCUS_16690 1044 2519 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_16690 2507 3427 gene locus_tag LOCUS_16700 2507 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 3671 3429 gene locus_tag LOCUS_16710 3671 3429 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776417.1 protein_id gnl|my_center|LOCUS_16710 3895 4215 gene locus_tag LOCUS_16720 3895 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 5058 4171 gene locus_tag LOCUS_16730 5058 4171 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402865.1 protein_id gnl|my_center|LOCUS_16730 6013 5042 gene locus_tag LOCUS_16740 gene menE 6013 5042 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_16740 6144 7064 gene locus_tag LOCUS_16750 gene menB 6144 7064 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963885.1 protein_id gnl|my_center|LOCUS_16750 7061 7981 gene locus_tag LOCUS_16760 7061 7981 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_16760 8080 8424 gene locus_tag LOCUS_16770 8080 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8434 9525 gene locus_tag LOCUS_16780 gene msiK 8434 9525 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence090 731 153 gene locus_tag LOCUS_16790 731 153 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 protein_id gnl|my_center|LOCUS_16790 2168 762 gene locus_tag LOCUS_16800 2168 762 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_16800 3085 2204 gene locus_tag LOCUS_16810 3085 2204 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224041.1 protein_id gnl|my_center|LOCUS_16810 4056 3082 gene locus_tag LOCUS_16820 4056 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4373 4098 gene locus_tag LOCUS_16830 4373 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5883 4510 gene locus_tag LOCUS_16840 5883 4510 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_16840 7788 6166 gene locus_tag LOCUS_16850 7788 6166 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence091 1086 286 gene locus_tag LOCUS_16860 1086 286 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_16860 1661 1095 gene locus_tag LOCUS_16870 gene pth 1661 1095 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_16870 2257 1673 gene locus_tag LOCUS_16880 2257 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3454 2453 gene locus_tag LOCUS_16890 3454 2453 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_16890 4934 3501 gene locus_tag LOCUS_16900 gene glmU 4934 3501 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929929.1 protein_id gnl|my_center|LOCUS_16900 5233 6666 gene locus_tag LOCUS_16910 5233 6666 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970144.1 protein_id gnl|my_center|LOCUS_16910 8824 6674 gene locus_tag LOCUS_16920 8824 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 8966 8892 gene locus_tag LOCUS_t00200 8966 8892 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9926 9006 gene locus_tag LOCUS_16930 9926 9006 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence092 1247 153 gene locus_tag LOCUS_16940 1247 153 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_16940 2272 1244 gene locus_tag LOCUS_16950 2272 1244 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_16950 2426 2665 gene locus_tag LOCUS_16960 2426 2665 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_16960 2669 4021 gene locus_tag LOCUS_16970 2669 4021 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_16970 4022 5380 gene locus_tag LOCUS_16980 4022 5380 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_16980 5384 6148 gene locus_tag LOCUS_16990 5384 6148 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_16990 7001 6315 gene locus_tag LOCUS_17000 7001 6315 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_17000 7168 8877 gene locus_tag LOCUS_17010 gene leuA 7168 8877 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence093 273 361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 466 780 gene locus_tag LOCUS_17020 466 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1085 1414 gene locus_tag LOCUS_17030 1085 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 1414 2220 gene locus_tag LOCUS_17040 1414 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2364 2525 gene locus_tag LOCUS_17050 2364 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2531 2821 gene locus_tag LOCUS_17060 2531 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2920 3357 gene locus_tag LOCUS_17070 2920 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3347 4924 gene locus_tag LOCUS_17080 3347 4924 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 protein_id gnl|my_center|LOCUS_17080 4937 5074 gene locus_tag LOCUS_17090 4937 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5071 6219 gene locus_tag LOCUS_17100 5071 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 6216 6878 gene locus_tag LOCUS_17110 6216 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6912 8387 gene locus_tag LOCUS_17120 6912 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 8472 8654 gene locus_tag LOCUS_17130 8472 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 8647 9054 gene locus_tag LOCUS_17140 8647 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence094 1137 166 gene locus_tag LOCUS_17150 gene nusA 1137 166 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_17150 1601 1137 gene locus_tag LOCUS_17160 gene rimP 1601 1137 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_17160 1654 2094 gene locus_tag LOCUS_17170 1654 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2091 2510 gene locus_tag LOCUS_17180 2091 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2531 3628 gene locus_tag LOCUS_17190 2531 3628 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_17190 5364 3625 gene locus_tag LOCUS_17200 5364 3625 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_17200 5439 8036 gene locus_tag LOCUS_17210 5439 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 8950 8117 gene locus_tag LOCUS_17220 8950 8117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_17220 <9829 8947 gene locus_tag LOCUS_17230 <9829 8947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973330.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence095 914 2731 gene locus_tag LOCUS_17240 914 2731 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_17240 2728 4890 gene locus_tag LOCUS_17250 gene scpA 2728 4890 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_17250 4887 5873 gene locus_tag LOCUS_17260 gene meaB 4887 5873 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_17260 6033 6863 gene locus_tag LOCUS_17270 6033 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 6924 8099 gene locus_tag LOCUS_17280 6924 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 8109 8615 gene locus_tag LOCUS_17290 8109 8615 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_17290 8620 9798 gene locus_tag LOCUS_17300 8620 9798 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896009.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence096 498 1712 gene locus_tag LOCUS_17310 498 1712 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731196.1 protein_id gnl|my_center|LOCUS_17310 1709 3052 gene locus_tag LOCUS_17320 gene gabT 1709 3052 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_17320 3049 4488 gene locus_tag LOCUS_17330 3049 4488 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_17330 4578 5993 gene locus_tag LOCUS_17340 4578 5993 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_17340 6093 6449 gene locus_tag LOCUS_17350 6093 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7553 6453 gene locus_tag LOCUS_17360 7553 6453 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296635.1 protein_id gnl|my_center|LOCUS_17360 8354 7767 gene locus_tag LOCUS_17370 8354 7767 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582781.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence097 <1 786 gene locus_tag LOCUS_17380 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038535503.1:Gfo/Idh/MocA family oxidoreductase 265 283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 846 1625 gene locus_tag LOCUS_17390 846 1625 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_17390 1642 2205 gene locus_tag LOCUS_17400 1642 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3626 2202 gene locus_tag LOCUS_17410 3626 2202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_17410 3724 4752 gene locus_tag LOCUS_17420 3724 4752 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549222.1 protein_id gnl|my_center|LOCUS_17420 4847 4680 gene locus_tag LOCUS_17430 4847 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5625 4957 gene locus_tag LOCUS_17440 5625 4957 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_17440 5676 6554 gene locus_tag LOCUS_17450 5676 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 6573 8960 gene locus_tag LOCUS_17460 6573 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 8971 9378 gene locus_tag LOCUS_17470 8971 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17470 9365 9374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 <1 783 gene locus_tag LOCUS_17480 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109491.1:FGGY-family carbohydrate kinase 1475 768 gene locus_tag LOCUS_17490 1475 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1718 1530 gene locus_tag LOCUS_17500 1718 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1934 1752 gene locus_tag LOCUS_17510 1934 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1986 2447 gene locus_tag LOCUS_17520 1986 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 2947 2405 gene locus_tag LOCUS_17530 2947 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4166 2976 gene locus_tag LOCUS_17540 4166 2976 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899255.1 protein_id gnl|my_center|LOCUS_17540 4194 5225 gene locus_tag LOCUS_17550 4194 5225 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_17550 5328 6968 gene locus_tag LOCUS_17560 5328 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7459 6977 gene locus_tag LOCUS_17570 7459 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 7824 9488 gene locus_tag LOCUS_17580 gene glpD 7824 9488 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226258.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence099 224 1687 gene locus_tag LOCUS_17590 224 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1669 2637 gene locus_tag LOCUS_17600 1669 2637 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869937.1 protein_id gnl|my_center|LOCUS_17600 3545 2745 gene locus_tag LOCUS_17610 3545 2745 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066638520.1 protein_id gnl|my_center|LOCUS_17610 3896 4864 gene locus_tag LOCUS_17620 3896 4864 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_17620 4882 7116 gene locus_tag LOCUS_17630 4882 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 7696 7124 gene locus_tag LOCUS_17640 7696 7124 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_17640 7984 7700 gene locus_tag LOCUS_17650 7984 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8945 7905 gene locus_tag LOCUS_17660 8945 7905 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_17660 9124 9486 gene locus_tag LOCUS_17670 9124 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence100 723 136 gene locus_tag LOCUS_17680 723 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 795 2561 gene locus_tag LOCUS_17690 795 2561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030802.1 protein_id gnl|my_center|LOCUS_17690 2649 3689 gene locus_tag LOCUS_17700 2649 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3747 3905 gene locus_tag LOCUS_17710 3747 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 5380 3971 gene locus_tag LOCUS_17720 5380 3971 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_17720 5917 5447 gene locus_tag LOCUS_17730 5917 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 6051 6983 gene locus_tag LOCUS_17740 6051 6983 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_17740 6980 7672 gene locus_tag LOCUS_17750 6980 7672 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_17750 7908 7663 gene locus_tag LOCUS_17760 7908 7663 CDS product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414489.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence101 1391 78 gene locus_tag LOCUS_17770 1391 78 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_17770 2305 1388 gene locus_tag LOCUS_17780 gene fmt 2305 1388 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_17780 2841 2302 gene locus_tag LOCUS_17790 gene def 2841 2302 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_17790 4773 2932 gene locus_tag LOCUS_17800 4773 2932 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_17800 5963 4773 gene locus_tag LOCUS_17810 gene metK 5963 4773 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_17810 7404 6178 gene locus_tag LOCUS_17820 7404 6178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226215.1 protein_id gnl|my_center|LOCUS_17820 8647 7463 gene locus_tag LOCUS_17830 gene coaBC 8647 7463 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_17830 9099 8668 gene locus_tag LOCUS_17840 9099 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 9157 9172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence102 353 700 gene locus_tag LOCUS_17850 353 700 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_17850 697 1680 gene locus_tag LOCUS_17860 697 1680 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_17860 1677 2135 gene locus_tag LOCUS_17870 gene ybeY 1677 2135 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_17870 2135 3430 gene locus_tag LOCUS_17880 2135 3430 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_17880 3420 3740 gene locus_tag LOCUS_17890 3420 3740 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_17890 3737 4645 gene locus_tag LOCUS_17900 gene era 3737 4645 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_17900 5752 4625 gene locus_tag LOCUS_17910 5752 4625 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_17910 5810 6595 gene locus_tag LOCUS_17920 gene recO 5810 6595 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060357.1 protein_id gnl|my_center|LOCUS_17920 6592 7356 gene locus_tag LOCUS_17930 6592 7356 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_17930 8212 7358 gene locus_tag LOCUS_17940 8212 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8520 8209 gene locus_tag LOCUS_17950 8520 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence103 303 719 gene locus_tag LOCUS_17960 303 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 723 914 gene locus_tag LOCUS_17970 723 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1063 1338 gene locus_tag LOCUS_17980 1063 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1335 1646 gene locus_tag LOCUS_17990 1335 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2393 1785 gene locus_tag LOCUS_18000 2393 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3736 2390 gene locus_tag LOCUS_18010 3736 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4130 3870 gene locus_tag LOCUS_18020 4130 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4945 4127 gene locus_tag LOCUS_18030 4945 4127 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_18030 5951 5664 gene locus_tag LOCUS_18040 5951 5664 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_18040 6166 5948 gene locus_tag LOCUS_18050 6166 5948 CDS product TraY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390943.1 protein_id gnl|my_center|LOCUS_18050 6803 6228 gene locus_tag LOCUS_18060 6803 6228 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_18060 7237 7770 gene locus_tag LOCUS_18070 7237 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 8982 8113 gene locus_tag LOCUS_18080 8982 8113 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence104 64 1305 gene locus_tag LOCUS_18090 gene dinB 64 1305 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_18090 1401 1805 gene locus_tag LOCUS_18100 1401 1805 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_18100 1863 4244 gene locus_tag LOCUS_18110 1863 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4270 4812 gene locus_tag LOCUS_18120 gene mraZ 4270 4812 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_18120 4952 5908 gene locus_tag LOCUS_18130 gene rsmH 4952 5908 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_18130 5905 6495 gene locus_tag LOCUS_18140 5905 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6524 8329 gene locus_tag LOCUS_18150 gene ftsI 6524 8329 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence105 