>Feature sequence001 <1 511 gene locus_tag LOCUS_00010 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021995751.1:group II intron reverse transcriptase/maturase 3743 1383 gene locus_tag LOCUS_00020 3743 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4235 3813 gene locus_tag LOCUS_00030 4235 3813 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_00030 6273 4288 gene locus_tag LOCUS_00040 6273 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6494 6844 gene locus_tag LOCUS_00050 6494 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7190 8845 gene locus_tag LOCUS_00060 gene leuA 7190 8845 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406457.1 protein_id gnl|my_center|LOCUS_00060 9036 10217 gene locus_tag LOCUS_00070 9036 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10620 10285 gene locus_tag LOCUS_00080 10620 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10722 12083 gene locus_tag LOCUS_00090 gene asnS 10722 12083 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_00090 13585 12125 gene locus_tag LOCUS_00100 gene purF 13585 12125 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_00100 15938 13605 gene locus_tag LOCUS_00110 gene purL 15938 13605 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_00110 16705 15992 gene locus_tag LOCUS_00120 gene purQ 16705 15992 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_00120 16938 16720 gene locus_tag LOCUS_00130 gene purS 16938 16720 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388468.1 protein_id gnl|my_center|LOCUS_00130 17880 17479 gene locus_tag LOCUS_00140 17880 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18204 18623 gene locus_tag LOCUS_00150 18204 18623 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_00150 18884 19405 gene locus_tag LOCUS_00160 18884 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19889 20725 gene locus_tag LOCUS_00170 19889 20725 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_00170 20752 21039 gene locus_tag LOCUS_00180 20752 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21355 22629 gene locus_tag LOCUS_00190 21355 22629 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_00190 23058 22903 gene locus_tag LOCUS_00200 23058 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25623 23299 gene locus_tag LOCUS_00210 25623 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26665 25772 gene locus_tag LOCUS_00220 26665 25772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28160 26733 gene locus_tag LOCUS_00230 28160 26733 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_00230 28418 29410 gene locus_tag LOCUS_00240 28418 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29446 30312 gene locus_tag LOCUS_00250 29446 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31212 30379 gene locus_tag LOCUS_00260 31212 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31644 32735 gene locus_tag LOCUS_00270 31644 32735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32824 34398 gene locus_tag LOCUS_00280 32824 34398 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_00280 34672 35583 gene locus_tag LOCUS_00290 34672 35583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37683 35644 gene locus_tag LOCUS_00300 gene ligA 37683 35644 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_00300 38336 39670 gene locus_tag LOCUS_00310 38336 39670 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_00310 39813 41744 gene locus_tag LOCUS_00320 39813 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42687 41755 gene locus_tag LOCUS_00330 42687 41755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44437 42965 gene locus_tag LOCUS_00340 gene cls 44437 42965 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_00340 44655 46481 gene locus_tag LOCUS_00350 44655 46481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 47687 46485 gene locus_tag LOCUS_00360 47687 46485 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_00360 48183 48004 gene locus_tag LOCUS_00370 48183 48004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 49240 48368 gene locus_tag LOCUS_00380 49240 48368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 51269 49296 gene locus_tag LOCUS_00390 51269 49296 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388633.1 protein_id gnl|my_center|LOCUS_00390 52037 51351 gene locus_tag LOCUS_00400 52037 51351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 52815 52030 gene locus_tag LOCUS_00410 52815 52030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_00410 54119 52911 gene locus_tag LOCUS_00420 gene thrC 54119 52911 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_00420 54303 54536 gene locus_tag LOCUS_00430 54303 54536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55340 54567 gene locus_tag LOCUS_00440 55340 54567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 55927 58731 gene locus_tag LOCUS_00450 55927 58731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 59383 58841 gene locus_tag LOCUS_00460 59383 58841 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_00460 59781 59380 gene locus_tag LOCUS_00470 59781 59380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59880 60809 gene locus_tag LOCUS_00480 59880 60809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 60942 61361 gene locus_tag LOCUS_00490 gene nrdR 60942 61361 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_00490 61358 61915 gene locus_tag LOCUS_00500 61358 61915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61931 62275 gene locus_tag LOCUS_00510 61931 62275 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_00510 63582 62305 gene locus_tag LOCUS_00520 63582 62305 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806995.1 protein_id gnl|my_center|LOCUS_00520 64538 63681 gene locus_tag LOCUS_00530 64538 63681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_00530 68467 64694 gene locus_tag LOCUS_00540 68467 64694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 69288 68614 gene locus_tag LOCUS_00550 69288 68614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_00550 70242 69451 gene locus_tag LOCUS_00560 70242 69451 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_00560 70967 70239 gene locus_tag LOCUS_00570 gene rnc 70967 70239 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_00570 71615 70986 gene locus_tag LOCUS_00580 71615 70986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 74151 71623 gene locus_tag LOCUS_00590 74151 71623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 77477 74682 gene locus_tag LOCUS_00600 77477 74682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 82146 77695 gene locus_tag LOCUS_00610 82146 77695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 87163 82313 gene locus_tag LOCUS_00620 87163 82313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 95014 87728 gene locus_tag LOCUS_00630 95014 87728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 99036 95401 gene locus_tag LOCUS_00640 99036 95401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 103187 99186 gene locus_tag LOCUS_00650 103187 99186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 108125 103287 gene locus_tag LOCUS_00660 108125 103287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 108651 109754 gene locus_tag LOCUS_00670 gene dusB 108651 109754 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_00670 109886 112480 gene locus_tag LOCUS_00680 109886 112480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 112549 113961 gene locus_tag LOCUS_00690 112549 113961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 114029 114856 gene locus_tag LOCUS_00700 114029 114856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 114861 115937 gene locus_tag LOCUS_00710 gene hemA 114861 115937 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_00710 115998 117023 gene locus_tag LOCUS_00720 gene hemC 115998 117023 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174006.1 protein_id gnl|my_center|LOCUS_00720 117165 118682 gene locus_tag LOCUS_00730 gene cobA 117165 118682 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_00730 119952 119374 gene locus_tag LOCUS_00740 119952 119374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 121033 120302 gene locus_tag LOCUS_00750 121033 120302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 121538 121128 gene locus_tag LOCUS_00760 121538 121128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 122365 122078 gene locus_tag LOCUS_00770 122365 122078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 125071 122810 gene locus_tag LOCUS_00780 125071 122810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 125482 127260 gene locus_tag LOCUS_00790 125482 127260 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_00790 127257 128081 gene locus_tag LOCUS_00800 127257 128081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 128246 128452 gene locus_tag LOCUS_00810 128246 128452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 128694 129044 gene locus_tag LOCUS_00820 128694 129044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 132771 129058 gene locus_tag LOCUS_00830 132771 129058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 134187 132934 gene locus_tag LOCUS_00840 134187 132934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 134427 135893 gene locus_tag LOCUS_00850 134427 135893 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124559.1 protein_id gnl|my_center|LOCUS_00850 136208 135921 gene locus_tag LOCUS_00860 gene gatC 136208 135921 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_00860 136509 136210 gene locus_tag LOCUS_00870 136509 136210 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_00870 137508 136561 gene locus_tag LOCUS_00880 gene hprK 137508 136561 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_00880 138333 137566 gene locus_tag LOCUS_00890 gene lptB 138333 137566 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_00890 140185 138356 gene locus_tag LOCUS_00900 140185 138356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 140762 140190 gene locus_tag LOCUS_00910 140762 140190 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_00910 141549 140764 gene locus_tag LOCUS_00920 gene kdsA 141549 140764 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_00920 142583 141660 gene locus_tag LOCUS_00930 142583 141660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 143642 142593 gene locus_tag LOCUS_00940 143642 142593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_00940 144189 143695 gene locus_tag LOCUS_00950 144189 143695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 144919 146046 gene locus_tag LOCUS_00960 144919 146046 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_00960 146132 146638 gene locus_tag LOCUS_00970 146132 146638 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 protein_id gnl|my_center|LOCUS_00970 147263 146757 gene locus_tag LOCUS_00980 147263 146757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 148854 147493 gene locus_tag LOCUS_00990 148854 147493 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106497.1 protein_id gnl|my_center|LOCUS_00990 150947 148851 gene locus_tag LOCUS_01000 150947 148851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 152266 150962 gene locus_tag LOCUS_01010 gene rifK 152266 150962 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_01010 153809 152346 gene locus_tag LOCUS_01020 153809 152346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 153781 154098 gene locus_tag LOCUS_01030 153781 154098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 154757 153981 gene locus_tag LOCUS_01040 154757 153981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 154978 156858 gene locus_tag LOCUS_01050 154978 156858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 157221 157478 gene locus_tag LOCUS_01060 157221 157478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 161001 157540 gene locus_tag LOCUS_01070 161001 157540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 161792 163183 gene locus_tag LOCUS_01080 161792 163183 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_01080 164344 163280 gene locus_tag LOCUS_01090 164344 163280 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861648.1 protein_id gnl|my_center|LOCUS_01090 164751 165566 gene locus_tag LOCUS_01100 164751 165566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 165824 169030 gene locus_tag LOCUS_01110 165824 169030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 169565 170362 gene locus_tag LOCUS_01120 169565 170362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 170507 174661 gene locus_tag LOCUS_01130 170507 174661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 174755 176236 gene locus_tag LOCUS_01140 174755 176236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 177332 176244 gene locus_tag LOCUS_01150 177332 176244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 177601 179481 gene locus_tag LOCUS_01160 177601 179481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 180109 179486 gene locus_tag LOCUS_01170 180109 179486 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_01170 183357 180121 gene locus_tag LOCUS_01180 183357 180121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 185001 183895 gene locus_tag LOCUS_01190 185001 183895 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583800.1 protein_id gnl|my_center|LOCUS_01190 185421 185092 gene locus_tag LOCUS_01200 185421 185092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 186543 185491 gene locus_tag LOCUS_01210 186543 185491 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_01210 187721 186672 gene locus_tag LOCUS_01220 gene plsX 187721 186672 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_01220 188458 187970 gene locus_tag LOCUS_01230 188458 187970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 188958 188470 gene locus_tag LOCUS_01240 gene coaD 188958 188470 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_01240 191366 189021 gene locus_tag LOCUS_01250 191366 189021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 192168 191458 gene locus_tag LOCUS_01260 192168 191458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 194295 192358 gene locus_tag LOCUS_01270 194295 192358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 195671 194295 gene locus_tag LOCUS_01280 195671 194295 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_01280 196664 196176 gene locus_tag LOCUS_01290 196664 196176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 196921 197769 gene locus_tag LOCUS_01300 196921 197769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 200642 197814 gene locus_tag LOCUS_01310 200642 197814 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_01310 200863 201330 gene locus_tag LOCUS_01320 200863 201330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 201353 202768 gene locus_tag LOCUS_01330 201353 202768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 202740 204881 gene locus_tag LOCUS_01340 gene aas 202740 204881 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 protein_id gnl|my_center|LOCUS_01340 205006 205770 gene locus_tag LOCUS_01350 205006 205770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 206300 205767 gene locus_tag LOCUS_01360 206300 205767 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_01360 207306 206326 gene locus_tag LOCUS_01370 207306 206326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 213636 207415 gene locus_tag LOCUS_01380 213636 207415 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_01380 213839 214636 gene locus_tag LOCUS_01390 213839 214636 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 protein_id gnl|my_center|LOCUS_01390 215487 214849 gene locus_tag LOCUS_01400 215487 214849 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090041.1 protein_id gnl|my_center|LOCUS_01400 218292 215503 gene locus_tag LOCUS_01410 218292 215503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 218176 218442 gene locus_tag LOCUS_01420 218176 218442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 219062 218772 gene locus_tag LOCUS_01430 219062 218772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 219597 219271 gene locus_tag LOCUS_01440 219597 219271 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815797.1 protein_id gnl|my_center|LOCUS_01440 220118 219657 gene locus_tag LOCUS_01450 220118 219657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 221726 220221 gene locus_tag LOCUS_01460 221726 220221 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200075.1 protein_id gnl|my_center|LOCUS_01460 224366 222420 gene locus_tag LOCUS_01470 224366 222420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 225088 225393 gene locus_tag LOCUS_01480 225088 225393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 225458 227083 gene locus_tag LOCUS_01490 225458 227083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 227471 227614 gene locus_tag LOCUS_01500 227471 227614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 227628 228935 gene locus_tag LOCUS_01510 227628 228935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 229040 230206 gene locus_tag LOCUS_01520 229040 230206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 230230 230424 gene locus_tag LOCUS_01530 230230 230424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 230445 231020 gene locus_tag LOCUS_01540 230445 231020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 231296 231030 gene locus_tag LOCUS_01550 231296 231030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 232929 231514 gene locus_tag LOCUS_01560 232929 231514 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_01560 233234 236494 gene locus_tag LOCUS_01570 233234 236494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 237038 238435 gene locus_tag LOCUS_01580 237038 238435 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_01580 239992 238517 gene locus_tag LOCUS_01590 gene nuoN 239992 238517 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_01590 241539 239989 gene locus_tag LOCUS_01600 241539 239989 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_01600 243359 241542 gene locus_tag LOCUS_01610 243359 241542 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_01610 243627 243352 gene locus_tag LOCUS_01620 243627 243352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 245099 243627 gene locus_tag LOCUS_01630 245099 243627 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_01630 245430 245104 gene locus_tag LOCUS_01640 gene nuoK 245430 245104 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_01640 245960 245427 gene locus_tag LOCUS_01650 245960 245427 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_01650 246508 245957 gene locus_tag LOCUS_01660 246508 245957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 247530 246505 gene locus_tag LOCUS_01670 gene nuoH 247530 246505 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_01670 248664 247531 gene locus_tag LOCUS_01680 gene nuoD 248664 247531 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_01680 249185 248661 gene locus_tag LOCUS_01690 249185 248661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 249721 249203 gene locus_tag LOCUS_01700 249721 249203 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_01700 250098 249688 gene locus_tag LOCUS_01710 250098 249688 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151756315.1 protein_id gnl|my_center|LOCUS_01710 251190 251804 gene locus_tag LOCUS_01720 251190 251804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 251801 252772 gene locus_tag LOCUS_01730 251801 252772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 252857 254389 gene locus_tag LOCUS_01740 gene lpdA 252857 254389 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_01740 254731 254474 gene locus_tag LOCUS_01750 254731 254474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 256908 254737 gene locus_tag LOCUS_01760 256908 254737 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_01760 257959 257189 gene locus_tag LOCUS_01770 257959 257189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 258524 258039 gene locus_tag LOCUS_01780 gene tadA 258524 258039 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_01780 259020 258517 gene locus_tag LOCUS_01790 259020 258517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 259124 260308 gene locus_tag LOCUS_01800 259124 260308 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_01800 260438 261481 gene locus_tag LOCUS_01810 260438 261481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 261580 262710 gene locus_tag LOCUS_01820 261580 262710 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_01820 262720 264105 gene locus_tag LOCUS_01830 262720 264105 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_01830 264102 265190 gene locus_tag LOCUS_01840 264102 265190 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_01840 265190 266464 gene locus_tag LOCUS_01850 gene glcF 265190 266464 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_01850 266565 267026 gene locus_tag LOCUS_01860 266565 267026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 267431 267270 gene locus_tag LOCUS_01870 267431 267270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 267773 268612 gene locus_tag LOCUS_01880 267773 268612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 269023 269808 gene locus_tag LOCUS_01890 gene nagB 269023 269808 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_01890 271288 269855 gene locus_tag LOCUS_01900 271288 269855 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_01900 272480 271389 gene locus_tag LOCUS_01910 272480 271389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_01910 272540 274855 gene locus_tag LOCUS_01920 272540 274855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 275420 275211 gene locus_tag LOCUS_01930 275420 275211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 275385 276365 gene locus_tag LOCUS_01940 275385 276365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 278635 276407 gene locus_tag LOCUS_01950 278635 276407 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085486134.1 protein_id gnl|my_center|LOCUS_01950 279766 278690 gene locus_tag LOCUS_01960 279766 278690 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_01960 281528 279846 gene locus_tag LOCUS_01970 281528 279846 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_01970 282523 281543 gene locus_tag LOCUS_01980 282523 281543 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_01980 284339 282579 gene locus_tag LOCUS_01990 284339 282579 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_01990 285078 286466 gene locus_tag LOCUS_02000 285078 286466 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142234.1 protein_id gnl|my_center|LOCUS_02000 286545 287552 gene locus_tag LOCUS_02010 286545 287552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 287899 288846 gene locus_tag LOCUS_02020 gene fmt 287899 288846 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_02020 289903 289721 gene locus_tag LOCUS_02030 289903 289721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 289964 290575 gene locus_tag LOCUS_02040 289964 290575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 290796 291458 gene locus_tag LOCUS_02050 290796 291458 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_02050 291465 293507 gene locus_tag LOCUS_02060 291465 293507 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_02060 294484 294681 gene locus_tag LOCUS_02070 294484 294681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 295881 294853 gene locus_tag LOCUS_02080 gene hemH 295881 294853 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_02080 297328 295922 gene locus_tag LOCUS_02090 gene hemG 297328 295922 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_02090 298719 297325 gene locus_tag LOCUS_02100 gene hemN 298719 297325 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_02100 299857 298721 gene locus_tag LOCUS_02110 gene hemE 299857 298721 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_02110 300168 301244 gene locus_tag LOCUS_02120 300168 301244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 301257 302300 gene locus_tag LOCUS_02130 301257 302300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 303983 302409 gene locus_tag LOCUS_02140 303983 302409 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_02140 304148 304651 gene locus_tag LOCUS_02150 304148 304651 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_02150 304674 305168 gene locus_tag LOCUS_02160 304674 305168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 305179 306624 gene locus_tag LOCUS_02170 305179 306624 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_02170 309060 307042 gene locus_tag LOCUS_02180 309060 307042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 309625 309140 gene locus_tag LOCUS_02190 309625 309140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 312375 309622 gene locus_tag LOCUS_02200 312375 309622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02200 315618 312385 gene locus_tag LOCUS_02210 315618 312385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02210 315895 315698 gene locus_tag LOCUS_02220 315895 315698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 315797 316276 gene locus_tag LOCUS_02230 315797 316276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 316290 317111 gene locus_tag LOCUS_02240 316290 317111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 317218 319440 gene locus_tag LOCUS_02250 317218 319440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 319575 320711 gene locus_tag LOCUS_02260 319575 320711 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_02260 320721 321992 gene locus_tag LOCUS_02270 320721 321992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 321989 323362 gene locus_tag LOCUS_02280 321989 323362 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057589.1 protein_id gnl|my_center|LOCUS_02280 323370 323756 gene locus_tag LOCUS_02290 gene queD 323370 323756 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 protein_id gnl|my_center|LOCUS_02290 324543 323776 gene locus_tag LOCUS_02300 324543 323776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 325556 324657 gene locus_tag LOCUS_02310 325556 324657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 326590 325559 gene locus_tag LOCUS_02320 326590 325559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 327705 326596 gene locus_tag LOCUS_02330 327705 326596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_02330 328538 327702 gene locus_tag LOCUS_02340 328538 327702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 329839 328811 gene locus_tag LOCUS_02350 329839 328811 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_02350 330939 329836 gene locus_tag LOCUS_02360 330939 329836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 331181 331738 gene locus_tag LOCUS_02370 331181 331738 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_02370 331735 332628 gene locus_tag LOCUS_02380 331735 332628 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_02380 333196 332645 gene locus_tag LOCUS_02390 333196 332645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence002 498 1340 gene locus_tag LOCUS_02400 498 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1428 5567 gene locus_tag LOCUS_02410 1428 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 5848 9141 gene locus_tag LOCUS_02420 5848 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9138 10061 gene locus_tag LOCUS_02430 9138 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10329 13256 gene locus_tag LOCUS_02440 10329 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 13441 14424 gene locus_tag LOCUS_02450 13441 14424 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188534.1 protein_id gnl|my_center|LOCUS_02450 14518 15906 gene locus_tag LOCUS_02460 14518 15906 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_02460 15957 17345 gene locus_tag LOCUS_02470 15957 17345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_02470 17421 17918 gene locus_tag LOCUS_02480 gene rpiB 17421 17918 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187340.1 protein_id gnl|my_center|LOCUS_02480 18686 17889 gene locus_tag LOCUS_02490 18686 17889 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_02490 21504 18706 gene locus_tag LOCUS_02500 21504 18706 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_02500 23077 21512 gene locus_tag LOCUS_02510 gene cimA 23077 21512 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_02510 25595 23271 gene locus_tag LOCUS_02520 25595 23271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 25965 27410 gene locus_tag LOCUS_02530 25965 27410 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_02530 27872 27438 gene locus_tag LOCUS_02540 27872 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 28076 28408 gene locus_tag LOCUS_02550 28076 28408 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_02550 