>Feature sequence001 119 790 gene locus_tag LOCUS_00010 119 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 787 1578 gene locus_tag LOCUS_00020 787 1578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975547.1 protein_id gnl|my_center|LOCUS_00020 1575 2570 gene locus_tag LOCUS_00030 1575 2570 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_00030 4878 2572 gene locus_tag LOCUS_00040 4878 2572 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_00040 5290 5171 gene locus_tag LOCUS_00050 5290 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6543 5701 gene locus_tag LOCUS_00060 6543 5701 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_00060 7069 6530 gene locus_tag LOCUS_00070 7069 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7534 7070 gene locus_tag LOCUS_00080 gene ribE 7534 7070 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_00080 8779 7583 gene locus_tag LOCUS_00090 8779 7583 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_00090 9417 8791 gene locus_tag LOCUS_00100 9417 8791 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143593.1 protein_id gnl|my_center|LOCUS_00100 10526 9417 gene locus_tag LOCUS_00110 gene ribD 10526 9417 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_00110 11026 11319 gene locus_tag LOCUS_00120 11026 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11630 11797 gene locus_tag LOCUS_00130 11630 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13391 12081 gene locus_tag LOCUS_00140 13391 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00140 14603 13398 gene locus_tag LOCUS_00150 14603 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00150 15118 14603 gene locus_tag LOCUS_00160 15118 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00160 15847 15281 gene locus_tag LOCUS_00170 15847 15281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00170 16035 15844 gene locus_tag LOCUS_00180 16035 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 17351 17046 gene locus_tag LOCUS_00190 17351 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18796 20601 gene locus_tag LOCUS_00200 18796 20601 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705772.1 protein_id gnl|my_center|LOCUS_00200 22557 20746 gene locus_tag LOCUS_00210 22557 20746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26269 22733 gene locus_tag LOCUS_00220 26269 22733 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00220 26756 26259 gene locus_tag LOCUS_00230 26756 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27298 28053 gene locus_tag LOCUS_00240 27298 28053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 4493 918 gene locus_tag LOCUS_00250 4493 918 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_00250 5120 4644 gene locus_tag LOCUS_00260 5120 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 5504 6037 gene locus_tag LOCUS_00270 5504 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6034 7200 gene locus_tag LOCUS_00280 6034 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7223 9136 gene locus_tag LOCUS_00290 7223 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 11645 9309 gene locus_tag LOCUS_00300 11645 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 12245 11811 gene locus_tag LOCUS_00310 12245 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 13475 12492 gene locus_tag LOCUS_00320 13475 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 14277 13510 gene locus_tag LOCUS_00330 14277 13510 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_00330 15390 14305 gene locus_tag LOCUS_00340 15390 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 17486 15387 gene locus_tag LOCUS_00350 gene ligA 17486 15387 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_00350 17712 18677 gene locus_tag LOCUS_00360 17712 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 18738 19685 gene locus_tag LOCUS_00370 18738 19685 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_00370 19688 20758 gene locus_tag LOCUS_00380 19688 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 20751 22991 gene locus_tag LOCUS_00390 20751 22991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 23062 22979 gene locus_tag LOCUS_t00010 23062 22979 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25448 23151 gene locus_tag LOCUS_00400 25448 23151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00400 >Feature sequence003 1748 1611 gene locus_tag LOCUS_00410 1748 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2291 3427 gene locus_tag LOCUS_00420 gene pdxB 2291 3427 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699178.1 protein_id gnl|my_center|LOCUS_00420 3663 3806 gene locus_tag LOCUS_00430 3663 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 4015 5271 gene locus_tag LOCUS_00440 4015 5271 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_00440 8105 5400 gene locus_tag LOCUS_00450 8105 5400 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_00450 9769 8480 gene locus_tag LOCUS_00460 9769 8480 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_00460 11535 11161 gene locus_tag LOCUS_00470 11535 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 12826 11723 gene locus_tag LOCUS_00480 12826 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 15809 13131 gene locus_tag LOCUS_00490 15809 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 17708 15975 gene locus_tag LOCUS_00500 17708 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20224 17912 gene locus_tag LOCUS_00510 20224 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 20714 20379 gene locus_tag LOCUS_00520 20714 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 20918 22837 gene locus_tag LOCUS_00530 20918 22837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence004 2864 870 gene locus_tag LOCUS_00540 2864 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 6008 2970 gene locus_tag LOCUS_00550 6008 2970 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_00550 6229 7158 gene locus_tag LOCUS_00560 6229 7158 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 protein_id gnl|my_center|LOCUS_00560 8676 7210 gene locus_tag LOCUS_00570 8676 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 9121 8852 gene locus_tag LOCUS_00580 9121 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 10161 9118 gene locus_tag LOCUS_00590 gene waaF 10161 9118 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00590 10653 10177 gene locus_tag LOCUS_00600 10653 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 10928 11671 gene locus_tag LOCUS_00610 10928 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 11668 11994 gene locus_tag LOCUS_00620 11668 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 12070 13230 gene locus_tag LOCUS_00630 12070 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13383 14870 gene locus_tag LOCUS_00640 13383 14870 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_00640 15532 15104 gene locus_tag LOCUS_00650 15532 15104 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_00650 16455 15565 gene locus_tag LOCUS_00660 16455 15565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_00660 17015 18127 gene locus_tag LOCUS_00670 gene gcvT 17015 18127 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941043.1 protein_id gnl|my_center|LOCUS_00670 18124 18507 gene locus_tag LOCUS_00680 gene gcvH 18124 18507 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_00680 18558 19853 gene locus_tag LOCUS_00690 gene gcvPA 18558 19853 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938718.1 protein_id gnl|my_center|LOCUS_00690 19846 22020 gene locus_tag LOCUS_00700 19846 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 >Feature sequence005 797 3775 gene locus_tag LOCUS_00710 797 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4152 3772 gene locus_tag LOCUS_00720 4152 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4700 4122 gene locus_tag LOCUS_00730 4700 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 7082 5370 gene locus_tag LOCUS_00740 7082 5370 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_00740 8347 7364 gene locus_tag LOCUS_00750 8347 7364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_00750 9337 8363 gene locus_tag LOCUS_00760 gene iolG 9337 8363 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193713.1 protein_id gnl|my_center|LOCUS_00760 10284 9463 gene locus_tag LOCUS_00770 10284 9463 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_00770 12671 10413 gene locus_tag LOCUS_00780 12671 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 14009 15082 gene locus_tag LOCUS_00790 14009 15082 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_00790 15079 15852 gene locus_tag LOCUS_00800 15079 15852 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_00800 16034 17494 gene locus_tag LOCUS_00810 16034 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 17829 17623 gene locus_tag LOCUS_00820 17829 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 18703 17783 gene locus_tag LOCUS_00830 18703 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 18901 18977 gene locus_tag LOCUS_t00020 18901 18977 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 295 945 gene locus_tag LOCUS_00840 295 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1041 4076 gene locus_tag LOCUS_00850 1041 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 5743 4157 gene locus_tag LOCUS_00860 5743 4157 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582712.1 protein_id gnl|my_center|LOCUS_00860 6435 5767 gene locus_tag LOCUS_00870 6435 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8311 6458 gene locus_tag LOCUS_00880 gene nuoF 8311 6458 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_00880 8872 8324 gene locus_tag LOCUS_00890 gene nuoE 8872 8324 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_00890 9184 8915 gene locus_tag LOCUS_00900 9184 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 10775 9399 gene locus_tag LOCUS_00910 10775 9399 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_00910 11886 10765 gene locus_tag LOCUS_00920 11886 10765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 12273 14129 gene locus_tag LOCUS_00930 12273 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 14239 14562 gene locus_tag LOCUS_00940 14239 14562 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454504.1 protein_id gnl|my_center|LOCUS_00940 14937 15404 gene locus_tag LOCUS_00950 14937 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 15401 16003 gene locus_tag LOCUS_00960 15401 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16030 18096 gene locus_tag LOCUS_00970 16030 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18399 20615 gene locus_tag LOCUS_00980 18399 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence007 1674 664 gene locus_tag LOCUS_00990 1674 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 2120 4180 gene locus_tag LOCUS_01000 2120 4180 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010349194.1 protein_id gnl|my_center|LOCUS_01000 4177 5229 gene locus_tag LOCUS_01010 4177 5229 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_01010 5432 5629 gene locus_tag LOCUS_01020 5432 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5763 5927 gene locus_tag LOCUS_01030 5763 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7113 6097 gene locus_tag LOCUS_01040 7113 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6544 6553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8432 7479 gene locus_tag LOCUS_01050 8432 7479 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_01050 9913 8429 gene locus_tag LOCUS_01060 9913 8429 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973344.1 protein_id gnl|my_center|LOCUS_01060 10932 9943 gene locus_tag LOCUS_01070 10932 9943 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_01070 12554 11142 gene locus_tag LOCUS_01080 12554 11142 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_01080 12764 13660 gene locus_tag LOCUS_01090 12764 13660 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297963.1 protein_id gnl|my_center|LOCUS_01090 13677 14909 gene locus_tag LOCUS_01100 13677 14909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_01100 14928 15449 gene locus_tag LOCUS_01110 14928 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16917 15826 gene locus_tag LOCUS_01120 16917 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17644 17030 gene locus_tag LOCUS_01130 gene purN 17644 17030 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404384.1 protein_id gnl|my_center|LOCUS_01130 17915 19045 gene locus_tag LOCUS_01140 17915 19045 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_01140 19215 20045 gene locus_tag LOCUS_01150 19215 20045 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_01150 <20950 20213 gene locus_tag LOCUS_01160 <20950 20213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529293.1:alkaline phosphatase family protein >Feature sequence008 1431 52 gene locus_tag LOCUS_01170 1431 52 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_01170 3127 1556 gene locus_tag LOCUS_01180 3127 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3332 4561 gene locus_tag LOCUS_01190 gene ispG 3332 4561 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227844.1 protein_id gnl|my_center|LOCUS_01190 4891 4562 gene locus_tag LOCUS_01200 4891 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 5298 4873 gene locus_tag LOCUS_01210 5298 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5888 5391 gene locus_tag LOCUS_01220 gene ruvC 5888 5391 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_01220 6640 5891 gene locus_tag LOCUS_01230 6640 5891 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_01230 7477 6806 gene locus_tag LOCUS_01240 7477 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8500 7613 gene locus_tag LOCUS_01250 gene lsrF 8500 7613 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 protein_id gnl|my_center|LOCUS_01250 9179 8493 gene locus_tag LOCUS_01260 gene dhaL 9179 8493 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 protein_id gnl|my_center|LOCUS_01260 10138 9137 gene locus_tag LOCUS_01270 gene dhaK 10138 9137 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728174.1 protein_id gnl|my_center|LOCUS_01270 10535 10215 gene locus_tag LOCUS_01280 10535 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 12095 10656 gene locus_tag LOCUS_01290 12095 10656 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_01290 14427 12241 gene locus_tag LOCUS_01300 14427 12241 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014118.1 protein_id gnl|my_center|LOCUS_01300 14673 15446 gene locus_tag LOCUS_01310 14673 15446 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838205.1 protein_id gnl|my_center|LOCUS_01310 15433 16377 gene locus_tag LOCUS_01320 15433 16377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389847.1 protein_id gnl|my_center|LOCUS_01320 17022 16357 gene locus_tag LOCUS_01330 17022 16357 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694158.1 protein_id gnl|my_center|LOCUS_01330 17229 17825 gene locus_tag LOCUS_01340 gene rpoE 17229 17825 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_01340 17825 19111 gene locus_tag LOCUS_01350 17825 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 19493 19332 gene locus_tag LOCUS_01360 19493 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 19720 20700 gene locus_tag LOCUS_01370 19720 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence009 778 275 gene locus_tag LOCUS_01380 778 275 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_01380 707 937 gene locus_tag LOCUS_01390 707 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1136 2221 gene locus_tag LOCUS_01400 1136 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 2223 3443 gene locus_tag LOCUS_01410 2223 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3984 4313 gene locus_tag LOCUS_01420 3984 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6710 4497 gene locus_tag LOCUS_01430 6710 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8385 6781 gene locus_tag LOCUS_01440 8385 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8885 8421 gene locus_tag LOCUS_01450 8885 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9328 8879 gene locus_tag LOCUS_01460 9328 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 9909 9331 gene locus_tag LOCUS_01470 gene rpoE 9909 9331 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_01470 10554 12011 gene locus_tag LOCUS_01480 gene ahcY 10554 12011 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_01480 12551 13870 gene locus_tag LOCUS_01490 12551 13870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_01490 13886 15988 gene locus_tag LOCUS_01500 13886 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 16045 17187 gene locus_tag LOCUS_01510 16045 17187 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_01510 17245 18951 gene locus_tag LOCUS_01520 gene putP 17245 18951 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776955.1 protein_id gnl|my_center|LOCUS_01520 19873 18974 gene locus_tag LOCUS_01530 19873 18974 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 protein_id gnl|my_center|LOCUS_01530 20665 19991 gene locus_tag LOCUS_01540 20665 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence010 3002 1716 gene locus_tag LOCUS_01550 3002 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3538 4590 gene locus_tag LOCUS_01560 3538 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4810 5010 gene locus_tag LOCUS_01570 4810 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5221 7881 gene locus_tag LOCUS_01580 5221 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 7988 8956 gene locus_tag LOCUS_01590 gene amrS 7988 8956 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_01590 8953 9132 gene locus_tag LOCUS_01600 8953 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9159 10748 gene locus_tag LOCUS_01610 gene amrB 9159 10748 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052452.1 protein_id gnl|my_center|LOCUS_01610 10758 14582 gene locus_tag LOCUS_01620 10758 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15907 14705 gene locus_tag LOCUS_01630 15907 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 16965 15982 gene locus_tag LOCUS_01640 16965 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17133 18245 gene locus_tag LOCUS_01650 gene carA 17133 18245 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_01650 19580 18273 gene locus_tag LOCUS_01660 19580 18273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_01660 <20567 19738 gene locus_tag LOCUS_01670 <20567 19738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259620.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence011 268 765 gene locus_tag LOCUS_01680 268 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 809 1729 gene locus_tag LOCUS_01690 809 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1729 2427 gene locus_tag LOCUS_01700 1729 2427 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_01700 2447 2779 gene locus_tag LOCUS_01710 2447 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392788.1 protein_id gnl|my_center|LOCUS_01710 2782 3474 gene locus_tag LOCUS_01720 2782 3474 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061181.1 protein_id gnl|my_center|LOCUS_01720 3582 4013 gene locus_tag LOCUS_01730 3582 4013 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938935.1 protein_id gnl|my_center|LOCUS_01730 4304 4666 gene locus_tag LOCUS_01740 4304 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5191 4901 gene locus_tag LOCUS_01750 5191 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5226 5954 gene locus_tag LOCUS_01760 5226 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6138 7085 gene locus_tag LOCUS_01770 6138 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7124 8341 gene locus_tag LOCUS_01780 7124 8341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817388.1 protein_id gnl|my_center|LOCUS_01780 8345 9019 gene locus_tag LOCUS_01790 8345 9019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_01790 9131 9967 gene locus_tag LOCUS_01800 9131 9967 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_01800 9998 11191 gene locus_tag LOCUS_01810 gene arsB 9998 11191 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_01810 12097 11369 gene locus_tag LOCUS_01820 12097 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12517 13590 gene locus_tag LOCUS_01830 gene purM 12517 13590 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938699.1 protein_id gnl|my_center|LOCUS_01830 13571 16537 gene locus_tag LOCUS_01840 13571 16537 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_01840 16561 17352 gene locus_tag LOCUS_01850 16561 17352 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_01850 17411 18169 gene locus_tag LOCUS_01860 17411 18169 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938974.1 protein_id gnl|my_center|LOCUS_01860 18256 19389 gene locus_tag LOCUS_01870 18256 19389 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence012 3311 4570 gene locus_tag LOCUS_01880 3311 4570 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_01880 5934 4606 gene locus_tag LOCUS_01890 5934 4606 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_01890 7633 6374 gene locus_tag LOCUS_01900 7633 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8025 7630 gene locus_tag LOCUS_01910 8025 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8206 8027 gene locus_tag LOCUS_01920 8206 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 9023 8361 gene locus_tag LOCUS_01930 9023 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9235 9023 gene locus_tag LOCUS_01940 9235 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9674 9255 gene locus_tag LOCUS_01950 9674 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10318 10241 gene locus_tag LOCUS_t00030 10318 10241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10888 10757 gene locus_tag LOCUS_01960 10888 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10922 11578 gene locus_tag LOCUS_01970 10922 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 11630 12637 gene locus_tag LOCUS_01980 11630 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 12771 12846 gene locus_tag LOCUS_t00040 12771 12846 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12931 14706 gene locus_tag LOCUS_01990 12931 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 14827 17466 gene locus_tag LOCUS_02000 14827 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 17536 18522 gene locus_tag LOCUS_02010 17536 18522 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_02010 19757 18762 gene locus_tag LOCUS_02020 19757 18762 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence013 664 945 gene locus_tag LOCUS_02030 664 945 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_02030 923 1150 gene locus_tag LOCUS_02040 923 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 1294 1455 gene locus_tag LOCUS_02050 1294 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 1412 2401 gene locus_tag LOCUS_02060 1412 2401 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_02060 2650 3168 gene locus_tag LOCUS_02070 2650 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3245 4963 gene locus_tag LOCUS_02080 3245 4963 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_02080 6155 4965 gene locus_tag LOCUS_02090 6155 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7761 6349 gene locus_tag LOCUS_02100 7761 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8034 9869 gene locus_tag LOCUS_02110 8034 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 10266 11636 gene locus_tag LOCUS_02120 10266 11636 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_02120 11779 13146 gene locus_tag LOCUS_02130 11779 13146 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_02130 13246 14223 gene locus_tag LOCUS_02140 13246 14223 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_02140 14753 15898 gene locus_tag LOCUS_02150 14753 15898 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584024.1 protein_id gnl|my_center|LOCUS_02150 17958 15964 gene locus_tag LOCUS_02160 17958 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence014 252 449 gene locus_tag LOCUS_02170 252 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 737 3019 gene locus_tag LOCUS_02180 737 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3900 3091 gene locus_tag LOCUS_02190 3900 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4447 3926 gene locus_tag LOCUS_02200 4447 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4681 5994 gene locus_tag LOCUS_02210 4681 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 7162 6044 gene locus_tag LOCUS_02220 7162 6044 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_02220 8139 7372 gene locus_tag LOCUS_02230 gene truA 8139 7372 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_02230 8654 9928 gene locus_tag LOCUS_02240 8654 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 10022 10990 gene locus_tag LOCUS_02250 10022 10990 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_02250 10987 11739 gene locus_tag LOCUS_02260 10987 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11745 14399 gene locus_tag LOCUS_02270 11745 14399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14429 18889 gene locus_tag LOCUS_02280 14429 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 >Feature sequence015 1345 308 gene locus_tag LOCUS_02290 gene pspF 1345 308 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940248.1 protein_id gnl|my_center|LOCUS_02290 1768 2445 gene locus_tag LOCUS_02300 gene pspA 1768 2445 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428804.1 protein_id gnl|my_center|LOCUS_02300 2478 2843 gene locus_tag LOCUS_02310 gene pspC 2478 2843 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791589.1 protein_id gnl|my_center|LOCUS_02310 2883 3116 gene locus_tag LOCUS_02320 2883 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3113 3529 gene locus_tag LOCUS_02330 3113 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4519 3611 gene locus_tag LOCUS_02340 4519 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5269 4643 gene locus_tag LOCUS_02350 5269 4643 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 protein_id gnl|my_center|LOCUS_02350 5520 5978 gene locus_tag LOCUS_02360 5520 5978 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_02360 6890 6000 gene locus_tag LOCUS_02370 6890 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8215 6893 gene locus_tag LOCUS_02380 8215 6893 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_02380 8363 8842 gene locus_tag LOCUS_02390 8363 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 8878 9396 gene locus_tag LOCUS_02400 8878 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 9846 11750 gene locus_tag LOCUS_02410 9846 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 14633 11868 gene locus_tag LOCUS_02420 gene ppdK 14633 11868 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_02420 15037 15261 gene locus_tag LOCUS_02430 15037 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 15264 15665 gene locus_tag LOCUS_02440 15264 15665 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_02440 16200 15955 gene locus_tag LOCUS_02450 16200 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 16462 16205 gene locus_tag LOCUS_02460 16462 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 17173 18228 gene locus_tag LOCUS_02470 gene hflK 17173 18228 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence016 1531 1887 gene locus_tag LOCUS_02480 1531 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2362 1964 gene locus_tag LOCUS_02490 2362 1964 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_02490 2592 2362 gene locus_tag LOCUS_02500 2592 2362 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_02500 3971 2817 gene locus_tag LOCUS_02510 3971 2817 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_02510 4488 5957 gene locus_tag LOCUS_02520 gene hemL 4488 5957 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_02520 5954 6607 gene locus_tag LOCUS_02530 5954 6607 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_02530 6637 8235 gene locus_tag LOCUS_02540 6637 8235 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205720.1 protein_id gnl|my_center|LOCUS_02540 9051 8569 gene locus_tag LOCUS_02550 9051 8569 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_02550 9840 9079 gene locus_tag LOCUS_02560 9840 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10644 9877 gene locus_tag LOCUS_02570 10644 9877 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947313.1 protein_id gnl|my_center|LOCUS_02570 11698 10712 gene locus_tag LOCUS_02580 11698 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 12538 12062 gene locus_tag LOCUS_02590 12538 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 13218 14384 gene locus_tag LOCUS_02600 gene nagA 13218 14384 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_02600 14397 15683 gene locus_tag LOCUS_02610 14397 15683 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_02610 16634 15699 gene locus_tag LOCUS_02620 16634 15699 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065281.1 protein_id gnl|my_center|LOCUS_02620 17285 16647 gene locus_tag LOCUS_02630 17285 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence017 3707 1281 gene locus_tag LOCUS_02640 3707 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 4406 5110 gene locus_tag LOCUS_02650 4406 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7066 5168 gene locus_tag LOCUS_02660 7066 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 8587 7073 gene locus_tag LOCUS_02670 8587 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 9806 8799 gene locus_tag LOCUS_02680 gene aguB 9806 8799 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_02680 10610 9912 gene locus_tag LOCUS_02690 10610 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11576 10683 gene locus_tag LOCUS_02700 11576 10683 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207045.1 protein_id gnl|my_center|LOCUS_02700 12562 11654 gene locus_tag LOCUS_02710 12562 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 13372 12605 gene locus_tag LOCUS_02720 13372 12605 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_02720 13840 14784 gene locus_tag LOCUS_02730 13840 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 15767 14793 gene locus_tag LOCUS_02740 15767 14793 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009660448.1 protein_id gnl|my_center|LOCUS_02740 17251 15764 gene locus_tag LOCUS_02750 gene gltX 17251 15764 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence018 1045 1830 gene locus_tag LOCUS_02760 1045 1830 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_02760 2014 2751 gene locus_tag LOCUS_02770 2014 2751 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_02770 2748 3164 gene locus_tag LOCUS_02780 2748 3164 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_02780 3171 5585 gene locus_tag LOCUS_02790 3171 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5589 7364 gene locus_tag LOCUS_02800 5589 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 7663 8865 gene locus_tag LOCUS_02810 7663 8865 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_02810 8890 9333 gene locus_tag LOCUS_02820 8890 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 9485 10630 gene locus_tag LOCUS_02830 9485 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 12247 10658 gene locus_tag LOCUS_02840 12247 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 14084 12279 gene locus_tag LOCUS_02850 gene pepF 14084 12279 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122658.1 protein_id gnl|my_center|LOCUS_02850 15320 14124 gene locus_tag LOCUS_02860 15320 14124 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_02860 >Feature sequence019 1173 2465 gene locus_tag LOCUS_02870 1173 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2660 3832 gene locus_tag LOCUS_02880 2660 3832 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_02880 3829 6678 gene locus_tag LOCUS_02890 3829 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 6940 8862 gene locus_tag LOCUS_02900 6940 8862 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_02900 9233 9790 gene locus_tag LOCUS_02910 9233 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10950 9913 gene locus_tag LOCUS_02920 10950 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11412 11164 gene locus_tag LOCUS_02930 11412 11164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 11814 11506 gene locus_tag LOCUS_02940 11814 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 12214 12927 gene locus_tag LOCUS_02950 12214 12927 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_02950 12961 14328 gene locus_tag LOCUS_02960 gene orpR 12961 14328 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_02960 14508 15161 gene locus_tag LOCUS_02970 14508 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 15364 15678 gene locus_tag LOCUS_02980 15364 15678 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392926.1 protein_id gnl|my_center|LOCUS_02980 15750 16424 gene locus_tag LOCUS_02990 15750 16424 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence020 2049 1576 gene locus_tag LOCUS_03000 2049 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3107 2151 gene locus_tag LOCUS_03010 3107 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5089 3104 gene locus_tag LOCUS_03020 5089 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6374 7480 gene locus_tag LOCUS_03030 6374 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7486 8520 gene locus_tag LOCUS_03040 7486 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9893 8643 gene locus_tag LOCUS_03050 9893 8643 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942406.1 protein_id gnl|my_center|LOCUS_03050 11458 10352 gene locus_tag LOCUS_03060 11458 10352 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_03060 11979 11458 gene locus_tag LOCUS_03070 11979 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 12920 11976 gene locus_tag LOCUS_03080 12920 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13237 13560 gene locus_tag LOCUS_03090 13237 13560 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_03090 13653 14954 gene locus_tag LOCUS_03100 13653 14954 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_03100 14951 15712 gene locus_tag LOCUS_03110 14951 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 15709 15942 gene locus_tag LOCUS_03120 15709 15942 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_03120 15965 16351 gene locus_tag LOCUS_03130 15965 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence021 267 1904 gene locus_tag LOCUS_03140 gene nadB 267 1904 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_03140 3578 1935 gene locus_tag LOCUS_03150 3578 1935 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_03150 5254 3686 gene locus_tag LOCUS_03160 5254 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 6579 5383 gene locus_tag LOCUS_03170 6579 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 7846 6887 gene locus_tag LOCUS_03180 7846 6887 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_03180 9005 7992 gene locus_tag LOCUS_03190 9005 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11441 9180 gene locus_tag LOCUS_03200 11441 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11698 12597 gene locus_tag LOCUS_03210 11698 12597 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615599.1 protein_id gnl|my_center|LOCUS_03210 12755 15637 gene locus_tag LOCUS_03220 12755 15637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence022 1090 3306 gene locus_tag LOCUS_03230 1090 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3408 4373 gene locus_tag LOCUS_03240 3408 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4405 5685 gene locus_tag LOCUS_03250 4405 5685 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_03250 5755 8271 gene locus_tag LOCUS_03260 5755 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 8631 8260 gene locus_tag LOCUS_03270 8631 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10422 8947 gene locus_tag LOCUS_03280 gene rfaE1 10422 8947 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_03280 10656 12077 gene locus_tag LOCUS_03290 10656 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12110 13447 gene locus_tag LOCUS_03300 12110 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 14122 15504 gene locus_tag LOCUS_03310 14122 15504 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_03310 15956 15603 gene locus_tag LOCUS_03320 15956 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence023 1035 2696 gene locus_tag LOCUS_03330 1035 2696 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_03330 2746 3684 gene locus_tag LOCUS_03340 2746 3684 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583990.1 protein_id gnl|my_center|LOCUS_03340 3735 4583 gene locus_tag LOCUS_03350 3735 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 4627 5145 gene locus_tag LOCUS_03360 4627 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 5251 7890 gene locus_tag LOCUS_03370 5251 7890 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_03370 8132 9250 gene locus_tag LOCUS_03380 8132 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9740 9393 gene locus_tag LOCUS_03390 9740 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 10033 9737 gene locus_tag LOCUS_03400 10033 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 12420 10030 gene locus_tag LOCUS_03410 gene pheT 12420 10030 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_03410 13468 12422 gene locus_tag LOCUS_03420 gene pheS 13468 12422 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367044.1 protein_id gnl|my_center|LOCUS_03420 14212 13502 gene locus_tag LOCUS_03430 14212 13502 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence024 3053 39 gene locus_tag LOCUS_03440 3053 39 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_03440 3589 3101 gene locus_tag LOCUS_03450 3589 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6198 4246 gene locus_tag LOCUS_03460 6198 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6186 6341 gene locus_tag LOCUS_03470 6186 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6452 9394 gene locus_tag LOCUS_03480 6452 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 9589 10566 gene locus_tag LOCUS_03490 9589 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11485 10574 gene locus_tag LOCUS_03500 11485 10574 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_03500 11809 11555 gene locus_tag LOCUS_03510 11809 11555 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883007.1 protein_id gnl|my_center|LOCUS_03510 12955 11927 gene locus_tag LOCUS_03520 12955 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 15079 13148 gene locus_tag LOCUS_03530 15079 13148 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880592.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence025 323 853 gene locus_tag LOCUS_03540 323 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 850 1326 gene locus_tag LOCUS_03550 850 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1446 2249 gene locus_tag LOCUS_03560 1446 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2304 3443 gene locus_tag LOCUS_03570 2304 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3513 3992 gene locus_tag LOCUS_03580 3513 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4751 4068 gene locus_tag LOCUS_03590 4751 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5409 6710 gene locus_tag LOCUS_03600 5409 6710 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_03600 6844 7635 gene locus_tag LOCUS_03610 6844 7635 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_03610 10860 7663 gene locus_tag LOCUS_03620 gene carB 10860 7663 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_03620 11576 11103 gene locus_tag LOCUS_03630 gene greA 11576 11103 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_03630 13010 11889 gene locus_tag LOCUS_03640 gene lpxB 13010 11889 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938656.1 protein_id gnl|my_center|LOCUS_03640 13960 13007 gene locus_tag LOCUS_03650 13960 13007 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_03650 14187 13957 gene locus_tag LOCUS_03660 14187 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 <15009 14236 gene locus_tag LOCUS_03670 <15009 14236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929161.1:VCBS repeat-containing protein >Feature sequence026 6482 5247 gene locus_tag LOCUS_03680 6482 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8081 6747 gene locus_tag LOCUS_03690 8081 6747 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_03690 8507 9940 gene locus_tag LOCUS_03700 8507 9940 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_03700 11906 10023 gene locus_tag LOCUS_03710 11906 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 12693 11914 gene locus_tag LOCUS_03720 12693 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 13118 12648 gene locus_tag LOCUS_03730 13118 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13763 13155 gene locus_tag LOCUS_03740 gene coaE 13763 13155 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583248.