2106 1618 gene locus_tag LOCUS_18160 2106 1618 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_18160 2303 2752 gene locus_tag LOCUS_18170 2303 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3506 2757 gene locus_tag LOCUS_18180 3506 2757 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_18180 6064 3503 gene locus_tag LOCUS_18190 6064 3503 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_18190 7256 6327 gene locus_tag LOCUS_18200 7256 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7664 8161 gene locus_tag LOCUS_18210 7664 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence106 945 199 gene locus_tag LOCUS_18220 945 199 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_18220 1649 942 gene locus_tag LOCUS_18230 gene pgeF 1649 942 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173521163.1 protein_id gnl|my_center|LOCUS_18230 2854 1646 gene locus_tag LOCUS_18240 gene ftsZ 2854 1646 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_18240 2483 2574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3455 3123 gene locus_tag LOCUS_18250 3455 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3579 5078 gene locus_tag LOCUS_18260 3579 5078 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 protein_id gnl|my_center|LOCUS_18260 5942 5082 gene locus_tag LOCUS_18270 5942 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6760 5939 gene locus_tag LOCUS_18280 6760 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 7350 6757 gene locus_tag LOCUS_18290 7350 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18290 8390 7347 gene locus_tag LOCUS_18300 gene murG 8390 7347 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_18300 <9120 8438 gene locus_tag LOCUS_18310 <9120 8438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976730.1:putative lipid II flippase FtsW >Feature sequence107 234 322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1108 767 gene locus_tag LOCUS_18320 1108 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2156 1101 gene locus_tag LOCUS_18330 2156 1101 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620874.1 protein_id gnl|my_center|LOCUS_18330 3166 2156 gene locus_tag LOCUS_18340 3166 2156 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620877.1 protein_id gnl|my_center|LOCUS_18340 4593 3163 gene locus_tag LOCUS_18350 4593 3163 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108522916.1 protein_id gnl|my_center|LOCUS_18350 4934 4590 gene locus_tag LOCUS_18360 4934 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5063 5746 gene locus_tag LOCUS_18370 5063 5746 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_18370 5743 6219 gene locus_tag LOCUS_18380 gene fhaB 5743 6219 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_18380 6224 7486 gene locus_tag LOCUS_18390 6224 7486 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_18390 7483 8856 gene locus_tag LOCUS_18400 7483 8856 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence108 1061 2140 gene locus_tag LOCUS_18410 1061 2140 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226295.1 protein_id gnl|my_center|LOCUS_18410 2163 2648 gene locus_tag LOCUS_18420 2163 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2648 2896 gene locus_tag LOCUS_18430 2648 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2901 3320 gene locus_tag LOCUS_18440 2901 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3254 4201 gene locus_tag LOCUS_18450 3254 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18450 4446 5801 gene locus_tag LOCUS_18460 4446 5801 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121857.1 protein_id gnl|my_center|LOCUS_18460 5801 7039 gene locus_tag LOCUS_18470 5801 7039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_18470 7964 7179 gene locus_tag LOCUS_18480 7964 7179 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence109 285 1010 gene locus_tag LOCUS_18490 285 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2179 1007 gene locus_tag LOCUS_18500 2179 1007 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_18500 2633 2190 gene locus_tag LOCUS_18510 2633 2190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888981.1 protein_id gnl|my_center|LOCUS_18510 2745 3416 gene locus_tag LOCUS_18520 2745 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3564 5048 gene locus_tag LOCUS_18530 3564 5048 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_18530 5143 5538 gene locus_tag LOCUS_18540 5143 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 5763 5527 gene locus_tag LOCUS_18550 5763 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8328 5941 gene locus_tag LOCUS_18560 8328 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence110 329 1828 gene locus_tag LOCUS_18570 329 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_18570 1869 3959 gene locus_tag LOCUS_18580 1869 3959 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228662.1 protein_id gnl|my_center|LOCUS_18580 4037 4588 gene locus_tag LOCUS_18590 4037 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4599 5438 gene locus_tag LOCUS_18600 4599 5438 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869103.1 protein_id gnl|my_center|LOCUS_18600 5496 5690 gene locus_tag LOCUS_18610 5496 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5744 7504 gene locus_tag LOCUS_18620 5744 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7514 8428 gene locus_tag LOCUS_18630 7514 8428 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_18630 <8978 8450 gene locus_tag LOCUS_18640 <8978 8450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880955.1:GspE/PulE family protein >Feature sequence111 3313 215 gene locus_tag LOCUS_18650 gene ileS 3313 215 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_18650 3368 3682 gene locus_tag LOCUS_18660 3368 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 3728 4234 gene locus_tag LOCUS_18670 gene lspA 3728 4234 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082236.1 protein_id gnl|my_center|LOCUS_18670 4231 5142 gene locus_tag LOCUS_18680 4231 5142 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence112 948 355 gene locus_tag LOCUS_18690 gene sigM 948 355 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_18690 2326 953 gene locus_tag LOCUS_18700 2326 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4144 2459 gene locus_tag LOCUS_18710 4144 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 6165 4141 gene locus_tag LOCUS_18720 6165 4141 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_18720 6710 6165 gene locus_tag LOCUS_18730 6710 6165 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_18730 6779 8215 gene locus_tag LOCUS_18740 6779 8215 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_18740 <8940 8212 gene locus_tag LOCUS_18750 <8940 8212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087403.1:MFS transporter >Feature sequence113 233 1528 gene locus_tag LOCUS_18760 233 1528 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_18760 3112 1508 gene locus_tag LOCUS_18770 3112 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3845 3135 gene locus_tag LOCUS_18780 3845 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4710 3742 gene locus_tag LOCUS_18790 4710 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3859 3868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4790 6457 gene locus_tag LOCUS_18800 4790 6457 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_18800 7046 6474 gene locus_tag LOCUS_18810 7046 6474 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_18810 7254 8177 gene locus_tag LOCUS_18820 7254 8177 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_18820 8876 8178 gene locus_tag LOCUS_18830 8876 8178 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence114 111 785 gene locus_tag LOCUS_18840 gene trmB 111 785 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446655.1 protein_id gnl|my_center|LOCUS_18840 782 1534 gene locus_tag LOCUS_18850 782 1534 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_18850 1525 2097 gene locus_tag LOCUS_18860 1525 2097 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230724.1 protein_id gnl|my_center|LOCUS_18860 2094 2927 gene locus_tag LOCUS_18870 2094 2927 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230725.1 protein_id gnl|my_center|LOCUS_18870 2937 3875 gene locus_tag LOCUS_18880 2937 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3956 5353 gene locus_tag LOCUS_18890 3956 5353 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229720.1 protein_id gnl|my_center|LOCUS_18890 6209 5355 gene locus_tag LOCUS_18900 6209 5355 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_18900 6572 6390 gene locus_tag LOCUS_18910 6572 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 6788 8506 gene locus_tag LOCUS_18920 6788 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence115 1618 467 gene locus_tag LOCUS_18930 gene dxr 1618 467 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_18930 2713 1619 gene locus_tag LOCUS_18940 gene rlmN 2713 1619 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076798.1 protein_id gnl|my_center|LOCUS_18940 2883 2710 gene locus_tag LOCUS_18950 2883 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2896 2963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4201 3644 gene locus_tag LOCUS_18960 gene frr 4201 3644 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_18960 4373 5284 gene locus_tag LOCUS_18970 4373 5284 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_18970 5538 6026 gene locus_tag LOCUS_18980 5538 6026 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_18980 6023 7009 gene locus_tag LOCUS_18990 6023 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 7023 7928 gene locus_tag LOCUS_19000 7023 7928 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence116 2357 927 gene locus_tag LOCUS_19010 2357 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2537 4000 gene locus_tag LOCUS_19020 2537 4000 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_19020 4706 4053 gene locus_tag LOCUS_19030 4706 4053 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_19030 5368 4703 gene locus_tag LOCUS_19040 5368 4703 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_19040 5424 7403 gene locus_tag LOCUS_19050 5424 7403 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_19050 7407 8567 gene locus_tag LOCUS_19060 7407 8567 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence117 951 766 gene locus_tag LOCUS_19070 951 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1545 2477 gene locus_tag LOCUS_19080 1545 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3631 2522 gene locus_tag LOCUS_19090 3631 2522 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_19090 4794 3631 gene locus_tag LOCUS_19100 4794 3631 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229157.1 protein_id gnl|my_center|LOCUS_19100 6328 4808 gene locus_tag LOCUS_19110 6328 4808 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730933.1 protein_id gnl|my_center|LOCUS_19110 7697 6360 gene locus_tag LOCUS_19120 7697 6360 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_19120 <8666 7694 gene locus_tag LOCUS_19130 <8666 7694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484340.1:alginate lyase family protein >Feature sequence118 <1 623 gene locus_tag LOCUS_19140 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081766.1:bifunctional riboflavin kinase/FAD synthetase 672 2060 gene locus_tag LOCUS_19150 672 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2854 2063 gene locus_tag LOCUS_19160 2854 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2817 2987 gene locus_tag LOCUS_19170 2817 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4535 3003 gene locus_tag LOCUS_19180 4535 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4614 6764 gene locus_tag LOCUS_19190 4614 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 8378 6768 gene locus_tag LOCUS_19200 8378 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence119 34 270 gene locus_tag LOCUS_19210 34 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 971 273 gene locus_tag LOCUS_19220 gene priA 971 273 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_19220 1546 1136 gene locus_tag LOCUS_19230 gene arfB 1546 1136 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_19230 2042 1539 gene locus_tag LOCUS_19240 2042 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4099 2075 gene locus_tag LOCUS_19250 4099 2075 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398395.1 protein_id gnl|my_center|LOCUS_19250 4191 4682 gene locus_tag LOCUS_19260 4191 4682 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112179.1 protein_id gnl|my_center|LOCUS_19260 4706 5902 gene locus_tag LOCUS_19270 gene serA 4706 5902 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_19270 5931 6167 gene locus_tag LOCUS_19280 5931 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6164 6571 gene locus_tag LOCUS_19290 gene vapC4 6164 6571 CDS product type II toxin-antitoxin system toxin ribonuclease C4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403122.1 protein_id gnl|my_center|LOCUS_19290 7238 6546 gene locus_tag LOCUS_19300 7238 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence120 <1 685 gene locus_tag LOCUS_19310 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034285284.1:dipeptidase 708 1316 gene locus_tag LOCUS_19320 708 1316 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415007.1 protein_id gnl|my_center|LOCUS_19320 1354 1803 gene locus_tag LOCUS_19330 1354 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1820 2296 gene locus_tag LOCUS_19340 1820 2296 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_19340 3624 2293 gene locus_tag LOCUS_19350 3624 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4687 3581 gene locus_tag LOCUS_19360 4687 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5383 4697 gene locus_tag LOCUS_19370 5383 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6294 5329 gene locus_tag LOCUS_19380 6294 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5555 5564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7560 6607 gene locus_tag LOCUS_19390 7560 6607 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_19390 8358 7576 gene locus_tag LOCUS_19400 8358 7576 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence121 <1 628 gene locus_tag LOCUS_19410 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110594.1:acyl-CoA dehydrogenase family protein 978 1535 gene locus_tag LOCUS_19420 978 1535 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110615.1 protein_id gnl|my_center|LOCUS_19420 2013 1546 gene locus_tag LOCUS_19430 2013 1546 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_19430 2819 2019 gene locus_tag LOCUS_19440 2819 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110620.1 protein_id gnl|my_center|LOCUS_19440 3074 3418 gene locus_tag LOCUS_19450 3074 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114273.1 protein_id gnl|my_center|LOCUS_19450 3523 4968 gene locus_tag LOCUS_19460 3523 4968 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_19460 5030 6451 gene locus_tag LOCUS_19470 5030 6451 CDS product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110629.1 protein_id gnl|my_center|LOCUS_19470 6638 8284 gene locus_tag LOCUS_19480 6638 8284 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296512.1 protein_id gnl|my_center|LOCUS_19480 8351 8265 gene locus_tag LOCUS_t00210 8351 8265 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 451 918 gene locus_tag LOCUS_19490 451 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1675 920 gene locus_tag LOCUS_19500 1675 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2734 1721 gene locus_tag LOCUS_19510 2734 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3213 2872 gene locus_tag LOCUS_19520 3213 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3998 3213 gene locus_tag LOCUS_19530 3998 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4711 3995 gene locus_tag LOCUS_19540 4711 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 7048 4784 gene locus_tag LOCUS_19550 7048 4784 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728362.1 protein_id gnl|my_center|LOCUS_19550 6956 7222 gene locus_tag LOCUS_19560 6956 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 7233 8264 gene locus_tag LOCUS_19570 7233 8264 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence123 294 1544 gene locus_tag LOCUS_19580 294 1544 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111120.1 protein_id gnl|my_center|LOCUS_19580 