28768 28397 gene locus_tag LOCUS_02560 28768 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_02560 28935 29852 gene locus_tag LOCUS_02570 28935 29852 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02570 29863 30969 gene locus_tag LOCUS_02580 29863 30969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 32052 30973 gene locus_tag LOCUS_02590 gene aroC 32052 30973 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_02590 33831 32371 gene locus_tag LOCUS_02600 33831 32371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 36743 33885 gene locus_tag LOCUS_02610 36743 33885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 37349 38683 gene locus_tag LOCUS_02620 37349 38683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 38692 39798 gene locus_tag LOCUS_02630 38692 39798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 40010 42103 gene locus_tag LOCUS_02640 40010 42103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 42158 45250 gene locus_tag LOCUS_02650 42158 45250 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_02650 45403 46029 gene locus_tag LOCUS_02660 45403 46029 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_02660 46034 47824 gene locus_tag LOCUS_02670 46034 47824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 49246 47849 gene locus_tag LOCUS_02680 49246 47849 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_02680 49638 50396 gene locus_tag LOCUS_02690 49638 50396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 51160 50459 gene locus_tag LOCUS_02700 51160 50459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 51505 52251 gene locus_tag LOCUS_02710 51505 52251 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_02710 52844 56953 gene locus_tag LOCUS_02720 52844 56953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 57022 61512 gene locus_tag LOCUS_02730 57022 61512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 61622 62380 gene locus_tag LOCUS_02740 61622 62380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 62506 65283 gene locus_tag LOCUS_02750 62506 65283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 65313 69116 gene locus_tag LOCUS_02760 65313 69116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 69309 71150 gene locus_tag LOCUS_02770 69309 71150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 71203 71682 gene locus_tag LOCUS_02780 71203 71682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 71624 71860 gene locus_tag LOCUS_02790 71624 71860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 72179 72051 gene locus_tag LOCUS_02800 72179 72051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 72328 72597 gene locus_tag LOCUS_02810 72328 72597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 72836 72594 gene locus_tag LOCUS_02820 72836 72594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 72720 73085 gene locus_tag LOCUS_02830 72720 73085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 73082 74515 gene locus_tag LOCUS_02840 73082 74515 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072542480.1 protein_id gnl|my_center|LOCUS_02840 74795 77287 gene locus_tag LOCUS_02850 74795 77287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 77492 78724 gene locus_tag LOCUS_02860 77492 78724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_02860 78805 80289 gene locus_tag LOCUS_02870 78805 80289 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_02870 80718 81791 gene locus_tag LOCUS_02880 80718 81791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 81781 82899 gene locus_tag LOCUS_02890 81781 82899 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_02890 83793 85964 gene locus_tag LOCUS_02900 83793 85964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 86049 87383 gene locus_tag LOCUS_02910 86049 87383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_02910 87591 88505 gene locus_tag LOCUS_02920 87591 88505 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816932.1 protein_id gnl|my_center|LOCUS_02920 88636 89181 gene locus_tag LOCUS_02930 88636 89181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 94333 89186 gene locus_tag LOCUS_02940 94333 89186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 95708 95049 gene locus_tag LOCUS_02950 95708 95049 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_02950 96095 98923 gene locus_tag LOCUS_02960 96095 98923 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_02960 98920 99882 gene locus_tag LOCUS_02970 gene xerC 98920 99882 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_02970 100430 102031 gene locus_tag LOCUS_02980 100430 102031 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_02980 103621 102272 gene locus_tag LOCUS_02990 103621 102272 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_02990 105366 103696 gene locus_tag LOCUS_03000 105366 103696 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_03000 105898 105359 gene locus_tag LOCUS_03010 105898 105359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 107198 105981 gene locus_tag LOCUS_03020 107198 105981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 108686 107202 gene locus_tag LOCUS_03030 108686 107202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 109114 110124 gene locus_tag LOCUS_03040 109114 110124 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256167.1 protein_id gnl|my_center|LOCUS_03040 110194 111852 gene locus_tag LOCUS_03050 110194 111852 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_03050 112184 112954 gene locus_tag LOCUS_03060 112184 112954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 114505 113381 gene locus_tag LOCUS_03070 114505 113381 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_03070 115792 114518 gene locus_tag LOCUS_03080 gene ftsW 115792 114518 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_03080 117753 115789 gene locus_tag LOCUS_03090 117753 115789 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_03090 118357 117767 gene locus_tag LOCUS_03100 118357 117767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 118698 118354 gene locus_tag LOCUS_03110 118698 118354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 119196 119651 gene locus_tag LOCUS_03120 119196 119651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 119686 120525 gene locus_tag LOCUS_03130 119686 120525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 121548 120757 gene locus_tag LOCUS_03140 121548 120757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 122066 122659 gene locus_tag LOCUS_03150 122066 122659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 122646 123890 gene locus_tag LOCUS_03160 122646 123890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 123887 124525 gene locus_tag LOCUS_03170 123887 124525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 124522 125316 gene locus_tag LOCUS_03180 124522 125316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 125343 125657 gene locus_tag LOCUS_03190 125343 125657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 126397 126089 gene locus_tag LOCUS_03200 126397 126089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 126278 127177 gene locus_tag LOCUS_03210 126278 127177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 127174 128925 gene locus_tag LOCUS_03220 127174 128925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 128941 129237 gene locus_tag LOCUS_03230 128941 129237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 129244 130146 gene locus_tag LOCUS_03240 129244 130146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 130159 131025 gene locus_tag LOCUS_03250 130159 131025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 131029 131871 gene locus_tag LOCUS_03260 131029 131871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 132045 133355 gene locus_tag LOCUS_03270 132045 133355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 133779 133703 gene locus_tag LOCUS_t00010 133779 133703 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 134523 133879 gene locus_tag LOCUS_03280 134523 133879 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337827.1 protein_id gnl|my_center|LOCUS_03280 135842 134520 gene locus_tag LOCUS_03290 135842 134520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 137214 135928 gene locus_tag LOCUS_03300 137214 135928 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_03300 138343 137588 gene locus_tag LOCUS_03310 138343 137588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 139534 138425 gene locus_tag LOCUS_03320 139534 138425 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_03320 140183 139560 gene locus_tag LOCUS_03330 gene upp 140183 139560 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_03330 141211 140186 gene locus_tag LOCUS_03340 gene sppA 141211 140186 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989751.1 protein_id gnl|my_center|LOCUS_03340 142485 141388 gene locus_tag LOCUS_03350 142485 141388 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_03350 142967 142542 gene locus_tag LOCUS_03360 142967 142542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 144178 142970 gene locus_tag LOCUS_03370 144178 142970 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_03370 144485 145657 gene locus_tag LOCUS_03380 144485 145657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 146543 146034 gene locus_tag LOCUS_03390 gene mog 146543 146034 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_03390 147034 146558 gene locus_tag LOCUS_03400 gene moaC 147034 146558 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_03400 147788 147012 gene locus_tag LOCUS_03410 gene panB 147788 147012 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_03410 148911 147898 gene locus_tag LOCUS_03420 148911 147898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 149662 148979 gene locus_tag LOCUS_03430 149662 148979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 150027 149650 gene locus_tag LOCUS_03440 150027 149650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 149929 150531 gene locus_tag LOCUS_03450 149929 150531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 151691 150528 gene locus_tag LOCUS_03460 151691 150528 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_03460 153038 151701 gene locus_tag LOCUS_03470 153038 151701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 153824 153312 gene locus_tag LOCUS_03480 153824 153312 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_03480 155167 153902 gene locus_tag LOCUS_03490 155167 153902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_03490 155359 156576 gene locus_tag LOCUS_03500 155359 156576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 158628 156727 gene locus_tag LOCUS_03510 158628 156727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 160740 158740 gene locus_tag LOCUS_03520 160740 158740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 165327 160918 gene locus_tag LOCUS_03530 165327 160918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 169635 165655 gene locus_tag LOCUS_03540 169635 165655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 170591 169638 gene locus_tag LOCUS_03550 170591 169638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 171711 170665 gene locus_tag LOCUS_03560 171711 170665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 177185 172119 gene locus_tag LOCUS_03570 177185 172119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 177727 177930 gene locus_tag LOCUS_03580 177727 177930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 178422 179576 gene locus_tag LOCUS_03590 178422 179576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 183309 179764 gene locus_tag LOCUS_03600 183309 179764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 183580 185967 gene locus_tag LOCUS_03610 183580 185967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03610 185964 187409 gene locus_tag LOCUS_03620 185964 187409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 187691 188053 gene locus_tag LOCUS_03630 187691 188053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 188071 189231 gene locus_tag LOCUS_03640 gene ygeW 188071 189231 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706019.1 protein_id gnl|my_center|LOCUS_03640 189359 190834 gene locus_tag LOCUS_03650 189359 190834 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_03650 190916 191227 gene locus_tag LOCUS_03660 190916 191227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 191249 191473 gene locus_tag LOCUS_03670 191249 191473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 193200 191656 gene locus_tag LOCUS_03680 193200 191656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 195378 193351 gene locus_tag LOCUS_03690 195378 193351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 195961 196036 gene locus_tag LOCUS_t00020 195961 196036 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 196151 197341 gene locus_tag LOCUS_03700 gene tuf 196151 197341 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_03700 197424 197499 gene locus_tag LOCUS_t00030 197424 197499 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 197519 197608 gene locus_tag LOCUS_t00040 197519 197608 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 197638 197889 gene locus_tag LOCUS_03710 197638 197889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 197894 198442 gene locus_tag LOCUS_03720 gene nusG 197894 198442 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_03720 198520 198945 gene locus_tag LOCUS_03730 gene rplK 198520 198945 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_03730 199025 199717 gene locus_tag LOCUS_03740 gene rplA 199025 199717 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_03740 199758 200294 gene locus_tag LOCUS_03750 gene rplJ 199758 200294 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403341.1 protein_id gnl|my_center|LOCUS_03750 200430 200819 gene locus_tag LOCUS_03760 gene rplL 200430 200819 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038645.1 protein_id gnl|my_center|LOCUS_03760 201036 204896 gene locus_tag LOCUS_03770 gene rpoB 201036 204896 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_03770 204940 209082 gene locus_tag LOCUS_03780 gene rpoC 204940 209082 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_03780 209202 209633 gene locus_tag LOCUS_03790 gene rpsL 209202 209633 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_03790 209747 210154 gene locus_tag LOCUS_03800 gene rpsG 209747 210154 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583341.1 protein_id gnl|my_center|LOCUS_03800 210225 212417 gene locus_tag LOCUS_03810 gene fusA 210225 212417 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_03810 213305 212529 gene locus_tag LOCUS_03820 213305 212529 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_03820 214128 214436 gene locus_tag LOCUS_03830 gene rpsJ 214128 214436 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002712302.1 protein_id gnl|my_center|LOCUS_03830 214450 215148 gene locus_tag LOCUS_03840 gene rplC 214450 215148 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_03840 215158 215784 gene locus_tag LOCUS_03850 gene rplD 215158 215784 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_03850 215786 216067 gene locus_tag LOCUS_03860 gene rplW 215786 216067 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_03860 217620 216070 gene locus_tag LOCUS_03870 217620 216070 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence003 642 463 gene locus_tag LOCUS_03880 642 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 884 642 gene locus_tag LOCUS_03890 884 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 968 1696 gene locus_tag LOCUS_03900 968 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1742 1945 gene locus_tag LOCUS_03910 1742 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4083 2290 gene locus_tag LOCUS_03920 4083 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5648 4092 gene locus_tag LOCUS_03930 gene metG 5648 4092 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458904.1 protein_id gnl|my_center|LOCUS_03930 6818 5784 gene locus_tag LOCUS_03940 6818 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8628 7216 gene locus_tag LOCUS_03950 gene glnA 8628 7216 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_03950 10135 8717 gene locus_tag LOCUS_03960 10135 8717 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_03960 10788 10294 gene locus_tag LOCUS_03970 10788 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11015 11278 gene locus_tag LOCUS_03980 11015 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12141 11380 gene locus_tag LOCUS_03990 12141 11380 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_03990 12323 13612 gene locus_tag LOCUS_04000 12323 13612 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_04000 13638 14420 gene locus_tag LOCUS_04010 13638 14420 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_04010 15062 16582 gene locus_tag LOCUS_04020 15062 16582 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_04020 16610 17650 gene locus_tag LOCUS_04030 16610 17650 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_04030 19118 18108 gene locus_tag LOCUS_04040 19118 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 19995 19102 gene locus_tag LOCUS_04050 gene galU 19995 19102 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_04050 20852 22207 gene locus_tag LOCUS_04060 20852 22207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 25655 22263 gene locus_tag LOCUS_04070 25655 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27400 26150 gene locus_tag LOCUS_04080 27400 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 31386 27754 gene locus_tag LOCUS_04090 31386 27754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 32633 31422 gene locus_tag LOCUS_04100 32633 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 34213 34440 gene locus_tag LOCUS_04110 34213 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 38657 34596 gene locus_tag LOCUS_04120 38657 34596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 40759 40076 gene locus_tag LOCUS_04130 40759 40076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 43338 40786 gene locus_tag LOCUS_04140 43338 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 47507 43851 gene locus_tag LOCUS_04150 47507 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 48884 47577 gene locus_tag LOCUS_04160 48884 47577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 50652 49360 gene locus_tag LOCUS_04170 gene purD 50652 49360 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_04170 50774 51697 gene locus_tag LOCUS_04180 gene mip 50774 51697 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_04180 52746 51703 gene locus_tag LOCUS_04190 gene purM 52746 51703 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_04190 54176 52902 gene locus_tag LOCUS_04200 54176 52902 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_04200 54403 54756 gene locus_tag LOCUS_04210 54403 54756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 54842 56173 gene locus_tag LOCUS_04220 54842 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 56870 56352 gene locus_tag LOCUS_04230 56870 56352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 57775 56930 gene locus_tag LOCUS_04240 57775 56930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704225.1 protein_id gnl|my_center|LOCUS_04240 58891 57845 gene locus_tag LOCUS_04250 58891 57845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 protein_id gnl|my_center|LOCUS_04250 59628 59317 gene locus_tag LOCUS_04260 59628 59317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 59789 60619 gene locus_tag LOCUS_04270 59789 60619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 62509 60695 gene locus_tag LOCUS_04280 62509 60695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 62710 63897 gene locus_tag LOCUS_04290 62710 63897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_04290 63899 65923 gene locus_tag LOCUS_04300 63899 65923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 65934 67973 gene locus_tag LOCUS_04310 65934 67973 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_04310 68006 68932 gene locus_tag LOCUS_04320 68006 68932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 69611 69015 gene locus_tag LOCUS_04330 69611 69015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 69925 72207 gene locus_tag LOCUS_04340 69925 72207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 72929 72231 gene locus_tag LOCUS_04350 gene pgl 72929 72231 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_04350 74582 72942 gene locus_tag LOCUS_04360 gene pgi 74582 72942 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_04360 75676 74591 gene locus_tag LOCUS_04370 gene tal 75676 74591 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_04370 77461 75863 gene locus_tag LOCUS_04380 gene pgm 77461 75863 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_04380 80439 77527 gene locus_tag LOCUS_04390 80439 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 81553 82371 gene locus_tag LOCUS_04400 81553 82371 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_04400 82418 83545 gene locus_tag LOCUS_04410 82418 83545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 83548 84114 gene locus_tag LOCUS_04420 gene def 83548 84114 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_04420 85200 84235 gene locus_tag LOCUS_04430 85200 84235 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_04430 85496 86830 gene locus_tag LOCUS_04440 85496 86830 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_04440 87065 86856 gene locus_tag LOCUS_04450 87065 86856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 87816 87082 gene locus_tag LOCUS_04460 87816 87082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 88389 91157 gene locus_tag LOCUS_04470 88389 91157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04470 91191 91838 gene locus_tag LOCUS_04480 91191 91838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 91852 94134 gene locus_tag LOCUS_04490 91852 94134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 95018 94170 gene locus_tag LOCUS_04500 95018 94170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 95463 95086 gene locus_tag LOCUS_04510 95463 95086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 97075 95741 gene locus_tag LOCUS_04520 97075 95741 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_04520 97269 97529 gene locus_tag LOCUS_04530 gene rpsP 97269 97529 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_04530 97546 97791 gene locus_tag LOCUS_04540 97546 97791 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_04540 97880 98563 gene locus_tag LOCUS_04550 gene trmD 97880 98563 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_04550 98560 98952 gene locus_tag LOCUS_04560 gene rplS 98560 98952 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_04560 100330 99065 gene locus_tag LOCUS_04570 gene hisS 100330 99065 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_04570 100761 100429 gene locus_tag LOCUS_04580 100761 100429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 101835 100921 gene locus_tag LOCUS_04590 101835 100921 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_04590 102617 101832 gene locus_tag LOCUS_04600 102617 101832 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_04600 104816 102699 gene locus_tag LOCUS_04610 gene shc 104816 102699 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_04610 107961 104998 gene locus_tag LOCUS_04620 107961 104998 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_04620 109085 108174 gene locus_tag LOCUS_04630 109085 108174 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_04630 109348 110232 gene locus_tag LOCUS_04640 109348 110232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 112259 110406 gene locus_tag LOCUS_04650 112259 110406 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113586.1 protein_id gnl|my_center|LOCUS_04650 113193 113822 gene locus_tag LOCUS_04660 gene purN 113193 113822 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_04660 113952 114833 gene locus_tag LOCUS_04670 gene hisG 113952 114833 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_04670 117341 114840 gene locus_tag LOCUS_04680 117341 114840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 118659 117346 gene locus_tag LOCUS_04690 118659 117346 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_04690 118844 119083 gene locus_tag LOCUS_04700 118844 119083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 119080 119355 gene locus_tag LOCUS_04710 119080 119355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 119348 121687 gene locus_tag LOCUS_04720 gene feoB 119348 121687 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_04720 122044 122661 gene locus_tag LOCUS_04730 122044 122661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 128498 122838 gene locus_tag LOCUS_04740 128498 122838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 130544 129060 gene locus_tag LOCUS_04750 130544 129060 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_04750 130642 134421 gene locus_tag LOCUS_04760 130642 134421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 134486 134803 gene locus_tag LOCUS_04770 134486 134803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 134998 135306 gene locus_tag LOCUS_04780 134998 135306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 135374 135598 gene locus_tag LOCUS_04790 135374 135598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 135670 135834 gene locus_tag LOCUS_04800 135670 135834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 135834 136286 gene locus_tag LOCUS_04810 gene dtd 135834 136286 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_04810 137046 136297 gene locus_tag LOCUS_04820 137046 136297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 138656 137424 gene locus_tag LOCUS_04830 138656 137424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 140572 138653 gene locus_tag LOCUS_04840 140572 138653 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_04840 141330 140587 gene locus_tag LOCUS_04850 141330 140587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_04850 142283 141330 gene locus_tag LOCUS_04860 142283 141330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_04860 143007 142624 gene locus_tag LOCUS_04870 143007 142624 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_04870 144693 143044 gene locus_tag LOCUS_04880 144693 143044 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_04880 147034 145160 gene locus_tag LOCUS_04890 147034 145160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 149062 147092 gene locus_tag LOCUS_04900 149062 147092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 150286 149081 gene locus_tag LOCUS_04910 150286 149081 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_04910 150933 152438 gene locus_tag LOCUS_04920 150933 152438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_04920 153938 152592 gene locus_tag LOCUS_04930 153938 152592 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_04930 154241 154026 gene locus_tag LOCUS_04940 154241 154026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 154357 154905 gene locus_tag LOCUS_04950 154357 154905 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_04950 155268 154939 gene locus_tag LOCUS_04960 155268 154939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 156349 155273 gene locus_tag LOCUS_04970 156349 155273 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_04970 156782 156360 gene locus_tag LOCUS_04980 156782 156360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 157780 156779 gene locus_tag LOCUS_04990 157780 156779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 158656 157799 gene locus_tag LOCUS_05000 158656 157799 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_05000 160533 158653 gene locus_tag LOCUS_05010 160533 158653 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_05010 160770 162710 gene locus_tag LOCUS_05020 160770 162710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 162793 163428 gene locus_tag LOCUS_05030 gene pdxH 162793 163428 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_05030 163814 164323 gene locus_tag LOCUS_05040 163814 164323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 167011 164345 gene locus_tag LOCUS_05050 gene gyrA 167011 164345 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_05050 169598 167091 gene locus_tag LOCUS_05060 gene gyrB 169598 167091 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871536.1 protein_id gnl|my_center|LOCUS_05060 170647 169811 gene locus_tag LOCUS_05070 170647 169811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 171594 170650 gene locus_tag LOCUS_05080 171594 170650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_05080 172239 171601 gene locus_tag LOCUS_05090 172239 