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence027 322 1365 gene locus_tag LOCUS_03750 gene recA 322 1365 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546028.1 protein_id gnl|my_center|LOCUS_03750 1367 4456 gene locus_tag LOCUS_03760 1367 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 6064 4484 gene locus_tag LOCUS_03770 6064 4484 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_03770 8033 6237 gene locus_tag LOCUS_03780 8033 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 8249 9781 gene locus_tag LOCUS_03790 8249 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 10510 10253 gene locus_tag LOCUS_03800 10510 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 10780 12936 gene locus_tag LOCUS_03810 10780 12936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence028 1483 1962 gene locus_tag LOCUS_03820 1483 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3581 2049 gene locus_tag LOCUS_03830 3581 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4634 3654 gene locus_tag LOCUS_03840 4634 3654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242341.1 protein_id gnl|my_center|LOCUS_03840 5219 6232 gene locus_tag LOCUS_03850 5219 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7718 6276 gene locus_tag LOCUS_03860 gene pyk 7718 6276 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_03860 8082 9203 gene locus_tag LOCUS_03870 8082 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 10058 9228 gene locus_tag LOCUS_03880 10058 9228 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_03880 11806 10103 gene locus_tag LOCUS_03890 11806 10103 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_03890 11958 12034 gene locus_tag LOCUS_t00050 11958 12034 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 314 2101 gene locus_tag LOCUS_03900 314 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2837 3097 gene locus_tag LOCUS_03910 2837 3097 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_03910 3161 3445 gene locus_tag LOCUS_03920 3161 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6315 3805 gene locus_tag LOCUS_03930 6315 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6566 6657 gene locus_tag LOCUS_t00060 6566 6657 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6913 8163 gene locus_tag LOCUS_03940 6913 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8627 8184 gene locus_tag LOCUS_03950 gene rpiB 8627 8184 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_03950 9269 8667 gene locus_tag LOCUS_03960 9269 8667 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_03960 9862 9266 gene locus_tag LOCUS_03970 9862 9266 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932644.1 protein_id gnl|my_center|LOCUS_03970 10571 9852 gene locus_tag LOCUS_03980 gene rph 10571 9852 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247175.1 protein_id gnl|my_center|LOCUS_03980 12093 10603 gene locus_tag LOCUS_03990 12093 10603 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_03990 14422 12542 gene locus_tag LOCUS_04000 14422 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence030 2130 2525 gene locus_tag LOCUS_04010 2130 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3843 2614 gene locus_tag LOCUS_04020 3843 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5180 3840 gene locus_tag LOCUS_04030 5180 3840 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_04030 6406 5348 gene locus_tag LOCUS_04040 gene dmeF 6406 5348 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 protein_id gnl|my_center|LOCUS_04040 6648 8669 gene locus_tag LOCUS_04050 6648 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 12073 8774 gene locus_tag LOCUS_04060 12073 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13991 12438 gene locus_tag LOCUS_04070 13991 12438 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_04070 14074 14271 gene locus_tag LOCUS_04080 14074 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence031 74 1942 gene locus_tag LOCUS_04090 74 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2406 2209 gene locus_tag LOCUS_04100 2406 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3083 4639 gene locus_tag LOCUS_04110 3083 4639 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_04110 6036 4765 gene locus_tag LOCUS_04120 6036 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7877 6114 gene locus_tag LOCUS_04130 7877 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 8350 7949 gene locus_tag LOCUS_04140 8350 7949 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039868.1 protein_id gnl|my_center|LOCUS_04140 8571 9923 gene locus_tag LOCUS_04150 8571 9923 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_04150 10576 10806 gene locus_tag LOCUS_04160 10576 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10975 13383 gene locus_tag LOCUS_04170 10975 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 <14189 13655 gene locus_tag LOCUS_04180 <14189 13655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219860.1:transposase >Feature sequence032 1407 2759 gene locus_tag LOCUS_04190 1407 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3862 2945 gene locus_tag LOCUS_04200 3862 2945 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_04200 5456 4095 gene locus_tag LOCUS_04210 5456 4095 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_04210 6720 5536 gene locus_tag LOCUS_04220 6720 5536 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_04220 7662 6958 gene locus_tag LOCUS_04230 gene aqpZ 7662 6958 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_04230 8096 8275 gene locus_tag LOCUS_04240 8096 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8362 9246 gene locus_tag LOCUS_04250 8362 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence033 527 766 gene locus_tag LOCUS_04260 527 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 859 1044 gene locus_tag LOCUS_04270 859 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1119 2390 gene locus_tag LOCUS_04280 1119 2390 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_04280 2430 4292 gene locus_tag LOCUS_04290 2430 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4563 5438 gene locus_tag LOCUS_04300 gene menH 4563 5438 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_04300 5904 5464 gene locus_tag LOCUS_04310 5904 5464 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_04310 6836 6045 gene locus_tag LOCUS_04320 gene suhB 6836 6045 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081652.1 protein_id gnl|my_center|LOCUS_04320 7557 7066 gene locus_tag LOCUS_04330 7557 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8239 7631 gene locus_tag LOCUS_04340 8239 7631 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_04340 8872 8540 gene locus_tag LOCUS_04350 8872 8540 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941930.1 protein_id gnl|my_center|LOCUS_04350 9190 9456 gene locus_tag LOCUS_04360 9190 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 9453 9665 gene locus_tag LOCUS_04370 9453 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12301 9740 gene locus_tag LOCUS_04380 12301 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 13669 12662 gene locus_tag LOCUS_04390 13669 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence034 304 2466 gene locus_tag LOCUS_04400 304 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2647 3045 gene locus_tag LOCUS_04410 2647 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3523 3272 gene locus_tag LOCUS_04420 3523 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4264 8106 gene locus_tag LOCUS_04430 4264 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 8377 8841 gene locus_tag LOCUS_04440 8377 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8934 10739 gene locus_tag LOCUS_04450 8934 10739 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_04450 12233 10887 gene locus_tag LOCUS_04460 gene rifK 12233 10887 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_04460 12535 12215 gene locus_tag LOCUS_04470 12535 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 13252 13734 gene locus_tag LOCUS_04480 13252 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence035 1074 676 gene locus_tag LOCUS_04490 1074 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1316 1071 gene locus_tag LOCUS_04500 1316 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2438 1491 gene locus_tag LOCUS_04510 2438 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4134 2836 gene locus_tag LOCUS_04520 4134 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6834 4165 gene locus_tag LOCUS_04530 6834 4165 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_04530 8052 6835 gene locus_tag LOCUS_04540 8052 6835 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_04540 8540 8280 gene locus_tag LOCUS_04550 8540 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8817 8533 gene locus_tag LOCUS_04560 8817 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 10852 8975 gene locus_tag LOCUS_04570 10852 8975 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_04570 12391 11045 gene locus_tag LOCUS_04580 12391 11045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence036 181 582 gene locus_tag LOCUS_04590 181 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 640 1962 gene locus_tag LOCUS_04600 640 1962 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_04600 3418 1973 gene locus_tag LOCUS_04610 3418 1973 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265568.1 protein_id gnl|my_center|LOCUS_04610 3850 3536 gene locus_tag LOCUS_04620 3850 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4410 3847 gene locus_tag LOCUS_04630 4410 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 5279 4701 gene locus_tag LOCUS_04640 gene pyrE 5279 4701 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_04640 5962 5276 gene locus_tag LOCUS_04650 gene pyrF 5962 5276 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_04650 6875 6084 gene locus_tag LOCUS_04660 6875 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7898 6879 gene locus_tag LOCUS_04670 7898 6879 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_04670 8731 7904 gene locus_tag LOCUS_04680 8731 7904 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_04680 10000 8750 gene locus_tag LOCUS_04690 10000 8750 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_04690 10829 10065 gene locus_tag LOCUS_04700 10829 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 12083 10989 gene locus_tag LOCUS_04710 12083 10989 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_04710 12330 12094 gene locus_tag LOCUS_04720 12330 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 12517 13401 gene locus_tag LOCUS_04730 12517 13401 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence037 272 1807 gene locus_tag LOCUS_04740 272 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3037 2096 gene locus_tag LOCUS_04750 3037 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3122 4282 gene locus_tag LOCUS_04760 3122 4282 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937749.1 protein_id gnl|my_center|LOCUS_04760 4427 5374 gene locus_tag LOCUS_04770 4427 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5572 6021 gene locus_tag LOCUS_04780 gene ndk 5572 6021 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_04780 6262 6738 gene locus_tag LOCUS_04790 6262 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6814 8679 gene locus_tag LOCUS_04800 6814 8679 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948610.1 protein_id gnl|my_center|LOCUS_04800 9038 10363 gene locus_tag LOCUS_04810 9038 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 11039 12652 gene locus_tag LOCUS_04820 11039 12652 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_04820 12592 12783 gene locus_tag LOCUS_04830 12592 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence038 <1 657 gene locus_tag LOCUS_04840 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615508.1:mechanosensitive ion channel 2077 950 gene locus_tag LOCUS_04850 2077 950 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_04850 2481 2206 gene locus_tag LOCUS_04860 2481 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04860 3441 2506 gene locus_tag LOCUS_04870 3441 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04870 4077 3463 gene locus_tag LOCUS_04880 gene nqrE 4077 3463 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_04880 4708 4079 gene locus_tag LOCUS_04890 4708 4079 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_04890 5473 4712 gene locus_tag LOCUS_04900 5473 4712 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816934.1 protein_id gnl|my_center|LOCUS_04900 6728 5463 gene locus_tag LOCUS_04910 6728 5463 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_04910 8188 6737 gene locus_tag LOCUS_04920 8188 6737 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_04920 9052 8423 gene locus_tag LOCUS_04930 9052 8423 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_04930 9861 9016 gene locus_tag LOCUS_04940 9861 9016 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_04940 10581 9865 gene locus_tag LOCUS_04950 10581 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11423 10578 gene locus_tag LOCUS_04960 11423 10578 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937413.1 protein_id gnl|my_center|LOCUS_04960 12548 11601 gene locus_tag LOCUS_04970 12548 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence039 1218 3110 gene locus_tag LOCUS_04980 1218 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4343 3114 gene locus_tag LOCUS_04990 4343 3114 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_04990 5017 5319 gene locus_tag LOCUS_05000 5017 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5405 6352 gene locus_tag LOCUS_05010 5405 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 6718 6530 gene locus_tag LOCUS_05020 6718 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 6997 8007 gene locus_tag LOCUS_05030 6997 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 8036 9043 gene locus_tag LOCUS_05040 8036 9043 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_05040 9700 9224 gene locus_tag LOCUS_05050 9700 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 11596 9710 gene locus_tag LOCUS_05060 11596 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12591 11593 gene locus_tag LOCUS_05070 12591 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence040 3088 6732 gene locus_tag LOCUS_05080 3088 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7550 6795 gene locus_tag LOCUS_05090 7550 6795 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_05090 8346 7594 gene locus_tag LOCUS_05100 8346 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9350 8343 gene locus_tag LOCUS_05110 9350 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11081 9390 gene locus_tag LOCUS_05120 11081 9390 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_05120 12222 11215 gene locus_tag LOCUS_05130 12222 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 <13387 12350 gene locus_tag LOCUS_05140 <13387 12350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:sulfatase-like hydrolase/transferase >Feature sequence041 49 402 gene locus_tag LOCUS_05150 49 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1187 396 gene locus_tag LOCUS_05160 1187 396 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_05160 1665 1450 gene locus_tag LOCUS_05170 1665 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1813 1685 gene locus_tag LOCUS_05180 1813 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4034 2136 gene locus_tag LOCUS_05190 4034 2136 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_05190 4653 5348 gene locus_tag LOCUS_05200 4653 5348 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_05200 5516 7843 gene locus_tag LOCUS_05210 5516 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 8526 9632 gene locus_tag LOCUS_05220 8526 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10065 12248 gene locus_tag LOCUS_05230 10065 12248 CDS product DUF6259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108900.1 protein_id gnl|my_center|LOCUS_05230 12880 12260 gene locus_tag LOCUS_05240 12880 12260 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530814.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence042 3639 4796 gene locus_tag LOCUS_05250 gene thiH 3639 4796 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_05250 5480 4998 gene locus_tag LOCUS_05260 5480 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6709 5477 gene locus_tag LOCUS_05270 6709 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9106 6743 gene locus_tag LOCUS_05280 9106 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10449 9223 gene locus_tag LOCUS_05290 10449 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11785 10514 gene locus_tag LOCUS_05300 gene ahbD 11785 10514 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938155.1 protein_id gnl|my_center|LOCUS_05300 12880 11795 gene locus_tag LOCUS_05310 12880 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 13064 12870 gene locus_tag LOCUS_05320 13064 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence043 1091 2563 gene locus_tag LOCUS_05330 1091 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2676 3959 gene locus_tag LOCUS_05340 2676 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6457 4088 gene locus_tag LOCUS_05350 6457 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7925 6663 gene locus_tag LOCUS_05360 7925 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 10022 7935 gene locus_tag LOCUS_05370 10022 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 13006 10223 gene locus_tag LOCUS_05380 13006 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence044 <1 1099 gene locus_tag LOCUS_05390 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275358.1:efflux RND transporter periplasmic adaptor subunit 1399 4989 gene locus_tag LOCUS_05400 1399 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4986 8111 gene locus_tag LOCUS_05410 4986 8111 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_05410 8223 10856 gene locus_tag LOCUS_05420 gene alaS 8223 10856 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_05420 11082 12959 gene locus_tag LOCUS_05430 11082 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence045 <1 610 gene locus_tag LOCUS_05440 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389529.1:site-2 protease family protein 1405 617 gene locus_tag LOCUS_05450 gene srlD 1405 617 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_05450 2296 1538 gene locus_tag LOCUS_05460 2296 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2546 2271 gene locus_tag LOCUS_05470 2546 2271 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_05470 3900 2539 gene locus_tag LOCUS_05480 3900 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4852 4157 gene locus_tag LOCUS_05490 4852 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5041 5117 gene locus_tag LOCUS_t00070 5041 5117 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5265 5507 gene locus_tag LOCUS_05500 5265 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7150 5606 gene locus_tag LOCUS_05510 7150 5606 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_05510 7209 7466 gene locus_tag LOCUS_05520 7209 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8172 7750 gene locus_tag LOCUS_05530 8172 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9506 8241 gene locus_tag LOCUS_05540 9506 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11273 9726 gene locus_tag LOCUS_05550 11273 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 11974 11402 gene locus_tag LOCUS_05560 11974 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12592 12194 gene locus_tag LOCUS_05570 12592 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence046 131 1129 gene locus_tag LOCUS_05580 131 1129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730942.1 protein_id gnl|my_center|LOCUS_05580 1122 2384 gene locus_tag LOCUS_05590 1122 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2613 3626 gene locus_tag LOCUS_05600 2613 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3629 4048 gene locus_tag LOCUS_05610 3629 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6238 4988 gene locus_tag LOCUS_05620 6238 4988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_05620 7443 6514 gene locus_tag LOCUS_05630 7443 6514 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_05630 7871 8764 gene locus_tag LOCUS_05640 7871 8764 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_05640 9888 8791 gene locus_tag LOCUS_05650 9888 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 10722 10078 gene locus_tag LOCUS_05660 10722 10078 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064873.1 protein_id gnl|my_center|LOCUS_05660 11795 12331 gene locus_tag LOCUS_05670 gene rsmD 11795 12331 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence047 <1 521 gene locus_tag LOCUS_05680 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108005.1:IS4 family transposase 535 2649 gene locus_tag LOCUS_05690 535 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2615 3565 gene locus_tag LOCUS_05700 2615 3565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_05700 3890 5074 gene locus_tag LOCUS_05710 3890 5074 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 protein_id gnl|my_center|LOCUS_05710 5077 6399 gene locus_tag LOCUS_05720 5077 6399 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_05720 6528 7925 gene locus_tag LOCUS_05730 gene lpdA 6528 7925 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 protein_id gnl|my_center|LOCUS_05730 7980 9014 gene locus_tag LOCUS_05740 7980 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 9058 10668 gene locus_tag LOCUS_05750 9058 10668 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence048 781 1872 gene locus_tag LOCUS_05760 781 1872 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_05760 1938 2588 gene locus_tag LOCUS_05770 1938 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2655 3449 gene locus_tag LOCUS_05780 2655 3449 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922304.1 protein_id gnl|my_center|LOCUS_05780 3475 4758 gene locus_tag LOCUS_05790 3475 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6119 4836 gene locus_tag LOCUS_05800 6119 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6864 10046 gene locus_tag LOCUS_05810 6864 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 10633 10253 gene locus_tag LOCUS_05820 10633 10253 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317410.1 protein_id gnl|my_center|LOCUS_05820 12181 10811 gene locus_tag LOCUS_05830 12181 10811 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence049 3044 1104 gene locus_tag LOCUS_05840 3044 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3344 3114 gene locus_tag LOCUS_05850 gene yidD 3344 3114 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393999.1 protein_id gnl|my_center|LOCUS_05850 3690 3337 gene locus_tag LOCUS_05860 gene rnpA 3690 3337 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944077.1 protein_id gnl|my_center|LOCUS_05860 5519 4152 gene locus_tag LOCUS_05870 gene ltrA 5519 4152 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_05870 6497 8593 gene locus_tag LOCUS_05880 6497 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8760 9338 gene locus_tag LOCUS_05890 8760 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 9411 10841 gene locus_tag LOCUS_05900 9411 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 11581 10898 gene locus_tag LOCUS_05910 11581 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence050 293 823 gene locus_tag LOCUS_05920 293 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 907 2160 gene locus_tag LOCUS_05930 gene murA 907 2160 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_05930 2197 3513 gene locus_tag LOCUS_05940 gene hisD 2197 3513 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_05940 3513 4574 gene locus_tag LOCUS_05950 gene hisC 3513 4574 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_05950 4613 5701 gene locus_tag LOCUS_05960 4613 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8519 5769 gene locus_tag LOCUS_05970 8519 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8737 8913 gene locus_tag LOCUS_05980 8737 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 9620 9853 gene locus_tag LOCUS_05990 9620 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9946 10923 gene locus_tag LOCUS_06000 9946 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11179 12693 gene locus_tag LOCUS_06010 11179 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence051 <1 1069 gene locus_tag LOCUS_06020 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081252.1:ABC transporter substrate-binding protein 1791 1123 gene locus_tag LOCUS_06030 1791 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3522 5693 gene locus_tag LOCUS_06040 3522 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6069 7460 gene locus_tag LOCUS_06050 6069 7460 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_06050 7457 9067 gene locus_tag LOCUS_06060 7457 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9712 11163 gene locus_tag LOCUS_06070 gene murC 9712 11163 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_06070 11160 11948 gene locus_tag LOCUS_06080 11160 11948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence052 497 590 gene locus_tag LOCUS_t00080 497 590 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 644 2065 gene locus_tag LOCUS_06090 gene selA 644 2065 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_06090 2343 3428 gene locus_tag LOCUS_06100 2343 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3468 4373 gene locus_tag LOCUS_06110 3468 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4674 5816 gene locus_tag LOCUS_06120 4674 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5868 6710 gene locus_tag LOCUS_06130 5868 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6981 8186 gene locus_tag LOCUS_06140 6981 8186 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_06140 9226 10992 gene locus_tag LOCUS_06150 9226 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 11924 12613 gene locus_tag LOCUS_06160 11924 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence053 4180 665 gene locus_tag LOCUS_06170 4180 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 6652 4277 gene locus_tag LOCUS_06180 6652 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7148 9085 gene locus_tag LOCUS_06190 7148 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10228 9116 gene locus_tag LOCUS_06200 10228 9116 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038266.1 protein_id gnl|my_center|LOCUS_06200 11275 12294 gene locus_tag LOCUS_06210 11275 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence054 2194 1094 gene locus_tag LOCUS_06220 2194 1094 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_06220 2800 2285 gene locus_tag LOCUS_06230 2800 2285 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_06230 3939 3013 gene locus_tag LOCUS_06240 3939 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5476 4379 gene locus_tag LOCUS_06250 gene ilvC 5476 4379 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_06250 6461 5574 gene locus_tag LOCUS_06260 6461 5574 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027182.1 protein_id gnl|my_center|LOCUS_06260 6616 7521 gene locus_tag LOCUS_06270 6616 7521 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939760.1 protein_id gnl|my_center|LOCUS_06270 7658 8365 gene locus_tag LOCUS_06280 7658 8365 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_06280 8775 8461 gene locus_tag LOCUS_06290 8775 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9235 8884 gene locus_tag LOCUS_tm00010 9235 8884 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9537 9292 gene locus_tag LOCUS_06300 9537 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence055 1028 408 gene locus_tag LOCUS_06310 1028 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1439 1092 gene locus_tag LOCUS_06320 1439 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1876 4764 gene locus_tag LOCUS_06330 1876 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4790 6280 gene locus_tag LOCUS_06340 4790 6280 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_06340 6277 6447 gene locus_tag LOCUS_06350 6277 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7670 6465 gene locus_tag LOCUS_06360 7670 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8634 7750 gene locus_tag LOCUS_06370 8634 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8849 9943 gene locus_tag LOCUS_06380 8849 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9978 12155 gene locus_tag LOCUS_06390 9978 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence056 4523 2817 gene locus_tag LOCUS_06400 4523 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5772 4684 gene locus_tag LOCUS_06410 5772 4684 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583663.1 protein_id gnl|my_center|LOCUS_06410 6872 5769 gene locus_tag LOCUS_06420 6872 5769 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_06420 7946 6975 gene locus_tag LOCUS_06430 gene pfkA 7946 6975 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821163.1 protein_id gnl|my_center|LOCUS_06430 8855 8007 gene locus_tag LOCUS_06440 8855 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9913 8981 gene locus_tag LOCUS_06450 gene miaA 9913 8981 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_06450 11811 9910 gene locus_tag LOCUS_06460 gene mutL 11811 9910 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_06460 12260 11904 gene locus_tag LOCUS_06470 12260 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence057 815 1048 gene locus_tag LOCUS_06480 815 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1020 2051 gene locus_tag LOCUS_06490 1020 2051 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_06490 2146 3069 gene locus_tag LOCUS_06500 2146 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3066 3593 gene locus_tag LOCUS_06510 3066 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3596 5527 gene locus_tag LOCUS_06520 gene mrdA 3596 5527 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06520 5535 6776 gene locus_tag LOCUS_06530 gene rodA 5535 6776 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597348.1 protein_id gnl|my_center|LOCUS_06530 7123 8067 gene locus_tag LOCUS_06540 7123 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8148 9020 gene locus_tag LOCUS_06550 8148 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 9202 10107 gene locus_tag LOCUS_06560 9202 10107 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_06560 10663 11556 gene locus_tag LOCUS_06570 10663 11556 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615882.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence058 5509 2372 gene locus_tag LOCUS_06580 gene addB 5509 2372 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_06580 5766 7286 gene locus_tag LOCUS_06590 5766 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7713 7564 gene locus_tag LOCUS_06600 7713 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8005 7703 gene locus_tag LOCUS_06610 8005 7703 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_06610 8335 11310 gene locus_tag LOCUS_06620 gene dnaE 8335 11310 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869579.1 protein_id gnl|my_center|LOCUS_06620 11755 11384 gene locus_tag LOCUS_06630 11755 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence059 442 224 gene locus_tag LOCUS_06640 442 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 441 1763 gene locus_tag LOCUS_06650 441 1763 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_06650 1835 2761 gene locus_tag LOCUS_06660 1835 2761 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_06660 3019 3804 gene locus_tag LOCUS_06670 3019 3804 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_06670 3832 5325 gene locus_tag LOCUS_06680 3832 5325 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261398.1 protein_id gnl|my_center|LOCUS_06680 5640 5840 gene locus_tag LOCUS_06690 5640 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5827 6090 gene locus_tag LOCUS_06700 5827 6090 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_06700 6581 6144 gene locus_tag LOCUS_06710 6581 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 7434 7045 gene locus_tag LOCUS_06720 7434 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7546 8955 gene locus_tag LOCUS_06730 7546 8955 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_06730 9251 10387 gene locus_tag LOCUS_06740 9251 10387 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_06740 10389 10679 gene locus_tag LOCUS_06750 10389 10679 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_06750 10680 12074 gene locus_tag LOCUS_06760 10680 12074 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence060 1862 897 gene locus_tag LOCUS_06770 1862 897 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_06770 3246 2035 gene locus_tag LOCUS_06780 3246 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3432 4145 gene locus_tag LOCUS_06790 3432 4145 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_06790 4281 5738 gene locus_tag LOCUS_06800 4281 5738 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_06800 5941 7347 gene locus_tag LOCUS_06810 5941 7347 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_06810 7656 7877 gene locus_tag LOCUS_06820 7656 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 7775 10108 gene locus_tag LOCUS_06830 7775 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11118 10285 gene locus_tag LOCUS_06840 11118 10285 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_06840 12161 11124 gene locus_tag LOCUS_06850 12161 11124 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940764.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence061 <1 940 gene locus_tag LOCUS_06860 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 1315 2040 gene locus_tag LOCUS_06870 1315 2040 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_06870 2054 2659 gene locus_tag LOCUS_06880 gene hisB 2054 2659 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_06880 2656 3279 gene locus_tag LOCUS_06890 gene hisH 2656 3279 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_06890 3331 4161 gene locus_tag LOCUS_06900 3331 4161 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 protein_id gnl|my_center|LOCUS_06900 4203 4430 gene locus_tag LOCUS_06910 4203 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4886 5743 gene locus_tag LOCUS_06920 4886 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5740 6837 gene locus_tag LOCUS_06930 5740 6837 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_06930 6918 7904 gene locus_tag LOCUS_06940 6918 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7959 9041 gene locus_tag LOCUS_06950 7959 9041 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_06950 9074 9601 gene locus_tag LOCUS_06960 gene efp 9074 9601 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_06960 10118 11416 gene locus_tag LOCUS_06970 10118 11416 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880939.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence062 2359 2435 gene locus_tag LOCUS_t00090 2359 2435 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2622 3233 gene locus_tag LOCUS_06980 gene rpsD 2622 3233 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879982.1 protein_id gnl|my_center|LOCUS_06980 3354 4622 gene locus_tag LOCUS_06990 3354 4622 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418817.1 protein_id gnl|my_center|LOCUS_06990 4784 5884 gene locus_tag LOCUS_07000 4784 5884 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_07000 5949 7223 gene locus_tag LOCUS_07010 5949 7223 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_07010 7248 8282 gene locus_tag LOCUS_07020 7248 8282 CDS product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 protein_id gnl|my_center|LOCUS_07020 <12032 8397 gene locus_tag LOCUS_07030 <12032 8397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108530.1:non-lysosomal glucosylceramidase >Feature sequence063 1446 739 gene locus_tag LOCUS_07040 1446 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2013 1507 gene locus_tag LOCUS_07050 2013 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3093 2671 gene locus_tag LOCUS_07060 3093 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4928 3114 gene locus_tag LOCUS_07070 4928 3114 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_07070 6545 5076 gene locus_tag LOCUS_07080 6545 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6607 6897 gene locus_tag LOCUS_07090 6607 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8088 6955 gene locus_tag LOCUS_07100 8088 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9615 8860 gene locus_tag LOCUS_07110 9615 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11523 9877 gene locus_tag LOCUS_07120 11523 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 11754 12005 gene locus_tag LOCUS_07130 11754 12005 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence064 <1 793 gene locus_tag LOCUS_07140 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226311.1:discoidin domain-containing protein 900 1097 gene locus_tag LOCUS_07150 900 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1188 2288 gene locus_tag LOCUS_07160 1188 2288 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_07160 2339 4618 gene locus_tag LOCUS_07170 2339 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4625 5962 gene locus_tag LOCUS_07180 4625 5962 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_07180 6809 6021 gene locus_tag LOCUS_07190 6809 6021 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_07190 7134 6844 gene locus_tag LOCUS_07200 7134 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8578 7196 gene locus_tag LOCUS_07210 8578 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 8863 9273 gene locus_tag LOCUS_07220 8863 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07220 9277 10080 gene locus_tag LOCUS_07230 9277 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07230 >Feature sequence065 3003 2137 gene locus_tag LOCUS_07240 3003 2137 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_07240 3650 3000 gene locus_tag LOCUS_07250 3650 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_07250 5438 3864 gene locus_tag LOCUS_07260 5438 3864 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248486.1 protein_id gnl|my_center|LOCUS_07260 6473 5595 gene locus_tag LOCUS_07270 6473 5595 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_07270 7956 6649 gene locus_tag LOCUS_07280 7956 6649 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_07280 9335 8181 gene locus_tag LOCUS_07290 9335 8181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_07290 10364 10173 gene locus_tag LOCUS_07300 10364 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 10476 10859 gene locus_tag LOCUS_07310 10476 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07310 10902 11207 gene locus_tag LOCUS_07320 10902 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 11642 11325 gene locus_tag LOCUS_07330 11642 11325 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence066 <1 507 gene locus_tag LOCUS_07340 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392066.1:ATP-dependent Clp protease ATP-binding subunit ClpX 675 3062 gene locus_tag LOCUS_07350 gene lon 675 3062 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_07350 3074 3655 gene locus_tag LOCUS_07360 gene ysxC 3074 3655 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_07360 5603 3756 gene locus_tag LOCUS_07370 5603 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5944 5660 gene locus_tag LOCUS_07380 5944 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5861 7216 gene locus_tag LOCUS_07390 5861 7216 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_07390 7308 9317 gene locus_tag LOCUS_07400 gene ppk1 7308 9317 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_07400 10110 9394 gene locus_tag LOCUS_07410 10110 9394 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_07410 10855 10310 gene locus_tag LOCUS_07420 10855 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence067 3010 866 gene locus_tag LOCUS_07430 3010 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5708 3495 gene locus_tag LOCUS_07440 5708 3495 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108899.1 protein_id gnl|my_center|LOCUS_07440 6945 5782 gene locus_tag LOCUS_07450 6945 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 8232 7033 gene locus_tag LOCUS_07460 8232 7033 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_07460 10215 8470 gene locus_tag LOCUS_07470 10215 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 11497 10202 gene locus_tag LOCUS_07480 11497 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence068 3049 1640 gene locus_tag LOCUS_07490 3049 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4191 4577 gene locus_tag LOCUS_07500 4191 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4627 4809 gene locus_tag LOCUS_07510 4627 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5063 4869 gene locus_tag LOCUS_07520 5063 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5597 6979 gene locus_tag LOCUS_07530 5597 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence069 2 2416 gene locus_tag LOCUS_07540 2 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2662 3261 gene locus_tag LOCUS_07550 2662 3261 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938506.1 protein_id gnl|my_center|LOCUS_07550 3537 4619 gene locus_tag LOCUS_07560 gene plsX 3537 4619 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_07560 5159 5016 gene locus_tag LOCUS_07570 5159 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5288 5647 gene locus_tag LOCUS_07580 5288 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07580 5715 6755 gene locus_tag LOCUS_07590 5715 6755 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381308.1 protein_id gnl|my_center|LOCUS_07590 6755 9415 gene locus_tag LOCUS_07600 6755 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9451 10197 gene locus_tag LOCUS_07610 9451 10197 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_07610 10190 10564 gene locus_tag LOCUS_07620 gene folB 10190 10564 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_07620 10566 11096 gene locus_tag LOCUS_07630 gene folK 10566 11096 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215128.1 protein_id gnl|my_center|LOCUS_07630 11093 11662 gene locus_tag LOCUS_07640 gene folE 11093 11662 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence070 <1 2317 gene locus_tag LOCUS_07650 <1 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 4766 2364 gene locus_tag LOCUS_07660 4766 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6731 4785 gene locus_tag LOCUS_07670 6731 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8033 6840 gene locus_tag LOCUS_07680 8033 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_07680 <11792 8554 gene locus_tag LOCUS_07690 <11792 8554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence071 279 1463 gene locus_tag LOCUS_07700 279 1463 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933651.1 protein_id gnl|my_center|LOCUS_07700 1467 2072 gene locus_tag LOCUS_07710 1467 2072 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_07710 2373 3131 gene locus_tag LOCUS_07720 2373 3131 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_07720 4448 3213 gene locus_tag LOCUS_07730 gene icd 4448 3213 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_07730 6157 4559 gene locus_tag LOCUS_07740 gene serA 6157 4559 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 protein_id gnl|my_center|LOCUS_07740 7670 6696 gene locus_tag LOCUS_07750 7670 6696 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_07750 7920 8651 gene locus_tag LOCUS_07760 7920 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 8579 9061 gene locus_tag LOCUS_07770 8579 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 9099 10391 gene locus_tag LOCUS_07780 9099 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence072 2427 1207 gene locus_tag LOCUS_07790 2427 1207 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_07790 2915 2424 gene locus_tag LOCUS_07800 2915 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3341 2937 gene locus_tag LOCUS_07810 3341 2937 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_07810 3565 3350 gene locus_tag LOCUS_07820 3565 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4382 3639 gene locus_tag LOCUS_07830 4382 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4780 4532 gene locus_tag LOCUS_07840 4780 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6989 4842 gene locus_tag LOCUS_07850 6989 4842 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211634420.1 protein_id gnl|my_center|LOCUS_07850 8257 7181 gene locus_tag LOCUS_07860 8257 7181 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_07860 10090 8393 gene locus_tag LOCUS_07870 10090 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 10727 10113 gene locus_tag LOCUS_07880 10727 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 <11645 10929 gene locus_tag LOCUS_07890 <11645 10929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226611.1:CocE/NonD family hydrolase >Feature sequence073 <1 573 gene locus_tag LOCUS_07900 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966368.1:phosphoenolpyruvate--protein phosphotransferase 694 2469 gene locus_tag LOCUS_07910 gene ptsP 694 2469 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_07910 2493 3647 gene locus_tag LOCUS_07920 2493 3647 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_07920 3654 5336 gene locus_tag LOCUS_07930 gene rseP 3654 5336 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_07930 5436 6746 gene locus_tag LOCUS_07940 5436 6746 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_07940 6993 7766 gene locus_tag LOCUS_07950 6993 7766 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_07950 7763 9325 gene locus_tag LOCUS_07960 gene bshC 7763 9325 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_07960 9325 10041 gene locus_tag LOCUS_07970 gene bshB1 9325 10041 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_07970 11095 10055 gene locus_tag LOCUS_07980 11095 10055 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence074 517 1392 gene locus_tag LOCUS_07990 517 1392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_07990 1438 3405 gene locus_tag LOCUS_08000 1438 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3461 4447 gene locus_tag LOCUS_08010 3461 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4680 5222 gene locus_tag LOCUS_08020 4680 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5297 5764 gene locus_tag LOCUS_08030 5297 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5792 6073 gene locus_tag LOCUS_08040 gene rpsR 5792 6073 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_08040 6135 7049 gene locus_tag LOCUS_08050 6135 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7129 7638 gene locus_tag LOCUS_08060 gene rplI 7129 7638 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_08060 7640 9142 gene locus_tag LOCUS_08070 gene dnaB 7640 9142 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_08070 9682 10554 gene locus_tag LOCUS_08080 gene dapA 9682 10554 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939154.