1607 2818 gene locus_tag LOCUS_19590 1607 2818 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_19590 2871 3482 gene locus_tag LOCUS_19600 2871 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 4798 3647 gene locus_tag LOCUS_19610 4798 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5586 4798 gene locus_tag LOCUS_19620 5586 4798 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_19620 5789 5592 gene locus_tag LOCUS_19630 5789 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 6879 5779 gene locus_tag LOCUS_19640 6879 5779 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_19640 7840 6881 gene locus_tag LOCUS_19650 7840 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7950 7963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence124 126 851 gene locus_tag LOCUS_19660 gene budA 126 851 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068896.1 protein_id gnl|my_center|LOCUS_19660 991 848 gene locus_tag LOCUS_19670 991 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1862 1014 gene locus_tag LOCUS_19680 1862 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1999 2508 gene locus_tag LOCUS_19690 1999 2508 CDS product glycine cleavage system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775899.1 protein_id gnl|my_center|LOCUS_19690 2606 3715 gene locus_tag LOCUS_19700 2606 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4041 4856 gene locus_tag LOCUS_19710 4041 4856 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_19710 4849 5997 gene locus_tag LOCUS_19720 4849 5997 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_19720 6220 5984 gene locus_tag LOCUS_19730 6220 5984 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_19730 7282 6230 gene locus_tag LOCUS_19740 7282 6230 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_19740 7533 7279 gene locus_tag LOCUS_19750 7533 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence125 <1 605 gene locus_tag LOCUS_19760 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225923.1:phytoene/squalene synthase family protein 1018 629 gene locus_tag LOCUS_19770 1018 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1329 1015 gene locus_tag LOCUS_19780 1329 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1802 1326 gene locus_tag LOCUS_19790 1802 1326 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 protein_id gnl|my_center|LOCUS_19790 1886 3805 gene locus_tag LOCUS_19800 gene pknB 1886 3805 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_19800 5164 3818 gene locus_tag LOCUS_19810 5164 3818 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_19810 6163 5444 gene locus_tag LOCUS_19820 6163 5444 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_19820 6584 6958 gene locus_tag LOCUS_19830 6584 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence126 2831 1248 gene locus_tag LOCUS_19840 2831 1248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 protein_id gnl|my_center|LOCUS_19840 3790 2849 gene locus_tag LOCUS_19850 3790 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4502 3852 gene locus_tag LOCUS_19860 4502 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5040 4534 gene locus_tag LOCUS_19870 5040 4534 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 protein_id gnl|my_center|LOCUS_19870 5122 5517 gene locus_tag LOCUS_19880 5122 5517 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 protein_id gnl|my_center|LOCUS_19880 5750 5484 gene locus_tag LOCUS_19890 5750 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 6712 5747 gene locus_tag LOCUS_19900 6712 5747 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_19900 7175 6726 gene locus_tag LOCUS_19910 7175 6726 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence127 <1 693 gene locus_tag LOCUS_19920 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204925.1:class I SAM-dependent DNA methyltransferase 665 2110 gene locus_tag LOCUS_19930 665 2110 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731434.1 protein_id gnl|my_center|LOCUS_19930 2107 3882 gene locus_tag LOCUS_19940 2107 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3879 5729 gene locus_tag LOCUS_19950 3879 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5722 6135 gene locus_tag LOCUS_19960 5722 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7391 7420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence128 3499 2477 gene locus_tag LOCUS_19970 3499 2477 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 protein_id gnl|my_center|LOCUS_19970 3626 3699 gene locus_tag LOCUS_t00220 3626 3699 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3913 3746 gene locus_tag LOCUS_19980 3913 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 4325 3930 gene locus_tag LOCUS_19990 4325 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 5610 4417 gene locus_tag LOCUS_20000 5610 4417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_20000 6911 5634 gene locus_tag LOCUS_20010 6911 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 7380 6922 gene locus_tag LOCUS_20020 7380 6922 CDS product YvaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080905.1 protein_id gnl|my_center|LOCUS_20020 7703 7380 gene locus_tag LOCUS_20030 7703 7380 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160972.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence129 1449 1826 gene locus_tag LOCUS_20040 1449 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 1823 2224 gene locus_tag LOCUS_20050 1823 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2215 2499 gene locus_tag LOCUS_20060 2215 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 3158 2667 gene locus_tag LOCUS_20070 3158 2667 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_20070 3201 3286 gene locus_tag LOCUS_t00230 3201 3286 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5578 3287 gene locus_tag LOCUS_20080 5578 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5656 5729 gene locus_tag LOCUS_t00240 5656 5729 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5753 5827 gene locus_tag LOCUS_t00250 5753 5827 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5852 6016 gene locus_tag LOCUS_20090 gene rpmG 5852 6016 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_20090 6103 6552 gene locus_tag LOCUS_20100 6103 6552 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_20100 6549 6944 gene locus_tag LOCUS_20110 6549 6944 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence130 108 566 gene locus_tag LOCUS_20120 108 566 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_20120 563 1507 gene locus_tag LOCUS_20130 563 1507 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479910.1 protein_id gnl|my_center|LOCUS_20130 1683 2576 gene locus_tag LOCUS_20140 1683 2576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_20140 2570 3319 gene locus_tag LOCUS_20150 2570 3319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_20150 3404 4321 gene locus_tag LOCUS_20160 3404 4321 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929933.1 protein_id gnl|my_center|LOCUS_20160 5138 4275 gene locus_tag LOCUS_20170 5138 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_20170 6049 5138 gene locus_tag LOCUS_20180 6049 5138 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence131 320 1594 gene locus_tag LOCUS_20190 320 1594 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_20190 1621 1779 gene locus_tag LOCUS_20200 1621 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1783 2364 gene locus_tag LOCUS_20210 gene nadD 1783 2364 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_20210 2364 3500 gene locus_tag LOCUS_20220 2364 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3505 3855 gene locus_tag LOCUS_20230 3505 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3848 4498 gene locus_tag LOCUS_20240 3848 4498 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_20240 5084 4641 gene locus_tag LOCUS_20250 5084 4641 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_20250 5191 5264 gene locus_tag LOCUS_t00260 5191 5264 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5330 6043 gene locus_tag LOCUS_20260 5330 6043 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228467.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence132 378 398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1139 738 gene locus_tag LOCUS_20270 1139 738 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_20270 1645 1136 gene locus_tag LOCUS_20280 1645 1136 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_20280 2198 1854 gene locus_tag LOCUS_20290 2198 1854 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_20290 2685 2200 gene locus_tag LOCUS_20300 2685 2200 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_20300 2823 3242 gene locus_tag LOCUS_20310 2823 3242 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_20310 3316 4014 gene locus_tag LOCUS_20320 gene glnR 3316 4014 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_20320 4011 4910 gene locus_tag LOCUS_20330 gene mshD 4011 4910 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_20330 4968 7064 gene locus_tag LOCUS_20340 4968 7064 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_20340 7227 7295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence133 368 2116 gene locus_tag LOCUS_20350 gene fadD 368 2116 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_20350 2113 3006 gene locus_tag LOCUS_20360 2113 3006 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_20360 4416 3010 gene locus_tag LOCUS_20370 4416 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5831 4416 gene locus_tag LOCUS_20380 5831 4416 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196368.1 protein_id gnl|my_center|LOCUS_20380 5888 6988 gene locus_tag LOCUS_20390 5888 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence134 821 2185 gene locus_tag LOCUS_20400 821 2185 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_20400 3334 2189 gene locus_tag LOCUS_20410 3334 2189 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_20410 3408 3947 gene locus_tag LOCUS_20420 3408 3947 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_20420 4569 4084 gene locus_tag LOCUS_20430 4569 4084 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_20430 5066 4566 gene locus_tag LOCUS_20440 gene purE 5066 4566 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_20440 6210 5059 gene locus_tag LOCUS_20450 6210 5059 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_20450 6850 6203 gene locus_tag LOCUS_20460 6850 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20460 >Feature sequence135 <1 504 gene locus_tag LOCUS_20470 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027833.1:HIT domain-containing protein 1627 755 gene locus_tag LOCUS_20480 1627 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 1683 2285 gene locus_tag LOCUS_20490 1683 2285 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_20490 2282 3211 gene locus_tag LOCUS_20500 2282 3211 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_20500 3208 4383 gene locus_tag LOCUS_20510 3208 4383 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_20510 4383 4940 gene locus_tag LOCUS_20520 4383 4940 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_20520 4991 5887 gene locus_tag LOCUS_20530 gene pdxS 4991 5887 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_20530 5884 6486 gene locus_tag LOCUS_20540 gene pdxT 5884 6486 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_20540 6483 7205 gene locus_tag LOCUS_20550 6483 7205 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence136 240 509 gene locus_tag LOCUS_20560 240 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 1142 408 gene locus_tag LOCUS_20570 1142 408 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111515.1 protein_id gnl|my_center|LOCUS_20570 1549 1139 gene locus_tag LOCUS_20580 1549 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1794 2447 gene locus_tag LOCUS_20590 1794 2447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894151.1 protein_id gnl|my_center|LOCUS_20590 3203 2451 gene locus_tag LOCUS_20600 3203 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3698 3252 gene locus_tag LOCUS_20610 gene dut 3698 3252 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_20610 4282 3695 gene locus_tag LOCUS_20620 4282 3695 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_20620 4340 4771 gene locus_tag LOCUS_20630 4340 4771 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728565.1 protein_id gnl|my_center|LOCUS_20630 4838 5089 gene locus_tag LOCUS_20640 4838 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5382 5086 gene locus_tag LOCUS_20650 5382 5086 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_20650 5541 6059 gene locus_tag LOCUS_20660 5541 6059 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_20660 <7116 6065 gene locus_tag LOCUS_20670 <7116 6065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976789.1:VIT1/CCC1 transporter family protein >Feature sequence137 <1 641 gene locus_tag LOCUS_20680 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003415922.1:class I SAM-dependent methyltransferase 638 2077 gene locus_tag LOCUS_20690 638 2077 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223546.1 protein_id gnl|my_center|LOCUS_20690 2077 3273 gene locus_tag LOCUS_20700 2077 3273 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 protein_id gnl|my_center|LOCUS_20700 3570 3286 gene locus_tag LOCUS_20710 3570 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5053 3584 gene locus_tag LOCUS_20720 5053 3584 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_20720 5825 5124 gene locus_tag LOCUS_20730 5825 5124 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_20730 6757 5822 gene locus_tag LOCUS_20740 6757 5822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_20740 6910 6761 gene locus_tag LOCUS_20750 6910 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence138 1682 609 gene locus_tag LOCUS_20760 1682 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1781 3403 gene locus_tag LOCUS_20770 1781 3403 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_20770 4266 3532 gene locus_tag LOCUS_20780 4266 3532 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_20780 5135 4263 gene locus_tag LOCUS_20790 5135 4263 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053659.1 protein_id gnl|my_center|LOCUS_20790 6008 5139 gene locus_tag LOCUS_20800 6008 5139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_20800 <6859 6058 gene locus_tag LOCUS_20810 <6859 6058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943149.1:EAL domain-containing protein >Feature sequence139 1853 1170 gene locus_tag LOCUS_20820 1853 1170 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391990.1 protein_id gnl|my_center|LOCUS_20820 2544 1825 gene locus_tag LOCUS_20830 2544 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 2614 4383 gene locus_tag LOCUS_20840 2614 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296325.1 protein_id gnl|my_center|LOCUS_20840 4393 4983 gene locus_tag LOCUS_20850 4393 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 5358 4987 gene locus_tag LOCUS_20860 5358 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6435 5377 gene locus_tag LOCUS_20870 6435 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence140 164 424 gene locus_tag LOCUS_20880 gene whiB1 164 424 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_20880 1922 474 gene locus_tag LOCUS_20890 1922 474 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_20890 2144 3445 gene locus_tag LOCUS_20900 gene bioA 2144 3445 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_20900 3442 4569 gene locus_tag LOCUS_20910 3442 4569 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_20910 4566 5276 gene locus_tag LOCUS_20920 gene bioD 4566 5276 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_20920 5273 6280 gene locus_tag LOCUS_20930 gene bioB 5273 6280 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_20930 6477 6503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 <1 741 gene locus_tag LOCUS_20940 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005074864.1:type I glutamate--ammonia ligase 1650 862 gene locus_tag LOCUS_20950 1650 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1904 2344 gene locus_tag LOCUS_20960 1904 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2370 3281 gene locus_tag LOCUS_20970 2370 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20970 3257 3266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3350 3967 gene locus_tag LOCUS_20980 3350 