171601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 172844 172242 gene locus_tag LOCUS_05100 172844 172242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 173009 174193 gene locus_tag LOCUS_05110 gene tyrA 173009 174193 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703194.1 protein_id gnl|my_center|LOCUS_05110 174909 174553 gene locus_tag LOCUS_05120 174909 174553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 174811 177429 gene locus_tag LOCUS_05130 174811 177429 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_05130 177920 178411 gene locus_tag LOCUS_05140 177920 178411 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197879.1 protein_id gnl|my_center|LOCUS_05140 180875 178527 gene locus_tag LOCUS_05150 180875 178527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 181011 181355 gene locus_tag LOCUS_05160 181011 181355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 181365 183857 gene locus_tag LOCUS_05170 gene secDF 181365 183857 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_05170 183873 184832 gene locus_tag LOCUS_05180 183873 184832 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_05180 184835 186610 gene locus_tag LOCUS_05190 gene recJ 184835 186610 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_05190 187450 186674 gene locus_tag LOCUS_05200 187450 186674 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_05200 189078 187873 gene locus_tag LOCUS_05210 189078 187873 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089073.1 protein_id gnl|my_center|LOCUS_05210 190204 189239 gene locus_tag LOCUS_05220 190204 189239 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_05220 191345 190212 gene locus_tag LOCUS_05230 191345 190212 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_05230 191530 193992 gene locus_tag LOCUS_05240 191530 193992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 194319 194807 gene locus_tag LOCUS_05250 194319 194807 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879700.1 protein_id gnl|my_center|LOCUS_05250 194919 195902 gene locus_tag LOCUS_05260 194919 195902 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792172.1 protein_id gnl|my_center|LOCUS_05260 196359 196018 gene locus_tag LOCUS_05270 196359 196018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 196246 196470 gene locus_tag LOCUS_05280 196246 196470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 196626 200135 gene locus_tag LOCUS_05290 196626 200135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 199924 200021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 200152 202197 gene locus_tag LOCUS_05300 200152 202197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 202248 202955 gene locus_tag LOCUS_05310 202248 202955 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_05310 202952 203593 gene locus_tag LOCUS_05320 202952 203593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 204636 203626 gene locus_tag LOCUS_05330 204636 203626 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_05330 205756 204656 gene locus_tag LOCUS_05340 205756 204656 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_05340 206682 205942 gene locus_tag LOCUS_05350 206682 205942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 209347 206993 gene locus_tag LOCUS_05360 209347 206993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 210292 209363 gene locus_tag LOCUS_05370 210292 209363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 211864 210296 gene locus_tag LOCUS_05380 211864 210296 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_05380 213778 211877 gene locus_tag LOCUS_05390 213778 211877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 215176 213788 gene locus_tag LOCUS_05400 215176 213788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence004 2586 3875 gene locus_tag LOCUS_05410 2586 3875 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_05410 4122 4844 gene locus_tag LOCUS_05420 4122 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5043 6542 gene locus_tag LOCUS_05430 5043 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6875 8050 gene locus_tag LOCUS_05440 6875 8050 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_05440 9490 8099 gene locus_tag LOCUS_05450 9490 8099 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_05450 9624 11237 gene locus_tag LOCUS_05460 9624 11237 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_05460 11449 13593 gene locus_tag LOCUS_05470 11449 13593 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_05470 14394 15197 gene locus_tag LOCUS_05480 14394 15197 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_05480 15197 18262 gene locus_tag LOCUS_05490 15197 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 18286 18912 gene locus_tag LOCUS_05500 18286 18912 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_05500 19093 19587 gene locus_tag LOCUS_05510 19093 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 19721 22441 gene locus_tag LOCUS_05520 gene acnA 19721 22441 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_05520 22947 22525 gene locus_tag LOCUS_05530 22947 22525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 24003 22969 gene locus_tag LOCUS_05540 24003 22969 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_05540 24884 24000 gene locus_tag LOCUS_05550 24884 24000 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_05550 25611 24868 gene locus_tag LOCUS_05560 25611 24868 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_05560 26253 25777 gene locus_tag LOCUS_05570 26253 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 27426 26257 gene locus_tag LOCUS_05580 27426 26257 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_05580 28560 27466 gene locus_tag LOCUS_05590 28560 27466 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_05590 28616 29809 gene locus_tag LOCUS_05600 28616 29809 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_05600 30673 29864 gene locus_tag LOCUS_05610 30673 29864 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_05610 31808 30684 gene locus_tag LOCUS_05620 gene dnaJ 31808 30684 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043914.1 protein_id gnl|my_center|LOCUS_05620 32372 31812 gene locus_tag LOCUS_05630 32372 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 36883 32552 gene locus_tag LOCUS_05640 36883 32552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 37254 36880 gene locus_tag LOCUS_05650 37254 36880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 37735 37184 gene locus_tag LOCUS_05660 37735 37184 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_05660 38254 39540 gene locus_tag LOCUS_05670 gene hemL 38254 39540 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_05670 39572 39985 gene locus_tag LOCUS_05680 gene ruvX 39572 39985 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_05680 39992 40837 gene locus_tag LOCUS_05690 gene truA 39992 40837 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_05690 40841 41305 gene locus_tag LOCUS_05700 gene trmL 40841 41305 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_05700 41811 41326 gene locus_tag LOCUS_05710 41811 41326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 42378 41917 gene locus_tag LOCUS_05720 42378 41917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 43678 42770 gene locus_tag LOCUS_05730 43678 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 44567 43917 gene locus_tag LOCUS_05740 44567 43917 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942483.1 protein_id gnl|my_center|LOCUS_05740 46071 44611 gene locus_tag LOCUS_05750 46071 44611 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_05750 46221 47588 gene locus_tag LOCUS_05760 46221 47588 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_05760 47651 48610 gene locus_tag LOCUS_05770 47651 48610 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_05770 48610 49359 gene locus_tag LOCUS_05780 gene gldF 48610 49359 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_05780 49361 50848 gene locus_tag LOCUS_05790 49361 50848 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_05790 50858 52654 gene locus_tag LOCUS_05800 50858 52654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 52657 55812 gene locus_tag LOCUS_05810 52657 55812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 55839 56585 gene locus_tag LOCUS_05820 55839 56585 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_05820 57022 57636 gene locus_tag LOCUS_05830 57022 57636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 58773 57679 gene locus_tag LOCUS_05840 58773 57679 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_05840 59044 62013 gene locus_tag LOCUS_05850 59044 62013 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121636.1 protein_id gnl|my_center|LOCUS_05850 62022 63077 gene locus_tag LOCUS_05860 62022 63077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 63196 63396 gene locus_tag LOCUS_05870 63196 63396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 63674 63438 gene locus_tag LOCUS_05880 63674 63438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 64029 64709 gene locus_tag LOCUS_05890 64029 64709 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_05890 64843 67347 gene locus_tag LOCUS_05900 64843 67347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 68285 67548 gene locus_tag LOCUS_05910 68285 67548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 70288 68453 gene locus_tag LOCUS_05920 70288 68453 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_05920 71567 70518 gene locus_tag LOCUS_05930 71567 70518 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_05930 72669 71617 gene locus_tag LOCUS_05940 72669 71617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 72983 73927 gene locus_tag LOCUS_05950 72983 73927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 74798 73950 gene locus_tag LOCUS_05960 74798 73950 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_05960 75050 76144 gene locus_tag LOCUS_05970 75050 76144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 76157 79303 gene locus_tag LOCUS_05980 76157 79303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 79780 83484 gene locus_tag LOCUS_05990 79780 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 84398 83604 gene locus_tag LOCUS_06000 84398 83604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 86129 85170 gene locus_tag LOCUS_06010 86129 85170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 86600 87346 gene locus_tag LOCUS_06020 86600 87346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 87710 87405 gene locus_tag LOCUS_06030 87710 87405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 89362 87605 gene locus_tag LOCUS_06040 89362 87605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 90028 90831 gene locus_tag LOCUS_06050 90028 90831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 91040 91705 gene locus_tag LOCUS_06060 91040 91705 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_06060 92075 92347 gene locus_tag LOCUS_06070 92075 92347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 92934 92344 gene locus_tag LOCUS_06080 92934 92344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 94474 93083 gene locus_tag LOCUS_06090 94474 93083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 95469 94516 gene locus_tag LOCUS_06100 95469 94516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 95630 96694 gene locus_tag LOCUS_06110 95630 96694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 96837 97835 gene locus_tag LOCUS_06120 gene corA 96837 97835 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_06120 97929 99212 gene locus_tag LOCUS_06130 97929 99212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 100380 99226 gene locus_tag LOCUS_06140 100380 99226 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_06140 100525 101364 gene locus_tag LOCUS_06150 100525 101364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161491309.1 protein_id gnl|my_center|LOCUS_06150 102050 101652 gene locus_tag LOCUS_06160 102050 101652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 103105 102047 gene locus_tag LOCUS_06170 103105 102047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 104524 103124 gene locus_tag LOCUS_06180 104524 103124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 105144 106733 gene locus_tag LOCUS_06190 105144 106733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 106804 108108 gene locus_tag LOCUS_06200 106804 108108 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838623.1 protein_id gnl|my_center|LOCUS_06200 108280 109092 gene locus_tag LOCUS_06210 108280 109092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 109216 109737 gene locus_tag LOCUS_06220 109216 109737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 109730 110224 gene locus_tag LOCUS_06230 109730 110224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 111124 110243 gene locus_tag LOCUS_06240 111124 110243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 111872 111183 gene locus_tag LOCUS_06250 gene pyrF 111872 111183 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_06250 111978 113267 gene locus_tag LOCUS_06260 gene hisD 111978 113267 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084074.1 protein_id gnl|my_center|LOCUS_06260 113296 114417 gene locus_tag LOCUS_06270 gene hisC 113296 114417 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970532.1 protein_id gnl|my_center|LOCUS_06270 114724 115053 gene locus_tag LOCUS_06280 114724 115053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 115153 118458 gene locus_tag LOCUS_06290 115153 118458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 118511 119314 gene locus_tag LOCUS_06300 118511 119314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 121240 119834 gene locus_tag LOCUS_06310 121240 119834 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_06310 122257 121490 gene locus_tag LOCUS_06320 122257 121490 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_06320 125487 122254 gene locus_tag LOCUS_06330 125487 122254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 125797 126630 gene locus_tag LOCUS_06340 125797 126630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 126627 127268 gene locus_tag LOCUS_06350 126627 127268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 127579 128457 gene locus_tag LOCUS_06360 127579 128457 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189376240.1 protein_id gnl|my_center|LOCUS_06360 128466 129077 gene locus_tag LOCUS_06370 gene thpR 128466 129077 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_06370 129274 131133 gene locus_tag LOCUS_06380 129274 131133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 131181 131741 gene locus_tag LOCUS_06390 gene frr 131181 131741 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_06390 132130 131807 gene locus_tag LOCUS_06400 132130 131807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 132282 132905 gene locus_tag LOCUS_06410 132282 132905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 133656 132868 gene locus_tag LOCUS_06420 gene murQ 133656 132868 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356712.1 protein_id gnl|my_center|LOCUS_06420 133821 135191 gene locus_tag LOCUS_06430 gene mnmE 133821 135191 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_06430 136088 135315 gene locus_tag LOCUS_06440 136088 135315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 137079 136177 gene locus_tag LOCUS_06450 137079 136177 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_06450 137327 139384 gene locus_tag LOCUS_06460 137327 139384 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_06460 139381 140655 gene locus_tag LOCUS_06470 139381 140655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_06470 142806 140764 gene locus_tag LOCUS_06480 142806 140764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 143807 142818 gene locus_tag LOCUS_06490 143807 142818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 144336 145157 gene locus_tag LOCUS_06500 gene rpsB 144336 145157 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_06500 145261 146100 gene locus_tag LOCUS_06510 gene tsf 145261 146100 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_06510 146411 148354 gene locus_tag LOCUS_06520 146411 148354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 148589 150493 gene locus_tag LOCUS_06530 148589 150493 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_06530 151285 150506 gene locus_tag LOCUS_06540 151285 150506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06540 151457 152632 gene locus_tag LOCUS_06550 151457 152632 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_06550 153291 154733 gene locus_tag LOCUS_06560 gene xylE 153291 154733 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_06560 154798 155436 gene locus_tag LOCUS_06570 154798 155436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 155465 156334 gene locus_tag LOCUS_06580 155465 156334 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_06580 156432 157400 gene locus_tag LOCUS_06590 156432 157400 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_06590 157593 159422 gene locus_tag LOCUS_06600 157593 159422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 159710 162217 gene locus_tag LOCUS_06610 159710 162217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 162864 162256 gene locus_tag LOCUS_06620 162864 162256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 163572 164456 gene locus_tag LOCUS_06630 163572 164456 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 protein_id gnl|my_center|LOCUS_06630 164485 165597 gene locus_tag LOCUS_06640 164485 165597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 165594 166406 gene locus_tag LOCUS_06650 165594 166406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 166413 166802 gene locus_tag LOCUS_06660 166413 166802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 167020 168372 gene locus_tag LOCUS_06670 gene miaB 167020 168372 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_06670 168628 169191 gene locus_tag LOCUS_06680 168628 169191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 169223 170164 gene locus_tag LOCUS_06690 169223 170164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 170360 171460 gene locus_tag LOCUS_06700 170360 171460 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_06700 172340 171483 gene locus_tag LOCUS_06710 172340 171483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 173446 172556 gene locus_tag LOCUS_06720 gene sucD 173446 172556 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_06720 174724 173516 gene locus_tag LOCUS_06730 gene sucC 174724 173516 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_06730 175988 174783 gene locus_tag LOCUS_06740 175988 174783 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_06740 176240 176503 gene locus_tag LOCUS_06750 176240 176503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 176648 176481 gene locus_tag LOCUS_06760 176648 176481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 176647 177831 gene locus_tag LOCUS_06770 gene amrS 176647 177831 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870318.1 protein_id gnl|my_center|LOCUS_06770 179988 178288 gene locus_tag LOCUS_06780 179988 178288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 180208 182400 gene locus_tag LOCUS_06790 180208 182400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 183473 182424 gene locus_tag LOCUS_06800 183473 182424 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_06800 184630 183470 gene locus_tag LOCUS_06810 184630 183470 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_06810 187579 184640 gene locus_tag LOCUS_06820 187579 184640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 188778 187633 gene locus_tag LOCUS_06830 gene rlmD 188778 187633 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_06830 188995 188783 gene locus_tag LOCUS_06840 188995 188783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 191760 189262 gene locus_tag LOCUS_06850 191760 189262 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_06850 192905 191784 gene locus_tag LOCUS_06860 192905 191784 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_06860 193411 192902 gene locus_tag LOCUS_06870 193411 192902 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128393.1 protein_id gnl|my_center|LOCUS_06870 194291 193419 gene locus_tag LOCUS_06880 gene ilvE 194291 193419 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_06880 194783 194857 gene locus_tag LOCUS_t00050 194783 194857 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 194975 195625 gene locus_tag LOCUS_06890 194975 195625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 196019 195531 gene locus_tag LOCUS_06900 196019 195531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 196765 196073 gene locus_tag LOCUS_06910 196765 196073 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_06910 197251 198528 gene locus_tag LOCUS_06920 197251 198528 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_06920 199978 198590 gene locus_tag LOCUS_06930 199978 198590 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_06930 200364 201128 gene locus_tag LOCUS_06940 200364 201128 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_06940 201465 201890 gene locus_tag LOCUS_06950 201465 201890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 202586 201924 gene locus_tag LOCUS_06960 202586 201924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence005 556 6078 gene locus_tag LOCUS_06970 556 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6157 6342 gene locus_tag LOCUS_06980 6157 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 6814 11616 gene locus_tag LOCUS_06990 6814 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11760 16292 gene locus_tag LOCUS_07000 11760 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 16892 17710 gene locus_tag LOCUS_07010 16892 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 17748 18722 gene locus_tag LOCUS_07020 17748 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18900 18825 gene locus_tag LOCUS_t00060 18900 18825 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18979 20136 gene locus_tag LOCUS_07030 18979 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20458 20192 gene locus_tag LOCUS_07040 20458 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 20966 21625 gene locus_tag LOCUS_07050 20966 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 21985 21632 gene locus_tag LOCUS_07060 21985 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 22934 22257 gene locus_tag LOCUS_07070 22934 22257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 23818 25584 gene locus_tag LOCUS_07080 23818 25584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 25592 26986 gene locus_tag LOCUS_07090 25592 26986 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_07090 28500 27118 gene locus_tag LOCUS_07100 28500 27118 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_07100 28654 29085 gene locus_tag LOCUS_07110 28654 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 29189 29698 gene locus_tag LOCUS_07120 29189 29698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 29889 29695 gene locus_tag LOCUS_07130 29889 29695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 29888 31693 gene locus_tag LOCUS_07140 29888 31693 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421615.1 protein_id gnl|my_center|LOCUS_07140 33028 32255 gene locus_tag LOCUS_07150 33028 32255 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_07150 33165 36350 gene locus_tag LOCUS_07160 33165 36350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 36799 37335 gene locus_tag LOCUS_07170 36799 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 37332 38306 gene locus_tag LOCUS_07180 37332 38306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 38303 39529 gene locus_tag LOCUS_07190 gene nrfD 38303 39529 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_07190 39526 40989 gene locus_tag LOCUS_07200 39526 40989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 41138 40977 gene locus_tag LOCUS_07210 41138 40977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 41172 41510 gene locus_tag LOCUS_07220 41172 41510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 43005 41557 gene locus_tag LOCUS_07230 43005 41557 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_07230 43424 43185 gene locus_tag LOCUS_07240 43424 43185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 43396 43548 gene locus_tag LOCUS_07250 43396 43548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 44074 45084 gene locus_tag LOCUS_07260 44074 45084 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_07260 45170 46633 gene locus_tag LOCUS_07270 45170 46633 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_07270 46933 46634 gene locus_tag LOCUS_07280 46933 46634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 48061 47012 gene locus_tag LOCUS_07290 48061 47012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 48653 48991 gene locus_tag LOCUS_07300 48653 48991 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_07300 49449 50756 gene locus_tag LOCUS_07310 gene dnaA 49449 50756 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_07310 50753 51733 gene locus_tag LOCUS_07320 50753 51733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_07320 52048 52974 gene locus_tag LOCUS_07330 52048 52974 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_07330 55121 53469 gene locus_tag LOCUS_07340 55121 53469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 56260 55214 gene locus_tag LOCUS_07350 56260 55214 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_07350 56388 56807 gene locus_tag LOCUS_07360 56388 56807 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_07360 56938 60024 gene locus_tag LOCUS_07370 gene secA 56938 60024 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_07370 60485 60162 gene locus_tag LOCUS_07380 60485 60162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 61823 60711 gene locus_tag LOCUS_07390 61823 60711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 62089 63351 gene locus_tag LOCUS_07400 62089 63351 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_07400 63749 64870 gene locus_tag LOCUS_07410 63749 64870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 64876 66297 gene locus_tag LOCUS_07420 64876 66297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 66290 67663 gene locus_tag LOCUS_07430 66290 67663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 67675 68940 gene locus_tag LOCUS_07440 67675 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 69439 71487 gene locus_tag LOCUS_07450 69439 71487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 71652 72935 gene locus_tag LOCUS_07460 71652 72935 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_07460 74952 73573 gene locus_tag LOCUS_07470 gene hydA 74952 73573 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140243.1 protein_id gnl|my_center|LOCUS_07470 75082 75498 gene locus_tag LOCUS_07480 75082 75498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 75577 76221 gene locus_tag LOCUS_07490 75577 76221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 76461 77756 gene locus_tag LOCUS_07500 76461 77756 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_07500 82615 78041 gene locus_tag LOCUS_07510 82615 78041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 82762 83880 gene locus_tag LOCUS_07520 gene mnmA 82762 83880 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_07520 84724 85668 gene locus_tag LOCUS_07530 84724 85668 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_07530 85694 86509 gene locus_tag LOCUS_07540 85694 86509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 86558 87166 gene locus_tag LOCUS_07550 gene pth 86558 87166 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_07550 87163 87483 gene locus_tag LOCUS_07560 87163 87483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 87498 87935 gene locus_tag LOCUS_07570 87498 87935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 87996 88697 gene locus_tag LOCUS_07580 87996 88697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 90737 88707 gene locus_tag LOCUS_07590 90737 88707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 91732 90734 gene locus_tag LOCUS_07600 91732 90734 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_07600 92304 91729 gene locus_tag LOCUS_07610 92304 91729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 93363 92407 gene locus_tag LOCUS_07620 93363 92407 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_07620 94349 93360 gene locus_tag LOCUS_07630 94349 93360 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_07630 94589 97162 gene locus_tag LOCUS_07640 94589 97162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 98533 97610 gene locus_tag LOCUS_07650 gene ribF 98533 97610 