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence075 3630 2263 gene locus_tag LOCUS_08090 3630 2263 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_08090 4629 3817 gene locus_tag LOCUS_08100 4629 3817 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532465.1 protein_id gnl|my_center|LOCUS_08100 5799 4939 gene locus_tag LOCUS_08110 5799 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6560 5796 gene locus_tag LOCUS_08120 6560 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 9297 7129 gene locus_tag LOCUS_08130 9297 7129 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_08130 11084 9675 gene locus_tag LOCUS_08140 11084 9675 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence076 <1 1367 gene locus_tag LOCUS_08150 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057374.1:class II fumarate hydratase 2728 1628 gene locus_tag LOCUS_08160 2728 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3769 2801 gene locus_tag LOCUS_08170 gene hprK 3769 2801 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_08170 4391 3825 gene locus_tag LOCUS_08180 gene raiA 4391 3825 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_08180 6658 4838 gene locus_tag LOCUS_08190 gene ilvB 6658 4838 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_08190 8985 6943 gene locus_tag LOCUS_08200 8985 6943 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_08200 9163 9846 gene locus_tag LOCUS_08210 9163 9846 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_08210 <11242 9893 gene locus_tag LOCUS_08220 <11242 9893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119973.1:Na+:solute symporter >Feature sequence077 1180 482 gene locus_tag LOCUS_08230 1180 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1676 1762 gene locus_tag LOCUS_t00100 1676 1762 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1899 2366 gene locus_tag LOCUS_08240 1899 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2448 4850 gene locus_tag LOCUS_08250 2448 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4995 5744 gene locus_tag LOCUS_08260 gene larB 4995 5744 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_08260 5755 6945 gene locus_tag LOCUS_08270 gene larC 5755 6945 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_08270 6938 7462 gene locus_tag LOCUS_08280 gene coaD 6938 7462 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_08280 8003 7509 gene locus_tag LOCUS_08290 gene tadA 8003 7509 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_08290 8284 9063 gene locus_tag LOCUS_08300 8284 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9123 10043 gene locus_tag LOCUS_08310 gene ftsY 9123 10043 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_08310 10349 10897 gene locus_tag LOCUS_08320 10349 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence078 <1 717 gene locus_tag LOCUS_08330 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803426.1:SDR family oxidoreductase 692 1888 gene locus_tag LOCUS_08340 692 1888 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259620.1 protein_id gnl|my_center|LOCUS_08340 1917 2594 gene locus_tag LOCUS_08350 1917 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2800 3729 gene locus_tag LOCUS_08360 2800 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4966 3803 gene locus_tag LOCUS_08370 4966 3803 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_08370 7750 5318 gene locus_tag LOCUS_08380 7750 5318 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_08380 7971 8786 gene locus_tag LOCUS_08390 7971 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10849 8822 gene locus_tag LOCUS_08400 10849 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence079 988 1698 gene locus_tag LOCUS_08410 988 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1923 2537 gene locus_tag LOCUS_08420 gene cysC 1923 2537 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 protein_id gnl|my_center|LOCUS_08420 3003 2644 gene locus_tag LOCUS_08430 3003 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3755 3000 gene locus_tag LOCUS_08440 gene trmD 3755 3000 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_08440 4332 3787 gene locus_tag LOCUS_08450 4332 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4580 4329 gene locus_tag LOCUS_08460 4580 4329 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557283.1 protein_id gnl|my_center|LOCUS_08460 5053 4580 gene locus_tag LOCUS_08470 5053 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6509 5157 gene locus_tag LOCUS_08480 gene ffh 6509 5157 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_08480 7169 8758 gene locus_tag LOCUS_08490 gene groL 7169 8758 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532389.1 protein_id gnl|my_center|LOCUS_08490 9101 8841 gene locus_tag LOCUS_08500 9101 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082814.1 protein_id gnl|my_center|LOCUS_08500 10573 9179 gene locus_tag LOCUS_08510 gene hydG 10573 9179 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939053.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence080 1366 335 gene locus_tag LOCUS_08520 1366 335 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062349.1 protein_id gnl|my_center|LOCUS_08520 1750 3864 gene locus_tag LOCUS_08530 1750 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3887 4618 gene locus_tag LOCUS_08540 3887 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4765 5220 gene locus_tag LOCUS_08550 4765 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5363 6409 gene locus_tag LOCUS_08560 gene hemE 5363 6409 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056588.1 protein_id gnl|my_center|LOCUS_08560 6561 7649 gene locus_tag LOCUS_08570 6561 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7951 9435 gene locus_tag LOCUS_08580 7951 9435 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 9432 10559 gene locus_tag LOCUS_08590 9432 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence081 993 1322 gene locus_tag LOCUS_08600 993 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1322 2257 gene locus_tag LOCUS_08610 gene fmt 1322 2257 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_08610 2257 3591 gene locus_tag LOCUS_08620 gene rsmB 2257 3591 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_08620 3549 4634 gene locus_tag LOCUS_08630 3549 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4675 5331 gene locus_tag LOCUS_08640 gene rpe 4675 5331 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_08640 6694 5426 gene locus_tag LOCUS_08650 6694 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6988 7902 gene locus_tag LOCUS_08660 6988 7902 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102098.1 protein_id gnl|my_center|LOCUS_08660 7937 9472 gene locus_tag LOCUS_08670 gene rbsA 7937 9472 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_08670 9462 10460 gene locus_tag LOCUS_08680 gene rbsC 9462 10460 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence082 4060 2921 gene locus_tag LOCUS_08690 4060 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4292 5743 gene locus_tag LOCUS_08700 gene gnd 4292 5743 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_08700 6014 8647 gene locus_tag LOCUS_08710 6014 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence083 686 1441 gene locus_tag LOCUS_08720 686 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1498 3720 gene locus_tag LOCUS_08730 1498 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 3751 4572 gene locus_tag LOCUS_08740 3751 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4861 5175 gene locus_tag LOCUS_08750 4861 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5181 6152 gene locus_tag LOCUS_08760 5181 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6269 7960 gene locus_tag LOCUS_08770 6269 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence084 5692 4574 gene locus_tag LOCUS_08780 5692 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8138 5946 gene locus_tag LOCUS_08790 8138 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 10404 8167 gene locus_tag LOCUS_08800 10404 8167 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence085 <1 779 gene locus_tag LOCUS_08810 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082850.1:ATP-dependent Clp protease ATP-binding subunit 776 3094 gene locus_tag LOCUS_08820 gene bamA 776 3094 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244679.1 protein_id gnl|my_center|LOCUS_08820 3307 3558 gene locus_tag LOCUS_08830 3307 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3501 3510 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3542 3874 gene locus_tag LOCUS_08840 3542 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4154 5206 gene locus_tag LOCUS_08850 gene lpxD 4154 5206 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939642.1 protein_id gnl|my_center|LOCUS_08850 5184 6506 gene locus_tag LOCUS_08860 5184 6506 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_08860 6534 6785 gene locus_tag LOCUS_08870 6534 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7911 6802 gene locus_tag LOCUS_08880 7911 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10001 8175 gene locus_tag LOCUS_08890 10001 8175 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence086 1520 4720 gene locus_tag LOCUS_08900 1520 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5424 5702 gene locus_tag LOCUS_08910 5424 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 7316 5919 gene locus_tag LOCUS_08920 7316 5919 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391703.1 protein_id gnl|my_center|LOCUS_08920 9900 7405 gene locus_tag LOCUS_08930 9900 7405 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence087 2146 839 gene locus_tag LOCUS_08940 2146 839 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704861.1 protein_id gnl|my_center|LOCUS_08940 3526 2267 gene locus_tag LOCUS_08950 3526 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4263 5678 gene locus_tag LOCUS_08960 4263 5678 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_08960 5692 6210 gene locus_tag LOCUS_08970 5692 6210 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942947.1 protein_id gnl|my_center|LOCUS_08970 6223 6777 gene locus_tag LOCUS_08980 6223 6777 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_08980 6803 8467 gene locus_tag LOCUS_08990 gene sulP 6803 8467 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_08990 8625 9227 gene locus_tag LOCUS_09000 8625 9227 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_09000 10223 9351 gene locus_tag LOCUS_09010 10223 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 10606 10364 gene locus_tag LOCUS_09020 10606 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence088 1805 963 gene locus_tag LOCUS_09030 1805 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2240 1815 gene locus_tag LOCUS_09040 2240 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3106 2261 gene locus_tag LOCUS_09050 3106 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3503 3096 gene locus_tag LOCUS_09060 gene xcpT 3503 3096 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_09060 4742 3507 gene locus_tag LOCUS_09070 gene gspF 4742 3507 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_09070 6482 4758 gene locus_tag LOCUS_09080 gene gspE 6482 4758 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_09080 9037 6485 gene locus_tag LOCUS_09090 gene gspD 9037 6485 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 protein_id gnl|my_center|LOCUS_09090 9604 9416 gene locus_tag LOCUS_09100 9604 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10651 9686 gene locus_tag LOCUS_09110 10651 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence089 1287 3815 gene locus_tag LOCUS_09120 1287 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 5368 4043 gene locus_tag LOCUS_09130 5368 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7725 5548 gene locus_tag LOCUS_09140 7725 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 9624 7969 gene locus_tag LOCUS_09150 9624 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 10118 9750 gene locus_tag LOCUS_09160 10118 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 <10676 10102 gene locus_tag LOCUS_09170 <10676 10102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003887303.1:IS630-like element ISMsm2 family transposase >Feature sequence090 1642 377 gene locus_tag LOCUS_09180 1642 377 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_09180 2712 1714 gene locus_tag LOCUS_09190 gene gap 2712 1714 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_09190 2861 3085 gene locus_tag LOCUS_09200 2861 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3183 4460 gene locus_tag LOCUS_09210 3183 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4911 4729 gene locus_tag LOCUS_09220 4911 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6131 5547 gene locus_tag LOCUS_09230 6131 5547 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_09230 7576 6128 gene locus_tag LOCUS_09240 7576 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9148 7604 gene locus_tag LOCUS_09250 9148 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9547 9398 gene locus_tag LOCUS_09260 9547 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence091 33 1652 gene locus_tag LOCUS_09270 33 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2022 2270 gene locus_tag LOCUS_09280 2022 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2387 5782 gene locus_tag LOCUS_09290 2387 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5888 6187 gene locus_tag LOCUS_09300 5888 6187 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_09300 6860 6213 gene locus_tag LOCUS_09310 6860 6213 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_09310 7666 7007 gene locus_tag LOCUS_09320 7666 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7911 8192 gene locus_tag LOCUS_09330 7911 8192 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727964.1 protein_id gnl|my_center|LOCUS_09330 8836 8618 gene locus_tag LOCUS_09340 8836 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 9010 9171 gene locus_tag LOCUS_09350 9010 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 9584 9396 gene locus_tag LOCUS_09360 9584 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 10605 9529 gene locus_tag LOCUS_09370 10605 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence092 273 82 gene locus_tag LOCUS_09380 273 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 486 752 gene locus_tag LOCUS_09390 486 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 797 4585 gene locus_tag LOCUS_09400 797 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6093 4933 gene locus_tag LOCUS_09410 6093 4933 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_09410 6964 6140 gene locus_tag LOCUS_09420 gene hisF 6964 6140 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_09420 7763 10054 gene locus_tag LOCUS_09430 7763 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence093 3899 378 gene locus_tag LOCUS_09440 3899 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4197 4382 gene locus_tag LOCUS_09450 4197 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 7470 4849 gene locus_tag LOCUS_09460 7470 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence094 350 63 gene locus_tag LOCUS_09470 350 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 502 1215 gene locus_tag LOCUS_09480 502 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1571 2800 gene locus_tag LOCUS_09490 1571 2800 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_09490 3171 5927 gene locus_tag LOCUS_09500 3171 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5924 6406 gene locus_tag LOCUS_09510 5924 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6813 8525 gene locus_tag LOCUS_09520 6813 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 8522 9220 gene locus_tag LOCUS_09530 8522 9220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence095 304 1188 gene locus_tag LOCUS_09540 304 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1273 3273 gene locus_tag LOCUS_09550 1273 3273 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_09550 3977 4186 gene locus_tag LOCUS_09560 3977 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4943 4869 gene locus_tag LOCUS_t00110 4943 4869 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5375 6472 gene locus_tag LOCUS_09570 5375 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7729 6803 gene locus_tag LOCUS_09580 7729 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 8992 8072 gene locus_tag LOCUS_09590 gene ispE 8992 8072 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 protein_id gnl|my_center|LOCUS_09590 9735 9511 gene locus_tag LOCUS_09600 9735 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence096 2316 1513 gene locus_tag LOCUS_09610 2316 1513 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_09610 3560 2856 gene locus_tag LOCUS_09620 3560 2856 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073710.1 protein_id gnl|my_center|LOCUS_09620 4316 3711 gene locus_tag LOCUS_09630 gene lmtA 4316 3711 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09630 4870 4679 gene locus_tag LOCUS_09640 4870 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6206 5322 gene locus_tag LOCUS_09650 6206 5322 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_09650 6756 9515 gene locus_tag LOCUS_09660 6756 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence097 2151 538 gene locus_tag LOCUS_09670 2151 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2599 4773 gene locus_tag LOCUS_09680 2599 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5325 6224 gene locus_tag LOCUS_09690 5325 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 7511 6360 gene locus_tag LOCUS_09700 7511 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7498 7577 gene locus_tag LOCUS_t00120 7498 7577 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8878 7775 gene locus_tag LOCUS_09710 8878 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9316 9089 gene locus_tag LOCUS_09720 9316 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence098 1769 282 gene locus_tag LOCUS_09730 gene pap 1769 282 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_09730 2742 1810 gene locus_tag LOCUS_09740 2742 1810 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_09740 3539 2739 gene locus_tag LOCUS_09750 3539 2739 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_09750 4621 3536 gene locus_tag LOCUS_09760 gene disA 4621 3536 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_09760 5984 4623 gene locus_tag LOCUS_09770 gene radA 5984 4623 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_09770 6349 7371 gene locus_tag LOCUS_09780 6349 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence099 1924 698 gene locus_tag LOCUS_09790 1924 698 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_09790 2062 3258 gene locus_tag LOCUS_09800 2062 3258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_09800 3844 3287 gene locus_tag LOCUS_09810 3844 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5019 4012 gene locus_tag LOCUS_09820 5019 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5290 6015 gene locus_tag LOCUS_09830 5290 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 7349 6021 gene locus_tag LOCUS_09840 7349 6021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_09840 7593 8717 gene locus_tag LOCUS_09850 7593 8717 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_09850 9212 8730 gene locus_tag LOCUS_09860 9212 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 <10138 9205 gene locus_tag LOCUS_09870 <10138 9205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089199.1:glycogen synthase GlgA >Feature sequence100 260 2086 gene locus_tag LOCUS_09880 260 2086 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551340.1 protein_id gnl|my_center|LOCUS_09880 3204 2131 gene locus_tag LOCUS_09890 3204 2131 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_09890 4205 3201 gene locus_tag LOCUS_09900 gene dmpG 4205 3201 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749470.1 protein_id gnl|my_center|LOCUS_09900 5110 4214 gene locus_tag LOCUS_09910 5110 4214 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552044.1 protein_id gnl|my_center|LOCUS_09910 5207 5986 gene locus_tag LOCUS_09920 gene rfbF 5207 5986 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976066.1 protein_id gnl|my_center|LOCUS_09920 5980 7056 gene locus_tag LOCUS_09930 gene rfbG 5980 7056 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_09930 7101 8933 gene locus_tag LOCUS_09940 7101 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8955 9887 gene locus_tag LOCUS_09950 8955 9887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence101 1618 146 gene locus_tag LOCUS_09960 gene nhaC 1618 146 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068039.1 protein_id gnl|my_center|LOCUS_09960 1840 2646 gene locus_tag LOCUS_09970 1840 2646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_09970 3403 3239 gene locus_tag LOCUS_09980 3403 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3922 3524 gene locus_tag LOCUS_09990 3922 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4893 3985 gene locus_tag LOCUS_10000 4893 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 5993 5028 gene locus_tag LOCUS_10010 5993 5028 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_10010 6837 6112 gene locus_tag LOCUS_10020 6837 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 9105 7045 gene locus_tag LOCUS_10030 9105 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 9104 9295 gene locus_tag LOCUS_10040 9104 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence102 751 2172 gene locus_tag LOCUS_10050 751 2172 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727239.1 protein_id gnl|my_center|LOCUS_10050 2465 3202 gene locus_tag LOCUS_10060 2465 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3346 5172 gene locus_tag LOCUS_10070 3346 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6327 5185 gene locus_tag LOCUS_10080 6327 5185 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_10080 6888 6664 gene locus_tag LOCUS_10090 6888 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 7024 7866 gene locus_tag LOCUS_10100 7024 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 7955 8164 gene locus_tag LOCUS_10110 7955 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8161 8538 gene locus_tag LOCUS_10120 8161 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 8552 9706 gene locus_tag LOCUS_10130 8552 9706 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence103 241 250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 335 1336 gene locus_tag LOCUS_10140 335 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2157 1357 gene locus_tag LOCUS_10150 gene dapB 2157 1357 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_10150 5705 2178 gene locus_tag LOCUS_10160 5705 2178 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_10160 5973 6851 gene locus_tag LOCUS_10170 5973 6851 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_10170 6862 7455 gene locus_tag LOCUS_10180 gene gmk 6862 7455 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_10180 7544 7774 gene locus_tag LOCUS_10190 7544 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7781 8980 gene locus_tag LOCUS_10200 gene coaBC 7781 8980 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence104 1288 1085 gene locus_tag LOCUS_10210 1288 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1415 1272 gene locus_tag LOCUS_10220 1415 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1654 1466 gene locus_tag LOCUS_10230 1654 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2027 1635 gene locus_tag LOCUS_10240 2027 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3619 2630 gene locus_tag LOCUS_10250 3619 2630 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_10250 4076 3603 gene locus_tag LOCUS_10260 4076 3603 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680156.1 protein_id gnl|my_center|LOCUS_10260 6322 4262 gene locus_tag LOCUS_10270 6322 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6578 8548 gene locus_tag LOCUS_10280 6578 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 <9838 8832 gene locus_tag LOCUS_10290 <9838 8832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332193.1:carbon starvation protein A >Feature sequence105 653 66 gene locus_tag LOCUS_10300 653 66 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_10300 2514 679 gene locus_tag LOCUS_10310 gene recN 2514 679 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_10310 2677 3195 gene locus_tag LOCUS_10320 2677 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3213 4766 gene locus_tag LOCUS_10330 3213 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6211 4814 gene locus_tag LOCUS_10340 6211 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8303 6225 gene locus_tag LOCUS_10350 8303 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 9643 8303 gene locus_tag LOCUS_10360 9643 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence106 794 1645 gene locus_tag LOCUS_10370 794 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1961 3598 gene locus_tag LOCUS_10380 1961 3598 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_10380 3756 4091 gene locus_tag LOCUS_10390 3756 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4084 4410 gene locus_tag LOCUS_10400 4084 4410 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_10400 4400 4744 gene locus_tag LOCUS_10410 4400 4744 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_10410 4904 5899 gene locus_tag LOCUS_10420 4904 5899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_10420 5977 6915 gene locus_tag LOCUS_10430 5977 6915 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10430 7683 6952 gene locus_tag LOCUS_10440 7683 6952 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_10440 9010 7790 gene locus_tag LOCUS_10450 9010 7790 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_10450 <9797 9007 gene locus_tag LOCUS_10460 <9797 9007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944011.1:efflux RND transporter permease subunit >Feature sequence107 261 1235 gene locus_tag LOCUS_10470 261 1235 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528381.1 protein_id gnl|my_center|LOCUS_10470 1180 2085 gene locus_tag LOCUS_10480 1180 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1949 1958 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2113 3555 gene locus_tag LOCUS_10490 2113 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3604 4188 gene locus_tag LOCUS_10500 3604 4188 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966373.1 protein_id gnl|my_center|LOCUS_10500 4409 4221 gene locus_tag LOCUS_10510 4409 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4323 5210 gene locus_tag LOCUS_10520 4323 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5207 6172 gene locus_tag LOCUS_10530 5207 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8899 6245 gene locus_tag LOCUS_10540 8899 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9337 8927 gene locus_tag LOCUS_10550 9337 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence108 <1 1568 gene locus_tag LOCUS_10560 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467081.1:molecular chaperone HtpG 1808 1668 gene locus_tag LOCUS_10570 1808 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1929 3437 gene locus_tag LOCUS_10580 1929 3437 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_10580 3488 5245 gene locus_tag LOCUS_10590 gene thiC 3488 5245 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121180.1 protein_id gnl|my_center|LOCUS_10590 5497 9198 gene locus_tag LOCUS_10600 5497 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence109 1762 2739 gene locus_tag LOCUS_10610 1762 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 3818 2769 gene locus_tag LOCUS_10620 3818 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6817 3899 gene locus_tag LOCUS_10630 6817 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7453 7220 gene locus_tag LOCUS_10640 7453 7220 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942550.1 protein_id gnl|my_center|LOCUS_10640 <9788 7861 gene locus_tag LOCUS_10650 <9788 7861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919647.1:DJ-1/PfpI family protein >Feature sequence110 796 464 gene locus_tag LOCUS_10660 796 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1415 825 gene locus_tag LOCUS_10670 1415 825 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_10670 2763 1999 gene locus_tag LOCUS_10680 gene larE 2763 1999 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_10680 3282 2842 gene locus_tag LOCUS_10690 3282 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4511 3468 gene locus_tag LOCUS_10700 4511 3468 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_10700 5592 4537 gene locus_tag LOCUS_10710 5592 4537 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 protein_id gnl|my_center|LOCUS_10710 7292 5589 gene locus_tag LOCUS_10720 7292 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7549 8790 gene locus_tag LOCUS_10730 7549 8790 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence111 1730 3205 gene locus_tag LOCUS_10740 1730 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 <9623 3680 gene locus_tag LOCUS_10750 <9623 3680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence112 <1 525 gene locus_tag LOCUS_10760 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038942.1:non-ribosomal peptide synthetase 522 4682 gene locus_tag LOCUS_10770 522 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4675 5448 gene locus_tag LOCUS_10780 4675 5448 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_10780 5588 6556 gene locus_tag LOCUS_10790 5588 6556 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_10790 7417 7019 gene locus_tag LOCUS_10800 7417 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 8434 7493 gene locus_tag LOCUS_10810 8434 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence113 2244 1078 gene locus_tag LOCUS_10820 gene gbcB 2244 1078 CDS product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763583.1 protein_id gnl|my_center|LOCUS_10820 3729 2254 gene locus_tag LOCUS_10830 gene crtI 3729 2254 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_10830 4216 5970 gene locus_tag LOCUS_10840 4216 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6168 7451 gene locus_tag LOCUS_10850 6168 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7661 8845 gene locus_tag LOCUS_10860 7661 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9428 9069 gene locus_tag LOCUS_10870 9428 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence114 985 146 gene locus_tag LOCUS_10880 gene prmC 985 146 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_10880 2068 989 gene locus_tag LOCUS_10890 gene prfA 2068 989 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_10890 2332 2075 gene locus_tag LOCUS_10900 2332 2075 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_10900 3778 2531 gene locus_tag LOCUS_10910 3778 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4127 5128 gene locus_tag LOCUS_10920 4127 5128 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_10920 5183 6151 gene locus_tag LOCUS_10930 5183 6151 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_10930 6503 8863 gene locus_tag LOCUS_10940 6503 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence115 2917 3762 gene locus_tag LOCUS_10950 2917 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4385 4972 gene locus_tag LOCUS_10960 4385 4972 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060787.1 protein_id gnl|my_center|LOCUS_10960 5694 6944 gene locus_tag LOCUS_10970 5694 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 7024 7839 gene locus_tag LOCUS_10980 7024 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 8000 8539 gene locus_tag LOCUS_10990 8000 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence116 2884 2156 gene locus_tag LOCUS_11000 2884 2156 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388824.1 protein_id gnl|my_center|LOCUS_11000 3588 2887 gene locus_tag LOCUS_11010 3588 2887 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_11010 4403 3585 gene locus_tag LOCUS_11020 4403 3585 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388821.1 protein_id gnl|my_center|LOCUS_11020 4877 4476 gene locus_tag LOCUS_11030 4877 4476 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_11030 6037 5204 gene locus_tag LOCUS_11040 6037 5204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_11040 6207 7646 gene locus_tag LOCUS_11050 6207 7646 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_11050 7715 8623 gene locus_tag LOCUS_11060 7715 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8907 8653 gene locus_tag LOCUS_11070 8907 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence117 1844 159 gene locus_tag LOCUS_11080 1844 159 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_11080 3296 1923 gene locus_tag LOCUS_11090 3296 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5158 3635 gene locus_tag LOCUS_11100 5158 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7180 5318 gene locus_tag LOCUS_11110 gene uvrC 7180 5318 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_11110 7260 8063 gene locus_tag LOCUS_11120 7260 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence118 4343 2694 gene locus_tag LOCUS_11130 4343 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5144 4344 gene locus_tag LOCUS_11140 5144 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7483 5540 gene locus_tag LOCUS_11150 7483 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 8874 7447 gene locus_tag LOCUS_11160 8874 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 <9419 8862 gene locus_tag LOCUS_11170 <9419 8862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259049.1:sugar phosphate nucleotidyltransferase >Feature sequence119 4494 457 gene locus_tag LOCUS_11180 4494 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5667 4498 gene locus_tag LOCUS_11190 gene bshA 5667 4498 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_11190 6072 5842 gene locus_tag LOCUS_11200 6072 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7803 6400 gene locus_tag LOCUS_11210 7803 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8090 7800 gene locus_tag LOCUS_11220 8090 7800 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_11220 9304 8120 gene locus_tag LOCUS_11230 9304 8120 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence120 5600 4812 gene locus_tag LOCUS_11240 5600 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 6795 5620 gene locus_tag LOCUS_11250 6795 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8471 7770 gene locus_tag LOCUS_11260 8471 7770 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_11260 8670 8882 gene locus_tag LOCUS_11270 8670 8882 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence121 4144 3938 gene locus_tag LOCUS_11280 4144 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4979 5167 gene locus_tag LOCUS_11290 4979 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5521 6813 gene locus_tag LOCUS_11300 5521 6813 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_11300 7425 9266 gene locus_tag LOCUS_11310 7425 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence122 399 1703 gene locus_tag LOCUS_11320 399 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1934 2497 gene locus_tag LOCUS_11330 1934 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 2479 2487 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2538 4004 gene locus_tag LOCUS_11340 2538 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 4189 5436 gene locus_tag LOCUS_11350 4189 5436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_11350 5691 7508 gene locus_tag LOCUS_11360 gene lepA 5691 7508 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_11360 7501 8544 gene locus_tag LOCUS_11370 7501 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence123 <1 1873 gene locus_tag LOCUS_11380 <1 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971639.1:glycoside hydrolase family 2 2743 5553 gene locus_tag LOCUS_11390 2743 5553 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_11390 5745 5978 gene locus_tag LOCUS_11400 5745 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6519 6827 gene locus_tag LOCUS_11410 6519 6827 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_11410 6808 7152 gene locus_tag LOCUS_11420 6808 7152 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_11420 9057 7606 gene locus_tag LOCUS_11430 9057 7606 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence124 183 1415 gene locus_tag LOCUS_11440 gene glgC 183 1415 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_11440 2867 1632 gene locus_tag LOCUS_11450 2867 1632 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_11450 4311 3076 gene locus_tag LOCUS_11460 4311 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4666 5868 gene locus_tag LOCUS_11470 4666 5868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_11470 5989 6969 gene locus_tag LOCUS_11480 5989 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6992 7339 gene locus_tag LOCUS_11490 6992 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7440 8453 gene locus_tag LOCUS_11500 7440 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 <9273 8471 gene locus_tag LOCUS_11510 <9273 8471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868819.1:sugar phosphate nucleotidyltransferase >Feature sequence125 6393 7697 gene locus_tag LOCUS_11520 6393 7697 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence126 220 1569 gene locus_tag LOCUS_11530 220 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1922 4597 gene locus_tag LOCUS_11540 1922 4597 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943038.1 protein_id gnl|my_center|LOCUS_11540 4891 5367 gene locus_tag LOCUS_11550 4891 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 5538 6083 gene locus_tag LOCUS_11560 5538 6083 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_11560 7239 6325 gene locus_tag LOCUS_11570 7239 6325 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_11570 7544 8113 gene locus_tag LOCUS_11580 gene rpoE 7544 8113 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_11580 8107 8802 gene locus_tag LOCUS_11590 8107 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence127 <1 1119 gene locus_tag LOCUS_11600 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272418.1:NADPH-dependent glutamate synthase 1450 1704 gene locus_tag LOCUS_11610 1450 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1728 3818 gene locus_tag LOCUS_11620 1728 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4396 4250 gene locus_tag LOCUS_11630 4396 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6324 4891 gene locus_tag LOCUS_11640 6324 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7022 6345 gene locus_tag LOCUS_11650 7022 6345 CDS product phosphatase PAP2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947360.1 protein_id gnl|my_center|LOCUS_11650 7702 7031 gene locus_tag LOCUS_11660 7702 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8569 7898 gene locus_tag LOCUS_11670 8569 7898 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918280.