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20980 3964 5565 gene locus_tag LOCUS_20990 3964 5565 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730437.1 protein_id gnl|my_center|LOCUS_20990 <6823 5597 gene locus_tag LOCUS_21000 <6823 5597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144393.1:potassium channel protein >Feature sequence142 2 280 gene locus_tag LOCUS_21010 2 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 336 992 gene locus_tag LOCUS_21020 336 992 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_21020 989 1294 gene locus_tag LOCUS_21030 989 1294 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_21030 1352 2158 gene locus_tag LOCUS_21040 1352 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2187 3101 gene locus_tag LOCUS_21050 2187 3101 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 protein_id gnl|my_center|LOCUS_21050 3094 3915 gene locus_tag LOCUS_21060 gene whiG 3094 3915 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_21060 4328 3921 gene locus_tag LOCUS_21070 4328 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4594 5538 gene locus_tag LOCUS_21080 gene rpsB 4594 5538 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_21080 5538 6371 gene locus_tag LOCUS_21090 gene tsf 5538 6371 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence143 852 109 gene locus_tag LOCUS_21100 852 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1297 863 gene locus_tag LOCUS_21110 1297 863 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_21110 1544 1266 gene locus_tag LOCUS_21120 1544 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2100 1840 gene locus_tag LOCUS_21130 2100 1840 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_21130 4894 2459 gene locus_tag LOCUS_21140 4894 2459 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_21140 3926 3836 gene locus_tag LOCUS_t00270 3926 3836 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4989 5930 gene locus_tag LOCUS_21150 gene cofD 4989 5930 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence144 2206 1133 gene locus_tag LOCUS_21160 2206 1133 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_21160 2535 2209 gene locus_tag LOCUS_21170 2535 2209 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_21170 3113 2640 gene locus_tag LOCUS_21180 3113 2640 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_21180 5019 3124 gene locus_tag LOCUS_21190 5019 3124 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259019.1 protein_id gnl|my_center|LOCUS_21190 6001 5108 gene locus_tag LOCUS_21200 gene mshB 6001 5108 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence145 406 1032 gene locus_tag LOCUS_21210 406 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1053 1433 gene locus_tag LOCUS_21220 1053 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2103 1612 gene locus_tag LOCUS_21230 2103 1612 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_21230 2898 2146 gene locus_tag LOCUS_21240 2898 2146 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_21240 3103 2882 gene locus_tag LOCUS_21250 3103 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21250 3708 3013 gene locus_tag LOCUS_21260 3708 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21260 3150 3164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5296 3698 gene locus_tag LOCUS_21270 5296 3698 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_21270 6099 5293 gene locus_tag LOCUS_21280 gene panC 6099 5293 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_21280 <6733 6096 gene locus_tag LOCUS_21290 <6733 6096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028947.1:DUF2520 domain-containing protein >Feature sequence146 526 227 gene locus_tag LOCUS_21300 526 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1281 523 gene locus_tag LOCUS_21310 1281 523 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 protein_id gnl|my_center|LOCUS_21310 1330 2559 gene locus_tag LOCUS_21320 1330 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3171 2560 gene locus_tag LOCUS_21330 3171 2560 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_21330 3680 3171 gene locus_tag LOCUS_21340 3680 3171 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014135.1 protein_id gnl|my_center|LOCUS_21340 5111 3723 gene locus_tag LOCUS_21350 5111 3723 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_21350 6455 5145 gene locus_tag LOCUS_21360 6455 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence147 738 361 gene locus_tag LOCUS_21370 738 361 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_21370 1486 815 gene locus_tag LOCUS_21380 gene deoC 1486 815 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776136.1 protein_id gnl|my_center|LOCUS_21380 2150 1500 gene locus_tag LOCUS_21390 2150 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2554 2147 gene locus_tag LOCUS_21400 2554 2147 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871555.1 protein_id gnl|my_center|LOCUS_21400 4173 2551 gene locus_tag LOCUS_21410 4173 2551 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_21410 4961 4170 gene locus_tag LOCUS_21420 4961 4170 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_21420 5471 5019 gene locus_tag LOCUS_21430 5471 5019 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_21430 5557 6510 gene locus_tag LOCUS_21440 5557 6510 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027140.1 protein_id gnl|my_center|LOCUS_21440 6363 6372 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence148 308 15 gene locus_tag LOCUS_21450 308 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21450 605 309 gene locus_tag LOCUS_21460 605 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21460 1724 627 gene locus_tag LOCUS_21470 gene yidC 1724 627 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899765.1 protein_id gnl|my_center|LOCUS_21470 1696 1905 gene locus_tag LOCUS_21480 1696 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2327 1971 gene locus_tag LOCUS_21490 gene rnpA 2327 1971 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296830.1 protein_id gnl|my_center|LOCUS_21490 2495 2352 gene locus_tag LOCUS_21500 gene rpmH 2495 2352 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898363.1 protein_id gnl|my_center|LOCUS_21500 3011 4516 gene locus_tag LOCUS_21510 gene dnaA 3011 4516 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950320.1 protein_id gnl|my_center|LOCUS_21510 5002 6201 gene locus_tag LOCUS_21520 gene dnaN 5002 6201 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726602.1 protein_id gnl|my_center|LOCUS_21520 6347 6385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence149 275 300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 343 1005 gene locus_tag LOCUS_21530 343 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21530 1014 1937 gene locus_tag LOCUS_21540 1014 1937 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_21540 2822 1944 gene locus_tag LOCUS_21550 2822 1944 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_21550 3631 2819 gene locus_tag LOCUS_21560 3631 2819 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_21560 4919 3696 gene locus_tag LOCUS_21570 4919 3696 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_21570 5794 4919 gene locus_tag LOCUS_21580 5794 4919 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence150 3568 3891 gene locus_tag LOCUS_21590 3568 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3593 3621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4393 3875 gene locus_tag LOCUS_21600 4393 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 4574 4449 gene locus_tag LOCUS_21610 4574 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 <6553 4735 gene locus_tag LOCUS_21620 <6553 4735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223114.1:bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX >Feature sequence151 361 1755 gene locus_tag LOCUS_21630 gene argH 361 1755 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729312.1 protein_id gnl|my_center|LOCUS_21630 1831 2823 gene locus_tag LOCUS_21640 1831 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2833 3612 gene locus_tag LOCUS_21650 2833 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3609 4868 gene locus_tag LOCUS_21660 gene tyrS 3609 4868 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence152 16 876 gene locus_tag LOCUS_21670 16 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 873 1676 gene locus_tag LOCUS_21680 873 1676 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_21680 1777 3168 gene locus_tag LOCUS_21690 gene lysA 1777 3168 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_21690 3305 4630 gene locus_tag LOCUS_21700 3305 4630 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_21700 4627 5670 gene locus_tag LOCUS_21710 gene thrC 4627 5670 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence153 <1 1401 gene locus_tag LOCUS_21720 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030377.1:FAD-dependent oxidoreductase 1443 2942 gene locus_tag LOCUS_21730 1443 2942 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_21730 3121 4263 gene locus_tag LOCUS_21740 3121 4263 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_21740 4260 5543 gene locus_tag LOCUS_21750 4260 5543 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228178.1 protein_id gnl|my_center|LOCUS_21750 5613 5942 gene locus_tag LOCUS_21760 5613 5942 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_21760 5944 6306 gene locus_tag LOCUS_21770 5944 6306 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379381.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence154 512 1993 gene locus_tag LOCUS_21780 512 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2008 2322 gene locus_tag LOCUS_21790 2008 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3449 2319 gene locus_tag LOCUS_21800 3449 2319 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_21800 3964 3497 gene locus_tag LOCUS_21810 3964 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5198 3957 gene locus_tag LOCUS_21820 5198 3957 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_21820 5284 6054 gene locus_tag LOCUS_21830 5284 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence155 2954 69 gene locus_tag LOCUS_21840 2954 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 4915 3002 gene locus_tag LOCUS_21850 gene dxs 4915 3002 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_21850 5425 5066 gene locus_tag LOCUS_21860 5425 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 <6471 5422 gene locus_tag LOCUS_21870 <6471 5422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805056.1:aconitate hydratase AcnA >Feature sequence156 1159 545 gene locus_tag LOCUS_21880 1159 545 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225289.1 protein_id gnl|my_center|LOCUS_21880 2181 1156 gene locus_tag LOCUS_21890 gene ilvC 2181 1156 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775904.1 protein_id gnl|my_center|LOCUS_21890 3303 2239 gene locus_tag LOCUS_21900 3303 2239 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106297146.1 protein_id gnl|my_center|LOCUS_21900 3824 3303 gene locus_tag LOCUS_21910 gene ilvN 3824 3303 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_21910 5554 3824 gene locus_tag LOCUS_21920 5554 3824 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence157 2088 334 gene locus_tag LOCUS_21930 2088 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3173 2109 gene locus_tag LOCUS_21940 3173 2109 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904572.1 protein_id gnl|my_center|LOCUS_21940 3307 4842 gene locus_tag LOCUS_21950 3307 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4901 5086 gene locus_tag LOCUS_21960 4901 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence158 <1 785 gene locus_tag LOCUS_21970 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230918.1:alpha-E domain-containing protein 785 1639 gene locus_tag LOCUS_21980 785 1639 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230919.1 protein_id gnl|my_center|LOCUS_21980 1662 2558 gene locus_tag LOCUS_21990 1662 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2702 2995 gene locus_tag LOCUS_22000 2702 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3047 4027 gene locus_tag LOCUS_22010 3047 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 5066 4065 gene locus_tag LOCUS_22020 5066 4065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence159 632 240 gene locus_tag LOCUS_22030 632 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 714 3638 gene locus_tag LOCUS_22040 714 3638 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_22040 3750 4712 gene locus_tag LOCUS_22050 3750 4712 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975143.1 protein_id gnl|my_center|LOCUS_22050 5639 4797 gene locus_tag LOCUS_22060 5639 4797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence160 211 71 gene locus_tag LOCUS_22070 211 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22070 273 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3058 641 gene locus_tag LOCUS_22080 3058 641 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_22080 3986 3165 gene locus_tag LOCUS_22090 3986 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 5907 4180 gene locus_tag LOCUS_22100 5907 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5934 6000 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence161 527 2062 gene locus_tag LOCUS_22110 527 2062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_22110 3476 2046 gene locus_tag LOCUS_22120 3476 2046 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_22120 3663 4349 gene locus_tag LOCUS_22130 3663 4349 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258296.1 protein_id gnl|my_center|LOCUS_22130 4414 4950 gene locus_tag LOCUS_22140 4414 4950 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920829.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence162 4 813 gene locus_tag LOCUS_22150 4 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 825 2072 gene locus_tag LOCUS_22160 825 2072 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_22160 2069 4297 gene locus_tag LOCUS_22170 2069 4297 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862490.