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_07650 99404 98658 gene locus_tag LOCUS_07660 99404 98658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 99808 101070 gene locus_tag LOCUS_07670 99808 101070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 101421 103763 gene locus_tag LOCUS_07680 101421 103763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 103760 106276 gene locus_tag LOCUS_07690 103760 106276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 108416 106281 gene locus_tag LOCUS_07700 108416 106281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 109895 108420 gene locus_tag LOCUS_07710 109895 108420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 111041 109902 gene locus_tag LOCUS_07720 111041 109902 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_07720 111194 112756 gene locus_tag LOCUS_07730 111194 112756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 112979 114181 gene locus_tag LOCUS_07740 112979 114181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 114181 115557 gene locus_tag LOCUS_07750 114181 115557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 118067 115578 gene locus_tag LOCUS_07760 118067 115578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 118581 119501 gene locus_tag LOCUS_07770 118581 119501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 119562 120536 gene locus_tag LOCUS_07780 119562 120536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 121343 120537 gene locus_tag LOCUS_07790 121343 120537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_07790 121500 122267 gene locus_tag LOCUS_07800 121500 122267 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235568.1 protein_id gnl|my_center|LOCUS_07800 122264 123763 gene locus_tag LOCUS_07810 122264 123763 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_07810 126700 124619 gene locus_tag LOCUS_07820 126700 124619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 126980 128380 gene locus_tag LOCUS_07830 126980 128380 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_07830 130112 128388 gene locus_tag LOCUS_07840 130112 128388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 130232 131785 gene locus_tag LOCUS_07850 130232 131785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 131988 131794 gene locus_tag LOCUS_07860 131988 131794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 133123 133314 gene locus_tag LOCUS_07870 133123 133314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 133377 133709 gene locus_tag LOCUS_07880 133377 133709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 133970 134668 gene locus_tag LOCUS_07890 133970 134668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 134662 134883 gene locus_tag LOCUS_07900 134662 134883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 135193 135354 gene locus_tag LOCUS_07910 135193 135354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 135662 136363 gene locus_tag LOCUS_07920 135662 136363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 136429 137130 gene locus_tag LOCUS_07930 136429 137130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 138502 137717 gene locus_tag LOCUS_07940 138502 137717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 138711 138786 gene locus_tag LOCUS_t00070 138711 138786 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 138996 140228 gene locus_tag LOCUS_07950 138996 140228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 140238 140981 gene locus_tag LOCUS_07960 140238 140981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 140995 141174 gene locus_tag LOCUS_07970 140995 141174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 141733 141350 gene locus_tag LOCUS_07980 141733 141350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 142181 142396 gene locus_tag LOCUS_07990 142181 142396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 142850 142404 gene locus_tag LOCUS_08000 142850 142404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 143056 142847 gene locus_tag LOCUS_08010 143056 142847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 144332 143046 gene locus_tag LOCUS_08020 gene dnaB 144332 143046 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_08020 145087 144329 gene locus_tag LOCUS_08030 145087 144329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 145407 145156 gene locus_tag LOCUS_08040 145407 145156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 146290 145451 gene locus_tag LOCUS_08050 146290 145451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 147414 146287 gene locus_tag LOCUS_08060 147414 146287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 148039 148491 gene locus_tag LOCUS_08070 148039 148491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 148481 149473 gene locus_tag LOCUS_08080 148481 149473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 149470 150597 gene locus_tag LOCUS_08090 149470 150597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 150640 153654 gene locus_tag LOCUS_08100 150640 153654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 154898 153675 gene locus_tag LOCUS_08110 154898 153675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 155712 154903 gene locus_tag LOCUS_08120 155712 154903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 156599 155721 gene locus_tag LOCUS_08130 156599 155721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 161228 156606 gene locus_tag LOCUS_08140 161228 156606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 162756 161293 gene locus_tag LOCUS_08150 162756 161293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 163718 162753 gene locus_tag LOCUS_08160 163718 162753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 164750 163737 gene locus_tag LOCUS_08170 164750 163737 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_08170 166065 164908 gene locus_tag LOCUS_08180 166065 164908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 167305 166076 gene locus_tag LOCUS_08190 167305 166076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 167909 167472 gene locus_tag LOCUS_08200 167909 167472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 168406 168200 gene locus_tag LOCUS_08210 168406 168200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 168780 168403 gene locus_tag LOCUS_08220 168780 168403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 <169727 169191 gene locus_tag LOCUS_08230 <169727 169191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086026417.1:IS3-like element ISVpa2 family transposase >Feature sequence006 233 1765 gene locus_tag LOCUS_08240 gene murJ 233 1765 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_08240 3330 1762 gene locus_tag LOCUS_08250 3330 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4873 3758 gene locus_tag LOCUS_08260 4873 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5505 4963 gene locus_tag LOCUS_08270 5505 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5762 6472 gene locus_tag LOCUS_08280 5762 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6482 7705 gene locus_tag LOCUS_08290 6482 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7708 8745 gene locus_tag LOCUS_08300 7708 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8751 10556 gene locus_tag LOCUS_08310 gene ctaD 8751 10556 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066649.1 protein_id gnl|my_center|LOCUS_08310 10558 11340 gene locus_tag LOCUS_08320 10558 11340 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_08320 11347 11664 gene locus_tag LOCUS_08330 11347 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11667 11876 gene locus_tag LOCUS_08340 11667 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 11873 12298 gene locus_tag LOCUS_08350 11873 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 12295 13056 gene locus_tag LOCUS_08360 12295 13056 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_08360 13882 13667 gene locus_tag LOCUS_08370 13882 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13766 14881 gene locus_tag LOCUS_08380 13766 14881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_08380 16747 14906 gene locus_tag LOCUS_08390 16747 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 17550 18215 gene locus_tag LOCUS_08400 17550 18215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 18212 18655 gene locus_tag LOCUS_08410 18212 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 18663 19649 gene locus_tag LOCUS_08420 18663 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 20552 19665 gene locus_tag LOCUS_08430 gene folP 20552 19665 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_08430 21517 20654 gene locus_tag LOCUS_08440 21517 20654 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_08440 22370 21540 gene locus_tag LOCUS_08450 22370 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 23401 22433 gene locus_tag LOCUS_08460 23401 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 24215 23406 gene locus_tag LOCUS_08470 24215 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 25558 24251 gene locus_tag LOCUS_08480 25558 24251 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_08480 27053 25692 gene locus_tag LOCUS_08490 27053 25692 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_08490 27523 27050 gene locus_tag LOCUS_08500 27523 27050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_08500 27607 27894 gene locus_tag LOCUS_08510 27607 27894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 30389 27966 gene locus_tag LOCUS_08520 30389 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 32651 31248 gene locus_tag LOCUS_08530 32651 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_08530 32795 33400 gene locus_tag LOCUS_08540 gene rpoE 32795 33400 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_08540 33441 33755 gene locus_tag LOCUS_08550 33441 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 33752 34216 gene locus_tag LOCUS_08560 33752 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 34346 35719 gene locus_tag LOCUS_08570 34346 35719 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_08570 35960 36202 gene locus_tag LOCUS_08580 35960 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 37890 36253 gene locus_tag LOCUS_08590 37890 36253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 39050 38070 gene locus_tag LOCUS_08600 39050 38070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 39261 39031 gene locus_tag LOCUS_08610 39261 39031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 39492 39419 gene locus_tag LOCUS_t00080 39492 39419 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39646 40947 gene locus_tag LOCUS_08620 39646 40947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_08620 40976 41884 gene locus_tag LOCUS_08630 40976 41884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 41892 42701 gene locus_tag LOCUS_08640 41892 42701 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_08640 44226 42844 gene locus_tag LOCUS_08650 44226 42844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_08650 45315 44230 gene locus_tag LOCUS_08660 45315 44230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 46080 45319 gene locus_tag LOCUS_08670 46080 45319 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_08670 47088 46084 gene locus_tag LOCUS_08680 47088 46084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 47608 47294 gene locus_tag LOCUS_08690 47608 47294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 47839 47621 gene locus_tag LOCUS_08700 47839 47621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 48269 51205 gene locus_tag LOCUS_08710 48269 51205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 51514 53232 gene locus_tag LOCUS_08720 51514 53232 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882974.1 protein_id gnl|my_center|LOCUS_08720 54823 53264 gene locus_tag LOCUS_08730 54823 53264 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294549.1 protein_id gnl|my_center|LOCUS_08730 55699 55391 gene locus_tag LOCUS_08740 55699 55391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 56065 55751 gene locus_tag LOCUS_08750 56065 55751 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_08750 57501 56062 gene locus_tag LOCUS_08760 57501 56062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 57994 57485 gene locus_tag LOCUS_08770 57994 57485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 58362 58021 gene locus_tag LOCUS_08780 58362 58021 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123648.1 protein_id gnl|my_center|LOCUS_08780 61895 58653 gene locus_tag LOCUS_08790 61895 58653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 62069 62491 gene locus_tag LOCUS_08800 62069 62491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 63159 62539 gene locus_tag LOCUS_08810 63159 62539 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_08810 64158 63376 gene locus_tag LOCUS_08820 64158 63376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 64308 64772 gene locus_tag LOCUS_08830 64308 64772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 65068 66498 gene locus_tag LOCUS_08840 65068 66498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 66561 68666 gene locus_tag LOCUS_08850 66561 68666 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_08850 69658 68672 gene locus_tag LOCUS_08860 69658 68672 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926799.1 protein_id gnl|my_center|LOCUS_08860 70034 72028 gene locus_tag LOCUS_08870 70034 72028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 74609 72093 gene locus_tag LOCUS_08880 74609 72093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 75086 74634 gene locus_tag LOCUS_08890 75086 74634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 75829 76629 gene locus_tag LOCUS_08900 75829 76629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 76661 77704 gene locus_tag LOCUS_08910 76661 77704 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017578.1 protein_id gnl|my_center|LOCUS_08910 81519 77827 gene locus_tag LOCUS_08920 81519 77827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 88130 81651 gene locus_tag LOCUS_08930 88130 81651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 88915 88721 gene locus_tag LOCUS_08940 88915 88721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 89176 90204 gene locus_tag LOCUS_08950 89176 90204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 91192 90395 gene locus_tag LOCUS_08960 91192 90395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 92037 94691 gene locus_tag LOCUS_08970 92037 94691 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_08970 95517 94720 gene locus_tag LOCUS_08980 95517 94720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 97555 95948 gene locus_tag LOCUS_08990 97555 95948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 99933 97570 gene locus_tag LOCUS_09000 99933 97570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 100579 100058 gene locus_tag LOCUS_09010 100579 100058 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294661.1 protein_id gnl|my_center|LOCUS_09010 101199 101507 gene locus_tag LOCUS_09020 101199 101507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 102663 101608 gene locus_tag LOCUS_09030 gene hypE 102663 101608 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_09030 103748 102660 gene locus_tag LOCUS_09040 gene hypD 103748 102660 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_09040 104038 103745 gene locus_tag LOCUS_09050 104038 103745 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_09050 105103 104249 gene locus_tag LOCUS_09060 gene mutM 105103 104249 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_09060 106399 105434 gene locus_tag LOCUS_09070 106399 105434 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_09070 107829 106432 gene locus_tag LOCUS_09080 107829 106432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 108627 107875 gene locus_tag LOCUS_09090 108627 107875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 109628 108624 gene locus_tag LOCUS_09100 109628 108624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 111111 109684 gene locus_tag LOCUS_09110 111111 109684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 113075 111177 gene locus_tag LOCUS_09120 113075 111177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 114179 113721 gene locus_tag LOCUS_09130 114179 113721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 115178 114183 gene locus_tag LOCUS_09140 115178 114183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 115062 115337 gene locus_tag LOCUS_09150 115062 115337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 116926 115406 gene locus_tag LOCUS_09160 116926 115406 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_09160 117444 116989 gene locus_tag LOCUS_09170 117444 116989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 118929 117808 gene locus_tag LOCUS_09180 118929 117808 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 protein_id gnl|my_center|LOCUS_09180 119450 118926 gene locus_tag LOCUS_09190 119450 118926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 119673 120815 gene locus_tag LOCUS_09200 119673 120815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 121597 120812 gene locus_tag LOCUS_09210 121597 120812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 121724 123016 gene locus_tag LOCUS_09220 121724 123016 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_09220 123053 124087 gene locus_tag LOCUS_09230 123053 124087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 125458 124205 gene locus_tag LOCUS_09240 125458 124205 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266800.1 protein_id gnl|my_center|LOCUS_09240 125645 126985 gene locus_tag LOCUS_09250 125645 126985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 126991 128100 gene locus_tag LOCUS_09260 126991 128100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 129170 128172 gene locus_tag LOCUS_09270 129170 128172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 130132 129167 gene locus_tag LOCUS_09280 130132 129167 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_09280 131109 130129 gene locus_tag LOCUS_09290 131109 130129 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927122.1 protein_id gnl|my_center|LOCUS_09290 132432 131110 gene locus_tag LOCUS_09300 132432 131110 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_09300 132841 132915 gene locus_tag LOCUS_t00090 132841 132915 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 134192 135097 gene locus_tag LOCUS_09310 134192 135097 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616169.1 protein_id gnl|my_center|LOCUS_09310 135094 136791 gene locus_tag LOCUS_09320 135094 136791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 136808 138034 gene locus_tag LOCUS_09330 136808 138034 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_09330 138150 140141 gene locus_tag LOCUS_09340 138150 140141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 140220 141548 gene locus_tag LOCUS_09350 140220 141548 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_09350 143230 142019 gene locus_tag LOCUS_09360 143230 142019 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_09360 144214 143240 gene locus_tag LOCUS_09370 144214 143240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 144554 147289 gene locus_tag LOCUS_09380 144554 147289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 147589 148920 gene locus_tag LOCUS_09390 147589 148920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 150523 148850 gene locus_tag LOCUS_09400 150523 148850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 151273 150617 gene locus_tag LOCUS_09410 gene aat 151273 150617 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_09410 151813 151349 gene locus_tag LOCUS_09420 151813 151349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 152118 151810 gene locus_tag LOCUS_09430 gene clpS 152118 151810 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_09430 152369 153925 gene locus_tag LOCUS_09440 gene purH 152369 153925 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_09440 154333 153944 gene locus_tag LOCUS_09450 154333 153944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 155050 154334 gene locus_tag LOCUS_09460 155050 154334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 157241 155067 gene locus_tag LOCUS_09470 157241 155067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 158554 157307 gene locus_tag LOCUS_09480 158554 157307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 159723 158956 gene locus_tag LOCUS_09490 159723 158956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 160484 159759 gene locus_tag LOCUS_09500 160484 159759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 161097 160645 gene locus_tag LOCUS_09510 161097 160645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 161997 161110 gene locus_tag LOCUS_09520 gene folD 161997 161110 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_09520 163142 161994 gene locus_tag LOCUS_09530 163142 161994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 163850 163146 gene locus_tag LOCUS_09540 163850 163146 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_09540 164099 163944 gene locus_tag LOCUS_09550 164099 163944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 165003 164614 gene locus_tag LOCUS_09560 165003 164614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 165215 165003 gene locus_tag LOCUS_09570 165215 165003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence007 1754 87 gene locus_tag LOCUS_09580 1754 87 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944001.1 protein_id gnl|my_center|LOCUS_09580 2398 1751 gene locus_tag LOCUS_09590 gene plsY 2398 1751 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814612.1 protein_id gnl|my_center|LOCUS_09590 3690 2662 gene locus_tag LOCUS_09600 3690 2662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_09600 3911 4426 gene locus_tag LOCUS_09610 3911 4426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101563.1 protein_id gnl|my_center|LOCUS_09610 4627 5364 gene locus_tag LOCUS_09620 4627 5364 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804215.1 protein_id gnl|my_center|LOCUS_09620 5454 5828 gene locus_tag LOCUS_09630 5454 5828 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115085.1 protein_id gnl|my_center|LOCUS_09630 5880 6110 gene locus_tag LOCUS_09640 5880 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7338 6370 gene locus_tag LOCUS_09650 7338 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 13070 8172 gene locus_tag LOCUS_09660 13070 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 14211 13444 gene locus_tag LOCUS_09670 14211 13444 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_09670 15482 14250 gene locus_tag LOCUS_09680 15482 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 16551 15535 gene locus_tag LOCUS_09690 16551 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 18327 16630 gene locus_tag LOCUS_09700 18327 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 18499 18317 gene locus_tag LOCUS_09710 18499 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 18842 18492 gene locus_tag LOCUS_09720 18842 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 24981 19510 gene locus_tag LOCUS_09730 24981 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 25836 25159 gene locus_tag LOCUS_09740 25836 25159 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_09740 26979 25996 gene locus_tag LOCUS_09750 26979 25996 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_09750 27424 27059 gene locus_tag LOCUS_09760 gene rbfA 27424 27059 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719600.1 protein_id gnl|my_center|LOCUS_09760 30018 27535 gene locus_tag LOCUS_09770 30018 27535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 31395 30115 gene locus_tag LOCUS_09780 gene nusA 31395 30115 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_09780 31651 32025 gene locus_tag LOCUS_09790 31651 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 34005 32125 gene locus_tag LOCUS_09800 34005 32125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 37298 34173 gene locus_tag LOCUS_09810 37298 34173 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_09810 40662 38248 gene locus_tag LOCUS_09820 40662 38248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 41821 40709 gene locus_tag LOCUS_09830 41821 40709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_09830 43411 41846 gene locus_tag LOCUS_09840 43411 41846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 44841 43684 gene locus_tag LOCUS_09850 44841 43684 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612335.1 protein_id gnl|my_center|LOCUS_09850 45932 44838 gene locus_tag LOCUS_09860 45932 44838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 47392 45929 gene locus_tag LOCUS_09870 gene xylB 47392 45929 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_09870 48805 47396 gene locus_tag LOCUS_09880 gene araA 48805 47396 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_09880 50476 48854 gene locus_tag LOCUS_09890 50476 48854 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09890 52644 50623 gene locus_tag LOCUS_09900 52644 50623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 53801 52641 gene locus_tag LOCUS_09910 53801 52641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 54446 53817 gene locus_tag LOCUS_09920 54446 53817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 54735 56333 gene locus_tag LOCUS_09930 54735 56333 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525369.1 protein_id gnl|my_center|LOCUS_09930 56336 56806 gene locus_tag LOCUS_09940 56336 56806 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525368.1 protein_id gnl|my_center|LOCUS_09940 56793 57980 gene locus_tag LOCUS_09950 56793 57980 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_09950 57990 58682 gene locus_tag LOCUS_09960 57990 58682 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525366.1 protein_id gnl|my_center|LOCUS_09960 58679 60919 gene locus_tag LOCUS_09970 58679 60919 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_09970 60916 61953 gene locus_tag LOCUS_09980 60916 61953 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525364.1 protein_id gnl|my_center|LOCUS_09980 61946 64486 gene locus_tag LOCUS_09990 61946 64486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 64511 65464 gene locus_tag LOCUS_10000 64511 65464 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_10000 66999 65524 gene locus_tag LOCUS_10010 66999 65524 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_10010 67456 67280 gene locus_tag LOCUS_10020 67456 67280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 67533 69764 gene locus_tag LOCUS_10030 67533 69764 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_10030 72419 69813 gene locus_tag LOCUS_10040 gene clpB 72419 69813 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_10040 72792 74021 gene locus_tag LOCUS_10050 72792 74021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 74545 74030 gene locus_tag LOCUS_10060 74545 74030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 75198 74548 gene locus_tag LOCUS_10070 gene rpoE 75198 74548 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_10070 76259 75195 gene locus_tag LOCUS_10080 76259 75195 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_10080 76601 79051 gene locus_tag LOCUS_10090 76601 79051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 79700 79197 gene locus_tag LOCUS_10100 79700 79197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 80915 79728 gene locus_tag LOCUS_10110 gene holA 80915 79728 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_10110 81372 80920 gene locus_tag LOCUS_10120 81372 80920 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882790.1 protein_id gnl|my_center|LOCUS_10120 85346 81543 gene locus_tag LOCUS_10130 gene metH 85346 81543 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262613.1 protein_id gnl|my_center|LOCUS_10130 94322 86046 gene locus_tag LOCUS_10140 94322 86046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 94998 97754 gene locus_tag LOCUS_10150 gene ppdK 94998 97754 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_10150 98016 98480 gene locus_tag LOCUS_10160 gene rpiB 98016 98480 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_10160 99052 98477 gene locus_tag LOCUS_10170 99052 98477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 99444 99049 gene locus_tag LOCUS_10180 99444 99049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 100320 99448 gene locus_tag LOCUS_10190 100320 99448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 101959 100679 gene locus_tag LOCUS_10200 gene argA 101959 100679 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 protein_id gnl|my_center|LOCUS_10200 103096 101978 gene locus_tag LOCUS_10210 gene hisC 