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence128 273 1022 gene locus_tag LOCUS_11680 273 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1279 4551 gene locus_tag LOCUS_11690 1279 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4674 5807 gene locus_tag LOCUS_11700 4674 5807 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence129 758 2746 gene locus_tag LOCUS_11710 758 2746 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803793.1 protein_id gnl|my_center|LOCUS_11710 3058 2903 gene locus_tag LOCUS_11720 3058 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3430 4989 gene locus_tag LOCUS_11730 gene xylB 3430 4989 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_11730 4979 6328 gene locus_tag LOCUS_11740 4979 6328 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_11740 6653 6471 gene locus_tag LOCUS_11750 6653 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6739 7476 gene locus_tag LOCUS_11760 6739 7476 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence130 2223 4016 gene locus_tag LOCUS_11770 2223 4016 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_11770 4019 8746 gene locus_tag LOCUS_11780 4019 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence131 2984 900 gene locus_tag LOCUS_11790 2984 900 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_11790 3165 3374 gene locus_tag LOCUS_11800 3165 3374 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_11800 3515 4822 gene locus_tag LOCUS_11810 3515 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 6189 4978 gene locus_tag LOCUS_11820 6189 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6470 7300 gene locus_tag LOCUS_11830 6470 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 7947 7342 gene locus_tag LOCUS_11840 7947 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8567 8382 gene locus_tag LOCUS_11850 8567 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence132 2148 466 gene locus_tag LOCUS_11860 2148 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2993 2172 gene locus_tag LOCUS_11870 gene murI 2993 2172 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_11870 3658 2990 gene locus_tag LOCUS_11880 3658 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4957 3701 gene locus_tag LOCUS_11890 4957 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6745 5726 gene locus_tag LOCUS_11900 6745 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7339 6746 gene locus_tag LOCUS_11910 7339 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 8331 7348 gene locus_tag LOCUS_11920 8331 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence133 1450 2649 gene locus_tag LOCUS_11930 1450 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5377 2945 gene locus_tag LOCUS_11940 5377 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6327 5365 gene locus_tag LOCUS_11950 6327 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence134 4443 3232 gene locus_tag LOCUS_11960 4443 3232 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_11960 5061 6362 gene locus_tag LOCUS_11970 5061 6362 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_11970 6599 8380 gene locus_tag LOCUS_11980 6599 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence135 <1 1014 gene locus_tag LOCUS_11990 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942443.1:citramalate synthase 1821 1051 gene locus_tag LOCUS_12000 1821 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4807 1832 gene locus_tag LOCUS_12010 4807 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7209 4948 gene locus_tag LOCUS_12020 7209 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8659 7325 gene locus_tag LOCUS_12030 8659 7325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence136 653 1555 gene locus_tag LOCUS_12040 653 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1652 2551 gene locus_tag LOCUS_12050 1652 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2591 4144 gene locus_tag LOCUS_12060 2591 4144 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_12060 4144 5481 gene locus_tag LOCUS_12070 4144 5481 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_12070 6022 5492 gene locus_tag LOCUS_12080 6022 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6534 6788 gene locus_tag LOCUS_12090 6534 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6913 8034 gene locus_tag LOCUS_12100 6913 8034 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_12100 8028 8339 gene locus_tag LOCUS_12110 8028 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12110 >Feature sequence137 1182 157 gene locus_tag LOCUS_12120 gene lpxK 1182 157 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_12120 2375 1179 gene locus_tag LOCUS_12130 gene dprA 2375 1179 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_12130 3088 2402 gene locus_tag LOCUS_12140 3088 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4078 3176 gene locus_tag LOCUS_12150 4078 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4110 4262 gene locus_tag LOCUS_12160 4110 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4804 4382 gene locus_tag LOCUS_12170 4804 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5399 4797 gene locus_tag LOCUS_12180 gene rpoE 5399 4797 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_12180 6307 5396 gene locus_tag LOCUS_12190 6307 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6566 6982 gene locus_tag LOCUS_12200 gene nikR 6566 6982 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_12200 7747 7007 gene locus_tag LOCUS_12210 7747 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7833 8093 gene locus_tag LOCUS_12220 7833 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence138 309 1826 gene locus_tag LOCUS_12230 309 1826 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_12230 5069 2835 gene locus_tag LOCUS_12240 5069 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 <8747 5905 gene locus_tag LOCUS_12250 <8747 5905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024193.1:PKD domain-containing protein >Feature sequence139 1333 668 gene locus_tag LOCUS_12260 1333 668 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_12260 1846 2151 gene locus_tag LOCUS_12270 gene gatC 1846 2151 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722233.1 protein_id gnl|my_center|LOCUS_12270 2148 3617 gene locus_tag LOCUS_12280 gene gatA 2148 3617 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_12280 3628 5058 gene locus_tag LOCUS_12290 gene gatB 3628 5058 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_12290 5081 5464 gene locus_tag LOCUS_12300 gene rsfS 5081 5464 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_12300 5478 6320 gene locus_tag LOCUS_12310 5478 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6409 8046 gene locus_tag LOCUS_12320 6409 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence140 1179 2348 gene locus_tag LOCUS_12330 1179 2348 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_12330 3484 2378 gene locus_tag LOCUS_12340 3484 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5134 3722 gene locus_tag LOCUS_12350 5134 3722 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_12350 5394 6554 gene locus_tag LOCUS_12360 5394 6554 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_12360 6880 8550 gene locus_tag LOCUS_12370 gene ilvD 6880 8550 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932306.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence141 204 22 gene locus_tag LOCUS_12380 204 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 671 1951 gene locus_tag LOCUS_12390 671 1951 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_12390 2171 2623 gene locus_tag LOCUS_12400 2171 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2626 2811 gene locus_tag LOCUS_12410 2626 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3057 3194 gene locus_tag LOCUS_12420 3057 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4056 6035 gene locus_tag LOCUS_12430 4056 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence142 <1 2336 gene locus_tag LOCUS_12440 <1 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' 2389 3375 gene locus_tag LOCUS_12450 2389 3375 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941029.1 protein_id gnl|my_center|LOCUS_12450 3740 5032 gene locus_tag LOCUS_12460 gene eno 3740 5032 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_12460 5081 5440 gene locus_tag LOCUS_12470 5081 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5784 8114 gene locus_tag LOCUS_12480 5784 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence143 593 384 gene locus_tag LOCUS_12490 593 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1572 781 gene locus_tag LOCUS_12500 1572 781 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_12500 2368 1964 gene locus_tag LOCUS_12510 2368 1964 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_12510 2562 2365 gene locus_tag LOCUS_12520 2562 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4039 2834 gene locus_tag LOCUS_12530 4039 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6443 4764 gene locus_tag LOCUS_12540 6443 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 7284 6613 gene locus_tag LOCUS_12550 gene thiE 7284 6613 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_12550 7499 7287 gene locus_tag LOCUS_12560 7499 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8529 7510 gene locus_tag LOCUS_12570 8529 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence144 462 1184 gene locus_tag LOCUS_12580 462 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1714 1490 gene locus_tag LOCUS_12590 1714 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2172 1951 gene locus_tag LOCUS_12600 2172 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3425 2274 gene locus_tag LOCUS_12610 3425 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7127 4314 gene locus_tag LOCUS_12620 7127 4314 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_12620 8540 7317 gene locus_tag LOCUS_12630 8540 7317 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence145 <1 1172 gene locus_tag LOCUS_12640 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224485.1:TRAM domain-containing protein 1189 1761 gene locus_tag LOCUS_12650 1189 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 3396 2020 gene locus_tag LOCUS_12660 3396 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3603 5123 gene locus_tag LOCUS_12670 3603 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_12670 5356 6570 gene locus_tag LOCUS_12680 5356 6570 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_12680 7505 6615 gene locus_tag LOCUS_12690 7505 6615 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_12690 7778 8323 gene locus_tag LOCUS_12700 gene hslV 7778 8323 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081403.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence146 1259 3853 gene locus_tag LOCUS_12710 1259 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3958 5589 gene locus_tag LOCUS_12720 3958 5589 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_12720 6617 5652 gene locus_tag LOCUS_12730 6617 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7126 6596 gene locus_tag LOCUS_12740 7126 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 7637 7455 gene locus_tag LOCUS_12750 7637 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 <8368 7824 gene locus_tag LOCUS_12760 <8368 7824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083415.1:DUF2239 family protein >Feature sequence147 5049 1393 gene locus_tag LOCUS_12770 5049 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 <8309 5481 gene locus_tag LOCUS_12780 <8309 5481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041670058.1:RecQ family ATP-dependent DNA helicase >Feature sequence148 1689 1039 gene locus_tag LOCUS_12790 1689 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2830 1766 gene locus_tag LOCUS_12800 gene hrcA 2830 1766 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_12800 3928 2948 gene locus_tag LOCUS_12810 3928 2948 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125147.1 protein_id gnl|my_center|LOCUS_12810 4872 3925 gene locus_tag LOCUS_12820 4872 3925 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_12820 5152 5763 gene locus_tag LOCUS_12830 5152 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5949 7391 gene locus_tag LOCUS_12840 5949 7391 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391741.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence149 354 208 gene locus_tag LOCUS_12850 354 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 865 2283 gene locus_tag LOCUS_12860 865 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2408 3481 gene locus_tag LOCUS_12870 2408 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4005 7577 gene locus_tag LOCUS_12880 gene nifJ 4005 7577 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence150 2345 195 gene locus_tag LOCUS_12890 2345 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3193 2339 gene locus_tag LOCUS_12900 3193 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4258 3302 gene locus_tag LOCUS_12910 gene trpD 4258 3302 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_12910 4633 5688 gene locus_tag LOCUS_12920 4633 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5685 6434 gene locus_tag LOCUS_12930 5685 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6494 7249 gene locus_tag LOCUS_12940 6494 7249 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223106389.1 protein_id gnl|my_center|LOCUS_12940 7322 8044 gene locus_tag LOCUS_12950 7322 8044 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence151 293 880 gene locus_tag LOCUS_12960 293 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1147 2391 gene locus_tag LOCUS_12970 1147 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2460 3491 gene locus_tag LOCUS_12980 2460 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3599 6217 gene locus_tag LOCUS_12990 3599 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6280 7755 gene locus_tag LOCUS_13000 6280 7755 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence152 186 1565 gene locus_tag LOCUS_13010 gene mnmE 186 1565 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_13010 1637 2206 gene locus_tag LOCUS_13020 1637 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2203 2829 gene locus_tag LOCUS_13030 2203 2829 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 protein_id gnl|my_center|LOCUS_13030 2826 3506 gene locus_tag LOCUS_13040 2826 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3517 4545 gene locus_tag LOCUS_13050 3517 4545 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_13050 4566 5426 gene locus_tag LOCUS_13060 4566 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5426 7291 gene locus_tag LOCUS_13070 5426 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence153 2374 800 gene locus_tag LOCUS_13080 2374 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3035 2748 gene locus_tag LOCUS_13090 3035 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3421 4107 gene locus_tag LOCUS_13100 3421 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4553 7030 gene locus_tag LOCUS_13110 4553 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence154 2 532 gene locus_tag LOCUS_13120 2 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 600 1898 gene locus_tag LOCUS_13130 600 1898 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_13130 2358 2588 gene locus_tag LOCUS_13140 2358 2588 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141324.1 protein_id gnl|my_center|LOCUS_13140 6277 2663 gene locus_tag LOCUS_13150 6277 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6660 7811 gene locus_tag LOCUS_13160 gene proB 6660 7811 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence155 2153 105 gene locus_tag LOCUS_13170 2153 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2734 5061 gene locus_tag LOCUS_13180 2734 5061 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_13180 5546 6346 gene locus_tag LOCUS_13190 5546 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6566 7342 gene locus_tag LOCUS_13200 6566 7342 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence156 1215 874 gene locus_tag LOCUS_13210 1215 874 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_13210 1753 1908 gene locus_tag LOCUS_13220 1753 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2026 2145 gene locus_tag LOCUS_13230 2026 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3782 2319 gene locus_tag LOCUS_13240 3782 2319 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_13240 4280 4891 gene locus_tag LOCUS_13250 gene pgsA 4280 4891 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_13250 4907 6046 gene locus_tag LOCUS_13260 gene alr 4907 6046 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_13260 6060 6632 gene locus_tag LOCUS_13270 6060 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 6828 7019 gene locus_tag LOCUS_13280 6828 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 <8115 7048 gene locus_tag LOCUS_13290 <8115 7048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393236.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydE >Feature sequence157 1503 2819 gene locus_tag LOCUS_13300 1503 2819 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13300 4311 2842 gene locus_tag LOCUS_13310 4311 2842 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13310 5202 6161 gene locus_tag LOCUS_13320 5202 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence158 1304 2662 gene locus_tag LOCUS_13330 1304 2662 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_13330 3060 2785 gene locus_tag LOCUS_13340 3060 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13340 5092 3185 gene locus_tag LOCUS_13350 5092 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5670 5089 gene locus_tag LOCUS_13360 5670 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 7691 5724 gene locus_tag LOCUS_13370 gene iha 7691 5724 CDS product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223352.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence159 1291 728 gene locus_tag LOCUS_13380 1291 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2313 1288 gene locus_tag LOCUS_13390 2313 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_13390 3759 2380 gene locus_tag LOCUS_13400 3759 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4341 5000 gene locus_tag LOCUS_13410 4341 5000 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_13410 5205 5618 gene locus_tag LOCUS_13420 5205 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5611 8016 gene locus_tag LOCUS_13430 5611 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence160 136 1203 gene locus_tag LOCUS_13440 136 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1904 1278 gene locus_tag LOCUS_13450 1904 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2177 1995 gene locus_tag LOCUS_13460 2177 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3163 2168 gene locus_tag LOCUS_13470 3163 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4820 3243 gene locus_tag LOCUS_13480 4820 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5401 4817 gene locus_tag LOCUS_13490 5401 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 6968 5394 gene locus_tag LOCUS_13500 6968 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence161 2252 3316 gene locus_tag LOCUS_13510 2252 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3445 4683 gene locus_tag LOCUS_13520 3445 4683 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_13520 6524 5100 gene locus_tag LOCUS_13530 gene glnA 6524 5100 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_13530 7018 6677 gene locus_tag LOCUS_13540 7018 6677 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_13540 8022 7735 gene locus_tag LOCUS_13550 8022 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence162 <1 916 gene locus_tag LOCUS_13560 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140254.1:tail fiber domain-containing protein 950 1474 gene locus_tag LOCUS_13570 950 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2240 1680 gene locus_tag LOCUS_13580 2240 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2542 3327 gene locus_tag LOCUS_13590 2542 3327 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 protein_id gnl|my_center|LOCUS_13590 3428 7015 gene locus_tag LOCUS_13600 gene smc 3428 7015 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence163 1093 152 gene locus_tag LOCUS_13610 1093 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2313 1366 gene locus_tag LOCUS_13620 2313 1366 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_13620 2573 3757 gene locus_tag LOCUS_13630 2573 3757 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_13630 4824 3790 gene locus_tag LOCUS_13640 4824 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6451 4817 gene locus_tag LOCUS_13650 6451 4817 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_13650 7895 6696 gene locus_tag LOCUS_13660 7895 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence164 1357 1770 gene locus_tag LOCUS_13670 1357 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2013 2342 gene locus_tag LOCUS_13680 2013 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2604 4010 gene locus_tag LOCUS_13690 2604 4010 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_13690 4612 4034 gene locus_tag LOCUS_13700 4612 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4869 4612 gene locus_tag LOCUS_13710 4869 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5162 4881 gene locus_tag LOCUS_13720 5162 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6724 5162 gene locus_tag LOCUS_13730 6724 5162 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_13730 <7941 6874 gene locus_tag LOCUS_13740 <7941 6874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence165 1834 1643 gene locus_tag LOCUS_13750 1834 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7171 2900 gene locus_tag LOCUS_13760 7171 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence166 383 309 gene locus_tag LOCUS_t00130 383 309 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 733 924 gene locus_tag LOCUS_13770 733 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 982 1503 gene locus_tag LOCUS_13780 982 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2032 1820 gene locus_tag LOCUS_13790 2032 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2276 2085 gene locus_tag LOCUS_13800 2276 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3229 2276 gene locus_tag LOCUS_13810 3229 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3929 4129 gene locus_tag LOCUS_13820 3929 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4233 6881 gene locus_tag LOCUS_13830 4233 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6910 7689 gene locus_tag LOCUS_13840 6910 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence167 2090 1032 gene locus_tag LOCUS_13850 gene ychF 2090 1032 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_13850 2351 3778 gene locus_tag LOCUS_13860 2351 3778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_13860 4029 4670 gene locus_tag LOCUS_13870 4029 4670 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_13870 4692 5378 gene locus_tag LOCUS_13880 4692 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5406 7307 gene locus_tag LOCUS_13890 5406 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence168 67 696 gene locus_tag LOCUS_13900 67 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 724 2031 gene locus_tag LOCUS_13910 724 2031 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083037.1 protein_id gnl|my_center|LOCUS_13910 4577 3723 gene locus_tag LOCUS_13920 4577 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5497 4598 gene locus_tag LOCUS_13930 5497 4598 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_13930 7581 5671 gene locus_tag LOCUS_13940 7581 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence169 2358 895 gene locus_tag LOCUS_13950 2358 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4736 2364 gene locus_tag LOCUS_13960 gene nuoF 4736 2364 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_13960 5189 6193 gene locus_tag LOCUS_13970 5189 6193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_13970 6896 6498 gene locus_tag LOCUS_13980 6896 6498 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_13980 7135 6896 gene locus_tag LOCUS_13990 7135 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7341 7634 gene locus_tag LOCUS_14000 7341 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence170 1328 555 gene locus_tag LOCUS_14010 1328 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2263 1526 gene locus_tag LOCUS_14020 gene istB 2263 1526 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_14020 3804 2257 gene locus_tag LOCUS_14030 gene istA 3804 2257 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_14030 5713 4262 gene locus_tag LOCUS_14040 5713 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6739 6512 gene locus_tag LOCUS_14050 6739 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence171 2419 4641 gene locus_tag LOCUS_14060 2419 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 5155 5719 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggggctcaccagcctgac 7362 6289 gene locus_tag LOCUS_14070 7362 6289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence172 <1 1031 gene locus_tag LOCUS_14080 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000552081.1:acetyl-CoA C-acetyltransferase 2447 1110 gene locus_tag LOCUS_14090 2447 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3027 4925 gene locus_tag LOCUS_14100 3027 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4932 6065 gene locus_tag LOCUS_14110 4932 6065 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence173 1378 1302 gene locus_tag LOCUS_t00140 1378 1302 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3728 1458 gene locus_tag LOCUS_14120 3728 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4096 5175 gene locus_tag LOCUS_14130 4096 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6876 5224 gene locus_tag LOCUS_14140 6876 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence174 232 241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence175 1619 2746 gene locus_tag LOCUS_14150 1619 2746 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_14150 4417 2777 gene locus_tag LOCUS_14160 4417 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4819 6471 gene locus_tag LOCUS_14170 4819 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 <7673 6676 gene locus_tag LOCUS_14180 <7673 6676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030935.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence176 1175 438 gene locus_tag LOCUS_14190 1175 438 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081657.1 protein_id gnl|my_center|LOCUS_14190 1435 2028 gene locus_tag LOCUS_14200 gene sodB 1435 2028 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_14200 2423 2091 gene locus_tag LOCUS_14210 2423 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4023 2686 gene locus_tag LOCUS_14220 4023 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 4367 4020 gene locus_tag LOCUS_14230 4367 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5652 4519 gene locus_tag LOCUS_14240 5652 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6644 5931 gene locus_tag LOCUS_14250 6644 5931 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence177 1191 3083 gene locus_tag LOCUS_14260 1191 3083 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_14260 3178 3576 gene locus_tag LOCUS_14270 3178 3576 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_14270 3787 4074 gene locus_tag LOCUS_14280 gene groES 3787 4074 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_14280 4118 5746 gene locus_tag LOCUS_14290 gene groL 4118 5746 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029966.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence178 <1 3622 gene locus_tag LOCUS_14300 <1 3622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108467.1:serine/threonine-protein kinase 3643 5892 gene locus_tag LOCUS_14310 3643 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 5995 6903 gene locus_tag LOCUS_14320 5995 6903 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_14320 6900 7178 gene locus_tag LOCUS_14330 6900 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence179 <1 1339 gene locus_tag LOCUS_14340 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986778.1:adenylosuccinate lyase 2435 1356 gene locus_tag LOCUS_14350 2435 1356 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932661.1 protein_id gnl|my_center|LOCUS_14350 4534 2588 gene locus_tag LOCUS_14360 4534 2588 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942135.1 protein_id gnl|my_center|LOCUS_14360 5105 4515 gene locus_tag LOCUS_14370 gene plsY 5105 4515 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002912552.1 protein_id gnl|my_center|LOCUS_14370 6490 5102 gene locus_tag LOCUS_14380 gene der 6490 5102 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_14380 7046 6477 gene locus_tag LOCUS_14390 7046 6477 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence180 330 1340 gene locus_tag LOCUS_14400 330 1340 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_14400 1966 2628 gene locus_tag LOCUS_14410 1966 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2717 3616 gene locus_tag LOCUS_14420 gene xerD 2717 3616 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_14420 3683 6244 gene locus_tag LOCUS_14430 3683 6244 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence181 651 2036 gene locus_tag LOCUS_14440 651 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2475 2053 gene locus_tag LOCUS_14450 2475 2053 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118215.1 protein_id gnl|my_center|LOCUS_14450 2752 3327 gene locus_tag LOCUS_14460 2752 3327 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_14460 3635 4096 gene locus_tag LOCUS_14470 3635 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4250 4975 gene locus_tag LOCUS_14480 4250 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6169 5075 gene locus_tag LOCUS_14490 gene thrC 6169 5075 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_14490 <7450 6189 gene locus_tag LOCUS_14500 <7450 6189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545264.1:homoserine dehydrogenase >Feature sequence182 3111 862 gene locus_tag LOCUS_14510 3111 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3479 3943 gene locus_tag LOCUS_14520 3479 3943 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_14520 3958 5034 gene locus_tag LOCUS_14530 3958 5034 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_14530 5058 5897 gene locus_tag LOCUS_14540 gene cysT 5058 5897 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_14540 5904 6779 gene locus_tag LOCUS_14550 gene cysW 5904 6779 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence183 120 1139 gene locus_tag LOCUS_14560 120 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1575 2261 gene locus_tag LOCUS_14570 1575 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2306 2983 gene locus_tag LOCUS_14580 2306 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2976 3953 gene locus_tag LOCUS_14590 2976 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4114 6996 gene locus_tag LOCUS_14600 4114 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence184 1049 2077 gene locus_tag LOCUS_14610 1049 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2840 3862 gene locus_tag LOCUS_14620 2840 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5903 4377 gene locus_tag LOCUS_14630 5903 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6886 6167 gene locus_tag LOCUS_14640 6886 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 <7430 6890 gene locus_tag LOCUS_14650 <7430 6890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339121.1:Hsp70 family protein note possible pseudo, internal stop codon >Feature sequence185 655 975 gene locus_tag LOCUS_14660 gene trxA 655 975 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_14660 1141 2148 gene locus_tag LOCUS_14670 1141 2148 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_14670 3312 2599 gene locus_tag LOCUS_14680 gene ubiE 3312 2599 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_14680 3907 3434 gene locus_tag LOCUS_14690 gene rimI 3907 3434 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_14690 4676 3924 gene locus_tag LOCUS_14700 gene tsaB 4676 3924 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_14700 5205 4867 gene locus_tag LOCUS_14710 5205 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6073 7329 gene locus_tag LOCUS_14720 6073 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence186 615 1688 gene locus_tag LOCUS_14730 615 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3184 1685 gene locus_tag LOCUS_14740 3184 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3578 3168 gene locus_tag LOCUS_14750 3578 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4636 3575 gene locus_tag LOCUS_14760 4636 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5739 4795 gene locus_tag LOCUS_14770 5739 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7282 6041 gene locus_tag LOCUS_14780 7282 6041 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence187 228 1703 gene locus_tag LOCUS_14790 228 1703 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_14790 3000 1708 gene locus_tag LOCUS_14800 3000 1708 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_14800 5202 3067 gene locus_tag LOCUS_14810 5202 3067 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_14810 5454 6911 gene locus_tag LOCUS_14820 5454 6911 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence188 <1 770 gene locus_tag LOCUS_14830 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020599.1:chorismate synthase 2814 868 gene locus_tag LOCUS_14840 2814 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3148 4170 gene locus_tag LOCUS_14850 3148 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 4629 4177 gene locus_tag LOCUS_14860 gene dut 4629 4177 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_14860 5894 4629 gene locus_tag LOCUS_14870 5894 4629 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_14870 <7386 5989 gene locus_tag LOCUS_14880 <7386 5989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence189 2056 476 gene locus_tag LOCUS_14890 2056 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2872 2408 gene locus_tag LOCUS_14900 2872 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3752 2940 gene locus_tag LOCUS_14910 3752 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 5320 3749 gene locus_tag LOCUS_14920 5320 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 6237 5317 gene locus_tag LOCUS_14930 6237 5317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_14930 6644 6234 gene locus_tag LOCUS_14940 6644 6234 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_14940 6776 6910 gene locus_tag LOCUS_14950 6776 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence190 3978 1786 gene locus_tag LOCUS_14960 3978 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5679 4528 gene locus_tag LOCUS_14970 5679 4528 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144327.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence191 5815 2549 gene locus_tag LOCUS_14980 5815 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 6975 5812 gene locus_tag LOCUS_14990 6975 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence192 732 421 gene locus_tag LOCUS_15000 732 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3565 1040 gene locus_tag LOCUS_15010 gene leuS 3565 1040 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_15010 4851 3574 gene locus_tag LOCUS_15020 4851 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 6205 5411 gene locus_tag LOCUS_15030 6205 5411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263654.1 protein_id gnl|my_center|LOCUS_15030 6840 6202 gene locus_tag LOCUS_15040 gene fetA 6840 6202 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157540.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence193 2006 3076 gene locus_tag LOCUS_15050 2006 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3129 3827 gene locus_tag LOCUS_15060 3129 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3876 4073 gene locus_tag LOCUS_15070 3876 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4181 4894 gene locus_tag LOCUS_15080 4181 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4943 5323 gene locus_tag LOCUS_15090 4943 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5355 6398 gene locus_tag LOCUS_15100 5355 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6451 6903 gene locus_tag LOCUS_15110 6451 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence194 473 1204 gene locus_tag LOCUS_15120 473 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2634 1198 gene locus_tag LOCUS_15130 gene rimO 2634 1198 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_15130 4139 2709 gene locus_tag LOCUS_15140 4139 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4458 5630 gene locus_tag LOCUS_15150 4458 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5826 7079 gene locus_tag LOCUS_15160 5826 7079 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921978.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence195 371 1615 gene locus_tag LOCUS_15170 371 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2083 1664 gene locus_tag LOCUS_15180 2083 1664 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_15180 3780 2086 gene locus_tag LOCUS_15190 3780 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4571 3777 gene locus_tag LOCUS_15200 4571 3777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_15200 6133 4640 gene locus_tag LOCUS_15210 6133 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 <7184 6109 gene locus_tag LOCUS_15220 <7184 6109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461206.1:preprotein translocase subunit SecA >Feature sequence196 967 368 gene locus_tag LOCUS_15230 967 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1575 2717 gene locus_tag LOCUS_15240 1575 2717 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_15240 3483 4031 gene locus_tag LOCUS_15250 3483 4031 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564348.1 protein_id gnl|my_center|LOCUS_15250 6530 4182 gene locus_tag LOCUS_15260 6530 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence197 5225 1185 gene locus_tag LOCUS_15270 5225 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6435 5773 gene locus_tag LOCUS_15280 gene deoC 6435 5773 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773709.1 protein_id gnl|my_center|LOCUS_15280 6741 7013 gene locus_tag LOCUS_15290 6741 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence198 1889 387 gene locus_tag LOCUS_15300 1889 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2704 2312 gene locus_tag LOCUS_15310 gene rplL 2704 2312 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_15310 3307 2780 gene locus_tag LOCUS_15320 gene rplJ 3307 2780 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_15320 3696 4478 gene locus_tag LOCUS_15330 gene trpC 3696 4478 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_15330 4462 5088 gene locus_tag LOCUS_15340 4462 5088 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_15340 5054 6271 gene locus_tag LOCUS_15350 gene trpB 5054 6271 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_15350 6273 7067 gene locus_tag LOCUS_15360 gene trpA 6273 7067 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence199 1358 3013 gene locus_tag LOCUS_15370 1358 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3436 3263 gene locus_tag LOCUS_15380 3436 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3602 6514 gene locus_tag LOCUS_15390 3602 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence200 716 630 gene locus_tag LOCUS_t00150 716 630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2757 1051 gene locus_tag LOCUS_15400 2757 1051 CDS product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 protein_id gnl|my_center|LOCUS_15400 4573 2870 gene locus_tag LOCUS_15410 4573 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 5199 4651 gene locus_tag LOCUS_15420 5199 4651 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_15420 5989 5189 gene locus_tag LOCUS_15430 5989 5189 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_15430 <7053 5983 gene locus_tag LOCUS_15440 <7053 5983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545833.