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence163 1112 627 gene locus_tag LOCUS_22180 1112 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 1558 1175 gene locus_tag LOCUS_22190 gene gcvH 1558 1175 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_22190 2234 1569 gene locus_tag LOCUS_22200 2234 1569 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805150.1 protein_id gnl|my_center|LOCUS_22200 2563 2231 gene locus_tag LOCUS_22210 2563 2231 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_22210 3363 2563 gene locus_tag LOCUS_22220 3363 2563 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805148.1 protein_id gnl|my_center|LOCUS_22220 3944 3360 gene locus_tag LOCUS_22230 3944 3360 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_22230 4640 3954 gene locus_tag LOCUS_22240 4640 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 5644 4664 gene locus_tag LOCUS_22250 5644 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence164 247 993 gene locus_tag LOCUS_22260 247 993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_22260 1883 990 gene locus_tag LOCUS_22270 1883 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2148 2945 gene locus_tag LOCUS_22280 gene rph 2148 2945 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_22280 2942 3556 gene locus_tag LOCUS_22290 gene rdgB 2942 3556 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_22290 3566 5503 gene locus_tag LOCUS_22300 3566 5503 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence165 1356 307 gene locus_tag LOCUS_22310 gene trpD 1356 307 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_22310 1828 1421 gene locus_tag LOCUS_22320 1828 1421 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_22320 2116 2658 gene locus_tag LOCUS_22330 2116 2658 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_22330 2670 3488 gene locus_tag LOCUS_22340 2670 3488 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_22340 3485 4522 gene locus_tag LOCUS_22350 3485 4522 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence166 435 1640 gene locus_tag LOCUS_22360 435 1640 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_22360 2812 1616 gene locus_tag LOCUS_22370 2812 1616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_22370 3694 2861 gene locus_tag LOCUS_22380 3694 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 4550 3687 gene locus_tag LOCUS_22390 gene rfbA 4550 3687 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_22390 5375 5470 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence167 <1 859 gene locus_tag LOCUS_22400 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014012.1:ABC transporter ATP-binding protein 1068 2996 gene locus_tag LOCUS_22410 1068 2996 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_22410 3028 3432 gene locus_tag LOCUS_22420 3028 3432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031354.1 protein_id gnl|my_center|LOCUS_22420 3451 4722 gene locus_tag LOCUS_22430 3451 4722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence168 1173 334 gene locus_tag LOCUS_22440 1173 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2069 1170 gene locus_tag LOCUS_22450 2069 1170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_22450 3479 2091 gene locus_tag LOCUS_22460 3479 2091 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_22460 4210 3551 gene locus_tag LOCUS_22470 4210 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4591 4313 gene locus_tag LOCUS_22480 4591 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence169 2023 224 gene locus_tag LOCUS_22490 2023 224 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_22490 2672 2142 gene locus_tag LOCUS_22500 2672 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 <5358 2672 gene locus_tag LOCUS_22510 <5358 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022472.1:cation-transporting P-type ATPase >Feature sequence170 2191 320 gene locus_tag LOCUS_22520 2191 320 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_22520 3019 2309 gene locus_tag LOCUS_22530 3019 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4071 3016 gene locus_tag LOCUS_22540 4071 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4350 4183 gene locus_tag LOCUS_22550 4350 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 5167 4550 gene locus_tag LOCUS_22560 5167 4550 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence171 249 258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1749 766 gene locus_tag LOCUS_22570 1749 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877581.1 protein_id gnl|my_center|LOCUS_22570 4215 1867 gene locus_tag LOCUS_22580 4215 1867 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_22580 4758 4369 gene locus_tag LOCUS_22590 4758 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 5189 4758 gene locus_tag LOCUS_22600 gene bldG 5189 4758 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence172 3 494 gene locus_tag LOCUS_22610 3 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1879 488 gene locus_tag LOCUS_22620 1879 488 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_22620 2110 3336 gene locus_tag LOCUS_22630 2110 3336 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229411.1 protein_id gnl|my_center|LOCUS_22630 5160 3574 gene locus_tag LOCUS_22640 gene serA 5160 3574 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence173 72 356 gene locus_tag LOCUS_22650 72 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 434 1108 gene locus_tag LOCUS_22660 gene cbiQ 434 1108 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_22660 1102 1833 gene locus_tag LOCUS_22670 1102 1833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_22670 1843 2181 gene locus_tag LOCUS_22680 1843 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2181 2489 gene locus_tag LOCUS_22690 2181 2489 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_22690 2523 2598 gene locus_tag LOCUS_t00280 2523 2598 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3146 2631 gene locus_tag LOCUS_22700 3146 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3284 3565 gene locus_tag LOCUS_22710 3284 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3565 4296 gene locus_tag LOCUS_22720 3565 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence174 2644 950 gene locus_tag LOCUS_22730 gene secD 2644 950 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_22730 2914 2648 gene locus_tag LOCUS_22740 2914 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3974 2928 gene locus_tag LOCUS_22750 gene ruvB 3974 2928 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_22750 4579 3971 gene locus_tag LOCUS_22760 gene ruvA 4579 3971 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_22760 5070 4576 gene locus_tag LOCUS_22770 gene ruvC 5070 4576 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence175 1500 190 gene locus_tag LOCUS_22780 1500 190 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_22780 1679 2488 gene locus_tag LOCUS_22790 1679 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4342 2489 gene locus_tag LOCUS_22800 4342 2489 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_22800 4671 4759 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence176 3 596 gene locus_tag LOCUS_22810 gene sigM 3 596 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_22810 593 1183 gene locus_tag LOCUS_22820 593 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1152 2186 gene locus_tag LOCUS_22830 gene trxB 1152 2186 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_22830 2230 2553 gene locus_tag LOCUS_22840 gene trxA 2230 2553 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_22840 2557 3624 gene locus_tag LOCUS_22850 2557 3624 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_22850 3750 4814 gene locus_tag LOCUS_22860 3750 4814 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158226985.1 protein_id gnl|my_center|LOCUS_22860 4762 4796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence177 2118 1726 gene locus_tag LOCUS_22870 gene mscL 2118 1726 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063375.1 protein_id gnl|my_center|LOCUS_22870 3387 2275 gene locus_tag LOCUS_22880 3387 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 <5046 3384 gene locus_tag LOCUS_22890 <5046 3384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065773.1:PKD domain-containing protein >Feature sequence178 366 596 gene locus_tag LOCUS_22900 366 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 593 964 gene locus_tag LOCUS_22910 593 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2253 1177 gene locus_tag LOCUS_22920 gene ligD 2253 1177 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_22920 3311 2253 gene locus_tag LOCUS_22930 3311 2253 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_22930 3733 3308 gene locus_tag LOCUS_22940 3733 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 3672 3845 gene locus_tag LOCUS_22950 3672 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3934 4944 gene locus_tag LOCUS_22960 gene zapE 3934 4944 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence179 <1 914 gene locus_tag LOCUS_22970 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028607.1:peptidoglycan-binding protein 2235 1039 gene locus_tag LOCUS_22980 2235 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 2553 2242 gene locus_tag LOCUS_22990 2553 2242 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_22990 2639 4369 gene locus_tag LOCUS_23000 2639 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence180 916 101 gene locus_tag LOCUS_23010 916 101 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_23010 1858 1088 gene locus_tag LOCUS_23020 1858 1088 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_23020 1914 3323 gene locus_tag LOCUS_23030 1914 3323 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_23030 3313 3735 gene locus_tag LOCUS_23040 3313 3735 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_23040 4601 3732 gene locus_tag LOCUS_23050 4601 3732 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence181 26 610 gene locus_tag LOCUS_23060 26 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2276 579 gene locus_tag LOCUS_23070 2276 579 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_23070 2432 3766 gene locus_tag LOCUS_23080 gene glnA 2432 3766 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence182 293 21 gene locus_tag LOCUS_23090 293 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_23090 1097 303 gene locus_tag LOCUS_23100 1097 303 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_23100 1174 1788 gene locus_tag LOCUS_23110 1174 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1848 2846 gene locus_tag LOCUS_23120 1848 2846 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_23120 2843 3022 gene locus_tag LOCUS_23130 2843 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3045 3359 gene locus_tag LOCUS_23140 3045 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3712 4740 gene locus_tag LOCUS_23150 3712 4740 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence183 <1 600 gene locus_tag LOCUS_23160 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939245.1:bifunctional diguanylate cyclase/phosphodiesterase 597 1073 gene locus_tag LOCUS_23170 597 1073 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803676.1 protein_id gnl|my_center|LOCUS_23170 1532 1080 gene locus_tag LOCUS_23180 1532 1080 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 protein_id gnl|my_center|LOCUS_23180 1610 2254 gene locus_tag LOCUS_23190 1610 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2448 3377 gene locus_tag LOCUS_23200 2448 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3429 4079 gene locus_tag LOCUS_23210 3429 4079 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_23210 4124 4705 gene locus_tag LOCUS_23220 4124 4705 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162810208.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence184 253 326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1338 1973 gene locus_tag LOCUS_23230 1338 1973 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_23230 1970 2773 gene locus_tag LOCUS_23240 1970 2773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228858.1 protein_id gnl|my_center|LOCUS_23240 2828 4366 gene locus_tag LOCUS_23250 2828 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence185 483 280 gene locus_tag LOCUS_23260 483 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2072 480 gene locus_tag LOCUS_23270 2072 480 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_23270 2115 2843 gene locus_tag LOCUS_23280 2115 2843 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_23280 3042 3596 gene locus_tag LOCUS_23290 3042 3596 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907897.1 protein_id gnl|my_center|LOCUS_23290 3593 4621 gene locus_tag LOCUS_23300 3593 4621 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_23300 >Feature sequence186 142 1359 gene locus_tag LOCUS_23310 142 1359 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120243.1 protein_id gnl|my_center|LOCUS_23310 1829 1356 gene locus_tag LOCUS_23320 1829 1356 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229707.1 protein_id gnl|my_center|LOCUS_23320 1943 3319 gene locus_tag LOCUS_23330 1943 3319 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 protein_id gnl|my_center|LOCUS_23330 4173 3304 gene locus_tag LOCUS_23340 4173 3304 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence187 773 429 gene locus_tag LOCUS_23350 773 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 992 1177 gene locus_tag LOCUS_23360 992 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1185 1577 gene locus_tag LOCUS_23370 1185 1577 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_23370 1826 2845 gene locus_tag LOCUS_23380 1826 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2850 3671 gene locus_tag LOCUS_23390 2850 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3735 4148 gene locus_tag LOCUS_23400 3735 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence188 <1 544 gene locus_tag LOCUS_23410 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726947.1:hydrolase 671 3379 gene locus_tag LOCUS_23420 gene ppdK 671 3379 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_23420 3425 4651 gene locus_tag LOCUS_23430 3425 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence189 93 332 gene locus_tag LOCUS_23440 93 332 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894138.1 protein_id gnl|my_center|LOCUS_23440 1281 319 gene locus_tag LOCUS_23450 1281 319 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894139.1 protein_id gnl|my_center|LOCUS_23450 1542 1351 gene locus_tag LOCUS_23460 1542 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_23460 1671 2033 gene locus_tag LOCUS_23470 1671 2033 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 protein_id gnl|my_center|LOCUS_23470 2392 2225 gene locus_tag LOCUS_23480 2392 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23480 3051 2389 gene locus_tag LOCUS_23490 3051 2389 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_23490 3209 3048 gene locus_tag LOCUS_23500 3209 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 <4763 3229 gene locus_tag LOCUS_23510 <4763 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111481136.1:RNA polymerase sigma factor >Feature sequence190 1728 448 gene locus_tag LOCUS_23520 1728 448 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_23520 2060 1728 gene locus_tag LOCUS_23530 2060 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2404 2321 gene locus_tag LOCUS_t00290 2404 2321 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2575 3066 gene locus_tag LOCUS_23540 2575 3066 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 protein_id gnl|my_center|LOCUS_23540 3118 4668 gene locus_tag LOCUS_23550 3118 4668 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402981.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence191 <1 627 gene locus_tag LOCUS_23560 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412306.1:sirohydrochlorin chelatase 648 1814 gene locus_tag LOCUS_23570 648 1814 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence192 2259 1237 gene locus_tag LOCUS_23580 2259 1237 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_23580 2810 2256 gene locus_tag LOCUS_23590 2810 2256 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417130.1 protein_id gnl|my_center|LOCUS_23590 3599 2865 gene locus_tag LOCUS_23600 3599 2865 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence193 3091 3648 gene locus_tag LOCUS_23610 3091 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3846 3652 gene locus_tag LOCUS_23620 3846 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4315 3932 gene locus_tag LOCUS_23630 4315 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 >Feature sequence194 <1 2376 gene locus_tag LOCUS_23640 <1 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105217514.1:T9SS type A sorting domain-containing protein 3886 2363 gene locus_tag LOCUS_23650 3886 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence195 993 277 gene locus_tag LOCUS_23660 993 277 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_23660 1440 1048 gene locus_tag LOCUS_23670 1440 1048 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_23670 2249 1437 gene locus_tag LOCUS_23680 2249 1437 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_23680 3001 2246 gene locus_tag LOCUS_23690 3001 2246 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_23690 3924 2998 gene locus_tag LOCUS_23700 3924 2998 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_23700 <4617 3970 gene locus_tag LOCUS_23710 <4617 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_114660815.1:WD40 repeat domain-containing protein >Feature sequence196 387 396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2042 1140 gene locus_tag LOCUS_23720 2042 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2861 2193 gene locus_tag LOCUS_23730 2861 2193 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854958.1 protein_id gnl|my_center|LOCUS_23730 <4566 2930 gene locus_tag LOCUS_23740 <4566 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229635.