103096 101978 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_10210 104199 103141 gene locus_tag LOCUS_10220 gene pta 104199 103141 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_10220 104305 105033 gene locus_tag LOCUS_10230 104305 105033 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_10230 105729 106592 gene locus_tag LOCUS_10240 105729 106592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 106856 108127 gene locus_tag LOCUS_10250 106856 108127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 109250 108216 gene locus_tag LOCUS_10260 109250 108216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 109353 111212 gene locus_tag LOCUS_10270 109353 111212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 111639 112262 gene locus_tag LOCUS_10280 111639 112262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 112470 112727 gene locus_tag LOCUS_10290 gene rpsO 112470 112727 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_10290 112942 115263 gene locus_tag LOCUS_10300 gene pnp 112942 115263 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_10300 115606 116040 gene locus_tag LOCUS_10310 115606 116040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 118416 116260 gene locus_tag LOCUS_10320 118416 116260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 118552 120315 gene locus_tag LOCUS_10330 118552 120315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 120484 121101 gene locus_tag LOCUS_10340 120484 121101 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405033.1 protein_id gnl|my_center|LOCUS_10340 124336 121205 gene locus_tag LOCUS_10350 124336 121205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 124507 125151 gene locus_tag LOCUS_10360 124507 125151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence008 <1 525 gene locus_tag LOCUS_10370 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899131.1:IS110 family transposase 853 533 gene locus_tag LOCUS_10380 853 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 957 1262 gene locus_tag LOCUS_10390 957 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1396 2232 gene locus_tag LOCUS_10400 1396 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2186 2407 gene locus_tag LOCUS_10410 2186 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2797 2516 gene locus_tag LOCUS_10420 2797 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3460 2921 gene locus_tag LOCUS_10430 3460 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3590 4720 gene locus_tag LOCUS_10440 3590 4720 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_10440 4737 7883 gene locus_tag LOCUS_10450 4737 7883 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_10450 8445 10307 gene locus_tag LOCUS_10460 8445 10307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 10304 10915 gene locus_tag LOCUS_10470 10304 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 12335 10968 gene locus_tag LOCUS_10480 12335 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 14023 13259 gene locus_tag LOCUS_10490 14023 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 17289 14272 gene locus_tag LOCUS_10500 17289 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18482 17502 gene locus_tag LOCUS_10510 18482 17502 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_10510 20022 18493 gene locus_tag LOCUS_10520 20022 18493 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227888.1 protein_id gnl|my_center|LOCUS_10520 21024 20149 gene locus_tag LOCUS_10530 21024 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 21123 21350 gene locus_tag LOCUS_10540 21123 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 21596 21943 gene locus_tag LOCUS_10550 21596 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 22021 22314 gene locus_tag LOCUS_10560 22021 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 23515 22715 gene locus_tag LOCUS_10570 23515 22715 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_10570 23983 23639 gene locus_tag LOCUS_10580 23983 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 24850 24056 gene locus_tag LOCUS_10590 24850 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 25263 25832 gene locus_tag LOCUS_10600 25263 25832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 25886 27655 gene locus_tag LOCUS_10610 25886 27655 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_10610 27657 28904 gene locus_tag LOCUS_10620 27657 28904 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328284.1 protein_id gnl|my_center|LOCUS_10620 28942 29358 gene locus_tag LOCUS_10630 gene lspG 28942 29358 CDS product GspG family T2SS major pseudopilin variant LspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_10630 29359 30048 gene locus_tag LOCUS_10640 29359 30048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 30045 30503 gene locus_tag LOCUS_10650 30045 30503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 30500 31183 gene locus_tag LOCUS_10660 30500 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 31180 32562 gene locus_tag LOCUS_10670 31180 32562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 32610 34019 gene locus_tag LOCUS_10680 32610 34019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 33994 34542 gene locus_tag LOCUS_10690 33994 34542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 34539 35513 gene locus_tag LOCUS_10700 34539 35513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 35835 37229 gene locus_tag LOCUS_10710 35835 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 37279 38547 gene locus_tag LOCUS_10720 37279 38547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 38633 40171 gene locus_tag LOCUS_10730 38633 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 40936 41904 gene locus_tag LOCUS_10740 40936 41904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 41946 42482 gene locus_tag LOCUS_10750 41946 42482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 43556 42525 gene locus_tag LOCUS_10760 gene cydB 43556 42525 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_10760 44920 43553 gene locus_tag LOCUS_10770 44920 43553 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_10770 45427 44993 gene locus_tag LOCUS_10780 45427 44993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 45595 45437 gene locus_tag LOCUS_10790 45595 45437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 47220 45592 gene locus_tag LOCUS_10800 47220 45592 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_10800 47414 49294 gene locus_tag LOCUS_10810 gene msbA 47414 49294 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_10810 50154 49324 gene locus_tag LOCUS_10820 50154 49324 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_10820 50253 51404 gene locus_tag LOCUS_10830 50253 51404 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_10830 51525 52370 gene locus_tag LOCUS_10840 51525 52370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 52367 53221 gene locus_tag LOCUS_10850 52367 53221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 53256 55445 gene locus_tag LOCUS_10860 53256 55445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 56551 55535 gene locus_tag LOCUS_10870 56551 55535 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937492.1 protein_id gnl|my_center|LOCUS_10870 57632 56493 gene locus_tag LOCUS_10880 57632 56493 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_10880 57823 58845 gene locus_tag LOCUS_10890 gene pseB 57823 58845 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_10890 58842 60008 gene locus_tag LOCUS_10900 gene pseC 58842 60008 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_10900 60013 61503 gene locus_tag LOCUS_10910 60013 61503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 61500 62588 gene locus_tag LOCUS_10920 gene pseI 61500 62588 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_10920 62585 63331 gene locus_tag LOCUS_10930 62585 63331 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_10930 63343 63990 gene locus_tag LOCUS_10940 63343 63990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 63983 65134 gene locus_tag LOCUS_10950 gene pseA 63983 65134 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_10950 65171 65785 gene locus_tag LOCUS_10960 gene hisH 65171 65785 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_10960 65788 66588 gene locus_tag LOCUS_10970 gene hisF 65788 66588 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_10970 66585 67979 gene locus_tag LOCUS_10980 66585 67979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 68280 68017 gene locus_tag LOCUS_10990 68280 68017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 68395 69117 gene locus_tag LOCUS_11000 68395 69117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 69260 69805 gene locus_tag LOCUS_11010 69260 69805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 69802 71433 gene locus_tag LOCUS_11020 69802 71433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 73416 71467 gene locus_tag LOCUS_11030 73416 71467 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_11030 73478 75544 gene locus_tag LOCUS_11040 73478 75544 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_11040 75765 75520 gene locus_tag LOCUS_11050 75765 75520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 78586 76016 gene locus_tag LOCUS_11060 78586 76016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 79851 78718 gene locus_tag LOCUS_11070 79851 78718 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_11070 80419 79868 gene locus_tag LOCUS_11080 80419 79868 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_11080 88730 81192 gene locus_tag LOCUS_11090 88730 81192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 96793 88955 gene locus_tag LOCUS_11100 96793 88955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 96960 98357 gene locus_tag LOCUS_11110 96960 98357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_11110 99078 98593 gene locus_tag LOCUS_11120 99078 98593 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531184.1 protein_id gnl|my_center|LOCUS_11120 99554 100345 gene locus_tag LOCUS_11130 99554 100345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 101194 100382 gene locus_tag LOCUS_11140 101194 100382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 106274 101205 gene locus_tag LOCUS_11150 106274 101205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 106931 108271 gene locus_tag LOCUS_11160 106931 108271 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_11160 108315 109001 gene locus_tag LOCUS_11170 108315 109001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 109061 110233 gene locus_tag LOCUS_11180 109061 110233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 110295 111977 gene locus_tag LOCUS_11190 110295 111977 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479264.1 protein_id gnl|my_center|LOCUS_11190 113557 113844 gene locus_tag LOCUS_11200 113557 113844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 113859 114035 gene locus_tag LOCUS_11210 113859 114035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 114040 114504 gene locus_tag LOCUS_11220 114040 114504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 115316 115068 gene locus_tag LOCUS_11230 115316 115068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 116118 115480 gene locus_tag LOCUS_11240 116118 115480 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence009 12872 9231 gene locus_tag LOCUS_11250 12872 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 17561 13134 gene locus_tag LOCUS_11260 17561 13134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 18757 17786 gene locus_tag LOCUS_11270 18757 17786 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061733.1 protein_id gnl|my_center|LOCUS_11270 19481 18834 gene locus_tag LOCUS_11280 19481 18834 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_11280 20658 19489 gene locus_tag LOCUS_11290 20658 19489 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_11290 21682 20651 gene locus_tag LOCUS_11300 21682 20651 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_11300 22558 22076 gene locus_tag LOCUS_11310 22558 22076 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_11310 23019 22813 gene locus_tag LOCUS_11320 23019 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 23462 23046 gene locus_tag LOCUS_11330 23462 23046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 25331 23475 gene locus_tag LOCUS_11340 25331 23475 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_11340 26465 25341 gene locus_tag LOCUS_11350 26465 25341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 27887 26871 gene locus_tag LOCUS_11360 27887 26871 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_11360 29077 27956 gene locus_tag LOCUS_11370 29077 27956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 30743 29196 gene locus_tag LOCUS_11380 30743 29196 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061735.1 protein_id gnl|my_center|LOCUS_11380 31726 30779 gene locus_tag LOCUS_11390 31726 30779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 33176 31938 gene locus_tag LOCUS_11400 33176 31938 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088671.1 protein_id gnl|my_center|LOCUS_11400 34683 33805 gene locus_tag LOCUS_11410 34683 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 36938 34926 gene locus_tag LOCUS_11420 36938 34926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 37012 37170 gene locus_tag LOCUS_11430 37012 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 38257 37322 gene locus_tag LOCUS_11440 38257 37322 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_11440 39563 38229 gene locus_tag LOCUS_11450 39563 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 40627 39677 gene locus_tag LOCUS_11460 40627 39677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 41639 40761 gene locus_tag LOCUS_11470 41639 40761 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_11470 42762 41662 gene locus_tag LOCUS_11480 42762 41662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 43937 42825 gene locus_tag LOCUS_11490 gene wecB 43937 42825 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_11490 45292 44195 gene locus_tag LOCUS_11500 45292 44195 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_11500 47294 45456 gene locus_tag LOCUS_11510 47294 45456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 50033 47823 gene locus_tag LOCUS_11520 50033 47823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 50630 50136 gene locus_tag LOCUS_11530 50630 50136 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_11530 51742 50627 gene locus_tag LOCUS_11540 51742 50627 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_11540 52482 51748 gene locus_tag LOCUS_11550 52482 51748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 54030 53347 gene locus_tag LOCUS_11560 54030 53347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 57379 54062 gene locus_tag LOCUS_11570 57379 54062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 58516 59079 gene locus_tag LOCUS_11580 58516 59079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 61164 59110 gene locus_tag LOCUS_11590 61164 59110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 62747 61917 gene locus_tag LOCUS_11600 62747 61917 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_11600 63511 62945 gene locus_tag LOCUS_11610 gene apt 63511 62945 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_11610 64672 63533 gene locus_tag LOCUS_11620 64672 63533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 65574 64699 gene locus_tag LOCUS_11630 65574 64699 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_11630 66277 65660 gene locus_tag LOCUS_11640 66277 65660 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087592.1 protein_id gnl|my_center|LOCUS_11640 66922 66317 gene locus_tag LOCUS_11650 gene recR 66922 66317 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_11650 67308 66994 gene locus_tag LOCUS_11660 67308 66994 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_11660 69102 67360 gene locus_tag LOCUS_11670 gene dnaX 69102 67360 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_11670 69619 71133 gene locus_tag LOCUS_11680 69619 71133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 72582 71188 gene locus_tag LOCUS_11690 72582 71188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 73038 72688 gene locus_tag LOCUS_11700 73038 72688 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325406.1 protein_id gnl|my_center|LOCUS_11700 74156 73098 gene locus_tag LOCUS_11710 gene moaA 74156 73098 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_11710 75019 74153 gene locus_tag LOCUS_11720 75019 74153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 75096 76031 gene locus_tag LOCUS_11730 75096 76031 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_11730 76052 77251 gene locus_tag LOCUS_11740 gene lhgO 76052 77251 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_11740 77280 78212 gene locus_tag LOCUS_11750 77280 78212 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_11750 78221 78961 gene locus_tag LOCUS_11760 78221 78961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 80454 79060 gene locus_tag LOCUS_11770 80454 79060 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_11770 80762 80544 gene locus_tag LOCUS_11780 gene infA 80762 80544 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_11780 80974 81243 gene locus_tag LOCUS_11790 80974 81243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 81250 81627 gene locus_tag LOCUS_11800 81250 81627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 82051 81635 gene locus_tag LOCUS_11810 82051 81635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 82570 82337 gene locus_tag LOCUS_11820 82570 82337 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_11820 83532 83242 gene locus_tag LOCUS_11830 83532 83242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 84117 83704 gene locus_tag LOCUS_11840 84117 83704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 84929 84336 gene locus_tag LOCUS_11850 84929 84336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 85753 84929 gene locus_tag LOCUS_11860 gene lpxI 85753 84929 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_11860 87641 85947 gene locus_tag LOCUS_11870 87641 85947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 88518 87652 gene locus_tag LOCUS_11880 88518 87652 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_11880 88574 90259 gene locus_tag LOCUS_11890 gene recN 88574 90259 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_11890 90434 91525 gene locus_tag LOCUS_11900 gene mqnC 90434 91525 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_11900 92061 92792 gene locus_tag LOCUS_11910 92061 92792 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_11910 93513 92830 gene locus_tag LOCUS_11920 93513 92830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 95479 93539 gene locus_tag LOCUS_11930 gene speA 95479 93539 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_11930 95623 96384 gene locus_tag LOCUS_11940 95623 96384 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_11940 97222 96446 gene locus_tag LOCUS_11950 97222 96446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 98469 97252 gene locus_tag LOCUS_11960 98469 97252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 98778 99821 gene locus_tag LOCUS_11970 98778 99821 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_11970 99824 100888 gene locus_tag LOCUS_11980 99824 100888 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_11980 101416 100991 gene locus_tag LOCUS_11990 101416 100991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 102609 101413 gene locus_tag LOCUS_12000 102609 101413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 103251 102616 gene locus_tag LOCUS_12010 103251 102616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 103967 103278 gene locus_tag LOCUS_12020 103967 103278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 104123 104524 gene locus_tag LOCUS_12030 104123 104524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 104771 105304 gene locus_tag LOCUS_12040 104771 105304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 105310 105519 gene locus_tag LOCUS_12050 105310 105519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 105648 106088 gene locus_tag LOCUS_12060 105648 106088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 107341 106208 gene locus_tag LOCUS_12070 107341 106208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 107499 110879 gene locus_tag LOCUS_12080 107499 110879 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073269.1 protein_id gnl|my_center|LOCUS_12080 111928 110990 gene locus_tag LOCUS_12090 111928 110990 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_12090 113530 112265 gene locus_tag LOCUS_12100 113530 112265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 <114134 113577 gene locus_tag LOCUS_12110 <114134 113577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150490919.1:IS110 family transposase >Feature sequence010 3494 1065 gene locus_tag LOCUS_12120 3494 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5226 3532 gene locus_tag LOCUS_12130 5226 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5887 5669 gene locus_tag LOCUS_12140 5887 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6287 5931 gene locus_tag LOCUS_12150 6287 5931 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_12150 6461 6913 gene locus_tag LOCUS_12160 6461 6913 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_12160 6974 7375 gene locus_tag LOCUS_12170 6974 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7638 8090 gene locus_tag LOCUS_12180 7638 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8351 8785 gene locus_tag LOCUS_12190 8351 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 10260 8971 gene locus_tag LOCUS_12200 10260 8971 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_12200 11227 10370 gene locus_tag LOCUS_12210 11227 10370 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_12210 11401 12342 gene locus_tag LOCUS_12220 11401 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 12502 12804 gene locus_tag LOCUS_12230 12502 12804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 13315 14010 gene locus_tag LOCUS_12240 13315 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14007 15161 gene locus_tag LOCUS_12250 14007 15161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_12250 15168 16367 gene locus_tag LOCUS_12260 15168 16367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_12260 16557 16648 gene locus_tag LOCUS_t00100 16557 16648 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16802 17473 gene locus_tag LOCUS_12270 16802 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 17496 19163 gene locus_tag LOCUS_12280 17496 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 20760 19273 gene locus_tag LOCUS_12290 20760 19273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 21022 22632 gene locus_tag LOCUS_12300 21022 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 24101 22674 gene locus_tag LOCUS_12310 24101 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 25741 24098 gene locus_tag LOCUS_12320 gene xrtU 25741 24098 CDS product exosortase U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921531.1 protein_id gnl|my_center|LOCUS_12320 26155 26910 gene locus_tag LOCUS_12330 26155 26910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 27689 27060 gene locus_tag LOCUS_12340 gene sodA 27689 27060 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_12340 28458 27838 gene locus_tag LOCUS_12350 gene hisH 28458 27838 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_12350 28589 34282 gene locus_tag LOCUS_12360 28589 34282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 34315 34974 gene locus_tag LOCUS_12370 34315 34974 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_12370 35455 37692 gene locus_tag LOCUS_12380 35455 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 37689 39566 gene locus_tag LOCUS_12390 37689 39566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 39634 40434 gene locus_tag LOCUS_12400 39634 40434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 44802 41158 gene locus_tag LOCUS_12410 44802 41158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 47384 45189 gene locus_tag LOCUS_12420 47384 45189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 47659 47471 gene locus_tag LOCUS_12430 47659 47471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 47890 49377 gene locus_tag LOCUS_12440 47890 49377 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_12440 51087 49396 gene locus_tag LOCUS_12450 51087 49396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 52195 51368 gene locus_tag LOCUS_12460 52195 51368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 53642 52287 gene locus_tag LOCUS_12470 53642 52287 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_12470 55910 53712 gene locus_tag LOCUS_12480 55910 53712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 57662 56529 gene locus_tag LOCUS_12490 57662 56529 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_12490 58567 57671 gene locus_tag LOCUS_12500 58567 57671 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12500 58913 59722 gene locus_tag LOCUS_12510 58913 59722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 59797 60837 gene locus_tag LOCUS_12520 59797 60837 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_12520 64258 60860 gene locus_tag LOCUS_12530 64258 60860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 70071 64255 gene locus_tag LOCUS_12540 70071 64255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 71484 70552 gene locus_tag LOCUS_12550 71484 70552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 72267 73664 gene locus_tag LOCUS_12560 72267 73664 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_12560 74347 73688 gene locus_tag LOCUS_12570 gene thrH 74347 73688 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_12570 74492 75760 gene locus_tag LOCUS_12580 74492 75760 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_12580 75761 76498 gene locus_tag LOCUS_12590 75761 76498 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_12590 79150 76523 gene locus_tag LOCUS_12600 79150 76523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 79396 80319 gene locus_tag LOCUS_12610 79396 80319 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_12610 80316 81455 gene locus_tag LOCUS_12620 80316 81455 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_12620 81882 83270 gene locus_tag LOCUS_12630 gene rseP 81882 83270 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 protein_id gnl|my_center|LOCUS_12630 83368 85170 gene locus_tag LOCUS_12640 83368 85170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 86089 85253 gene locus_tag LOCUS_12650 86089 85253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 87701 86106 gene locus_tag LOCUS_12660 87701 86106 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_12660 89179 87698 gene locus_tag LOCUS_12670 89179 87698 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460862.1 protein_id gnl|my_center|LOCUS_12670 89847 89176 gene locus_tag LOCUS_12680 89847 89176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_12680 90790 89849 gene locus_tag LOCUS_12690 90790 89849 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_12690 92877 90787 gene locus_tag LOCUS_12700 gene hyfB 92877 90787 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_12700 93486 93094 gene locus_tag LOCUS_12710 93486 93094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 94170 95039 gene locus_tag LOCUS_12720 gene gluQRS 94170 95039 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_12720 97030 95066 gene locus_tag LOCUS_12730 97030 95066 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946359.1 protein_id gnl|my_center|LOCUS_12730 97273 97887 gene locus_tag LOCUS_12740 97273 97887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 98113 100101 gene locus_tag LOCUS_12750 98113 100101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 100138 102792 gene locus_tag LOCUS_12760 100138 102792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 102875 103996 gene locus_tag LOCUS_12770 102875 103996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 104212 104427 gene locus_tag LOCUS_12780 104212 104427 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_12780 104560 105738 gene locus_tag LOCUS_12790 gene hemW 104560 105738 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_12790 105897 106850 gene locus_tag LOCUS_12800 gene glcK 105897 106850 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_12800 106872 108086 gene locus_tag LOCUS_12810 106872 108086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228603.1 protein_id gnl|my_center|LOCUS_12810 108127 108894 gene locus_tag LOCUS_12820 108127 108894 