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence201 1394 42 gene locus_tag LOCUS_15450 1394 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1598 3085 gene locus_tag LOCUS_15460 1598 3085 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_15460 3380 4693 gene locus_tag LOCUS_15470 3380 4693 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_15470 5234 5022 gene locus_tag LOCUS_15480 5234 5022 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_15480 5488 5234 gene locus_tag LOCUS_15490 5488 5234 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_15490 5662 5507 gene locus_tag LOCUS_15500 5662 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence202 509 1885 gene locus_tag LOCUS_15510 509 1885 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_15510 1900 2655 gene locus_tag LOCUS_15520 1900 2655 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_15520 3157 2669 gene locus_tag LOCUS_15530 3157 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4399 3389 gene locus_tag LOCUS_15540 4399 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 6030 4444 gene locus_tag LOCUS_15550 6030 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 <7034 6131 gene locus_tag LOCUS_15560 <7034 6131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678885.1:protease modulator HflC >Feature sequence203 494 1435 gene locus_tag LOCUS_15570 gene miaA 494 1435 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_15570 1432 2829 gene locus_tag LOCUS_15580 1432 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3437 2787 gene locus_tag LOCUS_15590 3437 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4677 3592 gene locus_tag LOCUS_15600 4677 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5696 4932 gene locus_tag LOCUS_15610 gene rlmB 5696 4932 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_15610 6133 5693 gene locus_tag LOCUS_15620 6133 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6500 6150 gene locus_tag LOCUS_15630 6500 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence204 147 830 gene locus_tag LOCUS_15640 147 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1550 1705 gene locus_tag LOCUS_15650 1550 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1716 1946 gene locus_tag LOCUS_15660 1716 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3467 2028 gene locus_tag LOCUS_15670 3467 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 5168 3924 gene locus_tag LOCUS_15680 5168 3924 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_15680 5952 7004 gene locus_tag LOCUS_15690 5952 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence205 85 1167 gene locus_tag LOCUS_15700 85 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1170 2141 gene locus_tag LOCUS_15710 1170 2141 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531221.1 protein_id gnl|my_center|LOCUS_15710 2160 2870 gene locus_tag LOCUS_15720 gene aroD 2160 2870 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545528.1 protein_id gnl|my_center|LOCUS_15720 3017 3706 gene locus_tag LOCUS_15730 3017 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3978 5717 gene locus_tag LOCUS_15740 3978 5717 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence206 1559 150 gene locus_tag LOCUS_15750 1559 150 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_15750 1869 2519 gene locus_tag LOCUS_15760 1869 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2567 2971 gene locus_tag LOCUS_15770 2567 2971 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_15770 4803 3184 gene locus_tag LOCUS_15780 4803 3184 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_15780 4990 5817 gene locus_tag LOCUS_15790 4990 5817 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence207 2497 1235 gene locus_tag LOCUS_15800 2497 1235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15800 5370 2536 gene locus_tag LOCUS_15810 5370 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6758 5619 gene locus_tag LOCUS_15820 6758 5619 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence208 322 1860 gene locus_tag LOCUS_15830 322 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1972 3984 gene locus_tag LOCUS_15840 1972 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4388 4029 gene locus_tag LOCUS_15850 4388 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5590 4439 gene locus_tag LOCUS_15860 5590 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6007 5594 gene locus_tag LOCUS_15870 6007 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 <6891 6060 gene locus_tag LOCUS_15880 <6891 6060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941439.1:cache domain-containing protein >Feature sequence209 1123 479 gene locus_tag LOCUS_15890 1123 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2909 1872 gene locus_tag LOCUS_15900 2909 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3300 2911 gene locus_tag LOCUS_15910 3300 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2959 2968 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4076 3321 gene locus_tag LOCUS_15920 4076 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 5132 4233 gene locus_tag LOCUS_15930 5132 4233 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_15930 6049 5219 gene locus_tag LOCUS_15940 6049 5219 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_15940 6714 6307 gene locus_tag LOCUS_15950 6714 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence210 3128 1761 gene locus_tag LOCUS_15960 gene xylE 3128 1761 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_15960 6677 3633 gene locus_tag LOCUS_15970 6677 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence211 1097 1711 gene locus_tag LOCUS_15980 1097 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1872 1747 gene locus_tag LOCUS_15990 1872 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2139 1903 gene locus_tag LOCUS_16000 2139 1903 CDS product YgiT-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393077.1 protein_id gnl|my_center|LOCUS_16000 2468 2139 gene locus_tag LOCUS_16010 2468 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3658 2549 gene locus_tag LOCUS_16020 3658 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_16020 4840 3683 gene locus_tag LOCUS_16030 gene wecB 4840 3683 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 protein_id gnl|my_center|LOCUS_16030 6111 4837 gene locus_tag LOCUS_16040 6111 4837 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717669.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence212 1297 2121 gene locus_tag LOCUS_16050 1297 2121 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_16050 2137 2280 gene locus_tag LOCUS_16060 2137 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2340 3314 gene locus_tag LOCUS_16070 2340 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3686 3366 gene locus_tag LOCUS_16080 3686 3366 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392133.1 protein_id gnl|my_center|LOCUS_16080 5438 5142 gene locus_tag LOCUS_16090 5438 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6067 5459 gene locus_tag LOCUS_16100 gene leuD 6067 5459 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_16100 6867 6145 gene locus_tag LOCUS_16110 6867 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence213 367 924 gene locus_tag LOCUS_16120 gene nuoE 367 924 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_16120 962 1333 gene locus_tag LOCUS_16130 962 1333 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_16130 1377 4448 gene locus_tag LOCUS_16140 1377 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4479 6251 gene locus_tag LOCUS_16150 4479 6251 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_16150 6859 6392 gene locus_tag LOCUS_16160 6859 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence214 >Feature sequence215 1407 499 gene locus_tag LOCUS_16170 gene murB 1407 499 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 protein_id gnl|my_center|LOCUS_16170 2485 1421 gene locus_tag LOCUS_16180 2485 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3859 2705 gene locus_tag LOCUS_16190 gene sat 3859 2705 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_16190 5050 4142 gene locus_tag LOCUS_16200 gene rfbA 5050 4142 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_16200 6632 5043 gene locus_tag LOCUS_16210 6632 5043 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence216 1114 659 gene locus_tag LOCUS_16220 gene tnpA 1114 659 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_16220 <6791 1398 gene locus_tag LOCUS_16230 <6791 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047813794.1:adenylate cyclase >Feature sequence217 1895 1137 gene locus_tag LOCUS_16240 1895 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 3782 2013 gene locus_tag LOCUS_16250 3782 2013 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_16250 4507 3818 gene locus_tag LOCUS_16260 4507 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4554 4563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6099 4774 gene locus_tag LOCUS_16270 gene rifK 6099 4774 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_16270 6537 6250 gene locus_tag LOCUS_16280 6537 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence218 1535 873 gene locus_tag LOCUS_16290 1535 873 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_16290 2632 1685 gene locus_tag LOCUS_16300 2632 1685 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_16300 3008 4789 gene locus_tag LOCUS_16310 3008 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5074 6708 gene locus_tag LOCUS_16320 5074 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence219 2392 389 gene locus_tag LOCUS_16330 2392 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3645 2728 gene locus_tag LOCUS_16340 3645 2728 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_16340 5270 3654 gene locus_tag LOCUS_16350 5270 3654 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence220 698 2575 gene locus_tag LOCUS_16360 gene mnmG 698 2575 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_16360 2799 4667 gene locus_tag LOCUS_16370 2799 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence221 1646 1002 gene locus_tag LOCUS_16380 gene sigR 1646 1002 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_16380 2540 1734 gene locus_tag LOCUS_16390 2540 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3873 2872 gene locus_tag LOCUS_16400 3873 2872 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_16400 5356 3968 gene locus_tag LOCUS_16410 5356 3968 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_16410 5553 6629 gene locus_tag LOCUS_16420 gene nadA 5553 6629 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence222 158 1543 gene locus_tag LOCUS_16430 158 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2625 1777 gene locus_tag LOCUS_16440 2625 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3713 2739 gene locus_tag LOCUS_16450 3713 2739 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 protein_id gnl|my_center|LOCUS_16450 4523 3762 gene locus_tag LOCUS_16460 4523 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4881 5294 gene locus_tag LOCUS_16470 4881 5294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5465 6601 gene locus_tag LOCUS_16480 5465 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence223 3367 2573 gene locus_tag LOCUS_16490 3367 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3944 5803 gene locus_tag LOCUS_16500 3944 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6604 5954 gene locus_tag LOCUS_16510 6604 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence224 <1 2864 gene locus_tag LOCUS_16520 <1 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391629.1:transcription-repair coupling factor 3376 2867 gene locus_tag LOCUS_16530 3376 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5225 3390 gene locus_tag LOCUS_16540 5225 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence225 42 641 gene locus_tag LOCUS_16550 42 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 702 3635 gene locus_tag LOCUS_16560 702 3635 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_16560 3873 5576 gene locus_tag LOCUS_16570 3873 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence226 1644 1165 gene locus_tag LOCUS_16580 1644 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1955 3199 gene locus_tag LOCUS_16590 1955 3199 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_16590 4623 3298 gene locus_tag LOCUS_16600 4623 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence227 3043 1955 gene locus_tag LOCUS_16610 3043 1955 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_16610 5377 3602 gene locus_tag LOCUS_16620 5377 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 <6556 5433 gene locus_tag LOCUS_16630 <6556 5433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162494075.1:FAD-dependent oxidoreductase >Feature sequence228 1858 545 gene locus_tag LOCUS_16640 1858 545 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_16640 3462 2110 gene locus_tag LOCUS_16650 3462 2110 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_16650 4945 3467 gene locus_tag LOCUS_16660 4945 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6037 4991 gene locus_tag LOCUS_16670 6037 4991 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence229 421 92 gene locus_tag LOCUS_16680 421 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2305 3780 gene locus_tag LOCUS_16690 2305 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4767 3847 gene locus_tag LOCUS_16700 gene ribF 4767 3847 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_16700 5691 4792 gene locus_tag LOCUS_16710 gene truB 5691 4792 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_16710 6552 5746 gene locus_tag LOCUS_16720 6552 5746 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence230 1679 789 gene locus_tag LOCUS_16730 1679 789 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_16730 5010 1729 gene locus_tag LOCUS_16740 5010 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6015 5044 gene locus_tag LOCUS_16750 6015 5044 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528455.1 protein_id gnl|my_center|LOCUS_16750 6350 6027 gene locus_tag LOCUS_16760 6350 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence231 1445 843 gene locus_tag LOCUS_16770 1445 843 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_16770 2700 1627 gene locus_tag LOCUS_16780 2700 1627 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_16780 3626 2793 gene locus_tag LOCUS_16790 3626 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5208 3721 gene locus_tag LOCUS_16800 5208 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6253 5198 gene locus_tag LOCUS_16810 6253 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence232 2201 444 gene locus_tag LOCUS_16820 2201 444 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_16820 2572 2252 gene locus_tag LOCUS_16830 2572 2252 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898763.1 protein_id gnl|my_center|LOCUS_16830 3563 2565 gene locus_tag LOCUS_16840 3563 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4172 3576 gene locus_tag LOCUS_16850 4172 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4733 4227 gene locus_tag LOCUS_16860 4733 4227 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583857.1 protein_id gnl|my_center|LOCUS_16860 <6437 4812 gene locus_tag LOCUS_16870 <6437 4812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583858.1:V-type ATPase 116kDa subunit family protein >Feature sequence233 3723 2548 gene locus_tag LOCUS_16880 3723 2548 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_16880 4501 3854 gene locus_tag LOCUS_16890 4501 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965296.1 protein_id gnl|my_center|LOCUS_16890 4883 4509 gene locus_tag LOCUS_16900 4883 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5071 4883 gene locus_tag LOCUS_16910 5071 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965299.1 protein_id gnl|my_center|LOCUS_16910 <6433 5190 gene locus_tag LOCUS_16920 <6433 5190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250017.1:aldehyde ferredoxin oxidoreductase >Feature sequence234 <1 3145 gene locus_tag LOCUS_16930 <1 3145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein 4105 3203 gene locus_tag LOCUS_16940 4105 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5070 4507 gene locus_tag LOCUS_16950 5070 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16950 5606 4995 gene locus_tag LOCUS_16960 5606 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 >Feature sequence235 1444 122 gene locus_tag LOCUS_16970 1444 122 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120758.1 protein_id gnl|my_center|LOCUS_16970 3010 1469 gene locus_tag LOCUS_16980 3010 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4457 3126 gene locus_tag LOCUS_16990 4457 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5722 4649 gene locus_tag LOCUS_17000 5722 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence236 2295 838 gene locus_tag LOCUS_17010 2295 838 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_17010 3760 2306 gene locus_tag LOCUS_17020 3760 2306 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_17020 4303 4312 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4790 4323 gene locus_tag LOCUS_17030 4790 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence237 2024 135 gene locus_tag LOCUS_17040 gene typA 2024 135 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925120.1 protein_id gnl|my_center|LOCUS_17040 6190 2414 gene locus_tag LOCUS_17050 6190 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence238 815 1612 gene locus_tag LOCUS_17060 815 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence239 135 2198 gene locus_tag LOCUS_17070 135 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2327 3562 gene locus_tag LOCUS_17080 2327 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence240 4351 3293 gene locus_tag LOCUS_17090 4351 3293 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence241 2005 929 gene locus_tag LOCUS_17100 2005 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2621 3004 gene locus_tag LOCUS_17110 2621 3004 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_17110 4074 3205 gene locus_tag LOCUS_17120 4074 3205 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence242 368 2134 gene locus_tag LOCUS_17130 gene dnaG 368 2134 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_17130 2203 3960 gene locus_tag LOCUS_17140 gene rpoD 2203 3960 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_17140 4394 5686 gene locus_tag LOCUS_17150 4394 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence243 1499 606 gene locus_tag LOCUS_17160 1499 606 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_17160 1888 2856 gene locus_tag LOCUS_17170 1888 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2918 3694 gene locus_tag LOCUS_17180 gene hisF 2918 3694 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_17180 3826 5313 gene locus_tag LOCUS_17190 gene trpE 3826 5313 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_17190 5310 5873 gene locus_tag LOCUS_17200 5310 5873 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence244 1541 1960 gene locus_tag LOCUS_17210 1541 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2675 3970 gene locus_tag LOCUS_17220 2675 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4317 6080 gene locus_tag LOCUS_17230 4317 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence245 1338 337 gene locus_tag LOCUS_17240 1338 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2708 1695 gene locus_tag LOCUS_17250 2708 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4645 3272 gene locus_tag LOCUS_17260 4645 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 <6245 5082 gene locus_tag LOCUS_17270 <6245 5082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227831.1:argininosuccinate synthase >Feature sequence246 2943 2485 gene locus_tag LOCUS_17280 2943 2485 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_17280 3639 3184 gene locus_tag LOCUS_17290 3639 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3941 3660 gene locus_tag LOCUS_17300 3941 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4631 4089 gene locus_tag LOCUS_17310 4631 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5379 4906 gene locus_tag LOCUS_17320 5379 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence247 1391 864 gene locus_tag LOCUS_17330 1391 864 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_17330 2968 1520 gene locus_tag LOCUS_17340 gene rho 2968 1520 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_17340 6157 3449 gene locus_tag LOCUS_17350 gene polA 6157 3449 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence248 377 955 gene locus_tag LOCUS_17360 gene scpB 377 955 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_17360 957 1676 gene locus_tag LOCUS_17370 957 1676 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_17370 1735 2196 gene locus_tag LOCUS_17380 1735 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2348 4282 gene locus_tag LOCUS_17390 2348 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence249 <1 2052 gene locus_tag LOCUS_17400 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121256.1:PQQ-like beta-propeller repeat protein 3069 2113 gene locus_tag LOCUS_17410 3069 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <6149 3549 gene locus_tag LOCUS_17420 <6149 3549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226935.1:family 78 glycoside hydrolase catalytic domain >Feature sequence250 943 1176 gene locus_tag LOCUS_17430 gene acpP 943 1176 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_17430 1477 2202 gene locus_tag LOCUS_17440 gene rncS 1477 2202 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232030.1 protein_id gnl|my_center|LOCUS_17440 2288 4339 gene locus_tag LOCUS_17450 2288 4339 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_17450 4675 4962 gene locus_tag LOCUS_17460 4675 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 5092 5304 gene locus_tag LOCUS_17470 5092 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 5523 5753 gene locus_tag LOCUS_17480 5523 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 5851 5994 gene locus_tag LOCUS_17490 5851 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence251 1112 1558 gene locus_tag LOCUS_17500 gene mscL 1112 1558 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267001.1 protein_id gnl|my_center|LOCUS_17500 2915 1803 gene locus_tag LOCUS_17510 2915 1803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_17510 3219 4268 gene locus_tag LOCUS_17520 3219 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 5766 4375 gene locus_tag LOCUS_17530 5766 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence252 1332 1976 gene locus_tag LOCUS_17540 1332 1976 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_17540 2052 3152 gene locus_tag LOCUS_17550 2052 3152 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_17550 3230 3943 gene locus_tag LOCUS_17560 3230 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3966 5291 gene locus_tag LOCUS_17570 3966 5291 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_17570 5734 5904 gene locus_tag LOCUS_17580 5734 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence253 <1 1391 gene locus_tag LOCUS_17590 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107588.1:DUF4838 domain-containing protein 2875 1559 gene locus_tag LOCUS_17600 2875 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4999 3476 gene locus_tag LOCUS_17610 4999 3476 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099686814.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence254 865 1455 gene locus_tag LOCUS_17620 865 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1452 2528 gene locus_tag LOCUS_17630 1452 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2671 2883 gene locus_tag LOCUS_17640 2671 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 <6123 2839 gene locus_tag LOCUS_17650 <6123 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000527072.1:M4 family metallopeptidase >Feature sequence255 2477 1995 gene locus_tag LOCUS_17660 2477 1995 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_17660 2442 2864 gene locus_tag LOCUS_17670 2442 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5119 2798 gene locus_tag LOCUS_17680 5119 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence256 132 1061 gene locus_tag LOCUS_17690 132 1061 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315826.1 protein_id gnl|my_center|LOCUS_17690 1617 1096 gene locus_tag LOCUS_17700 1617 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_17700 1921 1610 gene locus_tag LOCUS_17710 1921 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1992 3011 gene locus_tag LOCUS_17720 gene iolG 1992 3011 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_17720 3198 4628 gene locus_tag LOCUS_17730 3198 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence257 1734 421 gene locus_tag LOCUS_17740 1734 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3444 1999 gene locus_tag LOCUS_17750 3444 1999 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_17750 4943 3654 gene locus_tag LOCUS_17760 4943 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5797 5806 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence258 2785 3003 gene locus_tag LOCUS_17770 2785 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3017 3778 gene locus_tag LOCUS_17780 3017 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence259 287 1642 gene locus_tag LOCUS_17790 287 1642 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443995.1 protein_id gnl|my_center|LOCUS_17790 1648 3132 gene locus_tag LOCUS_17800 1648 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3154 4533 gene locus_tag LOCUS_17810 gene murD 3154 4533 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931730.1 protein_id gnl|my_center|LOCUS_17810 4549 5772 gene locus_tag LOCUS_17820 gene spoVE 4549 5772 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence260 <1 1567 gene locus_tag LOCUS_17830 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226869.1:alpha-galactosidase 1600 2733 gene locus_tag LOCUS_17840 1600 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2915 3475 gene locus_tag LOCUS_17850 2915 3475 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256063.1 protein_id gnl|my_center|LOCUS_17850 3554 4945 gene locus_tag LOCUS_17860 3554 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence261 1583 792 gene locus_tag LOCUS_17870 gene lpxA 1583 792 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_17870 3059 1764 gene locus_tag LOCUS_17880 3059 1764 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_17880 3390 3866 gene locus_tag LOCUS_17890 3390 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3901 5889 gene locus_tag LOCUS_17900 3901 5889 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence262 3703 2177 gene locus_tag LOCUS_17910 3703 2177 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_17910 4846 3893 gene locus_tag LOCUS_17920 4846 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence263 7 1107 gene locus_tag LOCUS_17930 7 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2683 1196 gene locus_tag LOCUS_17940 2683 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4967 3090 gene locus_tag LOCUS_17950 4967 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence264 247 507 gene locus_tag LOCUS_17960 247 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 504 890 gene locus_tag LOCUS_17970 504 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2535 1150 gene locus_tag LOCUS_17980 2535 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2626 2967 gene locus_tag LOCUS_17990 2626 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3054 3215 gene locus_tag LOCUS_18000 3054 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3333 5333 gene locus_tag LOCUS_18010 3333 5333 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence265 1349 1849 gene locus_tag LOCUS_18020 1349 1849 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_18020 2085 4586 gene locus_tag LOCUS_18030 2085 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence266 <1 716 gene locus_tag LOCUS_18040 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202541.1:GDSL-type esterase/lipase family protein 836 1354 gene locus_tag LOCUS_18050 836 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3668 1401 gene locus_tag LOCUS_18060 3668 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence267 55 1359 gene locus_tag LOCUS_18070 55 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1616 2872 gene locus_tag LOCUS_18080 1616 2872 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_18080 5269 3008 gene locus_tag LOCUS_18090 5269 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence268 133 951 gene locus_tag LOCUS_18100 133 951 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_18100 993 1307 gene locus_tag LOCUS_18110 gene rplU 993 1307 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_18110 1323 1592 gene locus_tag LOCUS_18120 gene rpmA 1323 1592 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_18120 2078 3337 gene locus_tag LOCUS_18130 gene obgE 2078 3337 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_18130 3419 4207 gene locus_tag LOCUS_18140 3419 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4200 4496 gene locus_tag LOCUS_18150 4200 4496 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence269 4383 520 gene locus_tag LOCUS_18160 4383 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence270 <1 626 gene locus_tag LOCUS_18170 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150382938.1:glycerate kinase 619 2346 gene locus_tag LOCUS_18180 619 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence271 2031 1156 gene locus_tag LOCUS_18190 2031 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3995 2181 gene locus_tag LOCUS_18200 3995 2181 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764130.1 protein_id gnl|my_center|LOCUS_18200 4883 4338 gene locus_tag LOCUS_18210 gene lspA 4883 4338 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933470.1 protein_id gnl|my_center|LOCUS_18210 <5824 5123 gene locus_tag LOCUS_18220 <5824 5123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141954.1:PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein >Feature sequence272 1149 517 gene locus_tag LOCUS_18230 1149 517 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_18230 2124 1417 gene locus_tag LOCUS_18240 2124 1417 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_18240 3079 2210 gene locus_tag LOCUS_18250 3079 2210 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_18250 3646 3849 gene locus_tag LOCUS_18260 3646 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3846 4052 gene locus_tag LOCUS_18270 3846 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4705 4067 gene locus_tag LOCUS_18280 4705 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 <5817 4930 gene locus_tag LOCUS_18290 <5817 4930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203125.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence273 1240 1091 gene locus_tag LOCUS_18300 1240 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 3816 1468 gene locus_tag LOCUS_18310 3816 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5264 3993 gene locus_tag LOCUS_18320 5264 3993 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_18320 <5800 5264 gene locus_tag LOCUS_18330 <5800 5264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108596.1:Na+:solute symporter >Feature sequence274 684 1046 gene locus_tag LOCUS_18340 684 1046 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072849092.1 protein_id gnl|my_center|LOCUS_18340 1043 2167 gene locus_tag LOCUS_18350 1043 2167 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_18350 2587 3843 gene locus_tag LOCUS_18360 2587 3843 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_18360 5617 4025 gene locus_tag LOCUS_18370 5617 4025 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence275 281 1828 gene locus_tag LOCUS_18380 281 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1825 2874 gene locus_tag LOCUS_18390 1825 2874 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259276.1 protein_id gnl|my_center|LOCUS_18390 2917 3579 gene locus_tag LOCUS_18400 gene lipB 2917 3579 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_18400 3569 4909 gene locus_tag LOCUS_18410 3569 4909 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118398.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence276 17 2197 gene locus_tag LOCUS_18420 17 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5581 2693 gene locus_tag LOCUS_18430 5581 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence277 3711 631 gene locus_tag LOCUS_18440 3711 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4090 5418 gene locus_tag LOCUS_18450 4090 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence278 68 1075 gene locus_tag LOCUS_18460 68 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1116 2459 gene locus_tag LOCUS_18470 1116 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2617 4281 gene locus_tag LOCUS_18480 2617 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence279 672 2123 gene locus_tag LOCUS_18490 672 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2120 5398 gene locus_tag LOCUS_18500 2120 5398 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence280 456 608 gene locus_tag LOCUS_18510 456 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 658 1926 gene locus_tag LOCUS_18520 658 1926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_18520 2178 3344 gene locus_tag LOCUS_18530 2178 3344 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence281 169 1635 gene locus_tag LOCUS_18540 169 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_18540 1795 2565 gene locus_tag LOCUS_18550 1795 2565 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392011.1 protein_id gnl|my_center|LOCUS_18550 2648 3568 gene locus_tag LOCUS_18560 2648 3568 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_18560 5508 3619 gene locus_tag LOCUS_18570 5508 3619 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence282 808 116 gene locus_tag LOCUS_18580 808 116 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_18580 951 1106 gene locus_tag LOCUS_18590 951 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1188 1922 gene locus_tag LOCUS_18600 1188 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2154 4571 gene locus_tag LOCUS_18610 2154 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence283 1870 659 gene locus_tag LOCUS_18620 1870 659 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707256.1 protein_id gnl|my_center|LOCUS_18620 2904 1870 gene locus_tag LOCUS_18630 2904 1870 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_18630 4292 2904 gene locus_tag LOCUS_18640 4292 2904 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464326.1 protein_id gnl|my_center|LOCUS_18640 4906 4289 gene locus_tag LOCUS_18650 4906 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5417 5133 gene locus_tag LOCUS_18660 5417 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence284 450 268 gene locus_tag LOCUS_18670 450 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_18670 1302 1227 gene locus_tag LOCUS_t00160 1302 1227 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2970 1609 gene locus_tag LOCUS_18680 2970 1609 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883303.1 protein_id gnl|my_center|LOCUS_18680 4516 3539 gene locus_tag LOCUS_18690 4516 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 <5652 4643 gene locus_tag LOCUS_18700 <5652 4643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112986.1:protease IV >Feature sequence285 1522 884 gene locus_tag LOCUS_18710 1522 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4023 1774 gene locus_tag LOCUS_18720 4023 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4325 5458 gene locus_tag LOCUS_18730 4325 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence286 901 976 gene locus_tag LOCUS_t00170 901 976 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence287 653 1399 gene locus_tag LOCUS_18740 653 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2548 2045 gene locus_tag LOCUS_18750 2548 2045 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_18750 3844 2573 gene locus_tag LOCUS_18760 3844 2573 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_18760 4222 5259 gene locus_tag LOCUS_18770 4222 5259 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence288 66 4382 gene locus_tag LOCUS_18780 66 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence289 95 790 gene locus_tag LOCUS_18790 95 790 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_18790 787 1443 gene locus_tag LOCUS_18800 787 1443 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_18800 1455 2036 gene locus_tag LOCUS_18810 gene rsxA 1455 2036 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_18810 2042 2254 gene locus_tag LOCUS_18820 2042 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2446 4158 gene locus_tag LOCUS_18830 2446 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence290 4264 2567 gene locus_tag LOCUS_18840 gene argS 4264 2567 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_18840 4863 4297 gene locus_tag LOCUS_18850 4863 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 <5548 4921 gene locus_tag LOCUS_18860 <5548 4921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021326.1:type II secretion system F family protein >Feature sequence291 5176 2180 gene locus_tag LOCUS_18870 5176 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence292 1717 419 gene locus_tag LOCUS_18880 1717 419 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_18880 2444 1902 gene locus_tag LOCUS_18890 2444 1902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865378.1 protein_id gnl|my_center|LOCUS_18890 3183 2437 gene locus_tag LOCUS_18900 3183 2437 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_18900 3533 3174 gene locus_tag LOCUS_18910 3533 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4102 3530 gene locus_tag LOCUS_18920 4102 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4461 4099 gene locus_tag LOCUS_18930 4461 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4990 4550 gene locus_tag LOCUS_18940 4990 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence293 1573 1367 gene locus_tag LOCUS_18950 1573 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1588 3564 gene locus_tag LOCUS_18960 1588 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4966 3632 gene locus_tag LOCUS_18970 4966 3632 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence294 4493 144 gene locus_tag LOCUS_18980 4493 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 5453 4596 gene locus_tag LOCUS_18990 5453 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence295 201 1277 gene locus_tag LOCUS_19000 201 1277 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_19000 3519 1315 gene locus_tag LOCUS_19010 3519 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4875 3547 gene locus_tag LOCUS_19020 4875 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5288 4887 gene locus_tag LOCUS_19030 5288 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence296 <1 646 gene locus_tag LOCUS_19040 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943895.1:glutamyl-tRNA reductase 643 1539 gene locus_tag LOCUS_19050 gene hemC 643 1539 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_19050 1560 2333 gene locus_tag LOCUS_19060 1560 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2407 2769 gene locus_tag LOCUS_19070 2407 2769 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_19070 3187 3960 gene locus_tag LOCUS_19080 3187 3960 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767663.1 protein_id gnl|my_center|LOCUS_19080 3957 5201 gene locus_tag LOCUS_19090 3957 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence297 1148 3268 gene locus_tag LOCUS_19100 1148 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3330 4127 gene locus_tag LOCUS_19110 3330 4127 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_19110 4246 5205 gene locus_tag LOCUS_19120 4246 5205 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence298 <1 1704 gene locus_tag LOCUS_19130 <1 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932992.1:aspartate--tRNA ligase 1762 2778 gene locus_tag LOCUS_19140 1762 2778 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814186.1 protein_id gnl|my_center|LOCUS_19140 3701 2823 gene locus_tag LOCUS_19150 3701 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4046 4885 gene locus_tag LOCUS_19160 gene rbsK 4046 4885 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence299 <1 3442 gene locus_tag LOCUS_19170 <1 3442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence300 1889 546 gene locus_tag LOCUS_19180 1889 546 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_19180 2960 2379 gene locus_tag LOCUS_19190 2960 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3328 