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein >Feature sequence197 109 1290 gene locus_tag LOCUS_23750 109 1290 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_23750 1291 1596 gene locus_tag LOCUS_23760 1291 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2744 1605 gene locus_tag LOCUS_23770 2744 1605 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_23770 2796 3296 gene locus_tag LOCUS_23780 2796 3296 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_23780 4194 3298 gene locus_tag LOCUS_23790 4194 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence198 1662 502 gene locus_tag LOCUS_23800 1662 502 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_23800 1750 2700 gene locus_tag LOCUS_23810 1750 2700 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 protein_id gnl|my_center|LOCUS_23810 2744 3130 gene locus_tag LOCUS_23820 2744 3130 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_23820 3127 3924 gene locus_tag LOCUS_23830 3127 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4299 3937 gene locus_tag LOCUS_23840 4299 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence199 138 2315 gene locus_tag LOCUS_23850 138 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2359 3639 gene locus_tag LOCUS_23860 2359 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3639 4172 gene locus_tag LOCUS_23870 3639 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 4236 4245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence200 2246 1179 gene locus_tag LOCUS_23880 gene mraY 2246 1179 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804699.1 protein_id gnl|my_center|LOCUS_23880 3619 2243 gene locus_tag LOCUS_23890 3619 2243 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_23890 <4512 3616 gene locus_tag LOCUS_23900 <4512 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028131.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence201 960 142 gene locus_tag LOCUS_23910 960 142 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_23910 1058 1657 gene locus_tag LOCUS_23920 1058 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2719 1658 gene locus_tag LOCUS_23930 gene disA 2719 1658 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_23930 4213 2780 gene locus_tag LOCUS_23940 gene radA 4213 2780 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence202 1488 1219 gene locus_tag LOCUS_23950 gene rpsT 1488 1219 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_23950 1634 3478 gene locus_tag LOCUS_23960 gene lepA 1634 3478 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_23960 3475 4338 gene locus_tag LOCUS_23970 3475 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence203 389 87 gene locus_tag LOCUS_23980 389 87 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_23980 540 2372 gene locus_tag LOCUS_23990 gene dnaK 540 2372 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_23990 2369 2926 gene locus_tag LOCUS_24000 gene grpE 2369 2926 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_24000 2945 4048 gene locus_tag LOCUS_24010 gene dnaJ 2945 4048 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_24010 4041 4358 gene locus_tag LOCUS_24020 4041 4358 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence204 2292 409 gene locus_tag LOCUS_24030 2292 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2936 2289 gene locus_tag LOCUS_24040 2936 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 3796 3014 gene locus_tag LOCUS_24050 3796 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence205 845 1711 gene locus_tag LOCUS_24060 845 1711 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057202.1 protein_id gnl|my_center|LOCUS_24060 2879 1716 gene locus_tag LOCUS_24070 2879 1716 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080747.1 protein_id gnl|my_center|LOCUS_24070 4009 2876 gene locus_tag LOCUS_24080 4009 2876 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_24080 4140 4213 gene locus_tag LOCUS_t00300 4140 4213 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4247 4321 gene locus_tag LOCUS_t00310 4247 4321 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 530 763 gene locus_tag LOCUS_24090 530 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 902 1861 gene locus_tag LOCUS_24100 902 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1923 3488 gene locus_tag LOCUS_24110 1923 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3848 3765 gene locus_tag LOCUS_t00320 3848 3765 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 384 121 gene locus_tag LOCUS_24120 384 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1025 381 gene locus_tag LOCUS_24130 gene sigR 1025 381 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_24130 1651 1085 gene locus_tag LOCUS_24140 1651 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_24140 2325 1648 gene locus_tag LOCUS_24150 2325 1648 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_24150 3603 2338 gene locus_tag LOCUS_24160 3603 2338 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence208 990 2171 gene locus_tag LOCUS_24170 990 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2168 2368 gene locus_tag LOCUS_24180 2168 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2492 2680 gene locus_tag LOCUS_24190 2492 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 3786 2650 gene locus_tag LOCUS_24200 3786 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence209 774 1763 gene locus_tag LOCUS_24210 774 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1896 3950 gene locus_tag LOCUS_24220 1896 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence210 1432 155 gene locus_tag LOCUS_24230 gene eno 1432 155 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_24230 2151 1504 gene locus_tag LOCUS_24240 2151 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2756 2148 gene locus_tag LOCUS_24250 2756 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 4306 2825 gene locus_tag LOCUS_24260 4306 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence211 <1 1307 gene locus_tag LOCUS_24270 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091935.1:polyphosphate:AMP phosphotransferase 1952 1311 gene locus_tag LOCUS_24280 1952 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 2598 2026 gene locus_tag LOCUS_24290 2598 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 3259 2651 gene locus_tag LOCUS_24300 3259 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3469 3293 gene locus_tag LOCUS_24310 3469 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3740 4093 gene locus_tag LOCUS_24320 3740 4093 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803959.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence212 187 2010 gene locus_tag LOCUS_24330 187 2010 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228518.1 protein_id gnl|my_center|LOCUS_24330 3696 1999 gene locus_tag LOCUS_24340 3696 1999 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence213 1517 225 gene locus_tag LOCUS_24350 1517 225 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_24350 1578 3011 gene locus_tag LOCUS_24360 1578 3011 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196368.1 protein_id gnl|my_center|LOCUS_24360 3096 3962 gene locus_tag LOCUS_24370 3096 3962 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057202.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence214 662 261 gene locus_tag LOCUS_24380 662 261 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_24380 1356 727 gene locus_tag LOCUS_24390 1356 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1372 1381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1793 1413 gene locus_tag LOCUS_24400 1793 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 3589 1790 gene locus_tag LOCUS_24410 3589 1790 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence215 365 787 gene locus_tag LOCUS_24420 gene mce 365 787 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_24420 2482 863 gene locus_tag LOCUS_24430 2482 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2610 3944 gene locus_tag LOCUS_24440 gene ccrA 2610 3944 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence216 <1 764 gene locus_tag LOCUS_24450 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016111.1:cysteine desulfurase NifS 761 1012 gene locus_tag LOCUS_24460 761 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 1610 999 gene locus_tag LOCUS_24470 gene aat 1610 999 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403591.1 protein_id gnl|my_center|LOCUS_24470 1975 1619 gene locus_tag LOCUS_24480 1975 1619 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060786.1 protein_id gnl|my_center|LOCUS_24480 2142 3332 gene locus_tag LOCUS_24490 gene nadA 2142 3332 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_24490 4009 3449 gene locus_tag LOCUS_24500 4009 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence217 237 246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 249 659 gene locus_tag LOCUS_24510 249 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1533 649 gene locus_tag LOCUS_24520 1533 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1665 2639 gene locus_tag LOCUS_24530 1665 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence218 3 572 gene locus_tag LOCUS_24540 3 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 582 1688 gene locus_tag LOCUS_24550 582 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 1645 4119 gene locus_tag LOCUS_24560 1645 4119 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993797.1 protein_id gnl|my_center|LOCUS_24560 3789 3812 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence219 1588 491 gene locus_tag LOCUS_24570 gene hypD 1588 491 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_24570 1812 1585 gene locus_tag LOCUS_24580 1812 1585 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_24580 3539 2178 gene locus_tag LOCUS_24590 3539 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3662 3763 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence220 911 246 gene locus_tag LOCUS_24600 911 246 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_24600 2079 904 gene locus_tag LOCUS_24610 2079 904 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_24610 2303 2668 gene locus_tag LOCUS_24620 2303 2668 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929878.1 protein_id gnl|my_center|LOCUS_24620 <4027 2748 gene locus_tag LOCUS_24630 <4027 2748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230537.1:acetate--CoA ligase >Feature sequence221 1073 141 gene locus_tag LOCUS_24640 gene pstS 1073 141 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_24640 979 1290 gene locus_tag LOCUS_24650 979 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1560 1387 gene locus_tag LOCUS_24660 1560 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2507 1623 gene locus_tag LOCUS_24670 gene mutT1 2507 1623 CDS product 8-oxo-(d)GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728311.1 protein_id gnl|my_center|LOCUS_24670 <3986 2507 gene locus_tag LOCUS_24680 <3986 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978319.1:CYTH and CHAD domain-containing protein >Feature sequence222 <1 1058 gene locus_tag LOCUS_24690 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259073.1:GAF domain-containing protein 1062 1703 gene locus_tag LOCUS_24700 1062 1703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_24700 1762 2979 gene locus_tag LOCUS_24710 1762 2979 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_24710 <3961 2905 gene locus_tag LOCUS_24720 <3961 2905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486225.1:glycosyltransferase family 4 protein >Feature sequence223 1710 271 gene locus_tag LOCUS_24730 1710 271 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_24730 1893 2342 gene locus_tag LOCUS_24740 1893 2342 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_24740 3070 3161 gene locus_tag LOCUS_t00330 3070 3161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3636 3645 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence224 12 668 gene locus_tag LOCUS_24750 12 668 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886082.1 protein_id gnl|my_center|LOCUS_24750 689 1372 gene locus_tag LOCUS_24760 gene mtrA 689 1372 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_24760 1376 2935 gene locus_tag LOCUS_24770 gene mtrB 1376 2935 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence225 2296 116 gene locus_tag LOCUS_24780 2296 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3483 2293 gene locus_tag LOCUS_24790 3483 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence226 166 1485 gene locus_tag LOCUS_24800 166 1485 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_24800 3230 1482 gene locus_tag LOCUS_24810 3230 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 <3887 3227 gene locus_tag LOCUS_24820 <3887 3227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034285031.1:aldo/keto reductase >Feature sequence227 350 153 gene locus_tag LOCUS_24830 350 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 934 476 gene locus_tag LOCUS_24840 934 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 988 1905 gene locus_tag LOCUS_24850 988 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1950 3653 gene locus_tag LOCUS_24860 1950 3653 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252672.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence228 934 2184 gene locus_tag LOCUS_24870 gene istA 934 2184 CDS product IS21-like element ISMbo1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414864.1 protein_id gnl|my_center|LOCUS_24870 2184 2993 gene locus_tag LOCUS_24880 2184 2993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_24880 3473 3772 gene locus_tag LOCUS_24890 3473 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence229 74 568 gene locus_tag LOCUS_24900 74 568 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_24900 1555 569 gene locus_tag LOCUS_24910 1555 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1686 3194 gene locus_tag LOCUS_24920 1686 3194 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_24920 3363 3806 gene locus_tag LOCUS_24930 3363 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence230 1339 1136 gene locus_tag LOCUS_24940 1339 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1466 1918 gene locus_tag LOCUS_24950 1466 1918 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931873.1 protein_id gnl|my_center|LOCUS_24950 1915 3000 gene locus_tag LOCUS_24960 1915 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3792 3040 gene locus_tag LOCUS_24970 3792 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence231 151 861 gene locus_tag LOCUS_24980 151 861 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908858.1 protein_id gnl|my_center|LOCUS_24980 1126 2862 gene locus_tag LOCUS_24990 gene fadD26 1126 2862 CDS product long-chain-fatty-acid--AMP ligase FAAL26/FadD26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904960.