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_12820 109063 109935 gene locus_tag LOCUS_12830 109063 109935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 110282 112405 gene locus_tag LOCUS_12840 110282 112405 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_12840 112455 113099 gene locus_tag LOCUS_12850 112455 113099 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence011 204 1775 gene locus_tag LOCUS_12860 204 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3214 2084 gene locus_tag LOCUS_12870 3214 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4592 3303 gene locus_tag LOCUS_12880 4592 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5459 4767 gene locus_tag LOCUS_12890 5459 4767 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_12890 7339 5462 gene locus_tag LOCUS_12900 7339 5462 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_12900 9348 7771 gene locus_tag LOCUS_12910 9348 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9568 10275 gene locus_tag LOCUS_12920 9568 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10308 11069 gene locus_tag LOCUS_12930 10308 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11162 12904 gene locus_tag LOCUS_12940 11162 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13009 13881 gene locus_tag LOCUS_12950 13009 13881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_12950 13885 14796 gene locus_tag LOCUS_12960 13885 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 14856 15836 gene locus_tag LOCUS_12970 14856 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 15836 17635 gene locus_tag LOCUS_12980 15836 17635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_12980 17780 18070 gene locus_tag LOCUS_12990 17780 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 18560 18297 gene locus_tag LOCUS_13000 18560 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 19710 18667 gene locus_tag LOCUS_13010 19710 18667 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_13010 20023 20250 gene locus_tag LOCUS_13020 20023 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 20617 20273 gene locus_tag LOCUS_13030 20617 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 21152 20709 gene locus_tag LOCUS_13040 21152 20709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 23411 21351 gene locus_tag LOCUS_13050 23411 21351 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941556.1 protein_id gnl|my_center|LOCUS_13050 23578 24231 gene locus_tag LOCUS_13060 23578 24231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 24332 25183 gene locus_tag LOCUS_13070 24332 25183 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_13070 25433 25218 gene locus_tag LOCUS_13080 gene infA 25433 25218 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556767.1 protein_id gnl|my_center|LOCUS_13080 25879 25562 gene locus_tag LOCUS_13090 25879 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 26189 26797 gene locus_tag LOCUS_13100 26189 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 26918 27661 gene locus_tag LOCUS_13110 gene thiM 26918 27661 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_13110 28530 27664 gene locus_tag LOCUS_13120 28530 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 30204 28666 gene locus_tag LOCUS_13130 30204 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 30272 30895 gene locus_tag LOCUS_13140 30272 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 31236 30892 gene locus_tag LOCUS_13150 31236 30892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 31559 32641 gene locus_tag LOCUS_13160 31559 32641 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13160 32786 33706 gene locus_tag LOCUS_13170 32786 33706 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_13170 33853 34917 gene locus_tag LOCUS_13180 33853 34917 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_13180 36028 38316 gene locus_tag LOCUS_13190 36028 38316 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_13190 38994 38902 gene locus_tag LOCUS_t00110 38994 38902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41335 39167 gene locus_tag LOCUS_13200 41335 39167 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_13200 42776 41403 gene locus_tag LOCUS_13210 42776 41403 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_13210 43847 43341 gene locus_tag LOCUS_13220 43847 43341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 44150 45505 gene locus_tag LOCUS_13230 44150 45505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 45522 46922 gene locus_tag LOCUS_13240 45522 46922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 48422 47022 gene locus_tag LOCUS_13250 48422 47022 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_13250 48613 50073 gene locus_tag LOCUS_13260 48613 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 50098 50571 gene locus_tag LOCUS_13270 50098 50571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 51401 50826 gene locus_tag LOCUS_13280 51401 50826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13280 52940 51702 gene locus_tag LOCUS_13290 52940 51702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 53121 54536 gene locus_tag LOCUS_13300 gene cysS 53121 54536 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_13300 54538 55203 gene locus_tag LOCUS_13310 gene tmk 54538 55203 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_13310 55371 55703 gene locus_tag LOCUS_13320 55371 55703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 55768 57072 gene locus_tag LOCUS_13330 55768 57072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_13330 57749 57096 gene locus_tag LOCUS_13340 57749 57096 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_13340 58436 57756 gene locus_tag LOCUS_13350 gene cmk 58436 57756 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_13350 59748 58462 gene locus_tag LOCUS_13360 gene aroA 59748 58462 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266693.1 protein_id gnl|my_center|LOCUS_13360 60734 59775 gene locus_tag LOCUS_13370 60734 59775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 61317 63470 gene locus_tag LOCUS_13380 61317 63470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 63481 66147 gene locus_tag LOCUS_13390 63481 66147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 66253 66954 gene locus_tag LOCUS_13400 66253 66954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 67056 69758 gene locus_tag LOCUS_13410 67056 69758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 71616 69769 gene locus_tag LOCUS_13420 71616 69769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 72211 71624 gene locus_tag LOCUS_13430 72211 71624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 72792 72208 gene locus_tag LOCUS_13440 72792 72208 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 protein_id gnl|my_center|LOCUS_13440 72985 73551 gene locus_tag LOCUS_13450 72985 73551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 73561 76731 gene locus_tag LOCUS_13460 73561 76731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 76978 77454 gene locus_tag LOCUS_13470 76978 77454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 77978 77493 gene locus_tag LOCUS_13480 77978 77493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_13480 78221 78595 gene locus_tag LOCUS_13490 78221 78595 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_13490 78592 79686 gene locus_tag LOCUS_13500 78592 79686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 79683 80426 gene locus_tag LOCUS_13510 79683 80426 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_13510 82033 80564 gene locus_tag LOCUS_13520 82033 80564 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_13520 83089 82526 gene locus_tag LOCUS_13530 83089 82526 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262127.1 protein_id gnl|my_center|LOCUS_13530 83772 83089 gene locus_tag LOCUS_13540 83772 83089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 84615 83794 gene locus_tag LOCUS_13550 84615 83794 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_13550 84664 85479 gene locus_tag LOCUS_13560 gene nadC 84664 85479 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_13560 85492 86472 gene locus_tag LOCUS_13570 85492 86472 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_13570 86469 87224 gene locus_tag LOCUS_13580 86469 87224 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_13580 87313 88113 gene locus_tag LOCUS_13590 gene trpA 87313 88113 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318459.1 protein_id gnl|my_center|LOCUS_13590 88219 89310 gene locus_tag LOCUS_13600 88219 89310 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_13600 89657 89346 gene locus_tag LOCUS_13610 89657 89346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 90708 89695 gene locus_tag LOCUS_13620 gene glpQ 90708 89695 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706146.1 protein_id gnl|my_center|LOCUS_13620 93430 90974 gene locus_tag LOCUS_13630 gene pheT 93430 90974 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_13630 94455 93436 gene locus_tag LOCUS_13640 gene pheS 94455 93436 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_13640 94926 94555 gene locus_tag LOCUS_13650 gene rplT 94926 94555 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_13650 95175 94966 gene locus_tag LOCUS_13660 95175 94966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 95978 95694 gene locus_tag LOCUS_13670 95978 95694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 96932 95982 gene locus_tag LOCUS_13680 96932 95982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 98721 97279 gene locus_tag LOCUS_13690 98721 97279 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198931.1 protein_id gnl|my_center|LOCUS_13690 98731 100365 gene locus_tag LOCUS_13700 98731 100365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 101620 100388 gene locus_tag LOCUS_13710 101620 100388 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_13710 101780 103039 gene locus_tag LOCUS_13720 101780 103039 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_13720 106406 103056 gene locus_tag LOCUS_13730 106406 103056 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_13730 107253 106408 gene locus_tag LOCUS_13740 107253 106408 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_13740 107382 109403 gene locus_tag LOCUS_13750 107382 109403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 110119 110472 gene locus_tag LOCUS_13760 110119 110472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 110477 111160 gene locus_tag LOCUS_13770 110477 111160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 111307 112110 gene locus_tag LOCUS_13780 111307 112110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence012 816 901 gene locus_tag LOCUS_t00120 816 901 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2093 2326 gene locus_tag LOCUS_13790 2093 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3795 2854 gene locus_tag LOCUS_13800 3795 2854 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530826.1 protein_id gnl|my_center|LOCUS_13800 3915 4793 gene locus_tag LOCUS_13810 3915 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4805 5056 gene locus_tag LOCUS_13820 4805 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5076 6260 gene locus_tag LOCUS_13830 5076 6260 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_13830 6345 6420 gene locus_tag LOCUS_t00130 6345 6420 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7260 6457 gene locus_tag LOCUS_13840 7260 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 9163 7457 gene locus_tag LOCUS_13850 gene cobA 9163 7457 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_13850 10495 9176 gene locus_tag LOCUS_13860 10495 9176 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_13860 11425 10523 gene locus_tag LOCUS_13870 gene cysD 11425 10523 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_13870 12132 11467 gene locus_tag LOCUS_13880 12132 11467 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_13880 13832 12138 gene locus_tag LOCUS_13890 gene cysI 13832 12138 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_13890 14102 13848 gene locus_tag LOCUS_13900 14102 13848 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902713.1 protein_id gnl|my_center|LOCUS_13900 15092 14130 gene locus_tag LOCUS_13910 gene cysK 15092 14130 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_13910 15832 15122 gene locus_tag LOCUS_13920 15832 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 16469 16714 gene locus_tag LOCUS_13930 16469 16714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 17102 17416 gene locus_tag LOCUS_13940 17102 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 17836 17459 gene locus_tag LOCUS_13950 17836 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 17724 18020 gene locus_tag LOCUS_13960 17724 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 17987 18355 gene locus_tag LOCUS_13970 17987 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 18898 18377 gene locus_tag LOCUS_13980 18898 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 19198 19902 gene locus_tag LOCUS_13990 19198 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 19899 20516 gene locus_tag LOCUS_14000 19899 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 20538 22346 gene locus_tag LOCUS_14010 20538 22346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 22333 22980 gene locus_tag LOCUS_14020 22333 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 23372 24496 gene locus_tag LOCUS_14030 23372 24496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 25133 26050 gene locus_tag LOCUS_14040 25133 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 27154 26237 gene locus_tag LOCUS_14050 27154 26237 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_14050 27567 28100 gene locus_tag LOCUS_14060 gene hoxE 27567 28100 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943357.1 protein_id gnl|my_center|LOCUS_14060 28090 29781 gene locus_tag LOCUS_14070 28090 29781 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_14070 29803 30522 gene locus_tag LOCUS_14080 gene hoxU 29803 30522 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_14080 30542 31117 gene locus_tag LOCUS_14090 30542 31117 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_14090 31125 32555 gene locus_tag LOCUS_14100 31125 32555 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_14100 32709 32912 gene locus_tag LOCUS_14110 32709 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 33050 34270 gene locus_tag LOCUS_14120 33050 34270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 34304 35278 gene locus_tag LOCUS_14130 34304 35278 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_14130 35280 35750 gene locus_tag LOCUS_14140 35280 35750 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_14140 37180 35747 gene locus_tag LOCUS_14150 37180 35747 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_14150 38371 37253 gene locus_tag LOCUS_14160 38371 37253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 40248 38869 gene locus_tag LOCUS_14170 40248 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 40717 42174 gene locus_tag LOCUS_14180 40717 42174 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066243.1 protein_id gnl|my_center|LOCUS_14180 42176 43318 gene locus_tag LOCUS_14190 42176 43318 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_14190 43715 43350 gene locus_tag LOCUS_14200 43715 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 44628 43669 gene locus_tag LOCUS_14210 44628 43669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 45236 44640 gene locus_tag LOCUS_14220 45236 44640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 45737 45318 gene locus_tag LOCUS_14230 45737 45318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 46245 45739 gene locus_tag LOCUS_14240 46245 45739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 46836 46351 gene locus_tag LOCUS_14250 46836 46351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 47985 46930 gene locus_tag LOCUS_14260 gene trpD 47985 46930 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_14260 48918 52016 gene locus_tag LOCUS_14270 48918 52016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 52502 52098 gene locus_tag LOCUS_14280 52502 52098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 52704 52778 gene locus_tag LOCUS_t00140 52704 52778 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52894 53265 gene locus_tag LOCUS_14290 52894 53265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 53326 55239 gene locus_tag LOCUS_14300 53326 55239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 55324 56535 gene locus_tag LOCUS_14310 55324 56535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 56560 57750 gene locus_tag LOCUS_14320 56560 57750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 59739 57829 gene locus_tag LOCUS_14330 59739 57829 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14330 60195 62612 gene locus_tag LOCUS_14340 60195 62612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 62822 64828 gene locus_tag LOCUS_14350 62822 64828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 65000 67036 gene locus_tag LOCUS_14360 65000 67036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 67175 68014 gene locus_tag LOCUS_14370 67175 68014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 70317 68245 gene locus_tag LOCUS_14380 70317 68245 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14380 70472 70777 gene locus_tag LOCUS_14390 70472 70777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 71458 70793 gene locus_tag LOCUS_14400 71458 70793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 72221 71538 gene locus_tag LOCUS_14410 72221 71538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 74660 72894 gene locus_tag LOCUS_14420 74660 72894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 75832 75122 gene locus_tag LOCUS_14430 gene radC 75832 75122 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392073.1 protein_id gnl|my_center|LOCUS_14430 79153 76280 gene locus_tag LOCUS_14440 79153 76280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 80128 79238 gene locus_tag LOCUS_14450 80128 79238 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_14450 80240 81103 gene locus_tag LOCUS_14460 80240 81103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 81615 82643 gene locus_tag LOCUS_14470 81615 82643 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_14470 82650 82862 gene locus_tag LOCUS_14480 82650 82862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 83028 84452 gene locus_tag LOCUS_14490 gene fucP 83028 84452 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_14490 86248 84527 gene locus_tag LOCUS_14500 86248 84527 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_14500 87686 86256 gene locus_tag LOCUS_14510 87686 86256 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_14510 90646 87683 gene locus_tag LOCUS_14520 90646 87683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 91474 90722 gene locus_tag LOCUS_14530 91474 90722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 95751 91537 gene locus_tag LOCUS_14540 95751 91537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 98660 96237 gene locus_tag LOCUS_14550 98660 96237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 100356 99427 gene locus_tag LOCUS_14560 100356 99427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 102021 100489 gene locus_tag LOCUS_14570 102021 100489 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_14570 104474 102156 gene locus_tag LOCUS_14580 104474 102156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 105564 104596 gene locus_tag LOCUS_14590 105564 104596 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_14590 108390 105586 gene locus_tag LOCUS_14600 108390 105586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 109097 108474 gene locus_tag LOCUS_14610 109097 108474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_14610 112060 109100 gene locus_tag LOCUS_14620 112060 109100 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence013 621 821 gene locus_tag LOCUS_14630 621 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 4135 1586 gene locus_tag LOCUS_14640 4135 1586 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_14640 4308 4493 gene locus_tag LOCUS_14650 4308 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5144 4707 gene locus_tag LOCUS_14660 gene nikR 5144 4707 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_14660 5358 6914 gene locus_tag LOCUS_14670 5358 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7510 7211 gene locus_tag LOCUS_14680 7510 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10155 7969 gene locus_tag LOCUS_14690 10155 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 11604 10189 gene locus_tag LOCUS_14700 11604 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 12157 13293 gene locus_tag LOCUS_14710 12157 13293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 13359 14090 gene locus_tag LOCUS_14720 13359 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 14164 15612 gene locus_tag LOCUS_14730 14164 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 15939 16832 gene locus_tag LOCUS_14740 15939 16832 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_14740 19294 17471 gene locus_tag LOCUS_14750 gene thiC 19294 17471 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521865.1 protein_id gnl|my_center|LOCUS_14750 19830 21629 gene locus_tag LOCUS_14760 gene kdpA 19830 21629 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529643.1 protein_id gnl|my_center|LOCUS_14760 21709 23733 gene locus_tag LOCUS_14770 gene kdpB 21709 23733 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704756.1 protein_id gnl|my_center|LOCUS_14770 23736 24326 gene locus_tag LOCUS_14780 23736 24326 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_14780 24405 27086 gene locus_tag LOCUS_14790 24405 27086 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_14790 27089 27790 gene locus_tag LOCUS_14800 27089 27790 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_14800 30822 27760 gene locus_tag LOCUS_14810 30822 27760 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_14810 32526 31003 gene locus_tag LOCUS_14820 32526 31003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 33856 32540 gene locus_tag LOCUS_14830 33856 32540 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_14830 34346 33948 gene locus_tag LOCUS_14840 34346 33948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 34441 35373 gene locus_tag LOCUS_14850 gene fabD 34441 35373 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_14850 35430 36173 gene locus_tag LOCUS_14860 gene fabG 35430 36173 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_14860 36249 36494 gene locus_tag LOCUS_14870 gene acpP 36249 36494 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_14870 36620 37819 gene locus_tag LOCUS_14880 gene fabF 36620 37819 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_14880 40579 38033 gene locus_tag LOCUS_14890 gene hrpB 40579 38033 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_14890 40683 41081 gene locus_tag LOCUS_14900 40683 41081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 41914 42390 gene locus_tag LOCUS_14910 gene ispF 41914 42390 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_14910 42447 42719 gene locus_tag LOCUS_14920 42447 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 42794 43594 gene locus_tag LOCUS_14930 42794 43594 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_14930 43569 44936 gene locus_tag LOCUS_14940 43569 44936 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_14940 44936 45391 gene locus_tag LOCUS_14950 44936 45391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 46375 45440 gene locus_tag LOCUS_14960 46375 45440 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_14960 50099 46743 gene locus_tag LOCUS_14970 50099 46743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 52289 50670 gene locus_tag LOCUS_14980 52289 50670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 53270 52614 gene locus_tag LOCUS_14990 53270 52614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 53510 53761 gene locus_tag LOCUS_15000 53510 53761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 55107 53845 gene locus_tag LOCUS_15010 55107 53845 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_15010 57068 55767 gene locus_tag LOCUS_15020 gene ftsZ 57068 55767 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_15020 58309 57086 gene locus_tag LOCUS_15030 gene ftsA 58309 57086 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_15030 59174 58302 gene locus_tag LOCUS_15040 59174 58302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 60183 59263 gene locus_tag LOCUS_15050 60183 59263 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_15050 61124 60180 gene locus_tag LOCUS_15060 gene murB 61124 60180 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_15060 61810 61124 gene locus_tag LOCUS_15070 61810 61124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 63531 62383 gene locus_tag LOCUS_15080 gene spoVE 63531 62383 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_15080 64335 63589 gene locus_tag LOCUS_15090 64335 63589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 65556 64453 gene locus_tag LOCUS_15100 65556 64453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 66706 65558 gene locus_tag LOCUS_15110 gene mraY 66706 65558 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689450.1 protein_id gnl|my_center|LOCUS_15110 68104 66707 gene locus_tag LOCUS_15120 gene murF 68104 66707 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_15120 70299 68386 gene locus_tag LOCUS_15130 70299 68386 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_15130 70909 70523 gene locus_tag LOCUS_15140 70909 70523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 71895 70957 gene locus_tag LOCUS_15150 gene rsmH 71895 70957 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_15150 72447 71917 gene locus_tag LOCUS_15160 72447 71917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 72923 72459 gene locus_tag LOCUS_15170 72923 72459 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388714.1 protein_id gnl|my_center|LOCUS_15170 73248 74330 gene locus_tag LOCUS_15180 gene queA 73248 74330 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836693.1 protein_id gnl|my_center|LOCUS_15180 74327 75061 gene locus_tag LOCUS_15190 74327 75061 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_15190 76348 75848 gene locus_tag LOCUS_15200 76348 75848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 76935 76345 gene locus_tag LOCUS_15210 76935 76345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 77609 76932 gene locus_tag LOCUS_15220 77609 76932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 78650 77625 gene locus_tag LOCUS_15230 78650 77625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 78774 79121 gene locus_tag LOCUS_15240 78774 79121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 79859 79527 gene locus_tag LOCUS_15250 79859 79527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 80820 79948 gene locus_tag LOCUS_15260 80820 79948 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_15260 81285 83459 gene locus_tag LOCUS_15270 81285 83459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 84925 83645 gene locus_tag LOCUS_15280 84925 83645 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15280 84955 85338 gene locus_tag LOCUS_15290 84955 85338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 86840 85383 gene locus_tag LOCUS_15300 86840 85383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 88419 87049 gene locus_tag LOCUS_15310 88419 87049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 91237 88793 gene locus_tag LOCUS_15320 91237 88793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 92806 91286 gene locus_tag LOCUS_15330 92806 91286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 93810 92857 gene locus_tag LOCUS_15340 93810 92857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 94443 94003 gene locus_tag LOCUS_15350 94443 94003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 97234 94649 gene locus_tag LOCUS_15360 97234 94649 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_15360 97666 97247 gene locus_tag LOCUS_15370 97666 97247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 100725 97906 gene locus_tag LOCUS_15380 gene leuS 100725 97906 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_15380 101037 101819 gene locus_tag LOCUS_15390 gene rdgB 101037 101819 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403926.1 protein_id gnl|my_center|LOCUS_15390 101940 103127 gene locus_tag LOCUS_15400 101940 103127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 103177 104211 gene locus_tag LOCUS_15410 103177 104211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence014 