4293 gene locus_tag LOCUS_19200 3328 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5258 4365 gene locus_tag LOCUS_19210 5258 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence301 388 1227 gene locus_tag LOCUS_19220 388 1227 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_19220 3731 1470 gene locus_tag LOCUS_19230 3731 1470 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19230 4012 3737 gene locus_tag LOCUS_19240 4012 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence302 >Feature sequence303 284 529 gene locus_tag LOCUS_19250 284 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 530 907 gene locus_tag LOCUS_19260 530 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19260 1066 1980 gene locus_tag LOCUS_19270 1066 1980 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_19270 2843 2211 gene locus_tag LOCUS_19280 2843 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 4704 3028 gene locus_tag LOCUS_19290 4704 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4876 4688 gene locus_tag LOCUS_19300 4876 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 4892 5188 gene locus_tag LOCUS_19310 4892 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence304 <1 813 gene locus_tag LOCUS_19320 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881359.1:sodium-dependent transporter 810 944 gene locus_tag LOCUS_19330 810 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1675 977 gene locus_tag LOCUS_19340 1675 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2776 1745 gene locus_tag LOCUS_19350 2776 1745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_19350 4289 2865 gene locus_tag LOCUS_19360 4289 2865 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_19360 4601 4302 gene locus_tag LOCUS_19370 4601 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence305 <1 1378 gene locus_tag LOCUS_19380 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921847.1:sulfatase 2675 1440 gene locus_tag LOCUS_19390 2675 1440 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_19390 3133 2798 gene locus_tag LOCUS_19400 3133 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4082 3120 gene locus_tag LOCUS_19410 gene recF 4082 3120 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 protein_id gnl|my_center|LOCUS_19410 <5320 4317 gene locus_tag LOCUS_19420 <5320 4317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876295.1:AMP-binding protein >Feature sequence306 912 112 gene locus_tag LOCUS_19430 gene rlmB 912 112 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855753.1 protein_id gnl|my_center|LOCUS_19430 2440 1373 gene locus_tag LOCUS_19440 2440 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2617 2692 gene locus_tag LOCUS_t00180 2617 2692 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2737 2812 gene locus_tag LOCUS_t00190 2737 2812 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3304 2903 gene locus_tag LOCUS_19450 3304 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence307 307 316 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 401 1732 gene locus_tag LOCUS_19460 401 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 5017 1748 gene locus_tag LOCUS_19470 5017 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence308 >Feature sequence309 1174 722 gene locus_tag LOCUS_19480 1174 722 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_19480 2574 1177 gene locus_tag LOCUS_19490 gene atpD 2574 1177 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_19490 3443 2589 gene locus_tag LOCUS_19500 gene atpG 3443 2589 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_19500 4972 3443 gene locus_tag LOCUS_19510 gene atpA 4972 3443 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence310 339 1457 gene locus_tag LOCUS_19520 gene prfB 339 1457 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096772597.1 protein_id gnl|my_center|LOCUS_19520 2013 3557 gene locus_tag LOCUS_19530 gene lysS 2013 3557 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_19530 4562 5164 gene locus_tag LOCUS_19540 4562 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence311 991 314 gene locus_tag LOCUS_19550 991 314 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_19550 1375 2694 gene locus_tag LOCUS_19560 1375 2694 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence312 2076 1114 gene locus_tag LOCUS_19570 gene guaA 2076 1114 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_19570 3745 2375 gene locus_tag LOCUS_19580 3745 2375 CDS product ISNCY-like element ISRsp17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642802.1 protein_id gnl|my_center|LOCUS_19580 4098 4388 gene locus_tag LOCUS_19590 4098 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 4599 5212 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence313 <1 706 gene locus_tag LOCUS_19600 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303160.1:malectin domain-containing carbohydrate-binding protein 780 1859 gene locus_tag LOCUS_19610 780 1859 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206885.1 protein_id gnl|my_center|LOCUS_19610 3587 1971 gene locus_tag LOCUS_19620 3587 1971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_19620 4516 3584 gene locus_tag LOCUS_19630 4516 3584 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence314 1312 566 gene locus_tag LOCUS_19640 1312 566 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_19640 4342 1538 gene locus_tag LOCUS_19650 4342 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence315 1149 187 gene locus_tag LOCUS_19660 1149 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1239 1427 gene locus_tag LOCUS_19670 1239 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2253 1450 gene locus_tag LOCUS_19680 2253 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2572 2240 gene locus_tag LOCUS_19690 2572 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4536 2875 gene locus_tag LOCUS_19700 4536 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4792 4472 gene locus_tag LOCUS_19710 4792 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence316 864 1040 gene locus_tag LOCUS_19720 864 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1447 1283 gene locus_tag LOCUS_19730 1447 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1620 1432 gene locus_tag LOCUS_19740 1620 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3215 1851 gene locus_tag LOCUS_19750 3215 1851 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_19750 4926 3208 gene locus_tag LOCUS_19760 4926 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence317 790 2580 gene locus_tag LOCUS_19770 790 2580 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_19770 3263 2583 gene locus_tag LOCUS_19780 3263 2583 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_19780 4736 3327 gene locus_tag LOCUS_19790 4736 3327 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence318 <1 950 gene locus_tag LOCUS_19800 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393772.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 973 1866 gene locus_tag LOCUS_19810 gene argB 973 1866 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_19810 1868 2506 gene locus_tag LOCUS_19820 1868 2506 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_19820 2510 2950 gene locus_tag LOCUS_19830 2510 2950 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_19830 3027 3854 gene locus_tag LOCUS_19840 3027 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3851 4231 gene locus_tag LOCUS_19850 3851 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence319 494 138 gene locus_tag LOCUS_19860 494 138 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_19860 1386 511 gene locus_tag LOCUS_19870 gene panC 1386 511 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_19870 2174 1383 gene locus_tag LOCUS_19880 gene panB 2174 1383 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_19880 2731 2240 gene locus_tag LOCUS_19890 gene folK 2731 2240 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_19890 4209 2812 gene locus_tag LOCUS_19900 4209 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence320 3075 613 gene locus_tag LOCUS_19910 3075 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3873 3142 gene locus_tag LOCUS_19920 3873 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 <5050 3951 gene locus_tag LOCUS_19930 <5050 3951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398813.1:metal-dependent exonucleaseMrfB >Feature sequence321 196 843 gene locus_tag LOCUS_19940 196 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2031 925 gene locus_tag LOCUS_19950 2031 925 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_19950 3190 2084 gene locus_tag LOCUS_19960 3190 2084 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_19960 4296 3190 gene locus_tag LOCUS_19970 4296 3190 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_19970 <5046 4364 gene locus_tag LOCUS_19980 <5046 4364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958052.1:deoxyribodipyrimidine photo-lyase >Feature sequence322 1033 2730 gene locus_tag LOCUS_19990 1033 2730 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878005.1 protein_id gnl|my_center|LOCUS_19990 3182 3667 gene locus_tag LOCUS_20000 3182 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3664 3978 gene locus_tag LOCUS_20010 3664 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence323 1384 620 gene locus_tag LOCUS_20020 gene rsmA 1384 620 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_20020 1953 1531 gene locus_tag LOCUS_20030 1953 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2618 2337 gene locus_tag LOCUS_20040 2618 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3187 2615 gene locus_tag LOCUS_20050 gene thpR 3187 2615 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267029.1 protein_id gnl|my_center|LOCUS_20050 3134 3316 gene locus_tag LOCUS_20060 3134 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence324 2404 1316 gene locus_tag LOCUS_20070 2404 1316 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110188582.1 protein_id gnl|my_center|LOCUS_20070 3908 2421 gene locus_tag LOCUS_20080 3908 2421 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878342.1 protein_id gnl|my_center|LOCUS_20080 <5023 4150 gene locus_tag LOCUS_20090 <5023 4150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870209.1:TrkH family potassium uptake protein >Feature sequence325 685 482 gene locus_tag LOCUS_20100 685 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2533 773 gene locus_tag LOCUS_20110 2533 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence326 139 1965 gene locus_tag LOCUS_20120 gene for 139 1965 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_20120 2072 3265 gene locus_tag LOCUS_20130 2072 3265 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_20130 3449 4204 gene locus_tag LOCUS_20140 3449 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 4387 4617 gene locus_tag LOCUS_20150 4387 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4614 4853 gene locus_tag LOCUS_20160 4614 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence327 1295 783 gene locus_tag LOCUS_20170 1295 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3362 1746 gene locus_tag LOCUS_20180 gene opmB 3362 1746 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_20180 4560 3355 gene locus_tag LOCUS_20190 4560 3355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence328 <1 575 gene locus_tag LOCUS_20200 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein 679 1068 gene locus_tag LOCUS_20210 679 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1040 2350 gene locus_tag LOCUS_20220 1040 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2525 2797 gene locus_tag LOCUS_20230 2525 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2790 3242 gene locus_tag LOCUS_20240 2790 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence329 1878 220 gene locus_tag LOCUS_20250 1878 220 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 protein_id gnl|my_center|LOCUS_20250 2948 1968 gene locus_tag LOCUS_20260 2948 1968 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence330 2832 3287 gene locus_tag LOCUS_20270 2832 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence331 183 788 gene locus_tag LOCUS_20280 183 788 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_20280 2058 940 gene locus_tag LOCUS_20290 gene murG 2058 940 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_20290 3758 2100 gene locus_tag LOCUS_20300 3758 2100 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence332 744 598 gene locus_tag LOCUS_20310 744 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2007 778 gene locus_tag LOCUS_20320 2007 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2692 2093 gene locus_tag LOCUS_20330 2692 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 3111 3422 gene locus_tag LOCUS_20340 3111 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence333 418 2913 gene locus_tag LOCUS_20350 418 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2820 2828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4355 2967 gene locus_tag LOCUS_20360 4355 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 4938 4414 gene locus_tag LOCUS_20370 4938 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence334 1773 301 gene locus_tag LOCUS_20380 gene zwf 1773 301 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_20380 1998 2675 gene locus_tag LOCUS_20390 1998 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2838 3848 gene locus_tag LOCUS_20400 2838 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3886 4485 gene locus_tag LOCUS_20410 3886 4485 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268839.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence335 915 43 gene locus_tag LOCUS_20420 915 43 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_20420 1434 1018 gene locus_tag LOCUS_20430 1434 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2259 3461 gene locus_tag LOCUS_20440 gene rifK 2259 3461 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_20440 3624 4739 gene locus_tag LOCUS_20450 3624 4739 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence336 92 979 gene locus_tag LOCUS_20460 gene cysK 92 979 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_20460 2655 1234 gene locus_tag LOCUS_20470 2655 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4211 2826 gene locus_tag LOCUS_20480 4211 2826 CDS product IS4-like element IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011379024.1 protein_id gnl|my_center|LOCUS_20480 4297 4653 gene locus_tag LOCUS_20490 4297 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence337 688 98 gene locus_tag LOCUS_20500 688 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1053 2291 gene locus_tag LOCUS_20510 1053 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 <4871 2301 gene locus_tag LOCUS_20520 <4871 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871078.1:beta-propeller domain-containing protein >Feature sequence338 1332 1102 gene locus_tag LOCUS_20530 1332 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1247 1702 gene locus_tag LOCUS_20540 1247 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2422 1751 gene locus_tag LOCUS_20550 2422 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 3293 2538 gene locus_tag LOCUS_20560 3293 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4409 3321 gene locus_tag LOCUS_20570 gene aroB 4409 3321 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence339 4061 2355 gene locus_tag LOCUS_20580 4061 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4595 4140 gene locus_tag LOCUS_20590 4595 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence340 3442 944 gene locus_tag LOCUS_20600 3442 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4436 3585 gene locus_tag LOCUS_20610 4436 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 4846 4694 gene locus_tag LOCUS_20620 4846 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence341 279 1493 gene locus_tag LOCUS_20630 279 1493 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_20630 1725 1567 gene locus_tag LOCUS_20640 1725 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1918 4218 gene locus_tag LOCUS_20650 1918 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4586 4353 gene locus_tag LOCUS_20660 4586 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence342 4781 2436 gene locus_tag LOCUS_20670 4781 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence343 2916 1240 gene locus_tag LOCUS_20680 2916 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 3580 3819 gene locus_tag LOCUS_20690 3580 3819 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_20690 3816 4037 gene locus_tag LOCUS_20700 3816 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence344 389 1681 gene locus_tag LOCUS_20710 389 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1756 3384 gene locus_tag LOCUS_20720 1756 3384 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_20720 3389 4459 gene locus_tag LOCUS_20730 3389 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence345 335 2824 gene locus_tag LOCUS_20740 335 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2950 3561 gene locus_tag LOCUS_20750 2950 3561 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence346 3 830 gene locus_tag LOCUS_20760 3 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 827 1576 gene locus_tag LOCUS_20770 827 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1578 3047 gene locus_tag LOCUS_20780 1578 3047 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_20780 4540 2963 gene locus_tag LOCUS_20790 4540 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence347 2 310 gene locus_tag LOCUS_20800 2 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1985 465 gene locus_tag LOCUS_20810 1985 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3057 2152 gene locus_tag LOCUS_20820 3057 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3382 3972 gene locus_tag LOCUS_20830 gene pyrR 3382 3972 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence348 1591 1514 gene locus_tag LOCUS_t00200 1591 1514 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1760 1835 gene locus_tag LOCUS_t00210 1760 1835 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3647 2070 gene locus_tag LOCUS_20840 3647 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence349 1383 511 gene locus_tag LOCUS_20850 1383 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3016 1697 gene locus_tag LOCUS_20860 gene tolB 3016 1697 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence350 84 896 gene locus_tag LOCUS_20870 gene proC 84 896 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_20870 942 1604 gene locus_tag LOCUS_20880 942 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1567 2415 gene locus_tag LOCUS_20890 1567 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2589 3278 gene locus_tag LOCUS_20900 2589 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence351 33 758 gene locus_tag LOCUS_20910 33 758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_20910 779 1675 gene locus_tag LOCUS_20920 779 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3061 1721 gene locus_tag LOCUS_20930 3061 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_20930 4575 3319 gene locus_tag LOCUS_20940 gene ltrA 4575 3319 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930422.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence352 1401 643 gene locus_tag LOCUS_20950 1401 643 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_20950 1834 1415 gene locus_tag LOCUS_20960 1834 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2680 2087 gene locus_tag LOCUS_20970 2680 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence353 1344 2282 gene locus_tag LOCUS_20980 gene pfkB 1344 2282 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_20980 2500 3135 gene locus_tag LOCUS_20990 2500 3135 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937368.1 protein_id gnl|my_center|LOCUS_20990 3214 4398 gene locus_tag LOCUS_21000 gene acrA 3214 4398 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039199.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence354 545 1708 gene locus_tag LOCUS_21010 545 1708 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_21010 2529 1765 gene locus_tag LOCUS_21020 gene cobB 2529 1765 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_21020 3827 2556 gene locus_tag LOCUS_21030 gene serS 3827 2556 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_21030 4639 3839 gene locus_tag LOCUS_21040 gene spo0J 4639 3839 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence355 622 1032 gene locus_tag LOCUS_21050 622 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1071 1232 gene locus_tag LOCUS_21060 1071 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1210 1971 gene locus_tag LOCUS_21070 1210 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 2133 2342 gene locus_tag LOCUS_21080 2133 2342 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_21080 2648 2394 gene locus_tag LOCUS_21090 2648 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2767 3525 gene locus_tag LOCUS_21100 2767 3525 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_21100 3551 4048 gene locus_tag LOCUS_21110 3551 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4061 4399 gene locus_tag LOCUS_21120 4061 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence356 1134 3587 gene locus_tag LOCUS_21130 1134 3587 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence357 135 1340 gene locus_tag LOCUS_21140 135 1340 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_21140 2150 1467 gene locus_tag LOCUS_21150 gene phoU 2150 1467 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_21150 2936 2181 gene locus_tag LOCUS_21160 gene pstB 2936 2181 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_21160 3715 2945 gene locus_tag LOCUS_21170 gene pstB 3715 2945 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722628.1 protein_id gnl|my_center|LOCUS_21170 4554 3715 gene locus_tag LOCUS_21180 gene pstA 4554 3715 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence358 1582 2772 gene locus_tag LOCUS_21190 1582 2772 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052819287.1 protein_id gnl|my_center|LOCUS_21190 3646 2792 gene locus_tag LOCUS_21200 3646 2792 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_21200 <4596 3825 gene locus_tag LOCUS_21210 <4596 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123039.1:exo-alpha-sialidase >Feature sequence359 1722 364 gene locus_tag LOCUS_21220 1722 364 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947743.1 protein_id gnl|my_center|LOCUS_21220 2180 3592 gene locus_tag LOCUS_21230 2180 3592 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence360 791 1372 gene locus_tag LOCUS_21240 791 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1433 1729 gene locus_tag LOCUS_21250 1433 1729 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928906.1 protein_id gnl|my_center|LOCUS_21250 1910 2725 gene locus_tag LOCUS_21260 gene tatC 1910 2725 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_21260 2742 3269 gene locus_tag LOCUS_21270 2742 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3312 4310 gene locus_tag LOCUS_21280 3312 4310 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence361 1621 836 gene locus_tag LOCUS_21290 1621 836 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_21290 1743 1862 gene locus_tag LOCUS_21300 1743 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1974 2816 gene locus_tag LOCUS_21310 1974 2816 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence362 2046 853 gene locus_tag LOCUS_21320 gene metK 2046 853 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_21320 2678 3532 gene locus_tag LOCUS_21330 2678 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence363 <1 1612 gene locus_tag LOCUS_21340 <1 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263187.1:alpha-galactosidase 2323 1772 gene locus_tag LOCUS_21350 2323 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2581 2495 gene locus_tag LOCUS_t00220 2581 2495 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3672 2662 gene locus_tag LOCUS_21360 3672 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence364 1410 1066 gene locus_tag LOCUS_21370 gene yajC 1410 1066 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_21370 2602 1478 gene locus_tag LOCUS_21380 gene tgt 2602 1478 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_21380 3206 2625 gene locus_tag LOCUS_21390 3206 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3893 3324 gene locus_tag LOCUS_21400 3893 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence365 1322 2761 gene locus_tag LOCUS_21410 1322 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4433 2913 gene locus_tag LOCUS_21420 4433 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence366 782 459 gene locus_tag LOCUS_21430 782 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1558 815 gene locus_tag LOCUS_21440 1558 815 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401225.1 protein_id gnl|my_center|LOCUS_21440 2013 1558 gene locus_tag LOCUS_21450 2013 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 3211 3384 gene locus_tag LOCUS_21460 3211 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877459.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence367 914 1747 gene locus_tag LOCUS_21470 914 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1859 2443 gene locus_tag LOCUS_21480 1859 2443 CDS product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_21480 3330 2467 gene locus_tag LOCUS_21490 3330 2467 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544947.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence368 2078 915 gene locus_tag LOCUS_21500 2078 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3123 2344 gene locus_tag LOCUS_21510 3123 2344 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence369 <1 1030 gene locus_tag LOCUS_21520 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933195.1:sigma-54-dependent Fis family transcriptional regulator 1080 2078 gene locus_tag LOCUS_21530 1080 2078 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_21530 2188 3156 gene locus_tag LOCUS_21540 2188 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4257 3769 gene locus_tag LOCUS_21550 4257 3769 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944499.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence370 <1 2095 gene locus_tag LOCUS_21560 <1 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768340.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 2070 4112 gene locus_tag LOCUS_21570 gene uvrB 2070 4112 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence371 2879 267 gene locus_tag LOCUS_21580 2879 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 4143 2860 gene locus_tag LOCUS_21590 4143 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence372 309 590 gene locus_tag LOCUS_21600 309 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 734 2095 gene locus_tag LOCUS_21610 734 2095 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_21610 2936 3916 gene locus_tag LOCUS_21620 2936 3916 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529215.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence373 >Feature sequence374 1582 1244 gene locus_tag LOCUS_21630 1582 1244 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_21630 2773 1595 gene locus_tag LOCUS_21640 2773 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4327 2795 gene locus_tag LOCUS_21650 4327 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence375 <1 1743 gene locus_tag LOCUS_21660 <1 1743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460092.1:ASKHA domain-containing protein 2817 1747 gene locus_tag LOCUS_21670 2817 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3792 2857 gene locus_tag LOCUS_21680 gene glpQ 3792 2857 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705544.1 protein_id gnl|my_center|LOCUS_21680 4462 4004 gene locus_tag LOCUS_21690 4462 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence376 <4459 410 gene locus_tag LOCUS_21700 <4459 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942043.1:choice-of-anchor D domain-containing protein >Feature sequence377 161 1018 gene locus_tag LOCUS_21710 161 1018 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_21710 1015 1647 gene locus_tag LOCUS_21720 gene tmk 1015 1647 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_21720 1686 2741 gene locus_tag LOCUS_21730 1686 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2781 3662 gene locus_tag LOCUS_21740 2781 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3659 4459 gene locus_tag LOCUS_21750 3659 4459 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence378 58 393 gene locus_tag LOCUS_21760 58 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 561 1685 gene locus_tag LOCUS_21770 561 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1713 2801 gene locus_tag LOCUS_21780 1713 2801 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_21780 3004 3447 gene locus_tag LOCUS_21790 3004 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21790 3495 3773 gene locus_tag LOCUS_21800 3495 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21800 4012 4230 gene locus_tag LOCUS_21810 4012 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence379 3079 2705 gene locus_tag LOCUS_21820 3079 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3294 3070 gene locus_tag LOCUS_21830 3294 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4233 3439 gene locus_tag LOCUS_21840 4233 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence380 1405 815 gene locus_tag LOCUS_21850 1405 815 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_21850 2292 1405 gene locus_tag LOCUS_21860 2292 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3151 2372 gene locus_tag LOCUS_21870 3151 2372 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence381 897 79 gene locus_tag LOCUS_21880 897 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1454 873 gene locus_tag LOCUS_21890 gene yqeK 1454 873 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831144.1 protein_id gnl|my_center|LOCUS_21890 2044 1445 gene locus_tag LOCUS_21900 gene nadD 2044 1445 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144004.1 protein_id gnl|my_center|LOCUS_21900 3290 2037 gene locus_tag LOCUS_21910 3290 2037 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 protein_id gnl|my_center|LOCUS_21910 4394 3348 gene locus_tag LOCUS_21920 4394 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence382 3362 2145 gene locus_tag LOCUS_21930 3362 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 <4431 3389 gene locus_tag LOCUS_21940 <4431 3389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681491.1:metallophosphoesterase >Feature sequence383 518 261 gene locus_tag LOCUS_21950 518 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 280 289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1473 526 gene locus_tag LOCUS_21960 1473 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1666 2325 gene locus_tag LOCUS_21970 1666 2325 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770434.1 protein_id gnl|my_center|LOCUS_21970 2497 3447 gene locus_tag LOCUS_21980 gene mdh 2497 3447 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence384 2055 1570 gene locus_tag LOCUS_21990 2055 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2556 3593 gene locus_tag LOCUS_22000 gene fba 2556 3593 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence385 <1 553 gene locus_tag LOCUS_22010 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532810.1:glycosyltransferase family 9 protein 1672 560 gene locus_tag LOCUS_22020 1672 560 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_22020 2899 1964 gene locus_tag LOCUS_22030 2899 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 <4421 3557 gene locus_tag LOCUS_22040 <4421 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659530.1:metallophosphoesterase >Feature sequence386 1741 1583 gene locus_tag LOCUS_22050 1741 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2348 1851 gene locus_tag LOCUS_22060 gene tpx 2348 1851 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894924.1 protein_id gnl|my_center|LOCUS_22060 3809 2628 gene locus_tag LOCUS_22070 3809 2628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence387 60 1670 gene locus_tag LOCUS_22080 60 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2054 2485 gene locus_tag LOCUS_22090 gene rplM 2054 2485 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_22090 2513 2914 gene locus_tag LOCUS_22100 gene rpsI 2513 2914 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence388 <1 956 gene locus_tag LOCUS_22110 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_031160740.1:long-chain fatty acid--CoA ligase 1921 1358 gene locus_tag LOCUS_22120 1921 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2292 3038 gene locus_tag LOCUS_22130 2292 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3026 3982 gene locus_tag LOCUS_22140 3026 3982 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence389 2035 209 gene locus_tag LOCUS_22150 2035 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3711 2032 gene locus_tag LOCUS_22160 3711 2032 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_22160 <4375 3708 gene locus_tag LOCUS_22170 <4375 3708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000487316.1:ABC transporter permease subunit >Feature sequence390 386 712 gene locus_tag LOCUS_22180 386 712 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142290.1 protein_id gnl|my_center|LOCUS_22180 699 1088 gene locus_tag LOCUS_22190 699 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1271 2836 gene locus_tag LOCUS_22200 1271 2836 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141648.1 protein_id gnl|my_center|LOCUS_22200 2929 3327 gene locus_tag LOCUS_22210 2929 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3539 3748 gene locus_tag LOCUS_22220 3539 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence391 179 1582 gene locus_tag LOCUS_22230 179 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1593 2684 gene locus_tag LOCUS_22240 gene hemW 1593 2684 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_22240 2700 3419 gene locus_tag LOCUS_22250 gene aat 2700 3419 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_22250 4353 3454 gene locus_tag LOCUS_22260 4353 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence392 1210 284 gene locus_tag LOCUS_22270 1210 284 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_22270 1674 1297 gene locus_tag LOCUS_22280 1674 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3334 1808 gene locus_tag LOCUS_22290 3334 1808 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680713.1 protein_id gnl|my_center|LOCUS_22290 4139 3609 gene locus_tag LOCUS_22300 4139 3609 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence393 188 54 gene locus_tag LOCUS_22310 188 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 570 271 gene locus_tag LOCUS_22320 570 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1743 2198 gene locus_tag LOCUS_22330 1743 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2472 4280 gene locus_tag LOCUS_22340 gene cas1 2472 4280 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence394 438 133 gene locus_tag LOCUS_22350 438 133 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080382.1 protein_id gnl|my_center|LOCUS_22350 1241 2467 gene locus_tag LOCUS_22360 1241 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2477 3094 gene locus_tag LOCUS_22370 2477 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 3243 3476 gene locus_tag LOCUS_22380 3243 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence395 1045 710 gene locus_tag LOCUS_22390 1045 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2599 1712 gene locus_tag LOCUS_22400 2599 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2733 3338 gene locus_tag LOCUS_22410 2733 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence396 310 1596 gene locus_tag LOCUS_22420 310 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1796 3127 gene locus_tag LOCUS_22430 1796 3127 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence397 <1 541 gene locus_tag LOCUS_22440 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389482.1:DUF502 domain-containing protein 538 1266 gene locus_tag LOCUS_22450 538 1266 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358891.1 protein_id gnl|my_center|LOCUS_22450 1397 1321 gene locus_tag LOCUS_t00230 1397 1321 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3372 1807 gene locus_tag LOCUS_22460 3372 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4322 3369 gene locus_tag LOCUS_22470 4322 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence398 982 296 gene locus_tag LOCUS_22480 gene clpP 982 296 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_22480 2453 975 gene locus_tag LOCUS_22490 gene tig 2453 975 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_22490 2569 2485 gene locus_tag LOCUS_t00240 2569 2485 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2730 2655 gene locus_tag LOCUS_t00250 2730 2655 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2857 2783 gene locus_tag LOCUS_t00260 2857 2783 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3815 3054 gene locus_tag LOCUS_22500 3815 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence399 2 1168 gene locus_tag LOCUS_22510 gene larA 2 1168 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943907.1 protein_id gnl|my_center|LOCUS_22510 2457 1153 gene locus_tag LOCUS_22520 2457 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2868 3638 gene locus_tag LOCUS_22530 2868 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3780 4025 gene locus_tag LOCUS_22540 3780 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence400 964 416 gene locus_tag LOCUS_22550 964 416 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392330.1 protein_id gnl|my_center|LOCUS_22550 2048 3352 gene locus_tag LOCUS_22560 2048 3352 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187993.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence401 1180 2283 gene locus_tag LOCUS_22570 1180 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2301 3170 gene locus_tag LOCUS_22580 2301 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 4190 3336 gene locus_tag LOCUS_22590 4190 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence402 <1 720 gene locus_tag LOCUS_22600 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762702.1:L-rhamnose/proton symporter RhaT 731 1900 gene locus_tag LOCUS_22610 731 1900 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_22610 2896 1910 gene locus_tag LOCUS_22620 2896 1910 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_22620 4023 2995 gene locus_tag LOCUS_22630 4023 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence403 214 855 gene locus_tag LOCUS_22640 214 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 1398 1090 gene locus_tag LOCUS_22650 1398 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence404 729 235 gene locus_tag LOCUS_22660 729 235 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582742.1 protein_id gnl|my_center|LOCUS_22660 1702 818 gene locus_tag LOCUS_22670 1702 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4141 1970 gene locus_tag LOCUS_22680 4141 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence405 <1 2155 gene locus_tag LOCUS_22690 <1 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681741.1:SUMF1/EgtB/PvdO family nonheme iron enzyme 2423 3067 gene locus_tag LOCUS_22700 2423 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3039 3224 gene locus_tag LOCUS_22710 3039 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3353 3946 gene locus_tag LOCUS_22720 3353 3946 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304752.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence406 1176 3098 gene locus_tag LOCUS_22730 gene dnaK 1176 3098 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence407 157 1914 gene locus_tag LOCUS_22740 157 1914 CDS product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943797.1 protein_id gnl|my_center|LOCUS_22740 1936 2388 gene locus_tag LOCUS_22750 1936 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence408 675 532 gene locus_tag LOCUS_22760 675 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2153 675 gene locus_tag LOCUS_22770 2153 675 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_22770 2394 3551 gene locus_tag LOCUS_22780 2394 3551 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence409 706 2793 gene locus_tag LOCUS_22790 706 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3096 4142 gene locus_tag LOCUS_22800 3096 4142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence410 330 1862 gene locus_tag LOCUS_22810 330 1862 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_22810 3814 1952 gene locus_tag LOCUS_22820 3814 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence411 <4163 1973 gene locus_tag LOCUS_22830 <4163 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142730.1:DEAD/DEAH box helicase >Feature sequence412 598 2988 gene locus_tag LOCUS_22840 598 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3039 3263 gene locus_tag LOCUS_22850 3039 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3994 3209 gene locus_tag LOCUS_22860 3994 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence413 2886 1660 gene locus_tag LOCUS_22870 2886 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3154 2942 gene locus_tag LOCUS_22880 3154 2942 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020810.1 protein_id gnl|my_center|LOCUS_22880 3414 3181 gene locus_tag LOCUS_22890 3414 3181 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546765.1 protein_id gnl|my_center|LOCUS_22890 <4160 3567 gene locus_tag LOCUS_22900 <4160 3567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146468.1:glycosyltransferase >Feature sequence414 1867 3234 gene locus_tag LOCUS_22910 1867 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 <4152 3292 gene locus_tag LOCUS_22920 <4152 3292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator >Feature sequence415 1424 3175 gene locus_tag LOCUS_22930 1424 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence416 2121 1015 gene locus_tag LOCUS_22940 gene mltG 2121 1015 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_22940 2616 2128 gene locus_tag LOCUS_22950 gene ruvX 2616 2128 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 protein_id gnl|my_center|LOCUS_22950 3420 2662 gene locus_tag LOCUS_22960 3420 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3590 3441 gene locus_tag LOCUS_22970 3590 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence417 1773 340 gene locus_tag LOCUS_22980 gene uxaC 1773 340 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_22980 2123 2563 gene locus_tag LOCUS_22990 2123 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2681 3568 gene locus_tag LOCUS_23000 2681 3568 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence418 <1 603 gene locus_tag LOCUS_23010 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769287.1:MFS transporter 940 629 gene locus_tag LOCUS_23020 940 629 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_23020 1499 1119 gene locus_tag LOCUS_23030 1499 1119 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_23030 1690 1496 gene locus_tag LOCUS_23040 1690 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2264 1830 gene locus_tag LOCUS_23050 2264 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23050 2518 3027 gene locus_tag LOCUS_23060 2518 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23060 3040 3384 gene locus_tag LOCUS_23070 3040 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23070 <4086 3404 gene locus_tag LOCUS_23080 <4086 3404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965811.1:IlvD/Edd family dehydratase >Feature sequence419 1136 42 gene locus_tag LOCUS_23090 1136 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1410 1201 gene locus_tag LOCUS_23100 1410 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1661 1407 gene locus_tag LOCUS_23110 1661 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2373 2011 gene locus_tag LOCUS_23120 2373 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2684 2370 gene locus_tag LOCUS_23130 2684 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 3198 2677 gene locus_tag LOCUS_23140 3198 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 3403 3188 gene locus_tag LOCUS_23150 3403 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3711 3400 gene locus_tag LOCUS_23160 3711 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4046 3708 gene locus_tag LOCUS_23170 4046 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence420 855 730 gene locus_tag LOCUS_23180 855 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1422 2606 gene locus_tag LOCUS_23190 1422 2606 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence421 252 1541 gene locus_tag LOCUS_23200 252 1541 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438661.1 protein_id gnl|my_center|LOCUS_23200 2366 2830 gene locus_tag LOCUS_23210 2366 2830 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_23210 2870 3259 gene locus_tag LOCUS_23220 2870 3259 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_23220 3305 3781 gene locus_tag LOCUS_23230 3305 3781 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence422 379 906 gene locus_tag LOCUS_23240 379 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 906 1364 gene locus_tag LOCUS_23250 906 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1361 2116 gene locus_tag LOCUS_23260 1361 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2109 3053 gene locus_tag LOCUS_23270 2109 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence423 3 845 gene locus_tag LOCUS_23280 3 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence424 335 1672 gene locus_tag LOCUS_23290 335 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2344 1694 gene locus_tag LOCUS_23300 2344 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3611 2421 gene locus_tag LOCUS_23310 3611 2421 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence425 505 1884 gene locus_tag LOCUS_23320 505 1884 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_23320 1957 2091 gene locus_tag LOCUS_23330 1957 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2213 2890 gene locus_tag LOCUS_23340 2213 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3057 3653 gene locus_tag LOCUS_23350 gene sigR 3057 3653 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence426 882 424 gene locus_tag LOCUS_23360 gene smpB 882 424 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_23360 2519 879 gene locus_tag LOCUS_23370 2519 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence427 943 47 gene locus_tag LOCUS_23380 gene rfbD 943 47 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_23380 2111 1113 gene locus_tag LOCUS_23390 2111 1113 CDS product phosphatidylinositol-specific phospholipase C1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_23390 3921 2860 gene locus_tag LOCUS_23400 3921 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence428 229 8 gene locus_tag LOCUS_23410 229 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2205 277 gene locus_tag LOCUS_23420 2205 277 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_23420 2698 3678 gene locus_tag LOCUS_23430 2698 3678 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868853.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence429 1330 320 gene locus_tag LOCUS_23440 1330 320 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_23440 2829 1360 gene locus_tag LOCUS_23450 2829 1360 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226386.1 protein_id gnl|my_center|LOCUS_23450 2926 3909 gene locus_tag LOCUS_23460 gene lipA 2926 3909 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence430 280 1092 gene locus_tag LOCUS_23470 280 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1095 2288 gene locus_tag LOCUS_23480 1095 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2317 3153 gene locus_tag LOCUS_23490 2317 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence431 1078 599 gene locus_tag LOCUS_23500 1078 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1378 1779 gene locus_tag LOCUS_23510 1378 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3198 1882 gene locus_tag LOCUS_23520 3198 1882 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_23520 <3981 3322 gene locus_tag LOCUS_23530 <3981 3322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391322.1:acetate--CoA ligase >Feature sequence432 747 25 gene locus_tag LOCUS_23540 gene pyrH 747 25 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_23540 1429 767 gene locus_tag LOCUS_23550 gene tsf 1429 767 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_23550 2385 1507 gene locus_tag LOCUS_23560 gene rpsB 2385 1507 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_23560 3041 3367 gene locus_tag LOCUS_23570 3041 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence433 132 208 gene locus_tag LOCUS_t00270 132 208 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 561 719 gene locus_tag LOCUS_23580 561 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 773 1183 gene locus_tag LOCUS_23590 773 1183 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630908.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence434 <1 785 gene locus_tag LOCUS_23600 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458834.1:amidoligase family protein 892 1341 gene locus_tag LOCUS_23610 892 1341 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_23610 1338 1532 gene locus_tag LOCUS_23620 1338 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2023 1715 gene locus_tag LOCUS_23630 2023 1715 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_23630 2294 2016 gene locus_tag LOCUS_23640 2294 2016 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_23640 2849 2673 gene locus_tag LOCUS_23650 2849 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2930 3175 gene locus_tag LOCUS_23660 2930 3175 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_23660 3178 3492 gene locus_tag LOCUS_23670 3178 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3821 3681 gene locus_tag LOCUS_23680 3821 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence435 1734 208 gene locus_tag LOCUS_23690 gene rng 1734 208 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_23690 2067 2900 gene locus_tag LOCUS_23700 2067 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence436 3160 1166 gene locus_tag LOCUS_23710 3160 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence437 917 501 gene locus_tag LOCUS_23720 917 501 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_23720 1153 914 gene locus_tag LOCUS_23730 1153 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1312 1539 gene locus_tag LOCUS_23740 1312 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1829 1611 gene locus_tag LOCUS_23750 1829 1611 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_23750 2118 1831 gene locus_tag LOCUS_23760 2118 1831 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_23760 2641 3030 gene locus_tag LOCUS_23770 2641 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence438 3298 827 gene locus_tag LOCUS_23780 3298 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 <3925 3398 gene locus_tag LOCUS_23790 <3925 3398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615882.1:SGNH/GDSL hydrolase family protein >Feature sequence439 2123 981 gene locus_tag LOCUS_23800 2123 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2260 2185 gene locus_tag LOCUS_t00280 2260 2185 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2354 2280 gene locus_tag LOCUS_t00290 2354 2280 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3579 2437 gene locus_tag LOCUS_23810 gene purF 3579 2437 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 3602 3611 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3641 3916 gene locus_tag LOCUS_23820 3641 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence440 433 1710 gene locus_tag LOCUS_23830 433 1710 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_23830 1897 3036 gene locus_tag LOCUS_23840 1897 3036 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_23840 <3921 3076 gene locus_tag LOCUS_23850 <3921 3076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463614.1:mechanosensitive ion channel >Feature sequence441 416 219 gene locus_tag LOCUS_23860 416 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 521 1033 gene locus_tag LOCUS_23870 521 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence442 805 1284 gene locus_tag LOCUS_23880 gene mraZ 805 1284 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_23880 1277 1630 gene locus_tag LOCUS_23890 1277 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1679 2620 gene locus_tag LOCUS_23900 gene rsmH 1679 2620 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731975.1 protein_id gnl|my_center|LOCUS_23900 2642 3268 gene locus_tag LOCUS_23910 2642 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence443 240 1214 gene locus_tag LOCUS_23920 240 1214 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_23920 1500 2840 gene locus_tag LOCUS_23930 gene gdhA 1500 2840 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence444 1529 2752 gene locus_tag LOCUS_23940 1529 2752 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_23940 2768 3745 gene locus_tag LOCUS_23950 2768 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence445 221 146 gene locus_tag LOCUS_t00300 221 146 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1390 500 gene locus_tag LOCUS_23960 1390 500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990845.1 protein_id gnl|my_center|LOCUS_23960 2457 1390 gene locus_tag LOCUS_23970 2457 1390 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061496.1 protein_id gnl|my_center|LOCUS_23970 3225 2731 gene locus_tag LOCUS_23980 3225 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence446 1207 335 gene locus_tag LOCUS_23990 1207 335 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310200.1 protein_id gnl|my_center|LOCUS_23990 1995 1210 gene locus_tag LOCUS_24000 1995 1210 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679455.1 protein_id gnl|my_center|LOCUS_24000 2559 2957 gene locus_tag LOCUS_24010 2559 2957 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704430.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence447 1429 236 gene locus_tag LOCUS_24020 1429 236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_24020 1878 2906 gene locus_tag LOCUS_24030 1878 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2910 3704 gene locus_tag LOCUS_24040 2910 3704 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence448 776 1171 gene locus_tag LOCUS_24050 776 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1215 1538 gene locus_tag LOCUS_24060 1215 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1585 2034 gene locus_tag LOCUS_24070 1585 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2157 2444 gene locus_tag LOCUS_24080 2157 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2474 2752 gene locus_tag LOCUS_24090 2474 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2749 3048 gene locus_tag LOCUS_24100 2749 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 3165 3452 gene locus_tag LOCUS_24110 3165 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3556 3774 gene locus_tag LOCUS_24120 3556 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence449 <1 1389 gene locus_tag LOCUS_24130 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070812.1:DUF853 family protein 2420 1533 gene locus_tag LOCUS_24140 2420 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3822 2977 gene locus_tag LOCUS_24150 3822 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence450 <1 516 gene locus_tag LOCUS_24160 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972957.1:trehalose utilization protein ThuA 911 1390 gene locus_tag LOCUS_24170 911 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1387 1548 gene locus_tag LOCUS_24180 1387 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1884 3311 gene locus_tag LOCUS_24190 1884 3311 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243920.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence451 47 1321 gene locus_tag LOCUS_24200 47 1321 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_24200 1440 2942 gene locus_tag LOCUS_24210 gene gguA 1440 2942 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992366.1 protein_id gnl|my_center|LOCUS_24210 <3789 3220 gene locus_tag LOCUS_24220 <3789 3220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392957.1:uroporphyrinogen decarboxylase family protein >Feature sequence452 2217 64 gene locus_tag LOCUS_24230 2217 64 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583261.1 protein_id gnl|my_center|LOCUS_24230 3381 2320 gene locus_tag LOCUS_24240 3381 2320 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence453 >Feature sequence454 <1 1081 gene locus_tag LOCUS_24250 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024417.1:3-phosphoshikimate 1-carboxyvinyltransferase 1305 2921 gene locus_tag LOCUS_24260 1305 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 >Feature sequence455 1316 1756 gene locus_tag LOCUS_24270 1316 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2031 3038 gene locus_tag LOCUS_24280 2031 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence456 3373 2315 gene locus_tag LOCUS_24290 gene trpS 3373 2315 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence457 191 1057 gene locus_tag LOCUS_24300 191 1057 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083266.1 protein_id gnl|my_center|LOCUS_24300 1199 1645 gene locus_tag LOCUS_24310 1199 1645 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203320.1 protein_id gnl|my_center|LOCUS_24310 1819 1679 gene locus_tag LOCUS_24320 1819 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1797 2852 gene locus_tag LOCUS_24330 gene fbaA 1797 2852 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401856.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence458 1056 2318 gene locus_tag LOCUS_24340 1056 2318 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_24340 3136 2204 gene locus_tag LOCUS_24350 gene pssA 3136 2204 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072696843.1 protein_id gnl|my_center|LOCUS_24350 <3677 3133 gene locus_tag LOCUS_24360 <3677 3133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196436.1:phosphatidylserine decarboxylase >Feature sequence459 491 1504 gene locus_tag LOCUS_24370 491 1504 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_24370 2061 1654 gene locus_tag LOCUS_24380 2061 1654 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_24380 2282 2049 gene locus_tag LOCUS_24390 2282 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3603 2899 gene locus_tag LOCUS_24400 3603 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence460 3487 728 gene locus_tag LOCUS_24410 3487 728 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence461 <1 515 gene locus_tag LOCUS_24420 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986411.1:NADH-dependent [FeFe] hydrogenase, group A6 515 1081 gene locus_tag LOCUS_24430 515 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 1236 3272 gene locus_tag LOCUS_24440 gene fusA 1236 3272 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence462 670 497 gene locus_tag LOCUS_24450 670 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 673 1905 gene locus_tag LOCUS_24460 673 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1889 3178 gene locus_tag LOCUS_24470 1889 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence463 544 1869 gene locus_tag LOCUS_24480 gene miaB 544 1869 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_24480 1918 3444 gene locus_tag LOCUS_24490 1918 3444 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence464 419 2764 gene locus_tag LOCUS_24500 419 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3042 3494 gene locus_tag LOCUS_24510 3042 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence465 2201 3061 gene locus_tag LOCUS_24520 2201 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence466 1606 1226 gene locus_tag LOCUS_24530 1606 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2528 1635 gene locus_tag LOCUS_24540 2528 1635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_24540 3409 2537 gene locus_tag LOCUS_24550 3409 2537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence467 172 309 gene locus_tag LOCUS_24560 172 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 387 1796 gene locus_tag LOCUS_24570 387 1796 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence468 <1 940 gene locus_tag LOCUS_24580 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000661932.1:class I SAM-dependent methyltransferase 933 1553 gene locus_tag LOCUS_24590 gene gmhA 933 1553 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_24590 1617 2663 gene locus_tag LOCUS_24600 1617 2663 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence469 >Feature sequence470 <1 820 gene locus_tag LOCUS_24610 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein 2193 886 gene locus_tag LOCUS_24620 2193 886 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_24620 <3555 2180 gene locus_tag LOCUS_24630 <3555 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946128.1:RimK family protein >Feature sequence471 <1 2135 gene locus_tag LOCUS_24640 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546627.1:DNA-directed RNA polymerase subunit beta >Feature sequence472 871 1740 gene locus_tag LOCUS_24650 871 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1941 2576 gene locus_tag LOCUS_24660 gene lepB 1941 2576 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_24660 2711 3385 gene locus_tag LOCUS_24670 2711 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence473 1821 2744 gene locus_tag LOCUS_24680 1821 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 <3529 2850 gene locus_tag LOCUS_24690 <3529 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461032.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence474 261 1160 gene locus_tag LOCUS_24700 261 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1157 2140 gene locus_tag LOCUS_24710 gene thiL 1157 2140 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_24710 2685 2125 gene locus_tag LOCUS_24720 2685 2125 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_24720 3399 2761 gene locus_tag LOCUS_24730 3399 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence475 627 115 gene locus_tag LOCUS_24740 627 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 886 1872 gene locus_tag LOCUS_24750 886 1872 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_24750 1931 2782 gene locus_tag LOCUS_24760 gene purU 1931 2782 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_24760 3188 2898 gene locus_tag LOCUS_24770 3188 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3409 3185 gene locus_tag LOCUS_24780 3409 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence476 477 2882 gene locus_tag LOCUS_24790 477 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2998 3147 gene locus_tag LOCUS_24800 2998 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence477 1991 1239 gene locus_tag LOCUS_24810 1991 1239 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_24810 3025 2219 gene locus_tag LOCUS_24820 3025 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence478 838 3435 gene locus_tag LOCUS_24830 838 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence479 895 95 gene locus_tag LOCUS_24840 895 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24840 278 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1150 1320 gene locus_tag LOCUS_24850 1150 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1449 3143 gene locus_tag LOCUS_24860 1449 3143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118830.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence480 1683 1162 gene locus_tag LOCUS_24870 1683 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3127 1667 gene locus_tag LOCUS_24880 3127 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence481 3322 803 gene locus_tag LOCUS_24890 3322 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence482 801 190 gene locus_tag LOCUS_24900 801 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1307 1813 gene locus_tag LOCUS_24910 gene rnhA 1307 1813 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence483 1312 2205 gene locus_tag LOCUS_24920 1312 2205 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_24920 2450 2265 gene locus_tag LOCUS_24930 2450 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 2905 2447 gene locus_tag LOCUS_24940 2905 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 2939 3067 gene locus_tag LOCUS_24950 2939 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence484 2410 2180 gene locus_tag LOCUS_24960 2410 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 <3443 2550 gene locus_tag LOCUS_24970 <3443 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947378.1:5-dehydro-2-deoxygluconokinase >Feature sequence485 1852 572 gene locus_tag LOCUS_24980 1852 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2810 1857 gene locus_tag LOCUS_24990 2810 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 <3426 2914 gene locus_tag LOCUS_25000 <3426 2914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665638.1:MoxR family ATPase >Feature sequence486 >Feature sequence487 291 133 gene locus_tag LOCUS_25010 291 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 437 2653 gene locus_tag LOCUS_25020 437 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence488 184 342 gene locus_tag LOCUS_25030 184 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 242 251 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 351 983 gene locus_tag LOCUS_25040 351 983 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 1728 1039 gene locus_tag LOCUS_25050 1728 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2586 2158 gene locus_tag LOCUS_25060 2586 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 <3412 2568 gene locus_tag LOCUS_25070 <3412 2568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:sulfatase-like hydrolase/transferase note possible pseudo, frameshifted >Feature sequence489 1213 941 gene locus_tag LOCUS_25080 1213 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence490 1616 348 gene locus_tag LOCUS_25090 1616 348 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_25090 1973 2305 gene locus_tag LOCUS_25100 1973 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence491 1654 2559 gene locus_tag LOCUS_25110 1654 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2888 3280 gene locus_tag LOCUS_25120 2888 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence492 <1 859 gene locus_tag LOCUS_25130 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110499.1:UV DNA damage repair endonuclease UvsE 931 1359 gene locus_tag LOCUS_25140 931 1359 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942968.1 protein_id gnl|my_center|LOCUS_25140 1396 2832 gene locus_tag LOCUS_25150 1396 2832 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence493 2079 643 gene locus_tag LOCUS_25160 2079 643 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_25160 2584 2805 gene locus_tag LOCUS_25170 2584 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2802 3098 gene locus_tag LOCUS_25180 2802 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3174 3338 gene locus_tag LOCUS_25190 3174 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence494 734 2203 gene locus_tag LOCUS_25200 734 2203 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_25200 2229 3224 gene locus_tag LOCUS_25210 2229 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence495 791 174 gene locus_tag LOCUS_25220 791 174 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_25220 1159 2382 gene locus_tag LOCUS_25230 1159 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2802 2653 gene locus_tag LOCUS_25240 2802 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence496 470 2404 gene locus_tag LOCUS_25250 470 2404 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence497 887 174 gene locus_tag LOCUS_25260 887 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1018 1470 gene locus_tag LOCUS_25270 1018 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1753 2406 gene locus_tag LOCUS_25280 1753 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 3279 2425 gene locus_tag LOCUS_25290 3279 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence498 3246 2776 gene locus_tag LOCUS_25300 3246 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence499 <1 726 gene locus_tag LOCUS_25310 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942541.1:3-deoxy-manno-octulosonate cytidylyltransferase 742 1938 gene locus_tag LOCUS_25320 742 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence500 967 2646 gene locus_tag LOCUS_25330 967 2646 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_25330 3348 2701 gene locus_tag LOCUS_25340 3348 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence501 338 2473 gene locus_tag LOCUS_25350 338 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 <3341 2581 gene locus_tag LOCUS_25360 <3341 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965174.1:serine protease >Feature sequence502 1267 317 gene locus_tag LOCUS_25370 gene trxB 1267 317 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_25370 1248 1439 gene locus_tag LOCUS_25380 1248 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 <3323 1471 gene locus_tag LOCUS_25390 <3323 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938364.1:peptidylprolyl isomerase >Feature sequence503 650 21 gene locus_tag LOCUS_25400 650 21 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_25400 2890 680 gene locus_tag LOCUS_25410 2890 680 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence504 >Feature sequence505 <3314 287 gene locus_tag LOCUS_25420 <3314 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein >Feature sequence506 <1 714 gene locus_tag LOCUS_25430 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404186.1:ZIP family metal transporter 1993 770 gene locus_tag LOCUS_25440 1993 770 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941553.1 protein_id gnl|my_center|LOCUS_25440 3008 2112 gene locus_tag LOCUS_25450 3008 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence507 3190 1967 gene locus_tag LOCUS_25460 3190 1967 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence508 1702 3063 gene locus_tag LOCUS_25470 1702 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence509 8 1168 gene locus_tag LOCUS_25480 8 1168 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_25480 1172 3040 gene locus_tag LOCUS_25490 gene asnB 1172 3040 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence510 <1 504 gene locus_tag LOCUS_25500 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259744.1:methionine synthase 519 1103 gene locus_tag LOCUS_25510 519 1103 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_25510 2088 1105 gene locus_tag LOCUS_25520 2088 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3302 2442 gene locus_tag LOCUS_25530 3302 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence511 1097 3121 gene locus_tag LOCUS_25540 1097 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence512 2024 3229 gene locus_tag LOCUS_25550 2024 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence513 1782 883 gene locus_tag LOCUS_25560 gene folD 1782 883 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_25560 2597 1866 gene locus_tag LOCUS_25570 gene pdxJ 2597 1866 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815755.1 protein_id gnl|my_center|LOCUS_25570 <3256 2698 gene locus_tag LOCUS_25580 <3256 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391658.1:dihydropteroate synthase >Feature sequence514 674 1678 gene locus_tag LOCUS_25590 674 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2040 2504 gene locus_tag LOCUS_25600 2040 2504 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence515 287 1447 gene locus_tag LOCUS_25610 287 1447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence516 2642 1314 gene locus_tag LOCUS_25620 2642 1314 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838739.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence517 837 1307 gene locus_tag LOCUS_25630 837 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021936.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence518 1759 725 gene locus_tag LOCUS_25640 1759 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2712 1756 gene locus_tag LOCUS_25650 2712 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3212 2709 gene locus_tag LOCUS_25660 3212 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence519 370 513 gene locus_tag LOCUS_25670 370 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 529 2082 gene locus_tag LOCUS_25680 529 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence520 506 1228 gene locus_tag LOCUS_25690 506 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1225 2649 gene locus_tag LOCUS_25700 1225 2649 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence521 <1 836 gene locus_tag LOCUS_25710 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083434976.1:isoleucine--tRNA ligase note possible pseudo, frameshifted 988 761 gene locus_tag LOCUS_25720 988 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 962 3142 gene locus_tag LOCUS_25730 962 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25730 >Feature sequence522 2160 2597 gene locus_tag LOCUS_25740 2160 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence523 30 827 gene locus_tag LOCUS_25750 30 827 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_25750 1417 899 gene locus_tag LOCUS_25760 1417 899 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_25760 <3189 1558 gene locus_tag LOCUS_25770 <3189 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019081732.1:phosphoenolpyruvate-protein phosphotransferase PtsI >Feature sequence524 <3183 1514 gene locus_tag LOCUS_25780 <3183 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259750.1:acetate--CoA ligase >Feature sequence525 2983 302 gene locus_tag LOCUS_25790 2983 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence526 25 852 gene locus_tag LOCUS_25800 25 852 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256367.1 protein_id gnl|my_center|LOCUS_25800 982 1137 gene locus_tag LOCUS_25810 982 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1147 1452 gene locus_tag LOCUS_25820 1147 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence527 >Feature sequence528 2107 41 gene locus_tag LOCUS_25830 gene nrdJ 2107 41 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_25830 3127 2345 gene locus_tag LOCUS_25840 gene thyX 3127 2345 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390602.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence529 2128 941 gene locus_tag LOCUS_25850 2128 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2794 3141 gene locus_tag LOCUS_25860 gene hinT 2794 3141 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence530 2263 800 gene locus_tag LOCUS_25870 2263 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence531 703 822 gene locus_tag LOCUS_25880 703 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2733 883 gene locus_tag LOCUS_25890 2733 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence532 500 15 gene locus_tag LOCUS_25900 500 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2617 497 gene locus_tag LOCUS_25910 2617 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence533 1840 1043 gene locus_tag LOCUS_25920 1840 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2306 2007 gene locus_tag LOCUS_25930 2306 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence534 1775 861 gene locus_tag LOCUS_25940 1775 861 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090884.1 protein_id gnl|my_center|LOCUS_25940 2035 1751 gene locus_tag LOCUS_25950 2035 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2268 2993 gene locus_tag LOCUS_25960 2268 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence535 751 2682 gene locus_tag LOCUS_25970 751 2682 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence536 737 174 gene locus_tag LOCUS_25980 gene rplE 737 174 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055683.1 protein_id gnl|my_center|LOCUS_25980 1108 797 gene locus_tag LOCUS_25990 gene rplX 1108 797 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596219.1 protein_id gnl|my_center|LOCUS_25990 1491 1123 gene locus_tag LOCUS_26000 gene rplN 1491 1123 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129953.1 protein_id gnl|my_center|LOCUS_26000 1795 1511 gene locus_tag LOCUS_26010 gene rpsQ 1795 1511 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_26010 2007 1795 gene locus_tag LOCUS_26020 gene rpmC 2007 1795 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_26020 2451 2041 gene locus_tag LOCUS_26030 gene rplP 2451 2041 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_26030 <3133 2522 gene locus_tag LOCUS_26040 <3133 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810152.1:30S ribosomal protein S3 >Feature sequence537 1964 1653 gene locus_tag LOCUS_26050 1964 1653 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_26050 <3126 2460 gene locus_tag LOCUS_26060 <3126 2460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein >Feature sequence538 >Feature sequence539 392 252 gene locus_tag LOCUS_26070 392 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 668 1627 gene locus_tag LOCUS_26080 668 1627 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_26080 2582 1686 gene locus_tag LOCUS_26090 2582 1686 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence540 >Feature sequence541 3065 1062 gene locus_tag LOCUS_26100 3065 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence542 682 1347 gene locus_tag LOCUS_26110 682 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2279 1395 gene locus_tag LOCUS_26120 2279 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence543 <3083 118 gene locus_tag LOCUS_26130 <3083 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence544 1660 470 gene locus_tag LOCUS_26140 1660 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 <3083 1865 gene locus_tag LOCUS_26150 <3083 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967507.1:ATP-binding protein >Feature sequence545 412 1092 gene locus_tag LOCUS_26160 412 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1089 2084 gene locus_tag LOCUS_26170 1089 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence546 >Feature sequence547 1331 474 gene locus_tag LOCUS_26180 1331 474 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence548 202 1581 gene locus_tag LOCUS_26190 202 1581 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence549 87 563 gene locus_tag LOCUS_26200 87 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 687 890 gene locus_tag LOCUS_26210 gene rpsU 687 890 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_26210 1407 1042 gene locus_tag LOCUS_26220 1407 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1318 2271 gene locus_tag LOCUS_26230 1318 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 2307 2870 gene locus_tag LOCUS_26240 2307 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence550 >Feature sequence551 2989 1490 gene locus_tag LOCUS_26250 gene hisS 2989 1490 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968817.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence552 <1 825 gene locus_tag LOCUS_26260 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase 1280 1023 gene locus_tag LOCUS_26270 1280 1023 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123708.1 protein_id gnl|my_center|LOCUS_26270 2507 1347 gene locus_tag LOCUS_26280 gene anmK 2507 1347 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_26280 <3023 2504 gene locus_tag LOCUS_26290 <3023 2504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767086.1:SpoIID/LytB domain-containing protein >Feature sequence553 <1 2209 gene locus_tag LOCUS_26300 <1 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256824.1:redoxin domain-containing protein >Feature sequence554 43 534 gene locus_tag LOCUS_26310 43 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 586 2535 gene locus_tag LOCUS_26320 586 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence555 <1 1016 gene locus_tag LOCUS_26330 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776870.1:heparinase II/III family protein 2951 1044 gene locus_tag LOCUS_26340 2951 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence556 2000 249 gene locus_tag LOCUS_26350 2000 249 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence557 <1 1484 gene locus_tag LOCUS_26360 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206877616.1:RHS repeat-associated core domain-containing protein 1616 2677 gene locus_tag LOCUS_26370 gene mutY 1616 2677 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence558 1297 2247 gene locus_tag LOCUS_26380 gene cas6 1297 2247 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence559 >Feature sequence560 270 998 gene locus_tag LOCUS_26390 270 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 991 2091 gene locus_tag LOCUS_26400 991 2091 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498680.1 protein_id gnl|my_center|LOCUS_26400 <2985 2099 gene locus_tag LOCUS_26410 <2985 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080165.1:aldo/keto reductase >Feature sequence561 2052 757 gene locus_tag LOCUS_26420 2052 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence562 23 991 gene locus_tag LOCUS_26430 23 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1442 1290 gene locus_tag LOCUS_26440 1442 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence563 2745 361 gene locus_tag LOCUS_26450 2745 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence564 776 15 gene locus_tag LOCUS_26460 776 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1147 1560 gene locus_tag LOCUS_26470 1147 1560 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence565 243 1646 gene locus_tag LOCUS_26480 243 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence566 1105 1317 gene locus_tag LOCUS_26490 1105 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence567 2431 1838 gene locus_tag LOCUS_26500 2431 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence568 460 1290 gene locus_tag LOCUS_26510 460 1290 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938516.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence569 526 1035 gene locus_tag LOCUS_26520 526 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 1032 1592 gene locus_tag LOCUS_26530 1032 1592 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_26530 2488 1601 gene locus_tag LOCUS_26540 gene metF 2488 1601 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence570 701 375 gene locus_tag LOCUS_26550 701 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1276 701 gene locus_tag LOCUS_26560 1276 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 >Feature sequence571 2037 280 gene locus_tag LOCUS_26570 2037 280 CDS product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence572 2139 955 gene locus_tag LOCUS_26580 2139 955 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868787.1 protein_id gnl|my_center|LOCUS_26580 <2881 2132 gene locus_tag LOCUS_26590 <2881 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626657.1:TolC family protein >Feature sequence573 2877 2749 gene locus_tag LOCUS_26600 2877 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence574 3 911 gene locus_tag LOCUS_26610 3 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1726 2748 gene locus_tag LOCUS_26620 1726 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence575 150 1724 gene locus_tag LOCUS_26630 150 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence576 1174 227 gene locus_tag LOCUS_26640 1174 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2663 1485 gene locus_tag LOCUS_26650 2663 1485 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence577 473 398 gene locus_tag LOCUS_t00310 473 398 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <2841 626 gene locus_tag LOCUS_26660 <2841 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065778.1:tetratricopeptide repeat protein >Feature sequence578 1915 845 gene locus_tag LOCUS_26670 gene pheA 1915 845 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_26670 <2834 1933 gene locus_tag LOCUS_26680 <2834 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644128.1:DNA helicase PcrA >Feature sequence579 <1 1229 gene locus_tag LOCUS_26690 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393418.1:helicase-associated domain-containing protein 2132 1338 gene locus_tag LOCUS_26700 2132 1338 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 protein_id gnl|my_center|LOCUS_26700 2389 2240 gene locus_tag LOCUS_26710 2389 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence580 2269 2006 gene locus_tag LOCUS_26720 2269 2006 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_26720 2508 2266 gene locus_tag LOCUS_26730 2508 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2704 2549 gene locus_tag LOCUS_26740 2704 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence581 307 1263 gene locus_tag LOCUS_26750 307 1263 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_26750 1299 2468 gene locus_tag LOCUS_26760 1299 2468 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence582 >Feature sequence583 734 372 gene locus_tag LOCUS_26770 gene rplT 734 372 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_26770 1027 830 gene locus_tag LOCUS_26780 gene rpmI 1027 830 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_26780 1601 1167 gene locus_tag LOCUS_26790 gene infC 1601 1167 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_26790 <2788 1981 gene locus_tag LOCUS_26800 <2788 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404493.1:M20 family peptidase >Feature sequence584 438 827 gene locus_tag LOCUS_26810 438 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 827 2293 gene locus_tag LOCUS_26820 827 2293 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence585 641 1087 gene locus_tag LOCUS_26830 641 1087 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_26830 1081 1653 gene locus_tag LOCUS_26840 1081 1653 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence586 <1 809 gene locus_tag LOCUS_26850 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228712.1:ATP-dependent chaperone ClpB 2269 911 gene locus_tag LOCUS_26860 2269 911 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence587 2331 2125 gene locus_tag LOCUS_26870 2331 2125 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence588 723 2477 gene locus_tag LOCUS_26880 723 2477 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence589 116 895 gene locus_tag LOCUS_26890 116 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 925 1449 gene locus_tag LOCUS_26900 925 1449 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939583.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence590 1302 208 gene locus_tag LOCUS_26910 1302 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 >Feature sequence591 15 902 gene locus_tag LOCUS_26920 15 902 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_26920 1678 1950 gene locus_tag LOCUS_26930 1678 1950 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886812.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence592 >Feature sequence593 611 114 gene locus_tag LOCUS_26940 611 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1610 771 gene locus_tag LOCUS_26950 1610 771 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_26950 2296 1670 gene locus_tag LOCUS_26960 2296 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2576 2364 gene locus_tag LOCUS_26970 2576 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence594 267 1643 gene locus_tag LOCUS_26980 gene hemN 267 1643 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256540.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence595 634 1590 gene locus_tag LOCUS_26990 634 1590 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence596 245 2155 gene locus_tag LOCUS_27000 245 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence597 <1 1265 gene locus_tag LOCUS_27010 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388484.1:MFS transporter >Feature sequence598 1333 2463 gene locus_tag LOCUS_27020 gene mnmA 1333 2463 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence599 353 1285 gene locus_tag LOCUS_27030 353 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 1285 2061 gene locus_tag LOCUS_27040 1285 2061 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence600 496 672 gene locus_tag LOCUS_27050 496 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 654 917 gene locus_tag LOCUS_27060 654 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1002 2054 gene locus_tag LOCUS_27070 1002 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence601 636 1106 gene locus_tag LOCUS_27080 636 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1153 2589 gene locus_tag LOCUS_27090 1153 2589 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence602 >Feature sequence603 <2677 1423 gene locus_tag LOCUS_27100 <2677 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926994.1:AMP-dependent synthetase/ligase >Feature sequence604 1027 952 gene locus_tag LOCUS_t00320 1027 952 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1208 1846 gene locus_tag LOCUS_27110 1208 1846 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence605 910 1569 gene locus_tag LOCUS_27120 910 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1573 2265 gene locus_tag LOCUS_27130 1573 2265 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_27130 >Feature sequence606 1191 208 gene locus_tag LOCUS_27140 1191 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2040 1435 gene locus_tag LOCUS_27150 2040 1435 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence607 966 4 gene locus_tag LOCUS_27160 966 4 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_27160 2190 1027 gene locus_tag LOCUS_27170 2190 1027 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence608 3 431 gene locus_tag LOCUS_27180 3 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 482 1450 gene locus_tag LOCUS_27190 gene dusB 482 1450 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771241.1 protein_id gnl|my_center|LOCUS_27190 1472 2188 gene locus_tag LOCUS_27200 1472 2188 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704178.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence609 1555 380 gene locus_tag LOCUS_27210 1555 380 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence610 2246 108 gene locus_tag LOCUS_27220 2246 108 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence611 2302 1061 gene locus_tag LOCUS_27230 gene ogl 2302 1061 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence612 1698 646 gene locus_tag LOCUS_27240 1698 646 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_27240 2513 1839 gene locus_tag LOCUS_27250 2513 1839 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932010.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence613 >Feature sequence614 61 1104 gene locus_tag LOCUS_27260 gene mtnA 61 1104 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_27260 1274 2314 gene locus_tag LOCUS_27270 1274 2314 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence615 1214 2227 gene locus_tag LOCUS_27280 gene argC 1214 2227 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence616 118 1698 gene locus_tag LOCUS_27290 118 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1733 2455 gene locus_tag LOCUS_27300 1733 2455 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065490.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence617 1524 418 gene locus_tag LOCUS_27310 1524 418 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_27310 2042 1650 gene locus_tag LOCUS_27320 2042 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 2572 2039 gene locus_tag LOCUS_27330 2572 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence618 88 807 gene locus_tag LOCUS_27340 88 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 804 2054 gene locus_tag LOCUS_27350 804 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2056 2445 gene locus_tag LOCUS_27360 2056 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence619 >Feature sequence620 651 2369 gene locus_tag LOCUS_27370 gene dnaX 651 2369 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence621 1307 171 gene locus_tag LOCUS_27380 gene ogl 1307 171 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210841.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence622 1343 1804 gene locus_tag LOCUS_27390 1343 1804 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957986.1 protein_id gnl|my_center|LOCUS_27390 2545 2093 gene locus_tag LOCUS_27400 2545 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence623 3 860 gene locus_tag LOCUS_27410 3 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2264 1044 gene locus_tag LOCUS_27420 2264 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence624 2314 575 gene locus_tag LOCUS_27430 2314 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 >Feature sequence625 573 1496 gene locus_tag LOCUS_27440 573 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 <2582 1558 gene locus_tag LOCUS_27450 <2582 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989741.1:threonine--tRNA ligase >Feature sequence626 >Feature sequence627 177 1262 gene locus_tag LOCUS_27460 177 1262 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_27460 2424 1513 gene locus_tag LOCUS_27470 2424 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence628 826 1383 gene locus_tag LOCUS_27480 826 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1777 2457 gene locus_tag LOCUS_27490 1777 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence629 321 569 gene locus_tag LOCUS_27500 321 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 1041 1349 gene locus_tag LOCUS_27510 1041 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1346 1498 gene locus_tag LOCUS_27520 1346 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1846 2049 gene locus_tag LOCUS_27530 1846 2049 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence630 1846 497 gene locus_tag LOCUS_27540 1846 497 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence631 509 1018 gene locus_tag LOCUS_27550 gene def 509 1018 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 protein_id gnl|my_center|LOCUS_27550 1032 1643 gene locus_tag LOCUS_27560 gene recR 1032 1643 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence632 927 1295 gene locus_tag LOCUS_27570 927 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1906 1256 gene locus_tag LOCUS_27580 1906 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 <2528 2011 gene locus_tag LOCUS_27590 <2528 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072497.1:response regulator >Feature sequence633 2259 166 gene locus_tag LOCUS_27600 2259 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence634 336 479 gene locus_tag LOCUS_27610 336 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 925 1608 gene locus_tag LOCUS_27620 925 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence635 674 1660 gene locus_tag LOCUS_27630 gene hemB 674 1660 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence636 <1 806 gene locus_tag LOCUS_27640 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein 1412 1116 gene locus_tag LOCUS_27650 1412 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence637 893 2437 gene locus_tag LOCUS_27660 893 2437 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence638 >Feature sequence639 22 753 gene locus_tag LOCUS_27670 22 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence640 414 1763 gene locus_tag LOCUS_27680 414 1763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625279.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence641 1876 446 gene locus_tag LOCUS_27690 1876 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence642 221 2095 gene locus_tag LOCUS_27700 221 2095 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789151.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence643 1384 479 gene locus_tag LOCUS_27710 1384 479 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967757.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence644 142 576 gene locus_tag LOCUS_27720 142 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 557 2020 gene locus_tag LOCUS_27730 557 2020 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence645 427 134 gene locus_tag LOCUS_27740 427 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2208 430 gene locus_tag LOCUS_27750 gene dnaK 2208 430 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence646 1 246 gene locus_tag LOCUS_27760 1 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 425 1543 gene locus_tag LOCUS_27770 425 1543 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_27770 2457 1594 gene locus_tag LOCUS_27780 2457 1594 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence647 455 643 gene locus_tag LOCUS_27790 455 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 1171 1479 gene locus_tag LOCUS_27800 1171 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1469 1771 gene locus_tag LOCUS_27810 1469 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence648 2310 850 gene locus_tag LOCUS_27820 2310 850 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence649 <1 826 gene locus_tag LOCUS_27830 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444523.1:DNA gyrase subunit A 927 853 gene locus_tag LOCUS_t00330 927 853 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2359 953 gene locus_tag LOCUS_27840 2359 953 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence650 1391 264 gene locus_tag LOCUS_27850 1391 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2390 1602 gene locus_tag LOCUS_27860 2390 1602 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence651 >Feature sequence652 >Feature sequence653 604 311 gene locus_tag LOCUS_27870 604 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1726 608 gene locus_tag LOCUS_27880 1726 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 2047 2415 gene locus_tag LOCUS_27890 2047 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence654 >Feature sequence655 2211 778 gene locus_tag LOCUS_27900 2211 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence656 1115 348 gene locus_tag LOCUS_27910 1115 348 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_27910 1441 1241 gene locus_tag LOCUS_27920 1441 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2392 1628 gene locus_tag LOCUS_27930 2392 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence657 1198 1419 gene locus_tag LOCUS_27940 1198 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence658 1630 287 gene locus_tag LOCUS_27950 1630 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1734 1823 gene locus_tag LOCUS_t00340 1734 1823 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence659 1737 646 gene locus_tag LOCUS_27960 gene serC 1737 646 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_27960 1983 2073 gene locus_tag LOCUS_t00350 1983 2073 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence660 590 1366 gene locus_tag LOCUS_27970 590 1366 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_27970 1363 1977 gene locus_tag LOCUS_27980 1363 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence661 1188 400 gene locus_tag LOCUS_27990 1188 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 1817 1221 gene locus_tag LOCUS_28000 1817 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence662 <1 883 gene locus_tag LOCUS_28010 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391812.1:DUF72 domain-containing protein 1043 924 gene locus_tag LOCUS_28020 1043 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 <2391 1379 gene locus_tag LOCUS_28030 <2391 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083283.1:glycerol dehydrogenase >Feature sequence663 427 164 gene locus_tag LOCUS_28040 gene rpsS 427 164 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_28040 1347 520 gene locus_tag LOCUS_28050 gene rplB 1347 520 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_28050 1663 1364 gene locus_tag LOCUS_28060 gene rplW 1663 1364 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_28060 2286 1660 gene locus_tag LOCUS_28070 gene rplD 2286 1660 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_28070 >Feature sequence664 <1 1085 gene locus_tag LOCUS_28080 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932494.1:SO_0444 family Cu/Zn efflux transporter 1656 1072 gene locus_tag LOCUS_28090 1656 1072 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_28090 1837 1974 gene locus_tag LOCUS_28100 1837 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 2209 1931 gene locus_tag LOCUS_28110 gene rpsT 2209 1931 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence665 <1 1128 gene locus_tag LOCUS_28120 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404107.1:o-succinylbenzoate--CoA ligase >Feature sequence666 1064 156 gene locus_tag LOCUS_28130 1064 156 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence667 1570 227 gene locus_tag LOCUS_28140 1570 227 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence668 2205 754 gene locus_tag LOCUS_28150 2205 754 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence669 1485 1766 gene locus_tag LOCUS_28160 1485 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence670 197 682 gene locus_tag LOCUS_28170 197 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1091 2032 gene locus_tag LOCUS_28180 1091 2032 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939726.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence671 1411 65 gene locus_tag LOCUS_28190 1411 65 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence672 1049 219 gene locus_tag LOCUS_28200 1049 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1996 1049 gene locus_tag LOCUS_28210 1996 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence673 2065 389 gene locus_tag LOCUS_28220 2065 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence674 <1 1654 gene locus_tag LOCUS_28230 <1 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246149.1:ATP-dependent helicase MrfA >Feature sequence675 802 1578 gene locus_tag LOCUS_28240 gene cmk 802 1578 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence676 1156 545 gene locus_tag LOCUS_28250 1156 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2231 1665 gene locus_tag LOCUS_28260 2231 1665 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence677 2 613 gene locus_tag LOCUS_28270 2 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1798 629 gene locus_tag LOCUS_28280 gene vioA 1798 629 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998544.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence678 161 352 gene locus_tag LOCUS_28290 161 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 340 2058 gene locus_tag LOCUS_28300 340 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence679 798 574 gene locus_tag LOCUS_28310 798 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 1081 1950 gene locus_tag LOCUS_28320 1081 1950 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence680 1735 338 gene locus_tag LOCUS_28330 gene dnaA 1735 338 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence681 165 1019 gene locus_tag LOCUS_28340 165 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1864 1427 gene locus_tag LOCUS_28350 gene spo0F 1864 1427 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227621.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence682 1478 1819 gene locus_tag LOCUS_28360 1478 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1822 2004 gene locus_tag LOCUS_28370 1822 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 2136 2008 gene locus_tag LOCUS_28380 2136 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence683 1498 722 gene locus_tag LOCUS_28390 1498 722 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence684 >Feature sequence685 548 736 gene locus_tag LOCUS_28400 548 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 776 1042 gene locus_tag LOCUS_28410 776 1042 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence686 139 215 gene locus_tag LOCUS_t00360 139 215 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 462 1688 gene locus_tag LOCUS_28420 462 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2015 1782 gene locus_tag LOCUS_28430 2015 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence687 370 1581 gene locus_tag LOCUS_28440 370 1581 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104167.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence688 669 2030 gene locus_tag LOCUS_28450 gene hemG 669 2030 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence689 3 290 gene locus_tag LOCUS_28460 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 303 584 gene locus_tag LOCUS_28470 303 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 639 2150 gene locus_tag LOCUS_28480 639 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence690 >Feature sequence691 54 1148 gene locus_tag LOCUS_28490 54 1148 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_28490 1393 1317 gene locus_tag LOCUS_t00370 1393 1317 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence692 1422 295 gene locus_tag LOCUS_28500 gene dnaJ 1422 295 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_28500 <2211 1498 gene locus_tag LOCUS_28510 <2211 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940711.1:molecular chaperone DnaK >Feature sequence693 >Feature sequence694 <1 1105 gene locus_tag LOCUS_28520 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940767.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 1102 1539 gene locus_tag LOCUS_28530 1102 1539 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence695 267 130 gene locus_tag LOCUS_28540 267 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1055 624 gene locus_tag LOCUS_28550 1055 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence696 1902 1006 gene locus_tag LOCUS_28560 1902 1006 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence697 511 699 gene locus_tag LOCUS_28570 511 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence698 <1 1199 gene locus_tag LOCUS_28580 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057429.1:glycosyltransferase family 1 protein 1196 1723 gene locus_tag LOCUS_28590 1196 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence699 1103 81 gene locus_tag LOCUS_28600 1103 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 <2179 1371 gene locus_tag LOCUS_28610 <2179 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225518.1:family 78 glycoside hydrolase catalytic domain >Feature sequence700 >Feature sequence701 975 175 gene locus_tag LOCUS_28620 975 175 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence702 361 1128 gene locus_tag LOCUS_28630 361 1128 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence703 >Feature sequence704 1883 783 gene locus_tag LOCUS_28640 1883 783 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266713.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence705 >Feature sequence706 544 1533 gene locus_tag LOCUS_28650 544 1533 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence707 1251 316 gene locus_tag LOCUS_28660 1251 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence708 31 519 gene locus_tag LOCUS_28670 gene ispF 31 519 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393963.1 protein_id gnl|my_center|LOCUS_28670 1929 562 gene locus_tag LOCUS_28680 gene mgtE 1929 562 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922206.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence709 658 1236 gene locus_tag LOCUS_28690 658 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1495 1202 gene locus_tag LOCUS_28700 1495 1202 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_28700 1820 1482 gene locus_tag LOCUS_28710 1820 1482 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence710 1025 441 gene locus_tag LOCUS_28720 gene pth 1025 441 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281463.1 protein_id gnl|my_center|LOCUS_28720 1700 1053 gene locus_tag LOCUS_28730 1700 1053 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence711 >Feature sequence712 <1 1446 gene locus_tag LOCUS_28740 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272644.1:PEP/pyruvate-binding domain-containing protein 2115 1468 gene locus_tag LOCUS_28750 2115 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence713 <1 1534 gene locus_tag LOCUS_28760 <1 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase >Feature sequence714 1114 347 gene locus_tag LOCUS_28770 1114 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence715 >Feature sequence716 1664 945 gene locus_tag LOCUS_28780 1664 945 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence717 762 505 gene locus_tag LOCUS_28790 762 505 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_28790 1643 858 gene locus_tag LOCUS_28800 1643 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence718 1352 873 gene locus_tag LOCUS_28810 1352 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1651 1349 gene locus_tag LOCUS_28820 1651 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence719 1949 1572 gene locus_tag LOCUS_28830 1949 1572 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence720 196 1419 gene locus_tag LOCUS_28840 196 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence721 >Feature sequence722 131 1027 gene locus_tag LOCUS_28850 131 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1156 1959 gene locus_tag LOCUS_28860 1156 1959 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence723 930 1643 gene locus_tag LOCUS_28870 930 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence724 >Feature sequence725 408 863 gene locus_tag LOCUS_28880 408 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28880 860 1279 gene locus_tag LOCUS_28890 860 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28890 1261 1455 gene locus_tag LOCUS_28900 1261 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence726 >Feature sequence727 773 1162 gene locus_tag LOCUS_28910 773 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1159 1563 gene locus_tag LOCUS_28920 1159 1563 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence728 978 247 gene locus_tag LOCUS_28930 978 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 1822 1022 gene locus_tag LOCUS_28940 gene nagB 1822 1022 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence729 <2015 842 gene locus_tag LOCUS_28950 <2015 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118969.1:xylose isomerase >Feature sequence730 92 307 gene locus_tag LOCUS_28960 92 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 304 714 gene locus_tag LOCUS_28970 304 714 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence731 <1 645 gene locus_tag LOCUS_28980 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030935.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1546 1899 gene locus_tag LOCUS_28990 1546 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence732 >Feature sequence733 <1 952 gene locus_tag LOCUS_29000 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122228.1:glycogen debranching protein GlgX 1856 945 gene locus_tag LOCUS_29010 1856 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence734 >Feature sequence735 1766 744 gene locus_tag LOCUS_29020 gene pdhA 1766 744 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence736 <1 705 gene locus_tag LOCUS_29030 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582587.1:glycoside hydrolase family 31 protein 912 1523 gene locus_tag LOCUS_29040 912 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence737 204 1751 gene locus_tag LOCUS_29050 gene guaA 204 1751 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397349.1 protein_id gnl|my_center|LOCUS_29050 >Feature sequence738 >Feature sequence739 608 276 gene locus_tag LOCUS_29060 608 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence740 37 408 gene locus_tag LOCUS_29070 37 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 595 894 gene locus_tag LOCUS_29080 595 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29080 1034 1570 gene locus_tag LOCUS_29090 1034 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29090 >Feature sequence741 375 1199 gene locus_tag LOCUS_29100 gene menB 375 1199 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence742 2 475 gene locus_tag LOCUS_29110 2 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 566 1897 gene locus_tag LOCUS_29120 566 1897 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938906.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence743 >Feature sequence744 411 1838 gene locus_tag LOCUS_29130 411 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence745 851 1705 gene locus_tag LOCUS_29140 851 1705 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970670.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence746 >Feature sequence747 >Feature sequence748 <1 677 gene locus_tag LOCUS_29150 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_171602985.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence749 1736 858 gene locus_tag LOCUS_29160 1736 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence750 1276 806 gene locus_tag LOCUS_29170 gene nuoE 1276 806 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence751 111 782 gene locus_tag LOCUS_29180 gene nth 111 782 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_29180 779 1588 gene locus_tag LOCUS_29190 779 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence752 206 1570 gene locus_tag LOCUS_29200 206 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence753 >Feature sequence754 908 411 gene locus_tag LOCUS_29210 gene ruvX 908 411 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 protein_id gnl|my_center|LOCUS_29210 1712 954 gene locus_tag LOCUS_29220 1712 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 >Feature sequence755 >Feature sequence756 >Feature sequence757 110 1174 gene locus_tag LOCUS_29230 gene rlmN 110 1174 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_29230 1702 1277 gene locus_tag LOCUS_29240 1702 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence758 >Feature sequence759 >Feature sequence760 1256 183 gene locus_tag LOCUS_29250 1256 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence761 42 1367 gene locus_tag LOCUS_29260 42 1367 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225764.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence762 >Feature sequence763 1567 245 gene locus_tag LOCUS_29270 1567 245 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence764 >Feature sequence765 673 1692 gene locus_tag LOCUS_29280 673 1692 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096616.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence766 >Feature sequence767 1068 85 gene locus_tag LOCUS_29290 1068 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1722 1090 gene locus_tag LOCUS_29300 1722 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence768 <1 1272 gene locus_tag LOCUS_29310 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902969.1:sulfatase-like hydrolase/transferase >Feature sequence769 1640 63 gene locus_tag LOCUS_29320 1640 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence770 >Feature sequence771 <1679 367 gene locus_tag LOCUS_29330 <1679 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992445.1:penicillin-binding protein 1C >Feature sequence772 1517 228 gene locus_tag LOCUS_29340 1517 228 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence773 >Feature sequence774 604 74 gene locus_tag LOCUS_29350 604 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 <1630 604 gene locus_tag LOCUS_29360 <1630 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942697.1:TRAP transporter substrate-binding protein >Feature sequence775 >Feature sequence776 >Feature sequence777 36 758 gene locus_tag LOCUS_29370 36 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence778 >Feature sequence779 58 570 gene locus_tag LOCUS_29380 58 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence780 255 971 gene locus_tag LOCUS_29390 255 971 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813120.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence781 >Feature sequence782 >Feature sequence783 >Feature sequence784 >Feature sequence785 921 106 gene locus_tag LOCUS_29400 gene thiF 921 106 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence786 12 1094 gene locus_tag LOCUS_29410 12 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1213 1350 gene locus_tag LOCUS_29420 1213 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence787 >Feature sequence788 >Feature sequence789 <1456 681 gene locus_tag LOCUS_29430 <1456 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392112.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence790 >Feature sequence791 357 1103 gene locus_tag LOCUS_29440 357 1103 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence792 245 520 gene locus_tag LOCUS_29450 245 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence793 <1 826 gene locus_tag LOCUS_29460 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943931.1:DUF4139 domain-containing protein >Feature sequence794 <1 955 gene locus_tag LOCUS_29470 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546882.1:type IV pilus secretin PilQ >Feature sequence795 477 175 gene locus_tag LOCUS_29480 477 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence796 >Feature sequence797 3 209 gene locus_tag LOCUS_29490 3 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 849 730 gene locus_tag LOCUS_29500 849 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence798 >Feature sequence799 <1 699 gene locus_tag LOCUS_29510 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202917.1:DUF169 domain-containing protein >Feature sequence800 <1 744 gene locus_tag LOCUS_29520 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928482.1:beta-propeller fold lactonase family protein >Feature sequence801 >Feature sequence802 <1 910 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence803 >Feature sequence804 >Feature sequence805 >Feature sequence806 >Feature sequence807 >Feature sequence808 >Feature sequence809 328 191 gene locus_tag LOCUS_29530 328 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence810 <1 765 gene locus_tag LOCUS_29540 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946819.1:PDDEXK nuclease domain-containing protein >Feature sequence811 >Feature sequence812 >Feature sequence813 >Feature sequence814 >Feature sequence815 >Feature sequence816 >Feature sequence817 >Feature sequence818 >Feature sequence819 >Feature sequence820 >Feature sequence821 44 >726 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence822 >Feature sequence823 <724 94 gene locus_tag LOCUS_29550 <724 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051618804.1:N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA 255 264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence824 >Feature sequence825 >Feature sequence826 60 182 gene locus_tag LOCUS_29560 60 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence827 >Feature sequence828 >Feature sequence829 >Feature sequence830 >Feature sequence831 <1 559 gene locus_tag LOCUS_29570 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_220818393.1:IS630 family transposase >Feature sequence832 <700 139 gene locus_tag LOCUS_29580 <700 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944609.1:acyl-CoA dehydrogenase family protein >Feature sequence833 31 273 gene locus_tag LOCUS_29590 31 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 237 246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence834 >Feature sequence835 11 >681 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence836 >Feature sequence837 >Feature sequence838 >Feature sequence839 78 418 gene locus_tag LOCUS_tm00020 78 418 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence840 14 629 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgccgattttcatcggcggaaat >Feature sequence841 >Feature sequence842 >Feature sequence843 >Feature sequence844 >Feature sequence845 >Feature sequence846 <1 578 gene locus_tag LOCUS_29600 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence847 >Feature sequence848 >Feature sequence849 >Feature sequence850 >Feature sequence851 223 435 gene locus_tag LOCUS_29610 223 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence852 277 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence853 >Feature sequence854 347 177 gene locus_tag LOCUS_29620 347 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence855 >Feature sequence856 26 >633 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacccacgcgccccgcgcggggcgcgac >Feature sequence857 >Feature sequence858 114 >630 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatggggccgccgattttcatcggcggaaat >Feature sequence859 240 109 gene locus_tag LOCUS_29630 240 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence860 >Feature sequence861 >Feature sequence862 >Feature sequence863 >Feature sequence864 19 >618 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence865 258 479 gene locus_tag LOCUS_29640 258 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence866 423 347 gene locus_tag LOCUS_t00380 423 347 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence867 >Feature sequence868 >Feature sequence869 >Feature sequence870 26 575 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence871 >Feature sequence872 >Feature sequence873 >Feature sequence874 >Feature sequence875 98 598 gene locus_tag LOCUS_29650 98 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence876 >Feature sequence877 >Feature sequence878 >Feature sequence879 >Feature sequence880 >Feature sequence881 >Feature sequence882 >Feature sequence883 271 196 gene locus_tag LOCUS_t00390 271 196 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence884 >Feature sequence885 587 381 gene locus_tag LOCUS_29660 587 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence886 >Feature sequence887 369 166 gene locus_tag LOCUS_29670 369 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence888 >Feature sequence889 >Feature sequence890 327 403 gene locus_tag LOCUS_t00400 327 403 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence891 173 100 gene locus_tag LOCUS_t00410 173 100 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 460 164 gene locus_tag LOCUS_29680 460 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence892 42 >575 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence893 >Feature sequence894 >Feature sequence895 23 556 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence896 >Feature sequence897 >Feature sequence898 >Feature sequence899 >Feature sequence900 >Feature sequence901 <1 531 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence902 >Feature sequence903 >Feature sequence904 >Feature sequence905 >Feature sequence906 >Feature sequence907 >Feature sequence908 >Feature sequence909 >Feature sequence910 >Feature sequence911 >Feature sequence912 >Feature sequence913 >Feature sequence914 >Feature sequence915 >Feature sequence916 359 532 gene locus_tag LOCUS_29690 359 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence917 299 177 gene locus_tag LOCUS_29700 299 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence918 <1 489 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccgcgcggggcgcgtggattgaaac >Feature sequence919 >Feature sequence920 227 78 gene locus_tag LOCUS_29710 227 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence921 >Feature sequence922 >Feature sequence923 >Feature sequence924 >Feature sequence925 >Feature sequence926 >Feature sequence927 >Feature sequence928 >Feature sequence929 <1 486 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaacccacgcgccccgcgcggggcgcgac >Feature sequence930 281 357 gene locus_tag LOCUS_t00420 281 357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence931 >Feature sequence932 >Feature sequence933 >Feature sequence934 355 122 gene locus_tag LOCUS_29720 355 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence935 >Feature sequence936 >Feature sequence937 >Feature sequence938 >Feature sequence939 190 266 gene locus_tag LOCUS_t00430 190 266 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence940 >Feature sequence941 203 278 gene locus_tag LOCUS_t00440 203 278 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 293 368 gene locus_tag LOCUS_t00450 293 368 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence942 >Feature sequence943 >Feature sequence944 >Feature sequence945 >Feature sequence946 194 499 gene locus_tag LOCUS_29730 194 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence947 <1 392 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence948 29 503 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttccgccgatgaaaatcggcggccccattgaagc >Feature sequence949 >Feature sequence950 >Feature sequence951 >Feature sequence952 >Feature sequence953 >Feature sequence954 >Feature sequence955 >Feature sequence956 >Feature sequence957 >Feature sequence958 >Feature sequence959 >Feature sequence960 324 249 gene locus_tag LOCUS_t00460 324 249 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38