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence232 481 101 gene locus_tag LOCUS_25000 481 101 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_25000 737 2638 gene locus_tag LOCUS_25010 737 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence233 <1 2162 gene locus_tag LOCUS_25020 <1 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028707.1:NAD-glutamate dehydrogenase 2919 2320 gene locus_tag LOCUS_25030 2919 2320 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence234 1349 207 gene locus_tag LOCUS_25040 gene dnaJ 1349 207 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_25040 2373 1360 gene locus_tag LOCUS_25050 gene hrcA 2373 1360 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_25050 2543 3001 gene locus_tag LOCUS_25060 2543 3001 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973361.1 protein_id gnl|my_center|LOCUS_25060 3178 3642 gene locus_tag LOCUS_25070 3178 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence235 2979 880 gene locus_tag LOCUS_25080 2979 880 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_25080 <3716 3063 gene locus_tag LOCUS_25090 <3716 3063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974818.1:mycothiol synthase >Feature sequence236 366 16 gene locus_tag LOCUS_25100 gene aroH 366 16 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258091.1 protein_id gnl|my_center|LOCUS_25100 1113 391 gene locus_tag LOCUS_25110 1113 391 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_25110 1749 1114 gene locus_tag LOCUS_25120 gene scpB 1749 1114 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_25120 2536 1730 gene locus_tag LOCUS_25130 2536 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 <3713 2752 gene locus_tag LOCUS_25140 <3713 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729303.1:site-specific tyrosine recombinase XerD >Feature sequence237 1455 478 gene locus_tag LOCUS_25150 1455 478 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_25150 2377 1475 gene locus_tag LOCUS_25160 2377 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2447 3457 gene locus_tag LOCUS_25170 gene speB 2447 3457 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence238 888 103 gene locus_tag LOCUS_25180 888 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1089 2003 gene locus_tag LOCUS_25190 1089 2003 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_25190 2000 3013 gene locus_tag LOCUS_25200 2000 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence239 1554 640 gene locus_tag LOCUS_25210 1554 640 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908797.1 protein_id gnl|my_center|LOCUS_25210 2515 1616 gene locus_tag LOCUS_25220 2515 1616 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804236.1 protein_id gnl|my_center|LOCUS_25220 <3612 2544 gene locus_tag LOCUS_25230 <3612 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224737.1:LCP family protein >Feature sequence240 <1 622 gene locus_tag LOCUS_25240 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899377.1:DUF2189 domain-containing protein 1803 604 gene locus_tag LOCUS_25250 gene hemW 1803 604 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_25250 <3607 2039 gene locus_tag LOCUS_25260 <3607 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485037.1:AMP-dependent synthetase/ligase >Feature sequence241 2 355 gene locus_tag LOCUS_25270 2 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 385 394 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 567 719 gene locus_tag LOCUS_25280 567 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 712 924 gene locus_tag LOCUS_25290 712 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 936 1202 gene locus_tag LOCUS_25300 936 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1199 1840 gene locus_tag LOCUS_25310 1199 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1842 3029 gene locus_tag LOCUS_25320 1842 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3164 3337 gene locus_tag LOCUS_25330 3164 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3327 3515 gene locus_tag LOCUS_25340 3327 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence242 476 159 gene locus_tag LOCUS_25350 476 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1572 469 gene locus_tag LOCUS_25360 gene dnaJ 1572 469 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_25360 2172 1606 gene locus_tag LOCUS_25370 2172 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <3581 2169 gene locus_tag LOCUS_25380 <3581 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230874.1:molecular chaperone DnaK >Feature sequence243 33 740 gene locus_tag LOCUS_25390 33 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2100 688 gene locus_tag LOCUS_25400 gene purB 2100 688 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085600.1 protein_id gnl|my_center|LOCUS_25400 3335 2100 gene locus_tag LOCUS_25410 gene purD 3335 2100 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085596.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence244 <1 728 gene locus_tag LOCUS_25420 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977317.1:MBL fold metallo-hydrolase 725 1984 gene locus_tag LOCUS_25430 gene hisS 725 1984 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082383.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence245 8 583 gene locus_tag LOCUS_25440 8 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 636 1568 gene locus_tag LOCUS_25450 636 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1572 1781 gene locus_tag LOCUS_25460 1572 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1921 2328 gene locus_tag LOCUS_25470 1921 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2325 3017 gene locus_tag LOCUS_25480 2325 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence246 922 500 gene locus_tag LOCUS_25490 922 500 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730327.1 protein_id gnl|my_center|LOCUS_25490 2120 915 gene locus_tag LOCUS_25500 2120 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224795.1 protein_id gnl|my_center|LOCUS_25500 2623 2255 gene locus_tag LOCUS_25510 2623 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2673 3029 gene locus_tag LOCUS_25520 2673 3029 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence247 <1 655 gene locus_tag LOCUS_25530 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258626.1:nickel-dependent hydrogenase large subunit 661 1131 gene locus_tag LOCUS_25540 661 1131 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258625.1 protein_id gnl|my_center|LOCUS_25540 1135 1356 gene locus_tag LOCUS_25550 1135 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1373 2590 gene locus_tag LOCUS_25560 1373 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258623.1 protein_id gnl|my_center|LOCUS_25560 2590 2943 gene locus_tag LOCUS_25570 2590 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 2954 3202 gene locus_tag LOCUS_25580 2954 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3199 3399 gene locus_tag LOCUS_25590 3199 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence248 880 221 gene locus_tag LOCUS_25600 880 221 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_25600 942 2219 gene locus_tag LOCUS_25610 942 2219 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_25610 2442 2170 gene locus_tag LOCUS_25620 2442 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2765 2439 gene locus_tag LOCUS_25630 2765 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 <3426 2762 gene locus_tag LOCUS_25640 <3426 2762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000415207.1:oligo-1,6-glucosidase >Feature sequence249 419 1462 gene locus_tag LOCUS_25650 gene disA 419 1462 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_25650 2062 1463 gene locus_tag LOCUS_25660 2062 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2151 2981 gene locus_tag LOCUS_25670 2151 2981 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence250 609 2915 gene locus_tag LOCUS_25680 609 2915 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence251 687 1088 gene locus_tag LOCUS_25690 687 1088 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 protein_id gnl|my_center|LOCUS_25690 1189 2580 gene locus_tag LOCUS_25700 1189 2580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence252 1855 2106 gene locus_tag LOCUS_25710 1855 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2435 2184 gene locus_tag LOCUS_25720 2435 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 <3322 2432 gene locus_tag LOCUS_25730 <3322 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975733.1:SGNH/GDSL hydrolase family protein >Feature sequence253 962 552 gene locus_tag LOCUS_25740 962 552 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411534.1 protein_id gnl|my_center|LOCUS_25740 1295 2542 gene locus_tag LOCUS_25750 1295 2542 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110434.1 protein_id gnl|my_center|LOCUS_25750 1359 1432 gene locus_tag LOCUS_t00340 1359 1432 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2532 3269 gene locus_tag LOCUS_25760 2532 3269 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence254 2256 3056 gene locus_tag LOCUS_25770 2256 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence255 <1 930 gene locus_tag LOCUS_25780 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947843.1:GGDEF domain-containing protein 972 2090 gene locus_tag LOCUS_25790 972 2090 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_25790 2087 2929 gene locus_tag LOCUS_25800 2087 2929 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532218.1 protein_id gnl|my_center|LOCUS_25800 2963 2972 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence256 589 296 gene locus_tag LOCUS_25810 589 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 725 800 gene locus_tag LOCUS_t00350 725 800 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1573 1148 gene locus_tag LOCUS_25820 1573 1148 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_25820 1974 1570 gene locus_tag LOCUS_25830 1974 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2428 2916 gene locus_tag LOCUS_25840 2428 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence257 1394 9 gene locus_tag LOCUS_25850 1394 9 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_25850 2341 1391 gene locus_tag LOCUS_25860 2341 1391 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066336.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence258 702 908 gene locus_tag LOCUS_25870 702 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 912 1595 gene locus_tag LOCUS_25880 gene npdG 912 1595 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_25880 1595 1879 gene locus_tag LOCUS_25890 1595 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 2722 1895 gene locus_tag LOCUS_25900 gene panB 2722 1895 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence259 655 401 gene locus_tag LOCUS_25910 655 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1099 680 gene locus_tag LOCUS_25920 1099 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1536 1105 gene locus_tag LOCUS_25930 1536 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 <3194 1651 gene locus_tag LOCUS_25940 <3194 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972091.1:amino acid permease >Feature sequence260 3 233 gene locus_tag LOCUS_25950 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1072 290 gene locus_tag LOCUS_25960 1072 290 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_25960 2044 1118 gene locus_tag LOCUS_25970 2044 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3018 2041 gene locus_tag LOCUS_25980 gene dapE 3018 2041 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence261 442 11 gene locus_tag LOCUS_25990 442 11 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_25990 957 481 gene locus_tag LOCUS_26000 957 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224319.1 protein_id gnl|my_center|LOCUS_26000 1071 2858 gene locus_tag LOCUS_26010 1071 2858 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence262 683 1252 gene locus_tag LOCUS_26020 683 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1552 1851 gene locus_tag LOCUS_26030 gene groES 1552 1851 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence263 2120 951 gene locus_tag LOCUS_26040 2120 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907917.1 protein_id gnl|my_center|LOCUS_26040 2314 2117 gene locus_tag LOCUS_26050 2314 2117 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_26050 <3158 2349 gene locus_tag LOCUS_26060 <3158 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028721.1:phosphomannomutase/phosphoglucomutase >Feature sequence264 1685 1131 gene locus_tag LOCUS_26070 1685 1131 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 protein_id gnl|my_center|LOCUS_26070 2717 1725 gene locus_tag LOCUS_26080 2717 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 3081 2803 gene locus_tag LOCUS_26090 3081 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence265 335 45 gene locus_tag LOCUS_26100 335 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 465 1310 gene locus_tag LOCUS_26110 465 1310 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_26110 1327 2214 gene locus_tag LOCUS_26120 1327 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727764.1 protein_id gnl|my_center|LOCUS_26120 2282 2869 gene locus_tag LOCUS_26130 2282 2869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence266 1385 111 gene locus_tag LOCUS_26140 1385 111 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730135.1 protein_id gnl|my_center|LOCUS_26140 2560 1382 gene locus_tag LOCUS_26150 2560 1382 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730136.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence267 2511 1120 gene locus_tag LOCUS_26160 2511 1120 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence268 1530 691 gene locus_tag LOCUS_26170 1530 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1588 2232 gene locus_tag LOCUS_26180 1588 2232 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_26180 2190 2591 gene locus_tag LOCUS_26190 2190 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2654 2570 gene locus_tag LOCUS_t00360 2654 2570 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence269 1682 510 gene locus_tag LOCUS_26200 1682 510 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_26200 2710 1682 gene locus_tag LOCUS_26210 gene gap 2710 1682 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence270 495 812 gene locus_tag LOCUS_26220 gene rplU 495 812 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 protein_id gnl|my_center|LOCUS_26220 816 1064 gene locus_tag LOCUS_26230 gene rpmA 816 1064 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_26230 1076 2407 gene locus_tag LOCUS_26240 gene obgE 1076 2407 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence271 1421 63 gene locus_tag LOCUS_26250 1421 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3012 1471 gene locus_tag LOCUS_26260 3012 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731073.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence272 767 129 gene locus_tag LOCUS_26270 767 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1723 764 gene locus_tag LOCUS_26280 gene metF 1723 764 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_26280 1804 2883 gene locus_tag LOCUS_26290 1804 2883 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence273 275 284 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 493 759 gene locus_tag LOCUS_26300 493 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 803 1282 gene locus_tag LOCUS_26310 803 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence274 248 2209 gene locus_tag LOCUS_26320 248 2209 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_26320 2206 2787 gene locus_tag LOCUS_26330 gene amrR 2206 2787 CDS product TetR family transcriptional regulator AmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088626.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence275 <1 1146 gene locus_tag LOCUS_26340 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014876667.1:acyl-CoA dehydrogenase family protein 280 303 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1139 2164 gene locus_tag LOCUS_26350 1139 2164 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_26350 2846 2217 gene locus_tag LOCUS_26360 2846 2217 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence276 213 2255 gene locus_tag LOCUS_26370 213 2255 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence277 424 1437 gene locus_tag LOCUS_26380 424 1437 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_26380 1470 2078 gene locus_tag LOCUS_26390 1470 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2418 2484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence278 169 789 gene locus_tag LOCUS_26400 169 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 253 305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1985 1053 gene locus_tag LOCUS_26410 1985 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence279 835 1704 gene locus_tag LOCUS_26420 835 1704 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 protein_id gnl|my_center|LOCUS_26420 2797 1853 gene locus_tag LOCUS_26430 2797 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence280 1415 1029 gene locus_tag LOCUS_26440 1415 1029 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_26440 1627 1403 gene locus_tag LOCUS_26450 1627 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2052 1717 gene locus_tag LOCUS_26460 2052 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 <2793 2092 gene locus_tag LOCUS_26470 <2793 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727276.1:aldehyde dehydrogenase family protein >Feature sequence281 1634 1038 gene locus_tag LOCUS_26480 1634 1038 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 protein_id gnl|my_center|LOCUS_26480 1738 2187 gene locus_tag LOCUS_26490 1738 2187 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_26490 2184 2786 gene locus_tag LOCUS_26500 2184 2786 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence282 1212 277 gene locus_tag LOCUS_26510 1212 277 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_26510 1296 2000 gene locus_tag LOCUS_26520 1296 2000 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729239.1 protein_id gnl|my_center|LOCUS_26520 <2761 2002 gene locus_tag LOCUS_26530 <2761 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein >Feature sequence283 59 850 gene locus_tag LOCUS_26540 59 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 847 1626 gene locus_tag LOCUS_26550 847 1626 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_26550 2128 2723 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttctattcgctgtcgcgaggg >Feature sequence284 343 1221 gene locus_tag LOCUS_26560 343 1221 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730610.1 protein_id gnl|my_center|LOCUS_26560 1218 2471 gene locus_tag LOCUS_26570 1218 2471 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093017.