439 125 gene locus_tag LOCUS_15420 439 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15420 817 593 gene locus_tag LOCUS_15430 817 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 734 2263 gene locus_tag LOCUS_15440 734 2263 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_15440 2298 3671 gene locus_tag LOCUS_15450 2298 3671 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_15450 4835 3897 gene locus_tag LOCUS_15460 4835 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4722 5054 gene locus_tag LOCUS_15470 4722 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6896 5322 gene locus_tag LOCUS_15480 6896 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7018 8322 gene locus_tag LOCUS_15490 7018 8322 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_15490 8409 9107 gene locus_tag LOCUS_15500 8409 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9390 9136 gene locus_tag LOCUS_15510 9390 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 9875 9414 gene locus_tag LOCUS_15520 9875 9414 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_15520 12011 9963 gene locus_tag LOCUS_15530 12011 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 13189 12635 gene locus_tag LOCUS_15540 13189 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 14786 13296 gene locus_tag LOCUS_15550 14786 13296 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_15550 16925 14901 gene locus_tag LOCUS_15560 16925 14901 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_15560 18172 17168 gene locus_tag LOCUS_15570 18172 17168 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_15570 21809 18192 gene locus_tag LOCUS_15580 gene nifJ 21809 18192 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_15580 24972 22222 gene locus_tag LOCUS_15590 24972 22222 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_15590 25457 24969 gene locus_tag LOCUS_15600 25457 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814545.1 protein_id gnl|my_center|LOCUS_15600 26824 25616 gene locus_tag LOCUS_15610 26824 25616 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_15610 27555 26821 gene locus_tag LOCUS_15620 27555 26821 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_15620 28709 27681 gene locus_tag LOCUS_15630 28709 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 30431 29076 gene locus_tag LOCUS_15640 30431 29076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140349.1 protein_id gnl|my_center|LOCUS_15640 31882 30428 gene locus_tag LOCUS_15650 31882 30428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_15650 32619 31879 gene locus_tag LOCUS_15660 32619 31879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_15660 33917 32655 gene locus_tag LOCUS_15670 gene macA 33917 32655 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397100.1 protein_id gnl|my_center|LOCUS_15670 34054 34956 gene locus_tag LOCUS_15680 34054 34956 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817975.1 protein_id gnl|my_center|LOCUS_15680 37050 35440 gene locus_tag LOCUS_15690 37050 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 38409 37087 gene locus_tag LOCUS_15700 38409 37087 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_15700 38547 39848 gene locus_tag LOCUS_15710 gene serS 38547 39848 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_15710 39892 41388 gene locus_tag LOCUS_15720 gene glgA 39892 41388 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_15720 42496 41405 gene locus_tag LOCUS_15730 42496 41405 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_15730 43879 42800 gene locus_tag LOCUS_15740 43879 42800 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_15740 44515 43886 gene locus_tag LOCUS_15750 44515 43886 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_15750 44631 45986 gene locus_tag LOCUS_15760 44631 45986 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_15760 46149 45970 gene locus_tag LOCUS_15770 46149 45970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 46954 47958 gene locus_tag LOCUS_15780 46954 47958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 47955 48632 gene locus_tag LOCUS_15790 47955 48632 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_15790 48638 49009 gene locus_tag LOCUS_15800 48638 49009 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496980.1 protein_id gnl|my_center|LOCUS_15800 49642 49025 gene locus_tag LOCUS_15810 49642 49025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 51596 50064 gene locus_tag LOCUS_15820 51596 50064 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_15820 51736 52131 gene locus_tag LOCUS_15830 51736 52131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 53565 52276 gene locus_tag LOCUS_15840 53565 52276 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_15840 54740 53568 gene locus_tag LOCUS_15850 gene pqqE 54740 53568 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969547.1 protein_id gnl|my_center|LOCUS_15850 55136 55702 gene locus_tag LOCUS_15860 55136 55702 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_15860 56067 55825 gene locus_tag LOCUS_15870 56067 55825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 57171 56236 gene locus_tag LOCUS_15880 57171 56236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_15880 57538 57837 gene locus_tag LOCUS_15890 57538 57837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 57873 59249 gene locus_tag LOCUS_15900 gene lat 57873 59249 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869888.1 protein_id gnl|my_center|LOCUS_15900 59317 60885 gene locus_tag LOCUS_15910 59317 60885 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388038.1 protein_id gnl|my_center|LOCUS_15910 60973 61743 gene locus_tag LOCUS_15920 60973 61743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_15920 61740 62486 gene locus_tag LOCUS_15930 61740 62486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_15930 62488 63525 gene locus_tag LOCUS_15940 62488 63525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 63533 64546 gene locus_tag LOCUS_15950 63533 64546 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_15950 64558 64794 gene locus_tag LOCUS_15960 64558 64794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 64775 66154 gene locus_tag LOCUS_15970 64775 66154 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_15970 66950 66246 gene locus_tag LOCUS_15980 gene rsmI 66950 66246 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_15980 67747 66950 gene locus_tag LOCUS_15990 gene lpxA 67747 66950 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_15990 69114 67759 gene locus_tag LOCUS_16000 69114 67759 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_16000 69801 69196 gene locus_tag LOCUS_16010 69801 69196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 70906 69803 gene locus_tag LOCUS_16020 gene aroB 70906 69803 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142508.1 protein_id gnl|my_center|LOCUS_16020 71039 71836 gene locus_tag LOCUS_16030 71039 71836 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_16030 71842 73269 gene locus_tag LOCUS_16040 71842 73269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 74244 73336 gene locus_tag LOCUS_16050 gene rarD 74244 73336 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044965.1 protein_id gnl|my_center|LOCUS_16050 74818 76380 gene locus_tag LOCUS_16060 74818 76380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 76437 78455 gene locus_tag LOCUS_16070 gene ftsH 76437 78455 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709279.1 protein_id gnl|my_center|LOCUS_16070 78958 79686 gene locus_tag LOCUS_16080 gene rpe 78958 79686 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392431.1 protein_id gnl|my_center|LOCUS_16080 79710 81125 gene locus_tag LOCUS_16090 79710 81125 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence015 812 2569 gene locus_tag LOCUS_16100 812 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3850 2675 gene locus_tag LOCUS_16110 3850 2675 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_16110 4789 3929 gene locus_tag LOCUS_16120 4789 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5856 4870 gene locus_tag LOCUS_16130 5856 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 6395 5856 gene locus_tag LOCUS_16140 6395 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8293 9276 gene locus_tag LOCUS_16150 gene cysK 8293 9276 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_16150 9470 10612 gene locus_tag LOCUS_16160 gene rho 9470 10612 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311067.1 protein_id gnl|my_center|LOCUS_16160 12894 10696 gene locus_tag LOCUS_16170 12894 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 13688 12912 gene locus_tag LOCUS_16180 13688 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 14913 13759 gene locus_tag LOCUS_16190 14913 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 16066 15818 gene locus_tag LOCUS_16200 16066 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 15948 18707 gene locus_tag LOCUS_16210 15948 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 18856 20175 gene locus_tag LOCUS_16220 18856 20175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 20988 20248 gene locus_tag LOCUS_16230 20988 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 21212 22576 gene locus_tag LOCUS_16240 21212 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 23860 25236 gene locus_tag LOCUS_16250 23860 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 26057 25665 gene locus_tag LOCUS_16260 26057 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 27202 26174 gene locus_tag LOCUS_16270 27202 26174 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_16270 27980 27372 gene locus_tag LOCUS_16280 gene rpsD 27980 27372 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_16280 28680 28018 gene locus_tag LOCUS_16290 28680 28018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 29123 28728 gene locus_tag LOCUS_16300 gene rpsM 29123 28728 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_16300 30240 29464 gene locus_tag LOCUS_16310 gene map 30240 29464 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_16310 31631 30240 gene locus_tag LOCUS_16320 gene secY 31631 30240 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_16320 32192 31704 gene locus_tag LOCUS_16330 gene rplO 32192 31704 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986622.1 protein_id gnl|my_center|LOCUS_16330 32867 32199 gene locus_tag LOCUS_16340 32867 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 33236 32871 gene locus_tag LOCUS_16350 gene rplR 33236 32871 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_16350 33819 33283 gene locus_tag LOCUS_16360 gene rplF 33819 33283 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_16360 34268 33882 gene locus_tag LOCUS_16370 gene rpsH 34268 33882 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183034.1 protein_id gnl|my_center|LOCUS_16370 34543 34274 gene locus_tag LOCUS_16380 gene rpsN 34543 34274 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293413.1 protein_id gnl|my_center|LOCUS_16380 35158 34550 gene locus_tag LOCUS_16390 gene rplE 35158 34550 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_16390 35479 35183 gene locus_tag LOCUS_16400 35479 35183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 35844 35479 gene locus_tag LOCUS_16410 gene rplN 35844 35479 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_16410 36189 35887 gene locus_tag LOCUS_16420 gene rpsQ 36189 35887 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_16420 36405 36199 gene locus_tag LOCUS_16430 gene rpmC 36405 36199 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583353.1 protein_id gnl|my_center|LOCUS_16430 36850 36428 gene locus_tag LOCUS_16440 gene rplP 36850 36428 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_16440 37541 36876 gene locus_tag LOCUS_16450 gene rpsC 37541 36876 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_16450 37898 37545 gene locus_tag LOCUS_16460 gene rplV 37898 37545 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262335.1 protein_id gnl|my_center|LOCUS_16460 38184 37903 gene locus_tag LOCUS_16470 gene rpsS 38184 37903 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_16470 39051 38197 gene locus_tag LOCUS_16480 gene rplB 39051 38197 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_16480 39911 40387 gene locus_tag LOCUS_16490 39911 40387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 42903 40588 gene locus_tag LOCUS_16500 42903 40588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 43136 43426 gene locus_tag LOCUS_16510 43136 43426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 43457 44257 gene locus_tag LOCUS_16520 43457 44257 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_16520 44440 45216 gene locus_tag LOCUS_16530 44440 45216 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_16530 45271 45717 gene locus_tag LOCUS_16540 45271 45717 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_16540 46086 45730 gene locus_tag LOCUS_16550 46086 45730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 47167 46097 gene locus_tag LOCUS_16560 47167 46097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 47687 47211 gene locus_tag LOCUS_16570 47687 47211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 47850 48656 gene locus_tag LOCUS_16580 47850 48656 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_16580 48670 49527 gene locus_tag LOCUS_16590 48670 49527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170564.1 protein_id gnl|my_center|LOCUS_16590 50083 51486 gene locus_tag LOCUS_16600 50083 51486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 54776 51543 gene locus_tag LOCUS_16610 gene lacZ 54776 51543 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_16610 55713 54871 gene locus_tag LOCUS_16620 55713 54871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 55826 56212 gene locus_tag LOCUS_16630 55826 56212 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_16630 56576 56403 gene locus_tag LOCUS_16640 56576 56403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 59204 56766 gene locus_tag LOCUS_16650 gene bamA 59204 56766 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_16650 60675 59215 gene locus_tag LOCUS_16660 gene dnaB 60675 59215 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_16660 61255 60767 gene locus_tag LOCUS_16670 61255 60767 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_16670 62677 61619 gene locus_tag LOCUS_16680 62677 61619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 63048 65474 gene locus_tag LOCUS_16690 63048 65474 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_16690 65485 67884 gene locus_tag LOCUS_16700 65485 67884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 67990 69729 gene locus_tag LOCUS_16710 67990 69729 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_16710 69742 72162 gene locus_tag LOCUS_16720 69742 72162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 73041 76160 gene locus_tag LOCUS_16730 73041 76160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence016 683 2809 gene locus_tag LOCUS_16740 683 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3884 2940 gene locus_tag LOCUS_16750 3884 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 4134 4466 gene locus_tag LOCUS_16760 4134 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5008 4481 gene locus_tag LOCUS_16770 5008 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5963 5028 gene locus_tag LOCUS_16780 5963 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 6528 5965 gene locus_tag LOCUS_16790 6528 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6788 8317 gene locus_tag LOCUS_16800 6788 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_16800 9134 8250 gene locus_tag LOCUS_16810 9134 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 9214 9678 gene locus_tag LOCUS_16820 9214 9678 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706696.1 protein_id gnl|my_center|LOCUS_16820 9741 11483 gene locus_tag LOCUS_16830 9741 11483 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_16830 11520 11882 gene locus_tag LOCUS_16840 11520 11882 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_16840 12000 12581 gene locus_tag LOCUS_16850 12000 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12578 12847 gene locus_tag LOCUS_16860 12578 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 13431 14675 gene locus_tag LOCUS_16870 13431 14675 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_16870 15269 14703 gene locus_tag LOCUS_16880 15269 14703 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_16880 15365 17077 gene locus_tag LOCUS_16890 15365 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 20242 17276 gene locus_tag LOCUS_16900 20242 17276 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_16900 22320 20815 gene locus_tag LOCUS_16910 gene der 22320 20815 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296982.1 protein_id gnl|my_center|LOCUS_16910 23516 22473 gene locus_tag LOCUS_16920 23516 22473 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_16920 24005 23676 gene locus_tag LOCUS_16930 24005 23676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 25424 24057 gene locus_tag LOCUS_16940 25424 24057 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_16940 26154 25435 gene locus_tag LOCUS_16950 26154 25435 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_16950 26618 27043 gene locus_tag LOCUS_16960 26618 27043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 27621 29810 gene locus_tag LOCUS_16970 gene rnr 27621 29810 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_16970 30302 29781 gene locus_tag LOCUS_16980 30302 29781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 30823 30299 gene locus_tag LOCUS_16990 gene lepB 30823 30299 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_16990 30954 32282 gene locus_tag LOCUS_17000 30954 32282 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_17000 32279 33481 gene locus_tag LOCUS_17010 32279 33481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 33541 34452 gene locus_tag LOCUS_17020 33541 34452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 34489 35379 gene locus_tag LOCUS_17030 gene glpG 34489 35379 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 protein_id gnl|my_center|LOCUS_17030 35625 35888 gene locus_tag LOCUS_17040 35625 35888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 36467 35952 gene locus_tag LOCUS_17050 36467 35952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 36604 36528 gene locus_tag LOCUS_t00150 36604 36528 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38119 36704 gene locus_tag LOCUS_17060 gene lpdA 38119 36704 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_17060 39565 38246 gene locus_tag LOCUS_17070 39565 38246 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_17070 40658 39591 gene locus_tag LOCUS_17080 40658 39591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 41625 40741 gene locus_tag LOCUS_17090 41625 40741 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_17090 44371 41651 gene locus_tag LOCUS_17100 gene aceE 44371 41651 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_17100 44485 45204 gene locus_tag LOCUS_17110 44485 45204 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_17110 45825 47258 gene locus_tag LOCUS_17120 45825 47258 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922239.1 protein_id gnl|my_center|LOCUS_17120 47364 48767 gene locus_tag LOCUS_17130 47364 48767 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_17130 50746 49103 gene locus_tag LOCUS_17140 gene hcp 50746 49103 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941334.1 protein_id gnl|my_center|LOCUS_17140 51140 53089 gene locus_tag LOCUS_17150 51140 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 53198 54079 gene locus_tag LOCUS_17160 53198 54079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 54287 55024 gene locus_tag LOCUS_17170 54287 55024 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 protein_id gnl|my_center|LOCUS_17170 58782 55057 gene locus_tag LOCUS_17180 gene smc 58782 55057 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_17180 59117 60715 gene locus_tag LOCUS_17190 59117 60715 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231519.1 protein_id gnl|my_center|LOCUS_17190 61326 60748 gene locus_tag LOCUS_17200 61326 60748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 62499 61822 gene locus_tag LOCUS_17210 62499 61822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_17210 63695 62496 gene locus_tag LOCUS_17220 63695 62496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 64307 63846 gene locus_tag LOCUS_17230 64307 63846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_17230 65701 64304 gene locus_tag LOCUS_17240 65701 64304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 66234 65776 gene locus_tag LOCUS_17250 66234 65776 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_17250 66605 66366 gene locus_tag LOCUS_17260 66605 66366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 70559 66807 gene locus_tag LOCUS_17270 70559 66807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 71875 70775 gene locus_tag LOCUS_17280 71875 70775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence017 209 424 gene locus_tag LOCUS_17290 209 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 571 1104 gene locus_tag LOCUS_17300 571 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1309 3114 gene locus_tag LOCUS_17310 1309 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3774 3262 gene locus_tag LOCUS_17320 3774 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4695 4189 gene locus_tag LOCUS_17330 4695 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6206 4698 gene locus_tag LOCUS_17340 6206 4698 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 protein_id gnl|my_center|LOCUS_17340 6835 6230 gene locus_tag LOCUS_17350 6835 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7466 6813 gene locus_tag LOCUS_17360 7466 6813 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_17360 8422 7757 gene locus_tag LOCUS_17370 8422 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10139 8592 gene locus_tag LOCUS_17380 gene ggt 10139 8592 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595080.1 protein_id gnl|my_center|LOCUS_17380 10346 11338 gene locus_tag LOCUS_17390 10346 11338 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_17390 12172 12259 gene locus_tag LOCUS_t00160 12172 12259 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13083 12298 gene locus_tag LOCUS_17400 13083 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 13676 13212 gene locus_tag LOCUS_17410 13676 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 15057 13582 gene locus_tag LOCUS_17420 15057 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17420 16613 15198 gene locus_tag LOCUS_17430 16613 15198 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_17430 16753 17967 gene locus_tag LOCUS_17440 16753 17967 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_17440 18201 17905 gene locus_tag LOCUS_17450 18201 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 18728 18198 gene locus_tag LOCUS_17460 18728 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 19129 18725 gene locus_tag LOCUS_17470 19129 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 20319 19123 gene locus_tag LOCUS_17480 20319 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 21324 20326 gene locus_tag LOCUS_17490 21324 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 22972 21782 gene locus_tag LOCUS_17500 gene gspE 22972 21782 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 protein_id gnl|my_center|LOCUS_17500 23268 23843 gene locus_tag LOCUS_17510 23268 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123417.1 protein_id gnl|my_center|LOCUS_17510 24239 23925 gene locus_tag LOCUS_17520 24239 23925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 24204 24530 gene locus_tag LOCUS_17530 24204 24530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 29996 24537 gene locus_tag LOCUS_17540 29996 24537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 30152 32182 gene locus_tag LOCUS_17550 30152 32182 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401304.1 protein_id gnl|my_center|LOCUS_17550 32356 33027 gene locus_tag LOCUS_17560 32356 33027 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 protein_id gnl|my_center|LOCUS_17560 36202 33092 gene locus_tag LOCUS_17570 36202 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 36317 36724 gene locus_tag LOCUS_17580 36317 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 36862 37443 gene locus_tag LOCUS_17590 gene lepB 36862 37443 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583882.1 protein_id gnl|my_center|LOCUS_17590 37727 37888 gene locus_tag LOCUS_17600 37727 37888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 38022 39113 gene locus_tag LOCUS_17610 gene bioB 38022 39113 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_17610 39177 39971 gene locus_tag LOCUS_17620 39177 39971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 40431 39988 gene locus_tag LOCUS_17630 40431 39988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 41526 40561 gene locus_tag LOCUS_17640 41526 40561 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_17640 44774 41823 gene locus_tag LOCUS_17650 gene gcvP 44774 41823 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_17650 45578 45075 gene locus_tag LOCUS_17660 45578 45075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 47192 45585 gene locus_tag LOCUS_17670 47192 45585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 49684 47189 gene locus_tag LOCUS_17680 49684 47189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 51183 49681 gene locus_tag LOCUS_17690 51183 49681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 51566 51189 gene locus_tag LOCUS_17700 51566 51189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 52297 51824 gene locus_tag LOCUS_17710 52297 51824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 52867 52316 gene locus_tag LOCUS_17720 52867 52316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 53307 52870 gene locus_tag LOCUS_17730 53307 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 53828 53304 gene locus_tag LOCUS_17740 53828 53304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 54098 54877 gene locus_tag LOCUS_17750 54098 54877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 55029 55298 gene locus_tag LOCUS_17760 55029 55298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 55295 55591 gene locus_tag LOCUS_17770 55295 55591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 55540 55917 gene locus_tag LOCUS_17780 55540 55917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 56351 56539 gene locus_tag LOCUS_17790 56351 56539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 58576 57350 gene locus_tag LOCUS_17800 58576 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 60371 58581 gene locus_tag LOCUS_17810 gene lepA 60371 58581 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence018 319 20 gene locus_tag LOCUS_17820 319 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 676 374 gene locus_tag LOCUS_17830 676 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1407 685 gene locus_tag LOCUS_17840 1407 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 3998 2274 gene locus_tag LOCUS_17850 3998 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5085 7514 gene locus_tag LOCUS_17860 5085 7514 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_17860 9821 7671 gene locus_tag LOCUS_17870 gene recQ 9821 7671 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_17870 10806 9961 gene locus_tag LOCUS_17880 10806 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 12875 10818 gene locus_tag LOCUS_17890 12875 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 13074 14390 gene locus_tag LOCUS_17900 13074 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 15038 14469 gene locus_tag LOCUS_17910 15038 14469 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186966.1 protein_id gnl|my_center|LOCUS_17910 16964 15120 gene locus_tag LOCUS_17920 gene thrS 16964 15120 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_17920 17433 17020 gene locus_tag LOCUS_17930 17433 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 19009 17450 gene locus_tag LOCUS_17940 19009 17450 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938119.1 protein_id gnl|my_center|LOCUS_17940 19366 19103 gene locus_tag LOCUS_17950 19366 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 19265 19516 gene locus_tag LOCUS_17960 19265 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 21279 19651 gene locus_tag LOCUS_17970 21279 19651 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_17970 22592 21294 gene locus_tag LOCUS_17980 22592 21294 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_17980 25550 22653 gene locus_tag LOCUS_17990 25550 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 25768 26223 gene locus_tag LOCUS_18000 25768 26223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 26613 27029 gene locus_tag LOCUS_18010 26613 27029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 27208 27026 gene locus_tag LOCUS_18020 27208 27026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 27171 29483 gene locus_tag LOCUS_18030 gene lon 27171 29483 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_18030 29546 30325 gene locus_tag LOCUS_18040 29546 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 30398 30970 gene locus_tag LOCUS_18050 gene rpoE 30398 30970 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_18050 30977 31204 gene locus_tag LOCUS_18060 30977 31204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 31217 32764 gene locus_tag LOCUS_18070 31217 32764 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_18070 32978 33814 gene locus_tag LOCUS_18080 32978 33814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 33811 34872 gene locus_tag LOCUS_18090 33811 34872 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_18090 34931 36151 gene locus_tag LOCUS_18100 34931 36151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 36535 36137 gene locus_tag LOCUS_18110 36535 36137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 36969 37859 gene locus_tag LOCUS_18120 gene larE 36969 37859 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_18120 38054 39331 gene locus_tag LOCUS_18130 38054 39331 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_18130 39336 39908 gene locus_tag LOCUS_18140 39336 39908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 39905 40375 gene locus_tag LOCUS_18150 39905 40375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 40375 41208 gene locus_tag LOCUS_18160 40375 41208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 41205 42383 gene locus_tag LOCUS_18170 41205 42383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 42847 43569 gene locus_tag LOCUS_18180 42847 43569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 44012 45577 gene locus_tag LOCUS_r00010 44012 45577 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 45810 45885 gene locus_tag LOCUS_t00170 45810 45885 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 46004 46080 gene locus_tag LOCUS_t00180 46004 46080 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 46280 49287 gene locus_tag LOCUS_r00020 46280 49287 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 52474 49661 gene locus_tag LOCUS_18190 52474 49661 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_18190 53822 52494 gene locus_tag LOCUS_18200 53822 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 54274 53891 gene locus_tag LOCUS_18210 54274 53891 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_18210 55219 54356 gene locus_tag LOCUS_18220 gene mtnP 55219 54356 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_18220 55512 56786 gene locus_tag LOCUS_18230 55512 56786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 57912 56941 gene locus_tag LOCUS_18240 gene galE 57912 56941 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_18240 58142 58711 gene locus_tag LOCUS_18250 58142 58711 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258745.1 protein_id gnl|my_center|LOCUS_18250 58918 59979 gene locus_tag LOCUS_18260 58918 59979 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence019 441 1154 gene locus_tag LOCUS_18270 gene ispD 441 1154 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_18270 1246 2589 gene locus_tag LOCUS_18280 1246 2589 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_18280 2620 3645 gene locus_tag LOCUS_18290 gene tsaD 2620 3645 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931758.1 protein_id gnl|my_center|LOCUS_18290 5501 3780 gene locus_tag LOCUS_18300 5501 3780 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_18300 6347 5550 gene locus_tag LOCUS_18310 6347 5550 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_18310 7830 6358 gene locus_tag LOCUS_18320 7830 6358 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_18320 9380 7851 gene locus_tag LOCUS_18330 9380 7851 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_18330 10942 9383 gene locus_tag LOCUS_18340 10942 9383 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_18340 13071 10939 gene locus_tag LOCUS_18350 gene nuoL 13071 10939 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_18350 13384 13073 gene locus_tag LOCUS_18360 gene nuoK 13384 13073 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_18360 13878 13381 gene locus_tag LOCUS_18370 13878 13381 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_18370 15111 13948 gene locus_tag LOCUS_18380 gene nuoH 15111 13948 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_18380 16516 15299 gene locus_tag LOCUS_18390 16516 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 17272 16607 gene locus_tag LOCUS_18400 17272 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 18377 17811 gene locus_tag LOCUS_18410 18377 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 19600 18374 gene locus_tag LOCUS_18420 19600 18374 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_18420 20232 19597 gene locus_tag LOCUS_18430 20232 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 20926 20237 gene locus_tag LOCUS_18440 20926 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 21329 20952 gene locus_tag LOCUS_18450 gene ndhC 21329 20952 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_18450 21738 21472 gene locus_tag LOCUS_18460 21738 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 22430 21795 gene locus_tag LOCUS_18470 22430 21795 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_18470 25519 22493 gene locus_tag LOCUS_18480 25519 22493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 26049 25648 gene locus_tag LOCUS_18490 26049 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 29960 26262 gene locus_tag LOCUS_18500 29960 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 30759 33248 gene locus_tag LOCUS_18510 30759 33248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 33541 34734 gene locus_tag LOCUS_18520 33541 34734 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_18520 35964 34735 gene locus_tag LOCUS_18530 35964 34735 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_18530 35978 36142 gene locus_tag LOCUS_18540 35978 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 36270 36773 gene locus_tag LOCUS_18550 36270 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 37391 36795 gene locus_tag LOCUS_18560 37391 36795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 38401 37427 gene locus_tag LOCUS_18570 38401 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 38456 42301 gene locus_tag LOCUS_18580 38456 42301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 43226 42228 gene locus_tag LOCUS_18590 43226 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 43889 45301 gene locus_tag LOCUS_18600 43889 45301 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_18600 45415 47124 gene locus_tag LOCUS_18610 gene ade 45415 47124 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_18610 47334 47146 gene locus_tag LOCUS_18620 47334 47146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 47570 48436 gene locus_tag LOCUS_18630 47570 48436 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_18630 48631 49185 gene locus_tag LOCUS_18640 48631 49185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 49210 50010 gene locus_tag LOCUS_18650 49210 50010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 50177 51601 gene locus_tag LOCUS_18660 50177 51601 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_18660 52120 51623 gene locus_tag LOCUS_18670 52120 51623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 53496 52216 gene locus_tag LOCUS_18680 53496 52216 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_18680 53754 54299 gene locus_tag LOCUS_18690 53754 54299 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_18690 54361 56220 gene locus_tag LOCUS_18700 gene glmS 54361 56220 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_18700 56520 57014 gene locus_tag LOCUS_18710 56520 57014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 57313 57125 gene locus_tag LOCUS_18720 57313 57125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence020 1767 691 gene locus_tag LOCUS_18730 1767 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2132 3190 gene locus_tag LOCUS_18740 2132 3190 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_18740 4404 3223 gene locus_tag LOCUS_18750 4404 3223 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_18750 4285 5832 gene locus_tag LOCUS_18760 4285 5832 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_18760 6453 5863 gene locus_tag LOCUS_18770 6453 5863 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_18770 6560 7369 gene locus_tag LOCUS_18780 gene dapF 6560 7369 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_18780 7410 8288 gene locus_tag LOCUS_18790 gene dapA 7410 8288 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_18790 9919 8360 gene locus_tag LOCUS_18800 9919 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10142 10876 gene locus_tag LOCUS_18810 gene dapB 10142 10876 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_18810 10873 11403 gene locus_tag LOCUS_18820 gene folK 10873 11403 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_18820 12802 12056 gene locus_tag LOCUS_18830 12802 12056 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_18830 14715 12799 gene locus_tag LOCUS_18840 14715 12799 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_18840 15434 14712 gene locus_tag LOCUS_18850 15434 14712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_18850 16958 15564 gene locus_tag LOCUS_18860 16958 15564 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_18860 18680 17055 gene locus_tag LOCUS_18870 18680 17055 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_18870 19523 18783 gene locus_tag LOCUS_18880 gene kdsB 19523 18783 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_18880 19628 21670 gene locus_tag LOCUS_18890 19628 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 22449 21667 gene locus_tag LOCUS_18900 22449 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 22700 25843 gene locus_tag LOCUS_18910 22700 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 26534 26307 gene locus_tag LOCUS_18920 26534 26307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 26548 27240 gene locus_tag LOCUS_18930 26548 27240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 27389 28705 gene locus_tag LOCUS_18940 27389 28705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_18940 30595 28781 gene locus_tag LOCUS_18950 30595 28781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 32691 30742 gene locus_tag LOCUS_18960 32691 30742 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764130.1 protein_id gnl|my_center|LOCUS_18960 33112 35415 gene locus_tag LOCUS_18970 33112 35415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 35513 38689 gene locus_tag LOCUS_18980 35513 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 41390 39027 gene locus_tag LOCUS_18990 41390 39027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 41965 41756 gene locus_tag LOCUS_19000 41965 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 42872 41982 gene locus_tag LOCUS_19010 42872 41982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 43588 42869 gene locus_tag LOCUS_19020 43588 42869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 44992 43859 gene locus_tag LOCUS_19030 44992 43859 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_19030 44874 45128 gene locus_tag LOCUS_19040 44874 45128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 45259 46866 gene locus_tag LOCUS_19050 45259 46866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 48358 46979 gene locus_tag LOCUS_19060 48358 46979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence021 386 57 gene locus_tag LOCUS_19070 386 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1976 804 gene locus_tag LOCUS_19080 1976 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2192 1980 gene locus_tag LOCUS_19090 2192 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 4153 2648 gene locus_tag LOCUS_19100 4153 2648 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_19100 4709 4269 gene locus_tag LOCUS_19110 4709 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4855 5634 gene locus_tag LOCUS_19120 4855 5634 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_19120 5641 7041 gene locus_tag LOCUS_19130 gene xseA 5641 7041 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_19130 8823 7042 gene locus_tag LOCUS_19140 8823 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 9111 9395 gene locus_tag LOCUS_19150 9111 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9475 11466 gene locus_tag LOCUS_19160 gene dxs 9475 11466 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_19160 11692 12948 gene locus_tag LOCUS_19170 gene icd 11692 12948 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_19170 16089 13138 gene locus_tag LOCUS_19180 16089 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 16486 16115 gene locus_tag LOCUS_19190 16486 16115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 17697 16849 gene locus_tag LOCUS_19200 17697 16849 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_19200 18575 17694 gene locus_tag LOCUS_19210 18575 17694 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_19210 19621 18572 gene locus_tag LOCUS_19220 19621 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 19945 20232 gene locus_tag LOCUS_19230 19945 20232 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_19230 20373 21395 gene locus_tag LOCUS_19240 20373 21395 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_19240 22025 23371 gene locus_tag LOCUS_19250 gene gltX 22025 23371 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_19250 23907 23404 gene locus_tag LOCUS_19260 gene purE 23907 23404 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258176.1 protein_id gnl|my_center|LOCUS_19260 23937 25190 gene locus_tag LOCUS_19270 23937 25190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869075.1 protein_id gnl|my_center|LOCUS_19270 25187 25801 gene locus_tag LOCUS_19280 25187 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 25827 26300 gene locus_tag LOCUS_19290 gene bcp 25827 26300 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_19290 26402 26881 gene locus_tag LOCUS_19300 26402 26881 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_19300 27661 26984 gene locus_tag LOCUS_19310 27661 26984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 34023 27739 gene locus_tag LOCUS_19320 34023 27739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence022 1387 3786 gene locus_tag LOCUS_19330 1387 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4218 3802 gene locus_tag LOCUS_19340 4218 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 5583 4294 gene locus_tag LOCUS_19350 5583 4294 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_19350 6335 5580 gene locus_tag LOCUS_19360 6335 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6838 6419 gene locus_tag LOCUS_19370 6838 6419 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_19370 8278 6866 gene locus_tag LOCUS_19380 gene atpD 8278 6866 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_19380 9195 8317 gene locus_tag LOCUS_19390 gene atpG 9195 8317 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_19390 10804 9272 gene locus_tag LOCUS_19400 gene atpA 10804 9272 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_19400 11224 10832 gene locus_tag LOCUS_19410 11224 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 11815 11264 gene locus_tag LOCUS_19420 11815 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 12073 11870 gene locus_tag LOCUS_19430 12073 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 13093 12158 gene locus_tag LOCUS_19440 gene atpB 13093 12158 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_19440 13559 16417 gene locus_tag LOCUS_19450 13559 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 18011 16452 gene locus_tag LOCUS_19460 gene rimO 18011 16452 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_19460 18563 19258 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgccttccccccggaggcgcgcgcgctacaat >Feature sequence023 810 995 gene locus_tag LOCUS_19470 810 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 992 1336 gene locus_tag LOCUS_19480 992 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19480 3845 1329 gene locus_tag LOCUS_19490 3845 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 6560 3969 gene locus_tag LOCUS_19500 6560 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 7722 6577 gene locus_tag LOCUS_19510 7722 6577 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_19510 8992 7847 gene locus_tag LOCUS_19520 8992 7847 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_19520 10269 8989 gene locus_tag LOCUS_19530 10269 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921591.1 protein_id gnl|my_center|LOCUS_19530 11728 10427 gene locus_tag LOCUS_19540 11728 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 13424 11745 gene locus_tag LOCUS_19550 13424 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 14975 13602 gene locus_tag LOCUS_19560 gene glpT 14975 13602 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_19560 15134 15763 gene locus_tag LOCUS_19570 15134 15763 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_19570 16426 16190 gene locus_tag LOCUS_19580 16426 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 16371 16685 gene locus_tag LOCUS_19590 16371 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence024 332 553 gene locus_tag LOCUS_19600 332 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2126 594 gene locus_tag LOCUS_19610 2126 594 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_19610 2553 2146 gene locus_tag LOCUS_19620 2553 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2730 3872 gene locus_tag LOCUS_19630 2730 3872 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_19630 4084 5850 gene locus_tag LOCUS_19640 4084 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5897 7687 gene locus_tag LOCUS_19650 5897 7687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7687 8379 gene locus_tag LOCUS_19660 7687 8379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_19660 8376 9734 gene locus_tag LOCUS_19670 8376 9734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_19670 11302 9812 gene locus_tag LOCUS_19680 gene rho 11302 9812 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883248.1 protein_id gnl|my_center|LOCUS_19680 13328 11574 gene locus_tag LOCUS_19690 13328 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 14449 13436 gene locus_tag LOCUS_19700 14449 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 15161 15376 gene locus_tag LOCUS_19710 15161 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 16042 15398 gene locus_tag LOCUS_19720 16042 15398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 16118 16327 gene locus_tag LOCUS_19730 16118 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence025 2 238 gene locus_tag LOCUS_19740 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 1520 636 gene locus_tag LOCUS_19750 1520 636 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968890.1 protein_id gnl|my_center|LOCUS_19750 3015 1921 gene locus_tag LOCUS_19760 3015 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3937 3101 gene locus_tag LOCUS_19770 3937 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 4858 3953 gene locus_tag LOCUS_19780 4858 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 5213 8407 gene locus_tag LOCUS_19790 5213 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9272 11266 gene locus_tag LOCUS_19800 9272 11266 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_19800 11561 15382 gene locus_tag LOCUS_19810 11561 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence026 140 691 gene locus_tag LOCUS_19820 140 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 627 824 gene locus_tag LOCUS_19830 627 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 834 1046 gene locus_tag LOCUS_19840 834 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1047 1364 gene locus_tag LOCUS_19850 1047 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1450 1851 gene locus_tag LOCUS_19860 1450 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1897 4296 gene locus_tag LOCUS_19870 1897 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4921 6720 gene locus_tag LOCUS_19880 gene aspS 4921 6720 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_19880 7629 6730 gene locus_tag LOCUS_19890 7629 6730 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_19890 7760 9988 gene locus_tag LOCUS_19900 7760 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 9990 10661 gene locus_tag LOCUS_19910 9990 10661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_19910 10842 12677 gene locus_tag LOCUS_19920 10842 12677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence027 2594 660 gene locus_tag LOCUS_19930 2594 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4016 3327 gene locus_tag LOCUS_19940 4016 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4210 6318 gene locus_tag LOCUS_19950 4210 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6438 7214 gene locus_tag LOCUS_19960 6438 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 7314 10502 gene locus_tag LOCUS_19970 7314 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence028 943 110 gene locus_tag LOCUS_19980 943 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1326 937 gene locus_tag LOCUS_19990 1326 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1566 2582 gene locus_tag LOCUS_20000 1566 2582 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_20000 3818 2841 gene locus_tag LOCUS_20010 3818 2841 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_20010 4477 3815 gene locus_tag LOCUS_20020 gene plsY 4477 3815 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_20020 4610 5686 gene locus_tag LOCUS_20030 4610 5686 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_20030 5784 6992 gene locus_tag LOCUS_20040 gene lpxB 5784 6992 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_20040 8633 7029 gene locus_tag LOCUS_20050 8633 7029 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_20050 10641 8647 gene locus_tag LOCUS_20060 10641 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence029 103 1896 gene locus_tag LOCUS_20070 103 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 2568 2041 gene locus_tag LOCUS_20080 2568 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3403 2864 gene locus_tag LOCUS_20090 3403 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4891 3407 gene locus_tag LOCUS_20100 4891 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4969 5832 gene locus_tag LOCUS_20110 4969 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5840 9805 gene locus_tag LOCUS_20120 5840 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence030 >Feature sequence031 511 1008 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgtagcgcgcgcgcctccggggggaaggcaaaac >Feature sequence032 >Feature sequence033 <1 538 gene locus_tag LOCUS_20130 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766298.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence034 >Feature sequence035 >Feature sequence036 >Feature sequence037 >Feature sequence038 <963 131 gene locus_tag LOCUS_20140 <963 131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000138832.1:group II intron reverse transcriptase/maturase >Feature sequence039 >Feature sequence040 >Feature sequence041 >Feature sequence042 >Feature sequence043 >Feature sequence044 >Feature sequence045 >Feature sequence046 >Feature sequence047 >Feature sequence048 3 326 gene locus_tag LOCUS_20150 3 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 460 717 gene locus_tag LOCUS_20160 460 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence049 >Feature sequence050 >Feature sequence051 >Feature sequence052 >Feature sequence053 103 228 gene locus_tag LOCUS_20170 103 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence054 >Feature sequence055 453 617 gene locus_tag LOCUS_20180 453 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence056 >Feature sequence057 >Feature sequence058 >Feature sequence059 >Feature sequence060 >Feature sequence061 478 738 gene locus_tag LOCUS_20190 478 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence062 >Feature sequence063 >Feature sequence064 803 486 gene locus_tag LOCUS_20200 803 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence065 >Feature sequence066 >Feature sequence067 >Feature sequence068 >Feature sequence069 >Feature sequence070 >Feature sequence071 >Feature sequence072 >Feature sequence073 >Feature sequence074 >Feature sequence075 >Feature sequence076 >Feature sequence077 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 246 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence083 499 508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 3 221 gene locus_tag LOCUS_20210 3 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence085 >Feature sequence086 >Feature sequence087 181 330 gene locus_tag LOCUS_20220 181 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence088 >Feature sequence089 >Feature sequence090 >Feature sequence091 1 321 gene locus_tag LOCUS_20230 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence092 >Feature sequence093 >Feature sequence094 >Feature sequence095 >Feature sequence096 >Feature sequence097 251 260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence098 >Feature sequence099 <736 49 gene locus_tag LOCUS_20240 <736 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114372.1:glycolate oxidase subunit GlcD >Feature sequence100 140 433 gene locus_tag LOCUS_20250 140 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 435 508 gene locus_tag LOCUS_t00190 435 508 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 333 342 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 >Feature sequence107 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 245 254 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116 >Feature sequence117 163 321 gene locus_tag LOCUS_20260 163 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 377 568 gene locus_tag LOCUS_20270 377 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 396 405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence122 >Feature sequence123 >Feature sequence124 >Feature sequence125 314 323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence126 <1 592 gene locus_tag LOCUS_20280 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921368.1:sulfatase-like hydrolase/transferase note possible pseudo, frameshifted 396 405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence127 >Feature sequence128 266 275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence129 >Feature sequence130 >Feature sequence131 >Feature sequence132 >Feature sequence133 >Feature sequence134 >Feature sequence135 >Feature sequence136 >Feature sequence137 >Feature sequence138 >Feature sequence139 364 373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence140 >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 >Feature sequence145 >Feature sequence146 445 41 gene locus_tag LOCUS_20290 445 41 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940036.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence147 >Feature sequence148 >Feature sequence149 95 295 gene locus_tag LOCUS_20300 95 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence150 >Feature sequence151 >Feature sequence152 >Feature sequence153 >Feature sequence154 >Feature sequence155 <561 44 gene locus_tag LOCUS_20310 <561 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140840.1:aldo/keto reductase >Feature sequence156 >Feature sequence157 >Feature sequence158 >Feature sequence159 324 70 gene locus_tag LOCUS_20320 324 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 232 423 gene locus_tag LOCUS_20330 232 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 >Feature sequence164 >Feature sequence165 >Feature sequence166 >Feature sequence167 >Feature sequence168 >Feature sequence169 >Feature sequence170 68 256 gene locus_tag LOCUS_20340 68 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence171 >Feature sequence172 >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 >Feature sequence177 >Feature sequence178 >Feature sequence179 >Feature sequence180 >Feature sequence181 >Feature sequence182 >Feature sequence183 >Feature sequence184 >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 >Feature sequence189