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence285 547 2001 gene locus_tag LOCUS_26580 547 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2402 1998 gene locus_tag LOCUS_26590 2402 1998 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence286 <1 618 gene locus_tag LOCUS_26600 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005057202.1:PAC2 family protein 675 2108 gene locus_tag LOCUS_26610 675 2108 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727554.1 protein_id gnl|my_center|LOCUS_26610 <2692 2109 gene locus_tag LOCUS_26620 <2692 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042510626.1:amidohydrolase >Feature sequence287 1877 1161 gene locus_tag LOCUS_26630 1877 1161 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence288 1268 603 gene locus_tag LOCUS_26640 1268 603 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141850309.1 protein_id gnl|my_center|LOCUS_26640 1620 1432 gene locus_tag LOCUS_26650 1620 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 <2625 1668 gene locus_tag LOCUS_26660 <2625 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222411.1:long-chain fatty acid--CoA ligase >Feature sequence289 8 460 gene locus_tag LOCUS_26670 8 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 992 693 gene locus_tag LOCUS_26680 992 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1129 1953 gene locus_tag LOCUS_26690 1129 1953 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence290 <1 894 gene locus_tag LOCUS_26700 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004347154.1:aspartate aminotransferase family protein 1644 898 gene locus_tag LOCUS_26710 1644 898 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510615.1 protein_id gnl|my_center|LOCUS_26710 2066 1701 gene locus_tag LOCUS_26720 2066 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2398 2063 gene locus_tag LOCUS_26730 2398 2063 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence291 <1 1998 gene locus_tag LOCUS_26740 <1 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166276588.1:S8 family serine peptidase >Feature sequence292 >Feature sequence293 356 1708 gene locus_tag LOCUS_26750 356 1708 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121857.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence294 3 1169 gene locus_tag LOCUS_26760 3 1169 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_26760 1192 2181 gene locus_tag LOCUS_26770 1192 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence295 920 1171 gene locus_tag LOCUS_26780 920 1171 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 protein_id gnl|my_center|LOCUS_26780 1168 1557 gene locus_tag LOCUS_26790 1168 1557 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_26790 <2495 1588 gene locus_tag LOCUS_26800 <2495 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404453.1:tryptophanase >Feature sequence296 247 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 953 459 gene locus_tag LOCUS_26810 953 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1931 1014 gene locus_tag LOCUS_26820 1931 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26820 2254 1931 gene locus_tag LOCUS_26830 2254 1931 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence297 <1 698 gene locus_tag LOCUS_26840 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222287.1:hydroxyacid-oxoacid transhydrogenase 695 1126 gene locus_tag LOCUS_26850 695 1126 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence298 1740 1258 gene locus_tag LOCUS_26860 gene ispF 1740 1258 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 protein_id gnl|my_center|LOCUS_26860 2395 1742 gene locus_tag LOCUS_26870 gene ispD 2395 1742 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence299 1384 758 gene locus_tag LOCUS_26880 gene rpsD 1384 758 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_26880 1800 1405 gene locus_tag LOCUS_26890 gene rpsK 1800 1405 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_26890 2204 1827 gene locus_tag LOCUS_26900 gene rpsM 2204 1827 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence300 715 119 gene locus_tag LOCUS_26910 715 119 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121044.1 protein_id gnl|my_center|LOCUS_26910 1812 712 gene locus_tag LOCUS_26920 gene aguA 1812 712 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 protein_id gnl|my_center|LOCUS_26920 2360 1809 gene locus_tag LOCUS_26930 2360 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence301 1953 973 gene locus_tag LOCUS_26940 1953 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence302 144 410 gene locus_tag LOCUS_26950 144 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 688 1914 gene locus_tag LOCUS_26960 688 1914 CDS product ISL3-like element IS1096 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726739.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence303 1528 275 gene locus_tag LOCUS_26970 1528 275 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729172.1 protein_id gnl|my_center|LOCUS_26970 2074 1529 gene locus_tag LOCUS_26980 2074 1529 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence304 9 1178 gene locus_tag LOCUS_26990 9 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 <2273 1352 gene locus_tag LOCUS_27000 <2273 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224470.1:1,4-alpha-glucan branching protein GlgB >Feature sequence305 1594 365 gene locus_tag LOCUS_27010 1594 365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence306 >Feature sequence307 <1 567 gene locus_tag LOCUS_27020 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407794.1:acyltransferase family protein >Feature sequence308 377 156 gene locus_tag LOCUS_27030 gene infA 377 156 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_27030 1327 503 gene locus_tag LOCUS_27040 gene map 1327 503 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_27040 1894 1328 gene locus_tag LOCUS_27050 1894 1328 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence309 1484 1493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence310 245 1066 gene locus_tag LOCUS_27060 245 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1063 2016 gene locus_tag LOCUS_27070 1063 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence311 1719 1276 gene locus_tag LOCUS_27080 gene rpsI 1719 1276 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence312 180 1433 gene locus_tag LOCUS_27090 180 1433 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence313 198 743 gene locus_tag LOCUS_27100 198 743 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_27100 1111 800 gene locus_tag LOCUS_27110 gene wblA 1111 800 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence314 473 153 gene locus_tag LOCUS_27120 473 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 432 1052 gene locus_tag LOCUS_27130 432 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1918 1031 gene locus_tag LOCUS_27140 1918 1031 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence315 <2029 792 gene locus_tag LOCUS_27150 <2029 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000055092.1:NAD(P)-binding domain-containing protein >Feature sequence316 <1 748 gene locus_tag LOCUS_27160 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229334.1:HAMP domain-containing sensor histidine kinase 849 762 gene locus_tag LOCUS_t00370 849 762 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 892 983 gene locus_tag LOCUS_t00380 892 983 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence317 849 421 gene locus_tag LOCUS_27170 gene sodN 849 421 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_27170 932 1213 gene locus_tag LOCUS_27180 932 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1389 1228 gene locus_tag LOCUS_27190 1389 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1750 1938 gene locus_tag LOCUS_27200 1750 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence318 34 369 gene locus_tag LOCUS_27210 34 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 447 662 gene locus_tag LOCUS_27220 447 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence319 1102 263 gene locus_tag LOCUS_27230 1102 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 356 365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1830 1183 gene locus_tag LOCUS_27240 1830 1183 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence320 479 1399 gene locus_tag LOCUS_27250 479 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence321 456 1079 gene locus_tag LOCUS_27260 456 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1076 1849 gene locus_tag LOCUS_27270 1076 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence322 246 58 gene locus_tag LOCUS_27280 246 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 178 1740 gene locus_tag LOCUS_27290 178 1740 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence323 420 1 gene locus_tag LOCUS_27300 420 1 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411408.1 protein_id gnl|my_center|LOCUS_27300 1513 431 gene locus_tag LOCUS_27310 1513 431 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899214.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence324 251 820 gene locus_tag LOCUS_27320 251 820 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_27320 821 994 gene locus_tag LOCUS_27330 gene rpmF 821 994 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_27330 1008 1712 gene locus_tag LOCUS_27340 gene rnc 1008 1712 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence325 >Feature sequence326 1479 145 gene locus_tag LOCUS_27350 1479 145 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence327 <1 993 gene locus_tag LOCUS_27360 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484182.1:cryptochrome/photolyase family protein <1604 1058 gene locus_tag LOCUS_27370 <1604 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975111.1:NAD(P)H-quinone oxidoreductase >Feature sequence328 <1 580 gene locus_tag LOCUS_27380 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975278.1:ATP-dependent chaperone ClpB >Feature sequence329 >Feature sequence330 <1507 494 gene locus_tag LOCUS_27390 <1507 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029662.1:virginiamycin B lyase >Feature sequence331 >Feature sequence332 377 156 gene locus_tag LOCUS_27400 gene infA 377 156 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_27400 1362 535 gene locus_tag LOCUS_27410 gene map 1362 535 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence333 >Feature sequence334 <1 783 gene locus_tag LOCUS_27420 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110815.1:excinuclease ABC subunit UvrB >Feature sequence335 81 1247 gene locus_tag LOCUS_27430 81 1247 CDS product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence336 538 293 gene locus_tag LOCUS_27440 538 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1254 535 gene locus_tag LOCUS_27450 1254 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence337 535 290 gene locus_tag LOCUS_27460 535 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1251 532 gene locus_tag LOCUS_27470 1251 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence338 132 214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence339 899 381 gene locus_tag LOCUS_27480 899 381 CDS product glycine cleavage system regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775899.1 protein_id gnl|my_center|LOCUS_27480 757 766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence340 709 788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence341 <1115 417 gene locus_tag LOCUS_27490 <1115 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976727.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence342 689 749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence343 >Feature sequence344 82 450 gene locus_tag LOCUS_27500 82 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 480 839 gene locus_tag LOCUS_27510 480 839 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_27510 688 718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence345 >Feature sequence346 >Feature sequence347 >Feature sequence348 >Feature sequence349 <945 3 gene locus_tag LOCUS_27520 <945 3 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228058.1:ParA family protein >Feature sequence350 >Feature sequence351 567 280 gene locus_tag LOCUS_27530 567 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27530 324 333 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence352 >Feature sequence353 600 609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence354 330 339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 594 610 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence355 288 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence356 >Feature sequence357 34 369 gene locus_tag LOCUS_27540 34 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 441 668 gene locus_tag LOCUS_27550 441 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence358 >Feature sequence359 1 312 gene locus_tag LOCUS_27560 1 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence360 156 746 gene locus_tag LOCUS_27570 156 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence361 >Feature sequence362 609 205 gene locus_tag LOCUS_27580 609 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence363 365 745 gene locus_tag LOCUS_27590 365 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence364 361 642 gene locus_tag LOCUS_27600 361 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence365 687 103 gene locus_tag LOCUS_27610 687 103 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence366 >Feature sequence367 557 249 gene locus_tag LOCUS_27620 557 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 >Feature sequence368 >Feature sequence369 >Feature sequence370 311 338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 456 543 gene locus_tag LOCUS_t00390 456 543 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence371 271 312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence372 332 431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence373 >Feature sequence374 >Feature sequence375 174 99 gene locus_tag LOCUS_t00400 174 99 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence376 >Feature sequence377 229 386 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence378 >Feature sequence379 356 365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence380 276 347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence381 >Feature sequence382 242 589 gene locus_tag LOCUS_27630 242 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence383 >Feature sequence384 136 459 gene locus_tag LOCUS_27640 136 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27640 >Feature sequence385 238 83 gene locus_tag LOCUS_27650 238 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 263 324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence386 >Feature sequence387 252 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence388 249 332 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence389 >Feature sequence390 >Feature sequence391 255 320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence392 1 354 gene locus_tag LOCUS_27660 1 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 242 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 380 454 gene locus_tag LOCUS_t00410 380 454 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence393 >Feature sequence394 561 352 gene locus_tag LOCUS_27670 561 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence395 >Feature sequence396 262 314 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence397 280 289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence398 >Feature sequence399 237 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence400 >Feature sequence401 278 309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence402 >Feature sequence403 256 308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence404 517 98 gene locus_tag LOCUS_27680 517 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence405 >Feature sequence406 229 304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence407 238 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence408 >Feature sequence409 318 79 gene locus_tag LOCUS_27690 318 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence410 245 3 gene locus_tag LOCUS_27700 245 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27700 >Feature sequence411 267 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends