>Feature sequence001 <1 981 gene locus_tag LOCUS_00010 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203210.1:type I pullulanase 1222 1782 gene locus_tag LOCUS_00020 1222 1782 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_00020 1872 2870 gene locus_tag LOCUS_00030 1872 2870 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789284.1 protein_id gnl|my_center|LOCUS_00030 3125 6445 gene locus_tag LOCUS_00040 3125 6445 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203209.1 protein_id gnl|my_center|LOCUS_00040 6460 8325 gene locus_tag LOCUS_00050 6460 8325 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789279.1 protein_id gnl|my_center|LOCUS_00050 8558 9982 gene locus_tag LOCUS_00060 8558 9982 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203208.1 protein_id gnl|my_center|LOCUS_00060 9998 11512 gene locus_tag LOCUS_00070 9998 11512 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_00070 11654 13108 gene locus_tag LOCUS_00080 11654 13108 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_00080 15467 13248 gene locus_tag LOCUS_00090 15467 13248 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_00090 15747 16493 gene locus_tag LOCUS_00100 gene gpmA 15747 16493 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_00100 16607 17704 gene locus_tag LOCUS_00110 16607 17704 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203205.1 protein_id gnl|my_center|LOCUS_00110 20682 17758 gene locus_tag LOCUS_00120 20682 17758 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798848.1 protein_id gnl|my_center|LOCUS_00120 20859 22508 gene locus_tag LOCUS_00130 20859 22508 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_00130 24111 22645 gene locus_tag LOCUS_00140 24111 22645 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_00140 24523 26109 gene locus_tag LOCUS_00150 24523 26109 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_00150 26259 28469 gene locus_tag LOCUS_00160 26259 28469 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203203.1 protein_id gnl|my_center|LOCUS_00160 28547 31609 gene locus_tag LOCUS_00170 28547 31609 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993256.1 protein_id gnl|my_center|LOCUS_00170 31659 33476 gene locus_tag LOCUS_00180 31659 33476 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203202.1 protein_id gnl|my_center|LOCUS_00180 33542 34198 gene locus_tag LOCUS_00190 gene fsa 33542 34198 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789246.1 protein_id gnl|my_center|LOCUS_00190 34337 35506 gene locus_tag LOCUS_00200 34337 35506 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789244.1 protein_id gnl|my_center|LOCUS_00200 36366 35491 gene locus_tag LOCUS_00210 36366 35491 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_00210 38159 36693 gene locus_tag LOCUS_00220 38159 36693 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_00220 38321 38554 gene locus_tag LOCUS_00230 38321 38554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_00230 38591 39187 gene locus_tag LOCUS_00240 38591 39187 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_00240 39460 39203 gene locus_tag LOCUS_00250 39460 39203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 39511 40230 gene locus_tag LOCUS_00260 39511 40230 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_00260 40333 42276 gene locus_tag LOCUS_00270 40333 42276 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045899299.1 protein_id gnl|my_center|LOCUS_00270 42257 42697 gene locus_tag LOCUS_00280 42257 42697 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661089.1 protein_id gnl|my_center|LOCUS_00280 43110 42766 gene locus_tag LOCUS_00290 43110 42766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_00290 43409 43107 gene locus_tag LOCUS_00300 43409 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 43557 45401 gene locus_tag LOCUS_00310 43557 45401 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_00310 45568 46482 gene locus_tag LOCUS_00320 45568 46482 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789219.1 protein_id gnl|my_center|LOCUS_00320 46852 49590 gene locus_tag LOCUS_00330 46852 49590 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_00330 49617 50831 gene locus_tag LOCUS_00340 49617 50831 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789215.1 protein_id gnl|my_center|LOCUS_00340 50873 52420 gene locus_tag LOCUS_00350 50873 52420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555797.1 protein_id gnl|my_center|LOCUS_00350 52442 53026 gene locus_tag LOCUS_00360 52442 53026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789211.1 protein_id gnl|my_center|LOCUS_00360 53010 53585 gene locus_tag LOCUS_00370 53010 53585 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203194.1 protein_id gnl|my_center|LOCUS_00370 53613 54500 gene locus_tag LOCUS_00380 53613 54500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789207.1 protein_id gnl|my_center|LOCUS_00380 54526 55197 gene locus_tag LOCUS_00390 54526 55197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789206.1 protein_id gnl|my_center|LOCUS_00390 55231 56259 gene locus_tag LOCUS_00400 55231 56259 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203193.1 protein_id gnl|my_center|LOCUS_00400 56524 56450 gene locus_tag LOCUS_t00010 56524 56450 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57722 56604 gene locus_tag LOCUS_00410 57722 56604 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_00410 59366 57735 gene locus_tag LOCUS_00420 59366 57735 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203191.1 protein_id gnl|my_center|LOCUS_00420 60315 59434 gene locus_tag LOCUS_00430 gene folD 60315 59434 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_00430 61420 60335 gene locus_tag LOCUS_00440 61420 60335 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_00440 63144 61825 gene locus_tag LOCUS_00450 gene ffh 63144 61825 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_00450 64618 63296 gene locus_tag LOCUS_00460 64618 63296 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_00460 66648 64693 gene locus_tag LOCUS_00470 66648 64693 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203188.1 protein_id gnl|my_center|LOCUS_00470 68402 66645 gene locus_tag LOCUS_00480 68402 66645 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203187.1 protein_id gnl|my_center|LOCUS_00480 70690 68627 gene locus_tag LOCUS_00490 gene rho 70690 68627 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_00490 70965 71801 gene locus_tag LOCUS_00500 70965 71801 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_00500 72171 72491 gene locus_tag LOCUS_00510 72171 72491 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789182.1 protein_id gnl|my_center|LOCUS_00510 73440 72505 gene locus_tag LOCUS_00520 73440 72505 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_00520 74887 73442 gene locus_tag LOCUS_00530 74887 73442 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203184.1 protein_id gnl|my_center|LOCUS_00530 76007 74994 gene locus_tag LOCUS_00540 76007 74994 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789175.1 protein_id gnl|my_center|LOCUS_00540 77519 76509 gene locus_tag LOCUS_00550 77519 76509 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780364.1 protein_id gnl|my_center|LOCUS_00550 78241 77540 gene locus_tag LOCUS_00560 78241 77540 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_00560 78481 78885 gene locus_tag LOCUS_00570 78481 78885 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789172.1 protein_id gnl|my_center|LOCUS_00570 79424 79924 gene locus_tag LOCUS_00580 79424 79924 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_00580 80049 80807 gene locus_tag LOCUS_00590 80049 80807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 80839 81381 gene locus_tag LOCUS_00600 80839 81381 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_00600 81391 81843 gene locus_tag LOCUS_00610 gene smpB 81391 81843 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_00610 81863 84613 gene locus_tag LOCUS_00620 gene metH 81863 84613 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203181.1 protein_id gnl|my_center|LOCUS_00620 84628 85233 gene locus_tag LOCUS_00630 84628 85233 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203180.1 protein_id gnl|my_center|LOCUS_00630 85509 87062 gene locus_tag LOCUS_00640 85509 87062 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789151.1 protein_id gnl|my_center|LOCUS_00640 88510 87122 gene locus_tag LOCUS_00650 88510 87122 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_00650 89121 88507 gene locus_tag LOCUS_00660 gene udk 89121 88507 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_00660 89223 89522 gene locus_tag LOCUS_00670 89223 89522 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_00670 89623 91632 gene locus_tag LOCUS_00680 89623 91632 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_00680 92424 91717 gene locus_tag LOCUS_00690 92424 91717 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_00690 92546 93037 gene locus_tag LOCUS_00700 92546 93037 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798782.1 protein_id gnl|my_center|LOCUS_00700 93285 94136 gene locus_tag LOCUS_00710 gene hisG 93285 94136 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_00710 94172 95458 gene locus_tag LOCUS_00720 gene hisD 94172 95458 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_00720 95455 96492 gene locus_tag LOCUS_00730 gene hisC 95455 96492 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_00730 96498 97622 gene locus_tag LOCUS_00740 gene hisB 96498 97622 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789124.1 protein_id gnl|my_center|LOCUS_00740 98765 97761 gene locus_tag LOCUS_00750 98765 97761 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203177.1 protein_id gnl|my_center|LOCUS_00750 100270 98798 gene locus_tag LOCUS_00760 100270 98798 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_00760 103423 100301 gene locus_tag LOCUS_00770 103423 100301 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_00770 104098 103562 gene locus_tag LOCUS_00780 104098 103562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802922.1 protein_id gnl|my_center|LOCUS_00780 106093 104168 gene locus_tag LOCUS_00790 106093 104168 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_00790 106219 108315 gene locus_tag LOCUS_00800 106219 108315 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_00800 108497 108844 gene locus_tag LOCUS_00810 108497 108844 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_00810 109014 109433 gene locus_tag LOCUS_00820 109014 109433 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_00820 109455 110012 gene locus_tag LOCUS_00830 109455 110012 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_00830 110150 110785 gene locus_tag LOCUS_00840 110150 110785 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798768.1 protein_id gnl|my_center|LOCUS_00840 111633 111166 gene locus_tag LOCUS_00850 111633 111166 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789107.1 protein_id gnl|my_center|LOCUS_00850 112062 111643 gene locus_tag LOCUS_00860 112062 111643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 112114 112920 gene locus_tag LOCUS_00870 112114 112920 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_00870 112917 114041 gene locus_tag LOCUS_00880 112917 114041 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_00880 114038 114220 gene locus_tag LOCUS_00890 114038 114220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 116495 114327 gene locus_tag LOCUS_00900 116495 114327 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_00900 118660 116495 gene locus_tag LOCUS_00910 118660 116495 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_00910 119937 118702 gene locus_tag LOCUS_00920 119937 118702 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_00920 120176 120904 gene locus_tag LOCUS_00930 120176 120904 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_00930 121035 122708 gene locus_tag LOCUS_00940 121035 122708 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769667.1 protein_id gnl|my_center|LOCUS_00940 122874 123260 gene locus_tag LOCUS_00950 122874 123260 CDS product DUF3244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769668.1 protein_id gnl|my_center|LOCUS_00950 124804 123746 gene locus_tag LOCUS_00960 124804 123746 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769669.1 protein_id gnl|my_center|LOCUS_00960 125093 125302 gene locus_tag LOCUS_00970 125093 125302 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661023.1 protein_id gnl|my_center|LOCUS_00970 125386 126372 gene locus_tag LOCUS_00980 125386 126372 CDS product TolB-like 6-bladed beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789047.1 protein_id gnl|my_center|LOCUS_00980 126602 126871 gene locus_tag LOCUS_00990 126602 126871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 127067 128086 gene locus_tag LOCUS_01000 127067 128086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 128083 128463 gene locus_tag LOCUS_01010 128083 128463 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_01010 128466 129341 gene locus_tag LOCUS_01020 128466 129341 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203167.1 protein_id gnl|my_center|LOCUS_01020 129488 131449 gene locus_tag LOCUS_01030 129488 131449 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798745.1 protein_id gnl|my_center|LOCUS_01030 131614 133584 gene locus_tag LOCUS_01040 131614 133584 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555800.1 protein_id gnl|my_center|LOCUS_01040 134020 134697 gene locus_tag LOCUS_01050 134020 134697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 134778 135260 gene locus_tag LOCUS_01060 134778 135260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203164.1 protein_id gnl|my_center|LOCUS_01060 135369 136397 gene locus_tag LOCUS_01070 135369 136397 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661005.1 protein_id gnl|my_center|LOCUS_01070 136425 137315 gene locus_tag LOCUS_01080 gene lepB 136425 137315 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789018.1 protein_id gnl|my_center|LOCUS_01080 137312 139003 gene locus_tag LOCUS_01090 137312 139003 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555802.1 protein_id gnl|my_center|LOCUS_01090 139402 140472 gene locus_tag LOCUS_01100 139402 140472 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_01100 140499 143576 gene locus_tag LOCUS_01110 140499 143576 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_01110 143579 145072 gene locus_tag LOCUS_01120 143579 145072 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_01120 145093 148296 gene locus_tag LOCUS_01130 145093 148296 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_01130 149274 148426 gene locus_tag LOCUS_01140 149274 148426 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789007.1 protein_id gnl|my_center|LOCUS_01140 149273 150505 gene locus_tag LOCUS_01150 149273 150505 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203161.1 protein_id gnl|my_center|LOCUS_01150 150674 153637 gene locus_tag LOCUS_01160 150674 153637 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203160.1 protein_id gnl|my_center|LOCUS_01160 156016 154250 gene locus_tag LOCUS_01170 156016 154250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_01170 157743 156019 gene locus_tag LOCUS_01180 157743 156019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798723.1 protein_id gnl|my_center|LOCUS_01180 158771 157740 gene locus_tag LOCUS_01190 158771 157740 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_01190 158837 159004 gene locus_tag LOCUS_01200 158837 159004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 159602 159018 gene locus_tag LOCUS_01210 159602 159018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788993.1 protein_id gnl|my_center|LOCUS_01210 160118 159606 gene locus_tag LOCUS_01220 160118 159606 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_01220 160407 160889 gene locus_tag LOCUS_01230 160407 160889 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788988.1 protein_id gnl|my_center|LOCUS_01230 161676 162812 gene locus_tag LOCUS_01240 161676 162812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660988.1 protein_id gnl|my_center|LOCUS_01240 162891 163706 gene locus_tag LOCUS_01250 162891 163706 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788978.1 protein_id gnl|my_center|LOCUS_01250 163755 164642 gene locus_tag LOCUS_01260 163755 164642 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788975.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence002 <1 556 gene locus_tag LOCUS_01270 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203733.1:DNA-binding domain-containing protein 3482 726 gene locus_tag LOCUS_01280 3482 726 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203735.1 protein_id gnl|my_center|LOCUS_01280 5292 3646 gene locus_tag LOCUS_01290 5292 3646 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_01290 5570 8284 gene locus_tag LOCUS_01300 5570 8284 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_01300 8473 9405 gene locus_tag LOCUS_01310 8473 9405 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_01310 11285 9477 gene locus_tag LOCUS_01320 11285 9477 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203738.1 protein_id gnl|my_center|LOCUS_01320 11412 12368 gene locus_tag LOCUS_01330 11412 12368 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_01330 12457 13593 gene locus_tag LOCUS_01340 12457 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_01340 13599 15470 gene locus_tag LOCUS_01350 13599 15470 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_01350 15473 15925 gene locus_tag LOCUS_01360 gene coaD 15473 15925 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783477.1 protein_id gnl|my_center|LOCUS_01360 15941 17563 gene locus_tag LOCUS_01370 15941 17563 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_01370 18270 17647 gene locus_tag LOCUS_01380 18270 17647 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_01380 18386 19261 gene locus_tag LOCUS_01390 18386 19261 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783483.1 protein_id gnl|my_center|LOCUS_01390 19948 20640 gene locus_tag LOCUS_01400 19948 20640 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_01400 20678 22621 gene locus_tag LOCUS_01410 20678 22621 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_01410 22651 23406 gene locus_tag LOCUS_01420 22651 23406 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_01420 24521 23487 gene locus_tag LOCUS_01430 24521 23487 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_01430 25844 24624 gene locus_tag LOCUS_01440 25844 24624 CDS product DUF4374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783495.1 protein_id gnl|my_center|LOCUS_01440 28205 25854 gene locus_tag LOCUS_01450 28205 25854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_01450 29223 28405 gene locus_tag LOCUS_01460 29223 28405 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797165.1 protein_id gnl|my_center|LOCUS_01460 30394 29381 gene locus_tag LOCUS_01470 30394 29381 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_01470 31387 30446 gene locus_tag LOCUS_01480 31387 30446 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769080.1 protein_id gnl|my_center|LOCUS_01480 32365 31394 gene locus_tag LOCUS_01490 32365 31394 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203744.1 protein_id gnl|my_center|LOCUS_01490 34086 32965 gene locus_tag LOCUS_01500 gene dprA 34086 32965 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_01500 34487 34083 gene locus_tag LOCUS_01510 34487 34083 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_01510 35757 34489 gene locus_tag LOCUS_01520 35757 34489 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_01520 36250 35792 gene locus_tag LOCUS_01530 36250 35792 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783513.1 protein_id gnl|my_center|LOCUS_01530 36345 37319 gene locus_tag LOCUS_01540 gene dusB 36345 37319 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_01540 38435 37470 gene locus_tag LOCUS_01550 38435 37470 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_01550 39433 38426 gene locus_tag LOCUS_01560 39433 38426 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_01560 40354 39455 gene locus_tag LOCUS_01570 40354 39455 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_01570 40458 42602 gene locus_tag LOCUS_01580 gene rnr 40458 42602 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_01580 43303 43788 gene locus_tag LOCUS_01590 43303 43788 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783529.1 protein_id gnl|my_center|LOCUS_01590 43794 44402 gene locus_tag LOCUS_01600 43794 44402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783531.1 protein_id gnl|my_center|LOCUS_01600 44571 45044 gene locus_tag LOCUS_01610 44571 45044 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783533.1 protein_id gnl|my_center|LOCUS_01610 46089 45142 gene locus_tag LOCUS_01620 gene cysK 46089 45142 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_01620 47049 46237 gene locus_tag LOCUS_01630 47049 46237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783535.1 protein_id gnl|my_center|LOCUS_01630 47222 48607 gene locus_tag LOCUS_01640 47222 48607 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203748.1 protein_id gnl|my_center|LOCUS_01640 48828 49931 gene locus_tag LOCUS_01650 gene ychF 48828 49931 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_01650 50227 51156 gene locus_tag LOCUS_01660 50227 51156 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_01660 51167 52000 gene locus_tag LOCUS_01670 gene lgt 51167 52000 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_01670 51997 52638 gene locus_tag LOCUS_01680 51997 52638 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291289.1 protein_id gnl|my_center|LOCUS_01680 55254 52639 gene locus_tag LOCUS_01690 gene mutS 55254 52639 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_01690 56039 57064 gene locus_tag LOCUS_01700 56039 57064 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203752.1 protein_id gnl|my_center|LOCUS_01700 57380 60211 gene locus_tag LOCUS_01710 gene leuS 57380 60211 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_01710 60226 61125 gene locus_tag LOCUS_01720 60226 61125 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_01720 61136 61720 gene locus_tag LOCUS_01730 61136 61720 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_01730 63303 62311 gene locus_tag LOCUS_01740 gene nadA 63303 62311 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_01740 63664 64287 gene locus_tag LOCUS_01750 63664 64287 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_01750 64517 65212 gene locus_tag LOCUS_01760 64517 65212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01760 65312 65908 gene locus_tag LOCUS_01770 65312 65908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 65901 66872 gene locus_tag LOCUS_01780 65901 66872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201834.1 protein_id gnl|my_center|LOCUS_01780 66886 67725 gene locus_tag LOCUS_01790 66886 67725 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797121.1 protein_id gnl|my_center|LOCUS_01790 67759 68223 gene locus_tag LOCUS_01800 67759 68223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797120.1 protein_id gnl|my_center|LOCUS_01800 68255 70066 gene locus_tag LOCUS_01810 68255 70066 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797119.1 protein_id gnl|my_center|LOCUS_01810 70833 70621 gene locus_tag LOCUS_01820 70833 70621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 70984 71880 gene locus_tag LOCUS_01830 70984 71880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 71999 72547 gene locus_tag LOCUS_01840 71999 72547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 72684 74450 gene locus_tag LOCUS_01850 72684 74450 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797115.1 protein_id gnl|my_center|LOCUS_01850 74447 75565 gene locus_tag LOCUS_01860 74447 75565 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797113.1 protein_id gnl|my_center|LOCUS_01860 75546 76214 gene locus_tag LOCUS_01870 75546 76214 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797111.1 protein_id gnl|my_center|LOCUS_01870 76211 77569 gene locus_tag LOCUS_01880 76211 77569 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797109.1 protein_id gnl|my_center|LOCUS_01880 77574 79757 gene locus_tag LOCUS_01890 77574 79757 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201835.1 protein_id gnl|my_center|LOCUS_01890 80479 79874 gene locus_tag LOCUS_01900 80479 79874 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_01900 80638 82620 gene locus_tag LOCUS_01910 80638 82620 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_01910 82678 83451 gene locus_tag LOCUS_01920 82678 83451 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_01920 83448 84002 gene locus_tag LOCUS_01930 83448 84002 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797099.1 protein_id gnl|my_center|LOCUS_01930 84020 85633 gene locus_tag LOCUS_01940 84020 85633 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797097.1 protein_id gnl|my_center|LOCUS_01940 86363 85737 gene locus_tag LOCUS_01950 86363 85737 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797095.1 protein_id gnl|my_center|LOCUS_01950 88778 86364 gene locus_tag LOCUS_01960 88778 86364 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_01960 90658 88979 gene locus_tag LOCUS_01970 gene sulP 90658 88979 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_01970 90919 91497 gene locus_tag LOCUS_01980 90919 91497 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_01980 93152 91581 gene locus_tag LOCUS_01990 gene nadB 93152 91581 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_01990 93260 93658 gene locus_tag LOCUS_02000 93260 93658 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783575.1 protein_id gnl|my_center|LOCUS_02000 93665 95008 gene locus_tag LOCUS_02010 gene lpdA 93665 95008 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_02010 95112 96521 gene locus_tag LOCUS_02020 gene dacB 95112 96521 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_02020 98096 96597 gene locus_tag LOCUS_02030 98096 96597 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_02030 98462 98133 gene locus_tag LOCUS_02040 98462 98133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783583.1 protein_id gnl|my_center|LOCUS_02040 98793 100166 gene locus_tag LOCUS_02050 gene miaB 98793 100166 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_02050 100284 101702 gene locus_tag LOCUS_02060 100284 101702 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797085.1 protein_id gnl|my_center|LOCUS_02060 101758 103872 gene locus_tag LOCUS_02070 101758 103872 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_02070 105059 104265 gene locus_tag LOCUS_02080 105059 104265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 107051 108184 gene locus_tag LOCUS_02090 107051 108184 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792258.1 protein_id gnl|my_center|LOCUS_02090 108289 108507 gene locus_tag LOCUS_02100 108289 108507 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797079.1 protein_id gnl|my_center|LOCUS_02100 108647 109714 gene locus_tag LOCUS_02110 108647 109714 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797078.1 protein_id gnl|my_center|LOCUS_02110 110199 110426 gene locus_tag LOCUS_02120 110199 110426 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181747836.1 protein_id gnl|my_center|LOCUS_02120 110892 112010 gene locus_tag LOCUS_02130 110892 112010 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201847.1 protein_id gnl|my_center|LOCUS_02130 112265 112876 gene locus_tag LOCUS_02140 112265 112876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 112921 113163 gene locus_tag LOCUS_02150 112921 113163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 113315 114286 gene locus_tag LOCUS_02160 113315 114286 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991872.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence003 248 69 gene locus_tag LOCUS_02170 248 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 223 624 gene locus_tag LOCUS_02180 223 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02180 1642 737 gene locus_tag LOCUS_02190 1642 737 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_02190 1855 4074 gene locus_tag LOCUS_02200 1855 4074 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_02200 4078 4650 gene locus_tag LOCUS_02210 gene pnuC 4078 4650 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_02210 4637 5260 gene locus_tag LOCUS_02220 4637 5260 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202076.1 protein_id gnl|my_center|LOCUS_02220 6164 5214 gene locus_tag LOCUS_02230 6164 5214 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769354.1 protein_id gnl|my_center|LOCUS_02230 7934 6576 gene locus_tag LOCUS_02240 gene thrC 7934 6576 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_02240 9235 8024 gene locus_tag LOCUS_02250 9235 8024 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202073.1 protein_id gnl|my_center|LOCUS_02250 11682 9247 gene locus_tag LOCUS_02260 gene thrA 11682 9247 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_02260 12230 13225 gene locus_tag LOCUS_02270 12230 13225 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_02270 13883 15250 gene locus_tag LOCUS_02280 gene radA 13883 15250 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_02280 15306 15677 gene locus_tag LOCUS_02290 15306 15677 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_02290 15722 17311 gene locus_tag LOCUS_02300 15722 17311 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_02300 17316 17915 gene locus_tag LOCUS_02310 17316 17915 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202071.1 protein_id gnl|my_center|LOCUS_02310 18026 20413 gene locus_tag LOCUS_02320 18026 20413 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_02320 21541 20567 gene locus_tag LOCUS_02330 21541 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784529.1 protein_id gnl|my_center|LOCUS_02330 23364 21538 gene locus_tag LOCUS_02340 23364 21538 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_02340 24278 23361 gene locus_tag LOCUS_02350 gene metA 24278 23361 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_02350 24438 24608 gene locus_tag LOCUS_02360 24438 24608 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_02360 27390 24691 gene locus_tag LOCUS_02370 27390 24691 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_02370 28749 27556 gene locus_tag LOCUS_02380 28749 27556 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_02380 30046 28832 gene locus_tag LOCUS_02390 30046 28832 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_02390 31871 30051 gene locus_tag LOCUS_02400 31871 30051 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_02400 32436 32038 gene locus_tag LOCUS_02410 32436 32038 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_02410 32648 32722 gene locus_tag LOCUS_t00020 32648 32722 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 34230 33253 gene locus_tag LOCUS_02420 34230 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 35888 34227 gene locus_tag LOCUS_02430 35888 34227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 36249 35875 gene locus_tag LOCUS_02440 36249 35875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 36349 37059 gene locus_tag LOCUS_02450 36349 37059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 37973 37314 gene locus_tag LOCUS_02460 37973 37314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 39324 38056 gene locus_tag LOCUS_02470 39324 38056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 40213 39674 gene locus_tag LOCUS_02480 40213 39674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 41622 40402 gene locus_tag LOCUS_02490 41622 40402 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107591.1 protein_id gnl|my_center|LOCUS_02490 41935 44013 gene locus_tag LOCUS_02500 41935 44013 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_02500 44021 44692 gene locus_tag LOCUS_02510 44021 44692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 45465 46121 gene locus_tag LOCUS_02520 45465 46121 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992090.1 protein_id gnl|my_center|LOCUS_02520 47798 47076 gene locus_tag LOCUS_02530 47798 47076 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_02530 50885 47937 gene locus_tag LOCUS_02540 50885 47937 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202067.1 protein_id gnl|my_center|LOCUS_02540 53451 51058 gene locus_tag LOCUS_02550 53451 51058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202066.1 protein_id gnl|my_center|LOCUS_02550 55062 53575 gene locus_tag LOCUS_02560 55062 53575 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_02560 58451 55086 gene locus_tag LOCUS_02570 58451 55086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_02570 59628 58618 gene locus_tag LOCUS_02580 59628 58618 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202064.1 protein_id gnl|my_center|LOCUS_02580 60245 59682 gene locus_tag LOCUS_02590 60245 59682 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_02590 61841 60402 gene locus_tag LOCUS_02600 61841 60402 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202063.1 protein_id gnl|my_center|LOCUS_02600 62997 61870 gene locus_tag LOCUS_02610 62997 61870 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_02610 63842 63093 gene locus_tag LOCUS_02620 63842 63093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784491.1 protein_id gnl|my_center|LOCUS_02620 64427 63852 gene locus_tag LOCUS_02630 64427 63852 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784490.1 protein_id gnl|my_center|LOCUS_02630 66487 64439 gene locus_tag LOCUS_02640 gene kdpB 66487 64439 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784488.1 protein_id gnl|my_center|LOCUS_02640 68215 66509 gene locus_tag LOCUS_02650 gene kdpA 68215 66509 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658368.1 protein_id gnl|my_center|LOCUS_02650 70010 68667 gene locus_tag LOCUS_02660 70010 68667 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_02660 70315 71679 gene locus_tag LOCUS_02670 70315 71679 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202062.1 protein_id gnl|my_center|LOCUS_02670 71931 71788 gene locus_tag LOCUS_02680 71931 71788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 71998 74478 gene locus_tag LOCUS_02690 71998 74478 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_02690 74488 74838 gene locus_tag LOCUS_02700 74488 74838 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_02700 76364 74997 gene locus_tag LOCUS_02710 76364 74997 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784474.1 protein_id gnl|my_center|LOCUS_02710 76473 77105 gene locus_tag LOCUS_02720 76473 77105 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_02720 77123 77749 gene locus_tag LOCUS_02730 77123 77749 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784469.1 protein_id gnl|my_center|LOCUS_02730 79342 77873 gene locus_tag LOCUS_02740 79342 77873 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769340.1 protein_id gnl|my_center|LOCUS_02740 81498 79528 gene locus_tag LOCUS_02750 81498 79528 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784466.1 protein_id gnl|my_center|LOCUS_02750 84705 81514 gene locus_tag LOCUS_02760 84705 81514 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_02760 88330 85322 gene locus_tag LOCUS_02770 88330 85322 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_02770 91395 88405 gene locus_tag LOCUS_02780 91395 88405 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202059.1 protein_id gnl|my_center|LOCUS_02780 92335 91463 gene locus_tag LOCUS_02790 92335 91463 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_02790 93163 92375 gene locus_tag LOCUS_02800 93163 92375 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_02800 93320 93673 gene locus_tag LOCUS_02810 gene rplS 93320 93673 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_02810 95408 94428 gene locus_tag LOCUS_02820 95408 94428 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_02820 95587 96303 gene locus_tag LOCUS_02830 95587 96303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_02830 96318 97577 gene locus_tag LOCUS_02840 96318 97577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_02840 97580 98824 gene locus_tag LOCUS_02850 97580 98824 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_02850 98933 100033 gene locus_tag LOCUS_02860 98933 100033 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_02860 100073 101404 gene locus_tag LOCUS_02870 100073 101404 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_02870 101644 102405 gene locus_tag LOCUS_02880 101644 102405 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796465.1 protein_id gnl|my_center|LOCUS_02880 102499 103428 gene locus_tag LOCUS_02890 102499 103428 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence004 1811 1452 gene locus_tag LOCUS_02900 1811 1452 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791209.1 protein_id gnl|my_center|LOCUS_02900 2058 1873 gene locus_tag LOCUS_02910 2058 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2464 2168 gene locus_tag LOCUS_02920 2464 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 3354 2461 gene locus_tag LOCUS_02930 3354 2461 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797426.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02930 4664 3522 gene locus_tag LOCUS_02940 4664 3522 CDS product DUF4221 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803933.1 protein_id gnl|my_center|LOCUS_02940 7129 5558 gene locus_tag LOCUS_02950 7129 5558 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797424.1 protein_id gnl|my_center|LOCUS_02950 7413 7937 gene locus_tag LOCUS_02960 7413 7937 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_02960 7977 10985 gene locus_tag LOCUS_02970 7977 10985 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_02970 10992 12695 gene locus_tag LOCUS_02980 10992 12695 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_02980 12974 15319 gene locus_tag LOCUS_02990 gene topA 12974 15319 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_02990 15491 16474 gene locus_tag LOCUS_03000 15491 16474 CDS product DUF4842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791190.1 protein_id gnl|my_center|LOCUS_03000 18453 16660 gene locus_tag LOCUS_03010 gene argS 18453 16660 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_03010 18813 18541 gene locus_tag LOCUS_03020 18813 18541 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_03020 19061 19735 gene locus_tag LOCUS_03030 19061 19735 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_03030 19716 20615 gene locus_tag LOCUS_03040 19716 20615 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_03040 20619 21716 gene locus_tag LOCUS_03050 20619 21716 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_03050 22528 25551 gene locus_tag LOCUS_03060 gene secDF 22528 25551 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_03060 26142 25852 gene locus_tag LOCUS_03070 26142 25852 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791180.1 protein_id gnl|my_center|LOCUS_03070 30598 26183 gene locus_tag LOCUS_03080 30598 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770098.1 protein_id gnl|my_center|LOCUS_03080 33904 30743 gene locus_tag LOCUS_03090 33904 30743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770097.1 protein_id gnl|my_center|LOCUS_03090 35159 34176 gene locus_tag LOCUS_03100 35159 34176 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203694.1 protein_id gnl|my_center|LOCUS_03100 36303 35242 gene locus_tag LOCUS_03110 36303 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203695.1 protein_id gnl|my_center|LOCUS_03110 38044 36383 gene locus_tag LOCUS_03120 38044 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770094.1 protein_id gnl|my_center|LOCUS_03120 38692 38132 gene locus_tag LOCUS_03130 38692 38132 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791170.1 protein_id gnl|my_center|LOCUS_03130 39075 39962 gene locus_tag LOCUS_03140 39075 39962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791978.1 protein_id gnl|my_center|LOCUS_03140 41450 40209 gene locus_tag LOCUS_03150 41450 40209 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791977.1 protein_id gnl|my_center|LOCUS_03150 41907 41835 gene locus_tag LOCUS_t00030 41907 41835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42414 44264 gene locus_tag LOCUS_03160 42414 44264 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_03160 44268 45278 gene locus_tag LOCUS_03170 44268 45278 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_03170 47016 45517 gene locus_tag LOCUS_03180 47016 45517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203699.1 protein_id gnl|my_center|LOCUS_03180 48324 47563 gene locus_tag LOCUS_03190 48324 47563 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803918.1 protein_id gnl|my_center|LOCUS_03190 49211 48558 gene locus_tag LOCUS_03200 gene upp 49211 48558 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_03200 49476 51083 gene locus_tag LOCUS_03210 gene pckA 49476 51083 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_03210 52365 55562 gene locus_tag LOCUS_03220 52365 55562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791958.1 protein_id gnl|my_center|LOCUS_03220 55577 57604 gene locus_tag LOCUS_03230 55577 57604 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791957.1 protein_id gnl|my_center|LOCUS_03230 59634 57835 gene locus_tag LOCUS_03240 gene typA 59634 57835 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_03240 59790 60059 gene locus_tag LOCUS_03250 gene rpsO 59790 60059 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_03250 60218 60793 gene locus_tag LOCUS_03260 60218 60793 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781772.1 protein_id gnl|my_center|LOCUS_03260 60803 62479 gene locus_tag LOCUS_03270 60803 62479 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203709.1 protein_id gnl|my_center|LOCUS_03270 64103 62535 gene locus_tag LOCUS_03280 64103 62535 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791952.1 protein_id gnl|my_center|LOCUS_03280 64245 65708 gene locus_tag LOCUS_03290 gene ahcY 64245 65708 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_03290 65830 68328 gene locus_tag LOCUS_03300 65830 68328 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_03300 70799 69258 gene locus_tag LOCUS_03310 70799 69258 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_03310 72905 70956 gene locus_tag LOCUS_03320 72905 70956 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791949.1 protein_id gnl|my_center|LOCUS_03320 76448 72927 gene locus_tag LOCUS_03330 76448 72927 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803890.1 protein_id gnl|my_center|LOCUS_03330 77447 76488 gene locus_tag LOCUS_03340 77447 76488 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293097.1 protein_id gnl|my_center|LOCUS_03340 77598 78149 gene locus_tag LOCUS_03350 77598 78149 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 protein_id gnl|my_center|LOCUS_03350 79631 78393 gene locus_tag LOCUS_03360 79631 78393 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_03360 79960 79628 gene locus_tag LOCUS_03370 gene rbfA 79960 79628 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_03370 80919 80281 gene locus_tag LOCUS_03380 80919 80281 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_03380 82385 80928 gene locus_tag LOCUS_03390 gene pyk 82385 80928 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_03390 82832 82413 gene locus_tag LOCUS_03400 gene aroQ 82832 82413 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_03400 82906 83859 gene locus_tag LOCUS_03410 gene xerD 82906 83859 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_03410 84139 85761 gene locus_tag LOCUS_03420 84139 85761 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_03420 85948 86943 gene locus_tag LOCUS_03430 85948 86943 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791938.1 protein_id gnl|my_center|LOCUS_03430 87061 88515 gene locus_tag LOCUS_03440 87061 88515 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_03440 88931 90217 gene locus_tag LOCUS_03450 88931 90217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203714.1 protein_id gnl|my_center|LOCUS_03450 90403 91590 gene locus_tag LOCUS_03460 90403 91590 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791935.1 protein_id gnl|my_center|LOCUS_03460 93739 91706 gene locus_tag LOCUS_03470 93739 91706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791934.1 protein_id gnl|my_center|LOCUS_03470 94632 93892 gene locus_tag LOCUS_03480 94632 93892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03480 97881 94663 gene locus_tag LOCUS_03490 97881 94663 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03490 99068 97983 gene locus_tag LOCUS_03500 99068 97983 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_03500 99486 99058 gene locus_tag LOCUS_03510 99486 99058 CDS product radical SAM-associated putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797215.1 protein_id gnl|my_center|LOCUS_03510 101715 99646 gene locus_tag LOCUS_03520 101715 99646 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_03520 103218 101896 gene locus_tag LOCUS_03530 103218 101896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293105.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence005 388 975 gene locus_tag LOCUS_03540 388 975 CDS product N-acetylmuramidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203507.1 protein_id gnl|my_center|LOCUS_03540 1793 3340 gene locus_tag LOCUS_03550 1793 3340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_03550 4412 3411 gene locus_tag LOCUS_03560 4412 3411 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_03560 4592 6760 gene locus_tag LOCUS_03570 4592 6760 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_03570 7140 10277 gene locus_tag LOCUS_03580 7140 10277 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_03580 10303 11970 gene locus_tag LOCUS_03590 10303 11970 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992183.1 protein_id gnl|my_center|LOCUS_03590 11964 13112 gene locus_tag LOCUS_03600 11964 13112 CDS product glycan-binding surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796119.1 protein_id gnl|my_center|LOCUS_03600 13240 15027 gene locus_tag LOCUS_03610 13240 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784998.1 protein_id gnl|my_center|LOCUS_03610 15024 18239 gene locus_tag LOCUS_03620 15024 18239 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202165.1 protein_id gnl|my_center|LOCUS_03620 18329 19354 gene locus_tag LOCUS_03630 18329 19354 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_03630 19472 20779 gene locus_tag LOCUS_03640 19472 20779 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_03640 20776 23220 gene locus_tag LOCUS_03650 20776 23220 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_03650 23226 24479 gene locus_tag LOCUS_03660 23226 24479 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_03660 24660 25310 gene locus_tag LOCUS_03670 24660 25310 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814379.1 protein_id gnl|my_center|LOCUS_03670 25313 26017 gene locus_tag LOCUS_03680 25313 26017 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813226.1 protein_id gnl|my_center|LOCUS_03680 26024 27028 gene locus_tag LOCUS_03690 26024 27028 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658670.1 protein_id gnl|my_center|LOCUS_03690 27120 28244 gene locus_tag LOCUS_03700 27120 28244 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_03700 28281 29453 gene locus_tag LOCUS_03710 28281 29453 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_03710 29470 30858 gene locus_tag LOCUS_03720 29470 30858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_03720 30871 32049 gene locus_tag LOCUS_03730 30871 32049 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_03730 32119 33882 gene locus_tag LOCUS_03740 32119 33882 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_03740 33866 35344 gene locus_tag LOCUS_03750 33866 35344 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_03750 35348 36478 gene locus_tag LOCUS_03760 35348 36478 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202174.1 protein_id gnl|my_center|LOCUS_03760 38231 37083 gene locus_tag LOCUS_03770 38231 37083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769478.1 protein_id gnl|my_center|LOCUS_03770 39578 38304 gene locus_tag LOCUS_03780 39578 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_03780 42346 39647 gene locus_tag LOCUS_03790 42346 39647 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_03790 42584 45373 gene locus_tag LOCUS_03800 42584 45373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202178.1 protein_id gnl|my_center|LOCUS_03800 46925 45474 gene locus_tag LOCUS_03810 46925 45474 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_03810 48416 46932 gene locus_tag LOCUS_03820 48416 46932 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785038.1 protein_id gnl|my_center|LOCUS_03820 50339 48429 gene locus_tag LOCUS_03830 gene nuoL 50339 48429 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_03830 50687 50376 gene locus_tag LOCUS_03840 gene nuoK 50687 50376 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_03840 51206 50694 gene locus_tag LOCUS_03850 51206 50694 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_03850 51692 51213 gene locus_tag LOCUS_03860 51692 51213 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_03860 52542 51709 gene locus_tag LOCUS_03870 gene nuoH 52542 51709 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_03870 52510 52743 gene locus_tag LOCUS_03880 52510 52743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 54457 52865 gene locus_tag LOCUS_03890 54457 52865 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785050.1 protein_id gnl|my_center|LOCUS_03890 55069 54479 gene locus_tag LOCUS_03900 55069 54479 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_03900 55410 55060 gene locus_tag LOCUS_03910 55410 55060 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_03910 55931 55554 gene locus_tag LOCUS_03920 55931 55554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785055.1 protein_id gnl|my_center|LOCUS_03920 57569 56118 gene locus_tag LOCUS_03930 57569 56118 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_03930 58914 57574 gene locus_tag LOCUS_03940 gene trkA 58914 57574 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_03940 60950 58953 gene locus_tag LOCUS_03950 gene dxs 60950 58953 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_03950 62734 61391 gene locus_tag LOCUS_03960 62734 61391 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785063.1 protein_id gnl|my_center|LOCUS_03960 63027 62731 gene locus_tag LOCUS_03970 63027 62731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785065.1 protein_id gnl|my_center|LOCUS_03970 63233 63880 gene locus_tag LOCUS_03980 63233 63880 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_03980 65516 63960 gene locus_tag LOCUS_03990 65516 63960 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_03990 67612 65537 gene locus_tag LOCUS_04000 67612 65537 CDS product Sip1-related alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785073.1 protein_id gnl|my_center|LOCUS_04000 68890 67622 gene locus_tag LOCUS_04010 68890 67622 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785074.1 protein_id gnl|my_center|LOCUS_04010 70458 69007 gene locus_tag LOCUS_04020 70458 69007 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_04020 72559 70577 gene locus_tag LOCUS_04030 72559 70577 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785078.1 protein_id gnl|my_center|LOCUS_04030 75733 72572 gene locus_tag LOCUS_04040 75733 72572 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_04040 75973 80028 gene locus_tag LOCUS_04050 75973 80028 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769493.1 protein_id gnl|my_center|LOCUS_04050 81640 80195 gene locus_tag LOCUS_04060 81640 80195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_04060 82084 83433 gene locus_tag LOCUS_04070 82084 83433 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_04070 83452 84699 gene locus_tag LOCUS_04080 83452 84699 CDS product PNGase F N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_04080 88466 85035 gene locus_tag LOCUS_04090 88466 85035 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_04090 89575 88577 gene locus_tag LOCUS_04100 89575 88577 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_04100 90619 89825 gene locus_tag LOCUS_04110 gene tatC 90619 89825 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_04110 90923 90696 gene locus_tag LOCUS_04120 gene tatA 90923 90696 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785095.1 protein_id gnl|my_center|LOCUS_04120 93580 91085 gene locus_tag LOCUS_04130 93580 91085 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_04130 94596 93610 gene locus_tag LOCUS_04140 94596 93610 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence006 619 1308 gene locus_tag LOCUS_04150 gene tsaB 619 1308 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_04150 1360 1977 gene locus_tag LOCUS_04160 1360 1977 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_04160 2025 3329 gene locus_tag LOCUS_04170 gene murA 2025 3329 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_04170 3326 3868 gene locus_tag LOCUS_04180 gene rimM 3326 3868 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657443.1 protein_id gnl|my_center|LOCUS_04180 3934 4794 gene locus_tag LOCUS_04190 3934 4794 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_04190 4797 5963 gene locus_tag LOCUS_04200 4797 5963 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_04200 5983 7338 gene locus_tag LOCUS_04210 gene rseP 5983 7338 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_04210 8343 7465 gene locus_tag LOCUS_04220 8343 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790572.1 protein_id gnl|my_center|LOCUS_04220 8540 9331 gene locus_tag LOCUS_04230 gene phnX 8540 9331 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797923.1 protein_id gnl|my_center|LOCUS_04230 9337 10425 gene locus_tag LOCUS_04240 9337 10425 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790568.1 protein_id gnl|my_center|LOCUS_04240 11897 10590 gene locus_tag LOCUS_04250 11897 10590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797922.1 protein_id gnl|my_center|LOCUS_04250 12689 12231 gene locus_tag LOCUS_04260 gene nrdG 12689 12231 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_04260 15089 12696 gene locus_tag LOCUS_04270 15089 12696 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_04270 16080 15430 gene locus_tag LOCUS_04280 16080 15430 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817347.1 protein_id gnl|my_center|LOCUS_04280 17121 16222 gene locus_tag LOCUS_04290 17121 16222 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_04290 17280 17885 gene locus_tag LOCUS_04300 gene ruvA 17280 17885 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_04300 18315 18022 gene locus_tag LOCUS_04310 18315 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 18545 18312 gene locus_tag LOCUS_04320 18545 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04320 19245 18508 gene locus_tag LOCUS_04330 19245 18508 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769912.1 protein_id gnl|my_center|LOCUS_04330 19654 19232 gene locus_tag LOCUS_04340 19654 19232 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769911.1 protein_id gnl|my_center|LOCUS_04340 20276 19743 gene locus_tag LOCUS_04350 20276 19743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797917.1 protein_id gnl|my_center|LOCUS_04350 20349 21353 gene locus_tag LOCUS_04360 20349 21353 CDS product DUF3843 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203402.1 protein_id gnl|my_center|LOCUS_04360 21322 21474 gene locus_tag LOCUS_04370 21322 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790543.1 protein_id gnl|my_center|LOCUS_04370 21504 22205 gene locus_tag LOCUS_04380 gene rpiA 21504 22205 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790542.1 protein_id gnl|my_center|LOCUS_04380 22889 22419 gene locus_tag LOCUS_04390 22889 22419 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802390.1 protein_id gnl|my_center|LOCUS_04390 23157 23402 gene locus_tag LOCUS_04400 23157 23402 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790540.1 protein_id gnl|my_center|LOCUS_04400 23896 23618 gene locus_tag LOCUS_04410 23896 23618 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_04410 24195 23893 gene locus_tag LOCUS_04420 24195 23893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 26714 24555 gene locus_tag LOCUS_04430 26714 24555 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203399.1 protein_id gnl|my_center|LOCUS_04430 27160 26780 gene locus_tag LOCUS_04440 27160 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790536.1 protein_id gnl|my_center|LOCUS_04440 27819 28445 gene locus_tag LOCUS_04450 27819 28445 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790534.1 protein_id gnl|my_center|LOCUS_04450 28490 28975 gene locus_tag LOCUS_04460 28490 28975 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203398.1 protein_id gnl|my_center|LOCUS_04460 29132 30124 gene locus_tag LOCUS_04470 29132 30124 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_04470 30143 31486 gene locus_tag LOCUS_04480 gene rfbH 30143 31486 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_04480 31524 32300 gene locus_tag LOCUS_04490 gene rfbF 31524 32300 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107730.1 protein_id gnl|my_center|LOCUS_04490 32306 33385 gene locus_tag LOCUS_04500 gene rfbG 32306 33385 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_04500 33387 34286 gene locus_tag LOCUS_04510 33387 34286 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386917.1 protein_id gnl|my_center|LOCUS_04510 34289 35302 gene locus_tag LOCUS_04520 34289 35302 CDS product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 protein_id gnl|my_center|LOCUS_04520 35642 35358 gene locus_tag LOCUS_04530 35642 35358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 35770 36651 gene locus_tag LOCUS_04540 35770 36651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 36651 37496 gene locus_tag LOCUS_04550 36651 37496 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050162430.1 protein_id gnl|my_center|LOCUS_04550 37500 38402 gene locus_tag LOCUS_04560 37500 38402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 38399 39124 gene locus_tag LOCUS_04570 38399 39124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 39526 40398 gene locus_tag LOCUS_04580 39526 40398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 40383 41255 gene locus_tag LOCUS_04590 40383 41255 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_04590 41252 41947 gene locus_tag LOCUS_04600 41252 41947 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_04600 41948 42760 gene locus_tag LOCUS_04610 41948 42760 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_04610 42765 43754 gene locus_tag LOCUS_04620 42765 43754 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203384.1 protein_id gnl|my_center|LOCUS_04620 43759 44646 gene locus_tag LOCUS_04630 gene rfbA 43759 44646 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107280.1 protein_id gnl|my_center|LOCUS_04630 44643 45185 gene locus_tag LOCUS_04640 gene rfbC 44643 45185 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_04640 45182 45898 gene locus_tag LOCUS_04650 45182 45898 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203383.1 protein_id gnl|my_center|LOCUS_04650 46556 46996 gene locus_tag LOCUS_04660 46556 46996 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_04660 48124 47225 gene locus_tag LOCUS_04670 48124 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 50912 48105 gene locus_tag LOCUS_04680 50912 48105 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_04680 52158 50956 gene locus_tag LOCUS_04690 52158 50956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 53624 52176 gene locus_tag LOCUS_04700 53624 52176 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_04700 56688 53638 gene locus_tag LOCUS_04710 56688 53638 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_04710 57912 57064 gene locus_tag LOCUS_04720 57912 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_04720 58085 59530 gene locus_tag LOCUS_04730 58085 59530 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_04730 59858 61897 gene locus_tag LOCUS_04740 59858 61897 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790480.1 protein_id gnl|my_center|LOCUS_04740 61901 64663 gene locus_tag LOCUS_04750 61901 64663 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790478.1 protein_id gnl|my_center|LOCUS_04750 65986 64823 gene locus_tag LOCUS_04760 65986 64823 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790476.1 protein_id gnl|my_center|LOCUS_04760 67494 66157 gene locus_tag LOCUS_04770 gene gdhA 67494 66157 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_04770 67909 70878 gene locus_tag LOCUS_04780 67909 70878 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_04780 71102 71911 gene locus_tag LOCUS_04790 71102 71911 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792636.1 protein_id gnl|my_center|LOCUS_04790 71932 73260 gene locus_tag LOCUS_04800 71932 73260 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797878.1 protein_id gnl|my_center|LOCUS_04800 73318 75063 gene locus_tag LOCUS_04810 73318 75063 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203376.1 protein_id gnl|my_center|LOCUS_04810 75074 75799 gene locus_tag LOCUS_04820 75074 75799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_04820 75820 77430 gene locus_tag LOCUS_04830 75820 77430 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_04830 77514 79571 gene locus_tag LOCUS_04840 77514 79571 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203375.1 protein_id gnl|my_center|LOCUS_04840 79574 80251 gene locus_tag LOCUS_04850 79574 80251 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802439.1 protein_id gnl|my_center|LOCUS_04850 80762 81982 gene locus_tag LOCUS_04860 80762 81982 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_04860 81989 82495 gene locus_tag LOCUS_04870 81989 82495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797867.1 protein_id gnl|my_center|LOCUS_04870 83880 83422 gene locus_tag LOCUS_04880 83880 83422 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790451.1 protein_id gnl|my_center|LOCUS_04880 84080 84400 gene locus_tag LOCUS_04890 84080 84400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790449.1 protein_id gnl|my_center|LOCUS_04890 85486 84569 gene locus_tag LOCUS_04900 85486 84569 CDS product DUF1735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790447.1 protein_id gnl|my_center|LOCUS_04900 86794 85613 gene locus_tag LOCUS_04910 86794 85613 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292684.1 protein_id gnl|my_center|LOCUS_04910 87864 86818 gene locus_tag LOCUS_04920 87864 86818 CDS product endo-beta-N-acetylglucosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555852.1 protein_id gnl|my_center|LOCUS_04920 89383 87890 gene locus_tag LOCUS_04930 89383 87890 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797856.1 protein_id gnl|my_center|LOCUS_04930 <92821 89539 gene locus_tag LOCUS_04940 <92821 89539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203369.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence007 6404 585 gene locus_tag LOCUS_04950 6404 585 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291462.1 protein_id gnl|my_center|LOCUS_04950 6846 6394 gene locus_tag LOCUS_04960 6846 6394 CDS product DUF1896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304266.1 protein_id gnl|my_center|LOCUS_04960 9100 7010 gene locus_tag LOCUS_04970 9100 7010 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291456.1 protein_id gnl|my_center|LOCUS_04970 10713 9157 gene locus_tag LOCUS_04980 10713 9157 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291455.1 protein_id gnl|my_center|LOCUS_04980 11084 10734 gene locus_tag LOCUS_04990 11084 10734 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291454.1 protein_id gnl|my_center|LOCUS_04990 11405 11088 gene locus_tag LOCUS_05000 11405 11088 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304264.1 protein_id gnl|my_center|LOCUS_05000 11653 11946 gene locus_tag LOCUS_05010 11653 11946 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291426.1 protein_id gnl|my_center|LOCUS_05010 12044 12283 gene locus_tag LOCUS_05020 12044 12283 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291424.1 protein_id gnl|my_center|LOCUS_05020 12723 12361 gene locus_tag LOCUS_05030 12723 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291423.1 protein_id gnl|my_center|LOCUS_05030 13970 12735 gene locus_tag LOCUS_05040 13970 12735 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291422.1 protein_id gnl|my_center|LOCUS_05040 15629 14421 gene locus_tag LOCUS_05050 gene uxuA 15629 14421 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_05050 16538 15726 gene locus_tag LOCUS_05060 16538 15726 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_05060 17311 16667 gene locus_tag LOCUS_05070 17311 16667 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_05070 18310 17375 gene locus_tag LOCUS_05080 gene lepB 18310 17375 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783767.1 protein_id gnl|my_center|LOCUS_05080 19802 18318 gene locus_tag LOCUS_05090 19802 18318 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_05090 20535 19807 gene locus_tag LOCUS_05100 gene dapB 20535 19807 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_05100 20631 21899 gene locus_tag LOCUS_05110 20631 21899 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_05110 21991 22551 gene locus_tag LOCUS_05120 21991 22551 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783777.1 protein_id gnl|my_center|LOCUS_05120 23678 22746 gene locus_tag LOCUS_05130 23678 22746 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_05130 24905 23685 gene locus_tag LOCUS_05140 24905 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_05140 25136 25777 gene locus_tag LOCUS_05150 25136 25777 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_05150 26649 25879 gene locus_tag LOCUS_05160 gene lpxA 26649 25879 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783787.1 protein_id gnl|my_center|LOCUS_05160 28060 26669 gene locus_tag LOCUS_05170 28060 26669 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_05170 31280 28077 gene locus_tag LOCUS_05180 31280 28077 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_05180 32459 31305 gene locus_tag LOCUS_05190 32459 31305 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_05190 35872 32768 gene locus_tag LOCUS_05200 35872 32768 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_05200 35978 37897 gene locus_tag LOCUS_05210 35978 37897 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_05210 38007 38714 gene locus_tag LOCUS_05220 38007 38714 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769176.1 protein_id gnl|my_center|LOCUS_05220 39108 38704 gene locus_tag LOCUS_05230 39108 38704 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779558.1 protein_id gnl|my_center|LOCUS_05230 40694 39219 gene locus_tag LOCUS_05240 gene cysS 40694 39219 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_05240 42145 41249 gene locus_tag LOCUS_05250 42145 41249 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_05250 42393 43694 gene locus_tag LOCUS_05260 42393 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 43818 44039 gene locus_tag LOCUS_05270 43818 44039 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797070.1 protein_id gnl|my_center|LOCUS_05270 44272 44541 gene locus_tag LOCUS_05280 44272 44541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 44556 44795 gene locus_tag LOCUS_05290 44556 44795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 44964 46112 gene locus_tag LOCUS_05300 44964 46112 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202017.1 protein_id gnl|my_center|LOCUS_05300 46170 47033 gene locus_tag LOCUS_05310 46170 47033 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203167.1 protein_id gnl|my_center|LOCUS_05310 47270 48481 gene locus_tag LOCUS_05320 47270 48481 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813840.1 protein_id gnl|my_center|LOCUS_05320 48838 49524 gene locus_tag LOCUS_05330 48838 49524 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783816.1 protein_id gnl|my_center|LOCUS_05330 49521 50888 gene locus_tag LOCUS_05340 49521 50888 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657969.1 protein_id gnl|my_center|LOCUS_05340 51048 53408 gene locus_tag LOCUS_05350 gene mgtA 51048 53408 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783820.1 protein_id gnl|my_center|LOCUS_05350 53791 54849 gene locus_tag LOCUS_05360 53791 54849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_05360 55070 55867 gene locus_tag LOCUS_05370 55070 55867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657972.1 protein_id gnl|my_center|LOCUS_05370 58964 55914 gene locus_tag LOCUS_05380 58964 55914 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_05380 59016 60110 gene locus_tag LOCUS_05390 gene mnmA 59016 60110 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813829.1 protein_id gnl|my_center|LOCUS_05390 61681 60170 gene locus_tag LOCUS_05400 61681 60170 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_05400 61851 62861 gene locus_tag LOCUS_05410 61851 62861 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_05410 63752 62880 gene locus_tag LOCUS_05420 gene rnc 63752 62880 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_05420 65019 63757 gene locus_tag LOCUS_05430 gene fabF 65019 63757 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_05430 65271 65035 gene locus_tag LOCUS_05440 65271 65035 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_05440 65370 65993 gene locus_tag LOCUS_05450 gene purN 65370 65993 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_05450 67077 66031 gene locus_tag LOCUS_05460 gene pdxB 67077 66031 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_05460 67210 67926 gene locus_tag LOCUS_05470 67210 67926 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_05470 67931 68644 gene locus_tag LOCUS_05480 67931 68644 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783846.1 protein_id gnl|my_center|LOCUS_05480 69548 68613 gene locus_tag LOCUS_05490 69548 68613 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_05490 70598 69576 gene locus_tag LOCUS_05500 70598 69576 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769190.1 protein_id gnl|my_center|LOCUS_05500 71404 70601 gene locus_tag LOCUS_05510 71404 70601 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_05510 72595 71525 gene locus_tag LOCUS_05520 72595 71525 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_05520 73037 74851 gene locus_tag LOCUS_05530 73037 74851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_05530 74854 76086 gene locus_tag LOCUS_05540 74854 76086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_05540 76719 76090 gene locus_tag LOCUS_05550 76719 76090 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_05550 76839 77441 gene locus_tag LOCUS_05560 76839 77441 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783862.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence008 1664 687 gene locus_tag LOCUS_05570 1664 687 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_05570 2181 1759 gene locus_tag LOCUS_05580 2181 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291396.1 protein_id gnl|my_center|LOCUS_05580 2935 2276 gene locus_tag LOCUS_05590 2935 2276 CDS product DUF3823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291395.1 protein_id gnl|my_center|LOCUS_05590 4889 3003 gene locus_tag LOCUS_05600 4889 3003 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_05600 7956 4897 gene locus_tag LOCUS_05610 7956 4897 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_05610 8444 12061 gene locus_tag LOCUS_05620 8444 12061 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201938.1 protein_id gnl|my_center|LOCUS_05620 15125 12615 gene locus_tag LOCUS_05630 15125 12615 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201937.1 protein_id gnl|my_center|LOCUS_05630 17035 15221 gene locus_tag LOCUS_05640 17035 15221 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_05640 18244 17138 gene locus_tag LOCUS_05650 18244 17138 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_05650 18522 20585 gene locus_tag LOCUS_05660 18522 20585 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_05660 20624 22660 gene locus_tag LOCUS_05670 20624 22660 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_05670 22801 24561 gene locus_tag LOCUS_05680 22801 24561 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_05680 24777 25943 gene locus_tag LOCUS_05690 24777 25943 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784050.1 protein_id gnl|my_center|LOCUS_05690 26086 28584 gene locus_tag LOCUS_05700 26086 28584 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_05700 28666 29742 gene locus_tag LOCUS_05710 28666 29742 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201934.1 protein_id gnl|my_center|LOCUS_05710 33913 29924 gene locus_tag LOCUS_05720 33913 29924 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201933.1 protein_id gnl|my_center|LOCUS_05720 35296 33983 gene locus_tag LOCUS_05730 35296 33983 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_05730 35880 35293 gene locus_tag LOCUS_05740 35880 35293 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784040.1 protein_id gnl|my_center|LOCUS_05740 37664 35877 gene locus_tag LOCUS_05750 37664 35877 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_05750 38099 37665 gene locus_tag LOCUS_05760 gene dut 38099 37665 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_05760 38174 39529 gene locus_tag LOCUS_05770 38174 39529 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_05770 40514 39501 gene locus_tag LOCUS_05780 40514 39501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_05780 41363 40545 gene locus_tag LOCUS_05790 41363 40545 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_05790 42132 41629 gene locus_tag LOCUS_05800 42132 41629 CDS product DUF4625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784028.1 protein_id gnl|my_center|LOCUS_05800 44288 42129 gene locus_tag LOCUS_05810 44288 42129 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_05810 44902 45408 gene locus_tag LOCUS_05820 44902 45408 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_05820 46133 45507 gene locus_tag LOCUS_05830 46133 45507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 47365 46130 gene locus_tag LOCUS_05840 47365 46130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 48024 47524 gene locus_tag LOCUS_05850 48024 47524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 49081 48032 gene locus_tag LOCUS_05860 49081 48032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 49419 49075 gene locus_tag LOCUS_05870 49419 49075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 49865 50365 gene locus_tag LOCUS_05880 49865 50365 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796726.1 protein_id gnl|my_center|LOCUS_05880 50472 50948 gene locus_tag LOCUS_05890 gene mraZ 50472 50948 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801871.1 protein_id gnl|my_center|LOCUS_05890 50945 51859 gene locus_tag LOCUS_05900 gene rsmH 50945 51859 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_05900 51888 52229 gene locus_tag LOCUS_05910 51888 52229 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784014.1 protein_id gnl|my_center|LOCUS_05910 52233 54356 gene locus_tag LOCUS_05920 52233 54356 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_05920 54374 55831 gene locus_tag LOCUS_05930 54374 55831 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_05930 55917 57185 gene locus_tag LOCUS_05940 gene mraY 55917 57185 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_05940 57325 58659 gene locus_tag LOCUS_05950 gene murD 57325 58659 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_05950 58718 60013 gene locus_tag LOCUS_05960 58718 60013 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_05960 60015 61157 gene locus_tag LOCUS_05970 gene murG 60015 61157 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_05970 61154 62548 gene locus_tag LOCUS_05980 gene murC 61154 62548 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_05980 62580 63320 gene locus_tag LOCUS_05990 62580 63320 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_05990 63397 64827 gene locus_tag LOCUS_06000 gene ftsA 63397 64827 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_06000 64854 66164 gene locus_tag LOCUS_06010 gene ftsZ 64854 66164 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_06010 66239 66688 gene locus_tag LOCUS_06020 66239 66688 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_06020 67525 66797 gene locus_tag LOCUS_06030 gene recO 67525 66797 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783992.1 protein_id gnl|my_center|LOCUS_06030 67824 67896 gene locus_tag LOCUS_t00040 67824 67896 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67935 68189 gene locus_tag LOCUS_06040 gene rpsT 67935 68189 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_06040 68370 70328 gene locus_tag LOCUS_06050 gene gyrB 68370 70328 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_06050 73395 70429 gene locus_tag LOCUS_06060 73395 70429 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201927.1 protein_id gnl|my_center|LOCUS_06060 73973 73392 gene locus_tag LOCUS_06070 73973 73392 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_06070 76271 74328 gene locus_tag LOCUS_06080 76271 74328 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201926.1 protein_id gnl|my_center|LOCUS_06080 <77397 76268 gene locus_tag LOCUS_06090 <77397 76268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801880.1:HAMP domain-containing sensor histidine kinase >Feature sequence009 1561 545 gene locus_tag LOCUS_06100 1561 545 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 protein_id gnl|my_center|LOCUS_06100 2836 1601 gene locus_tag LOCUS_06110 2836 1601 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_06110 3983 2913 gene locus_tag LOCUS_06120 3983 2913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_06120 4644 3991 gene locus_tag LOCUS_06130 4644 3991 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_06130 5041 4763 gene locus_tag LOCUS_06140 5041 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6395 5232 gene locus_tag LOCUS_06150 6395 5232 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202732.1 protein_id gnl|my_center|LOCUS_06150 7832 6399 gene locus_tag LOCUS_06160 7832 6399 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_06160 8718 7852 gene locus_tag LOCUS_06170 8718 7852 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_06170 9938 9336 gene locus_tag LOCUS_06180 9938 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06180 10064 10249 gene locus_tag LOCUS_06190 10064 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202727.1 protein_id gnl|my_center|LOCUS_06190 11262 10411 gene locus_tag LOCUS_06200 11262 10411 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787284.1 protein_id gnl|my_center|LOCUS_06200 12350 11358 gene locus_tag LOCUS_06210 12350 11358 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202726.1 protein_id gnl|my_center|LOCUS_06210 13338 12358 gene locus_tag LOCUS_06220 13338 12358 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202725.1 protein_id gnl|my_center|LOCUS_06220 15385 15179 gene locus_tag LOCUS_06230 15385 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 16151 15528 gene locus_tag LOCUS_06240 16151 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 19800 16279 gene locus_tag LOCUS_06250 19800 16279 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_06250 21187 19832 gene locus_tag LOCUS_06260 21187 19832 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_06260 23236 21191 gene locus_tag LOCUS_06270 23236 21191 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_06270 24498 23296 gene locus_tag LOCUS_06280 24498 23296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 26880 24502 gene locus_tag LOCUS_06290 26880 24502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 27970 26924 gene locus_tag LOCUS_06300 27970 26924 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_06300 28170 27973 gene locus_tag LOCUS_06310 28170 27973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 29225 30358 gene locus_tag LOCUS_06320 29225 30358 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107088.1 protein_id gnl|my_center|LOCUS_06320 30480 30761 gene locus_tag LOCUS_06330 30480 30761 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295307.1 protein_id gnl|my_center|LOCUS_06330 30764 31054 gene locus_tag LOCUS_06340 30764 31054 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311261.1 protein_id gnl|my_center|LOCUS_06340 32382 31144 gene locus_tag LOCUS_06350 32382 31144 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108363.1 protein_id gnl|my_center|LOCUS_06350 32697 32623 gene locus_tag LOCUS_t00050 32697 32623 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32870 34186 gene locus_tag LOCUS_06360 32870 34186 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_06360 34258 34848 gene locus_tag LOCUS_06370 34258 34848 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_06370 35390 34851 gene locus_tag LOCUS_06380 35390 34851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_06380 35840 35391 gene locus_tag LOCUS_06390 35840 35391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202710.1 protein_id gnl|my_center|LOCUS_06390 36496 35879 gene locus_tag LOCUS_06400 gene recR 36496 35879 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_06400 36772 37182 gene locus_tag LOCUS_06410 36772 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787268.1 protein_id gnl|my_center|LOCUS_06410 37466 37981 gene locus_tag LOCUS_06420 37466 37981 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787267.1 protein_id gnl|my_center|LOCUS_06420 38478 39929 gene locus_tag LOCUS_06430 38478 39929 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_06430 39944 40549 gene locus_tag LOCUS_06440 gene yihA 39944 40549 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_06440 40565 41164 gene locus_tag LOCUS_06450 40565 41164 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787260.1 protein_id gnl|my_center|LOCUS_06450 41654 41217 gene locus_tag LOCUS_06460 41654 41217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 41832 42527 gene locus_tag LOCUS_06470 41832 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 42711 43106 gene locus_tag LOCUS_06480 42711 43106 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_06480 43237 45225 gene locus_tag LOCUS_06490 43237 45225 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_06490 45222 46085 gene locus_tag LOCUS_06500 45222 46085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_06500 46123 46899 gene locus_tag LOCUS_06510 46123 46899 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_06510 48137 47472 gene locus_tag LOCUS_06520 gene lipB 48137 47472 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_06520 48203 49042 gene locus_tag LOCUS_06530 48203 49042 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_06530 51428 49218 gene locus_tag LOCUS_06540 51428 49218 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_06540 51791 51480 gene locus_tag LOCUS_06550 51791 51480 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787238.1 protein_id gnl|my_center|LOCUS_06550 54058 51842 gene locus_tag LOCUS_06560 54058 51842 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_06560 54469 54660 gene locus_tag LOCUS_06570 54469 54660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 54772 55626 gene locus_tag LOCUS_06580 54772 55626 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_06580 55666 56340 gene locus_tag LOCUS_06590 gene rsmG 55666 56340 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817853.1 protein_id gnl|my_center|LOCUS_06590 56360 56998 gene locus_tag LOCUS_06600 56360 56998 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_06600 57041 59890 gene locus_tag LOCUS_06610 gene gcvP 57041 59890 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202698.1 protein_id gnl|my_center|LOCUS_06610 60600 60031 gene locus_tag LOCUS_06620 60600 60031 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787224.1 protein_id gnl|my_center|LOCUS_06620 61713 60625 gene locus_tag LOCUS_06630 61713 60625 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794495.1 protein_id gnl|my_center|LOCUS_06630 62408 61791 gene locus_tag LOCUS_06640 62408 61791 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_06640 62836 62435 gene locus_tag LOCUS_06650 62836 62435 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794500.1 protein_id gnl|my_center|LOCUS_06650 64331 63084 gene locus_tag LOCUS_06660 64331 63084 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_06660 65264 64344 gene locus_tag LOCUS_06670 65264 64344 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292180.1 protein_id gnl|my_center|LOCUS_06670 66445 65378 gene locus_tag LOCUS_06680 gene serC 66445 65378 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_06680 68278 66959 gene locus_tag LOCUS_06690 68278 66959 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_06690 69646 68375 gene locus_tag LOCUS_06700 gene nqrF 69646 68375 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_06700 70295 69669 gene locus_tag LOCUS_06710 gene nqrE 70295 69669 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_06710 70956 70324 gene locus_tag LOCUS_06720 70956 70324 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_06720 71650 70973 gene locus_tag LOCUS_06730 71650 70973 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_06730 72843 71665 gene locus_tag LOCUS_06740 72843 71665 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_06740 74227 72875 gene locus_tag LOCUS_06750 74227 72875 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_06750 76271 74823 gene locus_tag LOCUS_06760 76271 74823 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence010 1809 760 gene locus_tag LOCUS_06770 1809 760 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_06770 3131 2004 gene locus_tag LOCUS_06780 3131 2004 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_06780 3253 4593 gene locus_tag LOCUS_06790 3253 4593 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_06790 4702 5220 gene locus_tag LOCUS_06800 4702 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790723.1 protein_id gnl|my_center|LOCUS_06800 5902 5312 gene locus_tag LOCUS_06810 5902 5312 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_06810 6230 7078 gene locus_tag LOCUS_06820 6230 7078 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790717.1 protein_id gnl|my_center|LOCUS_06820 7110 8417 gene locus_tag LOCUS_06830 7110 8417 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657499.1 protein_id gnl|my_center|LOCUS_06830 8414 10579 gene locus_tag LOCUS_06840 8414 10579 CDS product FISUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657498.1 protein_id gnl|my_center|LOCUS_06840 10598 12748 gene locus_tag LOCUS_06850 10598 12748 CDS product FISUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203432.1 protein_id gnl|my_center|LOCUS_06850 12831 14840 gene locus_tag LOCUS_06860 12831 14840 CDS product PL29 family lyase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555855.1 protein_id gnl|my_center|LOCUS_06860 15227 16405 gene locus_tag LOCUS_06870 15227 16405 CDS product DUF4221 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203430.1 protein_id gnl|my_center|LOCUS_06870 16729 18531 gene locus_tag LOCUS_06880 gene ilvD 16729 18531 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_06880 18587 20284 gene locus_tag LOCUS_06890 gene ilvB 18587 20284 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_06890 20298 20858 gene locus_tag LOCUS_06900 gene ilvN 20298 20858 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 protein_id gnl|my_center|LOCUS_06900 20859 21602 gene locus_tag LOCUS_06910 20859 21602 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_06910 21665 22204 gene locus_tag LOCUS_06920 21665 22204 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_06920 22287 23330 gene locus_tag LOCUS_06930 gene ilvC 22287 23330 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_06930 23532 25451 gene locus_tag LOCUS_06940 23532 25451 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_06940 27468 25564 gene locus_tag LOCUS_06950 27468 25564 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_06950 27727 29970 gene locus_tag LOCUS_06960 27727 29970 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_06960 30133 31323 gene locus_tag LOCUS_06970 gene icd 30133 31323 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203424.1 protein_id gnl|my_center|LOCUS_06970 31336 32679 gene locus_tag LOCUS_06980 31336 32679 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_06980 32889 33650 gene locus_tag LOCUS_06990 32889 33650 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_06990 33665 34897 gene locus_tag LOCUS_07000 33665 34897 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_07000 34894 35766 gene locus_tag LOCUS_07010 34894 35766 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555854.1 protein_id gnl|my_center|LOCUS_07010 36812 35823 gene locus_tag LOCUS_07020 gene pfkA 36812 35823 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_07020 37749 36877 gene locus_tag LOCUS_07030 37749 36877 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_07030 38497 37862 gene locus_tag LOCUS_07040 gene cmk 38497 37862 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_07040 38707 39390 gene locus_tag LOCUS_07050 38707 39390 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790660.1 protein_id gnl|my_center|LOCUS_07050 39471 40445 gene locus_tag LOCUS_07060 39471 40445 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_07060 40453 41163 gene locus_tag LOCUS_07070 40453 41163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_07070 41167 41943 gene locus_tag LOCUS_07080 41167 41943 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817413.1 protein_id gnl|my_center|LOCUS_07080 42105 42193 gene locus_tag LOCUS_t00060 42105 42193 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 42271 43092 gene locus_tag LOCUS_07090 42271 43092 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_07090 43099 43569 gene locus_tag LOCUS_07100 43099 43569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_07100 43606 44196 gene locus_tag LOCUS_07110 43606 44196 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_07110 44196 44660 gene locus_tag LOCUS_07120 44196 44660 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_07120 46447 45167 gene locus_tag LOCUS_07130 46447 45167 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_07130 46598 47074 gene locus_tag LOCUS_07140 46598 47074 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_07140 47571 47071 gene locus_tag LOCUS_07150 47571 47071 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_07150 48380 47586 gene locus_tag LOCUS_07160 48380 47586 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_07160 49642 48446 gene locus_tag LOCUS_07170 gene cls 49642 48446 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_07170 50526 50197 gene locus_tag LOCUS_07180 50526 50197 CDS product DUF5056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790636.1 protein_id gnl|my_center|LOCUS_07180 51058 50510 gene locus_tag LOCUS_07190 51058 50510 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790634.1 protein_id gnl|my_center|LOCUS_07190 51684 51058 gene locus_tag LOCUS_07200 51684 51058 CDS product DUF6249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790632.1 protein_id gnl|my_center|LOCUS_07200 51803 52168 gene locus_tag LOCUS_07210 51803 52168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 52161 52373 gene locus_tag LOCUS_07220 52161 52373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07220 52370 53788 gene locus_tag LOCUS_07230 52370 53788 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_07230 53887 54573 gene locus_tag LOCUS_07240 53887 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_07240 54699 55679 gene locus_tag LOCUS_07250 54699 55679 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_07250 57021 55843 gene locus_tag LOCUS_07260 57021 55843 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_07260 60127 57041 gene locus_tag LOCUS_07270 60127 57041 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_07270 61382 60186 gene locus_tag LOCUS_07280 61382 60186 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_07280 62456 62181 gene locus_tag LOCUS_07290 62456 62181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203415.1 protein_id gnl|my_center|LOCUS_07290 64209 62575 gene locus_tag LOCUS_07300 64209 62575 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_07300 64318 64716 gene locus_tag LOCUS_07310 64318 64716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790608.1 protein_id gnl|my_center|LOCUS_07310 67190 64881 gene locus_tag LOCUS_07320 67190 64881 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_07320 69271 67196 gene locus_tag LOCUS_07330 69271 67196 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_07330 69328 69819 gene locus_tag LOCUS_07340 69328 69819 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_07340 69996 70859 gene locus_tag LOCUS_07350 gene rfbA 69996 70859 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790602.1 protein_id gnl|my_center|LOCUS_07350 70879 72018 gene locus_tag LOCUS_07360 gene rfbB 70879 72018 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_07360 72919 72023 gene locus_tag LOCUS_07370 72919 72023 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_07370 73019 74071 gene locus_tag LOCUS_07380 73019 74071 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203412.1 protein_id gnl|my_center|LOCUS_07380 74680 74075 gene locus_tag LOCUS_07390 gene nadD 74680 74075 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_07390 75328 74714 gene locus_tag LOCUS_07400 gene gmk 75328 74714 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence011 1284 271 gene locus_tag LOCUS_07410 1284 271 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202018.1 protein_id gnl|my_center|LOCUS_07410 1603 1433 gene locus_tag LOCUS_07420 1603 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2601 1573 gene locus_tag LOCUS_07430 2601 1573 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202017.1 protein_id gnl|my_center|LOCUS_07430 3087 2821 gene locus_tag LOCUS_07440 3087 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4106 3219 gene locus_tag LOCUS_07450 4106 3219 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784290.1 protein_id gnl|my_center|LOCUS_07450 4333 4106 gene locus_tag LOCUS_07460 4333 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5469 4399 gene locus_tag LOCUS_07470 5469 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202012.1 protein_id gnl|my_center|LOCUS_07470 5726 5466 gene locus_tag LOCUS_07480 5726 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6877 6113 gene locus_tag LOCUS_07490 gene cdaA 6877 6113 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_07490 7772 6912 gene locus_tag LOCUS_07500 gene folP 7772 6912 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_07500 7884 9899 gene locus_tag LOCUS_07510 7884 9899 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202008.1 protein_id gnl|my_center|LOCUS_07510 10950 9985 gene locus_tag LOCUS_07520 gene glsA 10950 9985 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202007.1 protein_id gnl|my_center|LOCUS_07520 12408 10966 gene locus_tag LOCUS_07530 12408 10966 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784276.1 protein_id gnl|my_center|LOCUS_07530 12670 13905 gene locus_tag LOCUS_07540 12670 13905 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801628.1 protein_id gnl|my_center|LOCUS_07540 13948 15246 gene locus_tag LOCUS_07550 13948 15246 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_07550 15643 15251 gene locus_tag LOCUS_07560 15643 15251 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202006.1 protein_id gnl|my_center|LOCUS_07560 15748 17115 gene locus_tag LOCUS_07570 15748 17115 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_07570 17118 18020 gene locus_tag LOCUS_07580 17118 18020 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_07580 18671 18021 gene locus_tag LOCUS_07590 18671 18021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_07590 19386 18676 gene locus_tag LOCUS_07600 19386 18676 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_07600 21431 19386 gene locus_tag LOCUS_07610 21431 19386 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_07610 21719 22729 gene locus_tag LOCUS_07620 21719 22729 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_07620 23029 23877 gene locus_tag LOCUS_07630 23029 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_07630 24339 27674 gene locus_tag LOCUS_07640 24339 27674 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202000.1 protein_id gnl|my_center|LOCUS_07640 27704 29401 gene locus_tag LOCUS_07650 27704 29401 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_07650 29775 30791 gene locus_tag LOCUS_07660 29775 30791 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_07660 30832 32283 gene locus_tag LOCUS_07670 30832 32283 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_07670 32291 35362 gene locus_tag LOCUS_07680 32291 35362 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_07680 35458 37323 gene locus_tag LOCUS_07690 35458 37323 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201995.1 protein_id gnl|my_center|LOCUS_07690 37347 38813 gene locus_tag LOCUS_07700 37347 38813 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_07700 38810 39742 gene locus_tag LOCUS_07710 38810 39742 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_07710 39739 41094 gene locus_tag LOCUS_07720 39739 41094 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_07720 41110 42408 gene locus_tag LOCUS_07730 41110 42408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_07730 42501 43724 gene locus_tag LOCUS_07740 42501 43724 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_07740 43760 46630 gene locus_tag LOCUS_07750 43760 46630 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_07750 46639 47802 gene locus_tag LOCUS_07760 46639 47802 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_07760 47799 48635 gene locus_tag LOCUS_07770 47799 48635 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_07770 48659 49504 gene locus_tag LOCUS_07780 gene murQ 48659 49504 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_07780 49537 51420 gene locus_tag LOCUS_07790 49537 51420 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201989.1 protein_id gnl|my_center|LOCUS_07790 52118 51432 gene locus_tag LOCUS_07800 52118 51432 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769271.1 protein_id gnl|my_center|LOCUS_07800 53430 52165 gene locus_tag LOCUS_07810 53430 52165 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_07810 54254 53463 gene locus_tag LOCUS_07820 gene ccsA 54254 53463 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201987.1 protein_id gnl|my_center|LOCUS_07820 55492 54251 gene locus_tag LOCUS_07830 55492 54251 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813632.1 protein_id gnl|my_center|LOCUS_07830 56977 55496 gene locus_tag LOCUS_07840 gene nrfA 56977 55496 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_07840 57588 57001 gene locus_tag LOCUS_07850 gene nrfH 57588 57001 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_07850 58230 57727 gene locus_tag LOCUS_07860 58230 57727 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_07860 58426 60012 gene locus_tag LOCUS_07870 58426 60012 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042366928.1 protein_id gnl|my_center|LOCUS_07870 60161 60541 gene locus_tag LOCUS_07880 60161 60541 CDS product DUF3244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784208.1 protein_id gnl|my_center|LOCUS_07880 60601 61488 gene locus_tag LOCUS_07890 60601 61488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201982.1 protein_id gnl|my_center|LOCUS_07890 62217 61666 gene locus_tag LOCUS_07900 62217 61666 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796621.1 protein_id gnl|my_center|LOCUS_07900 63770 62229 gene locus_tag LOCUS_07910 63770 62229 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_07910 63955 66603 gene locus_tag LOCUS_07920 63955 66603 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528589.1 protein_id gnl|my_center|LOCUS_07920 66628 67497 gene locus_tag LOCUS_07930 66628 67497 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801667.1 protein_id gnl|my_center|LOCUS_07930 67510 68541 gene locus_tag LOCUS_07940 67510 68541 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_07940 70184 68697 gene locus_tag LOCUS_07950 70184 68697 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_07950 73272 70213 gene locus_tag LOCUS_07960 73272 70213 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_07960 73669 73751 gene locus_tag LOCUS_t00070 73669 73751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74033 73797 gene locus_tag LOCUS_07970 74033 73797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201901.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence012 2302 965 gene locus_tag LOCUS_07980 gene rsxC 2302 965 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_07980 3211 2339 gene locus_tag LOCUS_07990 3211 2339 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_07990 4291 3887 gene locus_tag LOCUS_08000 4291 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788164.1 protein_id gnl|my_center|LOCUS_08000 5796 4420 gene locus_tag LOCUS_08010 5796 4420 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_08010 6195 5935 gene locus_tag LOCUS_08020 6195 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 6237 7838 gene locus_tag LOCUS_08030 6237 7838 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_08030 7887 9743 gene locus_tag LOCUS_08040 gene yidC 7887 9743 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_08040 9832 11163 gene locus_tag LOCUS_08050 9832 11163 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_08050 11195 13345 gene locus_tag LOCUS_08060 11195 13345 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_08060 14441 13446 gene locus_tag LOCUS_08070 14441 13446 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803756.1 protein_id gnl|my_center|LOCUS_08070 15672 14593 gene locus_tag LOCUS_08080 15672 14593 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_08080 16020 15685 gene locus_tag LOCUS_08090 16020 15685 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_08090 16182 16679 gene locus_tag LOCUS_08100 16182 16679 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_08100 18449 16791 gene locus_tag LOCUS_08110 18449 16791 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_08110 18990 18511 gene locus_tag LOCUS_08120 gene ybaK 18990 18511 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_08120 22074 19246 gene locus_tag LOCUS_08130 gene uvrA 22074 19246 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_08130 22386 24020 gene locus_tag LOCUS_08140 22386 24020 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202945.1 protein_id gnl|my_center|LOCUS_08140 24017 24724 gene locus_tag LOCUS_08150 24017 24724 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_08150 25195 24806 gene locus_tag LOCUS_08160 25195 24806 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_08160 25700 25365 gene locus_tag LOCUS_08170 25700 25365 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_08170 26519 25716 gene locus_tag LOCUS_08180 gene bamD 26519 25716 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_08180 27132 26707 gene locus_tag LOCUS_08190 27132 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778250.1 protein_id gnl|my_center|LOCUS_08190 28458 27160 gene locus_tag LOCUS_08200 28458 27160 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_08200 28575 30608 gene locus_tag LOCUS_08210 gene uvrB 28575 30608 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_08210 30911 31531 gene locus_tag LOCUS_08220 30911 31531 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202947.1 protein_id gnl|my_center|LOCUS_08220 31652 32350 gene locus_tag LOCUS_08230 31652 32350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 32347 32859 gene locus_tag LOCUS_08240 32347 32859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_08240 33103 33531 gene locus_tag LOCUS_08250 33103 33531 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_08250 36695 33627 gene locus_tag LOCUS_08260 36695 33627 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202950.1 protein_id gnl|my_center|LOCUS_08260 37947 36829 gene locus_tag LOCUS_08270 37947 36829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_08270 39044 37944 gene locus_tag LOCUS_08280 39044 37944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_08280 40508 39048 gene locus_tag LOCUS_08290 40508 39048 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202953.1 protein_id gnl|my_center|LOCUS_08290 41418 40522 gene locus_tag LOCUS_08300 41418 40522 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_08300 42665 41457 gene locus_tag LOCUS_08310 42665 41457 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_08310 43998 42925 gene locus_tag LOCUS_08320 43998 42925 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202954.1 protein_id gnl|my_center|LOCUS_08320 44417 45304 gene locus_tag LOCUS_08330 44417 45304 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_08330 46161 45865 gene locus_tag LOCUS_08340 46161 45865 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788237.1 protein_id gnl|my_center|LOCUS_08340 49591 46361 gene locus_tag LOCUS_08350 gene carB 49591 46361 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_08350 50830 49754 gene locus_tag LOCUS_08360 gene carA 50830 49754 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_08360 52748 50865 gene locus_tag LOCUS_08370 52748 50865 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_08370 53318 52869 gene locus_tag LOCUS_08380 53318 52869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793380.1 protein_id gnl|my_center|LOCUS_08380 53942 55549 gene locus_tag LOCUS_08390 gene asnB 53942 55549 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202957.1 protein_id gnl|my_center|LOCUS_08390 55800 56561 gene locus_tag LOCUS_08400 55800 56561 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_08400 56782 58095 gene locus_tag LOCUS_08410 56782 58095 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202958.1 protein_id gnl|my_center|LOCUS_08410 58304 59179 gene locus_tag LOCUS_08420 58304 59179 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788972.1 protein_id gnl|my_center|LOCUS_08420 59623 60432 gene locus_tag LOCUS_08430 gene dapF 59623 60432 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_08430 60485 61717 gene locus_tag LOCUS_08440 60485 61717 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_08440 62416 61850 gene locus_tag LOCUS_08450 62416 61850 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_08450 62587 64653 gene locus_tag LOCUS_08460 62587 64653 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788264.1 protein_id gnl|my_center|LOCUS_08460 64650 65564 gene locus_tag LOCUS_08470 64650 65564 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_08470 66902 65757 gene locus_tag LOCUS_08480 66902 65757 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202960.1 protein_id gnl|my_center|LOCUS_08480 67275 67514 gene locus_tag LOCUS_08490 67275 67514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 67769 67924 gene locus_tag LOCUS_08500 67769 67924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence013 62 274 gene locus_tag LOCUS_08510 62 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 323 1267 gene locus_tag LOCUS_08520 323 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1260 1973 gene locus_tag LOCUS_08530 1260 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555725.1 protein_id gnl|my_center|LOCUS_08530 1977 2162 gene locus_tag LOCUS_08540 1977 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202826.1 protein_id gnl|my_center|LOCUS_08540 2178 2669 gene locus_tag LOCUS_08550 2178 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793854.1 protein_id gnl|my_center|LOCUS_08550 2800 3231 gene locus_tag LOCUS_08560 2800 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793852.1 protein_id gnl|my_center|LOCUS_08560 3272 4132 gene locus_tag LOCUS_08570 3272 4132 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555635.1 protein_id gnl|my_center|LOCUS_08570 4159 6375 gene locus_tag LOCUS_08580 4159 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202828.1 protein_id gnl|my_center|LOCUS_08580 6435 7253 gene locus_tag LOCUS_08590 6435 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202829.1 protein_id gnl|my_center|LOCUS_08590 7414 8349 gene locus_tag LOCUS_08600 7414 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202830.1 protein_id gnl|my_center|LOCUS_08600 8503 8844 gene locus_tag LOCUS_08610 8503 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202831.1 protein_id gnl|my_center|LOCUS_08610 8825 9502 gene locus_tag LOCUS_08620 8825 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202832.1 protein_id gnl|my_center|LOCUS_08620 9468 11174 gene locus_tag LOCUS_08630 9468 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202833.1 protein_id gnl|my_center|LOCUS_08630 11756 12226 gene locus_tag LOCUS_08640 11756 12226 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202834.1 protein_id gnl|my_center|LOCUS_08640 12321 12770 gene locus_tag LOCUS_08650 12321 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814952.1 protein_id gnl|my_center|LOCUS_08650 12746 13036 gene locus_tag LOCUS_08660 12746 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793839.1 protein_id gnl|my_center|LOCUS_08660 13040 14392 gene locus_tag LOCUS_08670 13040 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202836.1 protein_id gnl|my_center|LOCUS_08670 14402 15343 gene locus_tag LOCUS_08680 14402 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793835.1 protein_id gnl|my_center|LOCUS_08680 15346 16146 gene locus_tag LOCUS_08690 15346 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793833.1 protein_id gnl|my_center|LOCUS_08690 16143 16538 gene locus_tag LOCUS_08700 16143 16538 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202837.1 protein_id gnl|my_center|LOCUS_08700 16551 16994 gene locus_tag LOCUS_08710 16551 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793829.1 protein_id gnl|my_center|LOCUS_08710 16991 17455 gene locus_tag LOCUS_08720 16991 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793827.1 protein_id gnl|my_center|LOCUS_08720 17403 21575 gene locus_tag LOCUS_08730 17403 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004338383.1 protein_id gnl|my_center|LOCUS_08730 21586 23688 gene locus_tag LOCUS_08740 21586 23688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202839.1 protein_id gnl|my_center|LOCUS_08740 23951 25144 gene locus_tag LOCUS_08750 23951 25144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793815.1 protein_id gnl|my_center|LOCUS_08750 25275 25865 gene locus_tag LOCUS_08760 25275 25865 CDS product BACON domain-containing carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793813.1 protein_id gnl|my_center|LOCUS_08760 26514 25921 gene locus_tag LOCUS_08770 26514 25921 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793811.1 protein_id gnl|my_center|LOCUS_08770 26705 27139 gene locus_tag LOCUS_08780 26705 27139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793809.1 protein_id gnl|my_center|LOCUS_08780 27753 28091 gene locus_tag LOCUS_08790 27753 28091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793807.1 protein_id gnl|my_center|LOCUS_08790 30504 29260 gene locus_tag LOCUS_08800 30504 29260 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793803.1 protein_id gnl|my_center|LOCUS_08800 30742 30667 gene locus_tag LOCUS_t00080 30742 30667 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30853 30778 gene locus_tag LOCUS_t00090 30853 30778 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31282 31064 gene locus_tag LOCUS_08810 31282 31064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787741.1 protein_id gnl|my_center|LOCUS_08810 31467 31619 gene locus_tag LOCUS_08820 31467 31619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 31628 31969 gene locus_tag LOCUS_08830 31628 31969 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787743.1 protein_id gnl|my_center|LOCUS_08830 32038 32211 gene locus_tag LOCUS_08840 32038 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777810.1 protein_id gnl|my_center|LOCUS_08840 33495 32218 gene locus_tag LOCUS_08850 33495 32218 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 protein_id gnl|my_center|LOCUS_08850 34856 33492 gene locus_tag LOCUS_08860 34856 33492 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_08860 35219 36691 gene locus_tag LOCUS_08870 35219 36691 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_08870 36730 37980 gene locus_tag LOCUS_08880 36730 37980 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_08880 38124 40547 gene locus_tag LOCUS_08890 38124 40547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787751.1 protein_id gnl|my_center|LOCUS_08890 40697 43042 gene locus_tag LOCUS_08900 40697 43042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202843.1 protein_id gnl|my_center|LOCUS_08900 43059 45386 gene locus_tag LOCUS_08910 43059 45386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 protein_id gnl|my_center|LOCUS_08910 45401 47803 gene locus_tag LOCUS_08920 45401 47803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202845.1 protein_id gnl|my_center|LOCUS_08920 48033 50225 gene locus_tag LOCUS_08930 48033 50225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803550.1 protein_id gnl|my_center|LOCUS_08930 50236 52572 gene locus_tag LOCUS_08940 50236 52572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555642.1 protein_id gnl|my_center|LOCUS_08940 52601 53275 gene locus_tag LOCUS_08950 52601 53275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_08950 53566 54612 gene locus_tag LOCUS_08960 53566 54612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 54746 55414 gene locus_tag LOCUS_08970 54746 55414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 55432 56058 gene locus_tag LOCUS_08980 55432 56058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 56034 56813 gene locus_tag LOCUS_08990 56034 56813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387940.1 protein_id gnl|my_center|LOCUS_08990 56810 58285 gene locus_tag LOCUS_09000 56810 58285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986676.1 protein_id gnl|my_center|LOCUS_09000 58282 58761 gene locus_tag LOCUS_09010 58282 58761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 58775 60184 gene locus_tag LOCUS_09020 58775 60184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_09020 60189 61991 gene locus_tag LOCUS_09030 gene cas10 60189 61991 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_09030 61984 63123 gene locus_tag LOCUS_09040 61984 63123 CDS product type III-B CRISPR module-associated Cmr3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986673.1 protein_id gnl|my_center|LOCUS_09040 63143 63982 gene locus_tag LOCUS_09050 gene cmr4 63143 63982 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_09050 63995 64405 gene locus_tag LOCUS_09060 63995 64405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 64402 65352 gene locus_tag LOCUS_09070 gene cmr6 64402 65352 CDS product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986670.1 protein_id gnl|my_center|LOCUS_09070 65372 67642 gene locus_tag LOCUS_09080 65372 67642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 67636 67926 gene locus_tag LOCUS_09090 67636 67926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence014 3205 77 gene locus_tag LOCUS_09100 3205 77 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_09100 3532 3933 gene locus_tag LOCUS_09110 3532 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291979.1 protein_id gnl|my_center|LOCUS_09110 3930 6176 gene locus_tag LOCUS_09120 gene bioA 3930 6176 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202495.1 protein_id gnl|my_center|LOCUS_09120 6315 7508 gene locus_tag LOCUS_09130 6315 7508 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_09130 7516 8991 gene locus_tag LOCUS_09140 gene bioC 7516 8991 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202493.1 protein_id gnl|my_center|LOCUS_09140 9026 9667 gene locus_tag LOCUS_09150 gene bioD 9026 9667 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_09150 10079 11434 gene locus_tag LOCUS_09160 10079 11434 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_09160 14026 11606 gene locus_tag LOCUS_09170 14026 11606 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_09170 14739 14023 gene locus_tag LOCUS_09180 14739 14023 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795152.1 protein_id gnl|my_center|LOCUS_09180 16052 14805 gene locus_tag LOCUS_09190 16052 14805 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_09190 17362 16193 gene locus_tag LOCUS_09200 17362 16193 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786410.1 protein_id gnl|my_center|LOCUS_09200 17793 19130 gene locus_tag LOCUS_09210 17793 19130 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_09210 19136 20386 gene locus_tag LOCUS_09220 19136 20386 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786408.1 protein_id gnl|my_center|LOCUS_09220 20455 21453 gene locus_tag LOCUS_09230 20455 21453 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_09230 21524 22696 gene locus_tag LOCUS_09240 21524 22696 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_09240 24009 22702 gene locus_tag LOCUS_09250 24009 22702 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_09250 25218 24019 gene locus_tag LOCUS_09260 25218 24019 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_09260 25389 26624 gene locus_tag LOCUS_09270 25389 26624 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_09270 26825 28732 gene locus_tag LOCUS_09280 26825 28732 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202488.1 protein_id gnl|my_center|LOCUS_09280 29619 28747 gene locus_tag LOCUS_09290 29619 28747 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786402.1 protein_id gnl|my_center|LOCUS_09290 30416 29583 gene locus_tag LOCUS_09300 30416 29583 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_09300 32278 30413 gene locus_tag LOCUS_09310 32278 30413 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_09310 33134 32304 gene locus_tag LOCUS_09320 33134 32304 CDS product DUF3805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786399.1 protein_id gnl|my_center|LOCUS_09320 33659 33276 gene locus_tag LOCUS_09330 33659 33276 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786398.1 protein_id gnl|my_center|LOCUS_09330 35095 33656 gene locus_tag LOCUS_09340 35095 33656 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_09340 36489 35296 gene locus_tag LOCUS_09350 36489 35296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786395.1 protein_id gnl|my_center|LOCUS_09350 36797 37486 gene locus_tag LOCUS_09360 36797 37486 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_09360 37722 39407 gene locus_tag LOCUS_09370 37722 39407 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_09370 41251 39413 gene locus_tag LOCUS_09380 41251 39413 CDS product DUF5724 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202485.1 protein_id gnl|my_center|LOCUS_09380 41346 42281 gene locus_tag LOCUS_09390 41346 42281 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_09390 43386 45422 gene locus_tag LOCUS_09400 43386 45422 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_09400 45469 47511 gene locus_tag LOCUS_09410 45469 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800687.1 protein_id gnl|my_center|LOCUS_09410 47536 48900 gene locus_tag LOCUS_09420 47536 48900 CDS product DUF5074 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202480.1 protein_id gnl|my_center|LOCUS_09420 50553 49015 gene locus_tag LOCUS_09430 50553 49015 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202479.1 protein_id gnl|my_center|LOCUS_09430 51607 50579 gene locus_tag LOCUS_09440 51607 50579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202478.1 protein_id gnl|my_center|LOCUS_09440 52719 51634 gene locus_tag LOCUS_09450 52719 51634 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009127789.1 protein_id gnl|my_center|LOCUS_09450 53584 52763 gene locus_tag LOCUS_09460 53584 52763 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786370.1 protein_id gnl|my_center|LOCUS_09460 53916 54218 gene locus_tag LOCUS_09470 53916 54218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_09470 54232 54447 gene locus_tag LOCUS_09480 54232 54447 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_09480 56859 54532 gene locus_tag LOCUS_09490 56859 54532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202476.1 protein_id gnl|my_center|LOCUS_09490 57530 56856 gene locus_tag LOCUS_09500 57530 56856 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_09500 58891 57545 gene locus_tag LOCUS_09510 58891 57545 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_09510 59485 59027 gene locus_tag LOCUS_09520 gene ssb 59485 59027 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_09520 61090 59573 gene locus_tag LOCUS_09530 61090 59573 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_09530 62233 61187 gene locus_tag LOCUS_09540 gene mutY 62233 61187 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291960.1 protein_id gnl|my_center|LOCUS_09540 62439 62714 gene locus_tag LOCUS_09550 62439 62714 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_09550 62993 64567 gene locus_tag LOCUS_09560 62993 64567 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_09560 64950 64615 gene locus_tag LOCUS_09570 64950 64615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 65278 64952 gene locus_tag LOCUS_09580 65278 64952 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence015 434 507 gene locus_tag LOCUS_t00100 434 507 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1095 1622 gene locus_tag LOCUS_09590 1095 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787699.1 protein_id gnl|my_center|LOCUS_09590 2264 2608 gene locus_tag LOCUS_09600 2264 2608 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_09600 2688 3284 gene locus_tag LOCUS_09610 2688 3284 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_09610 5685 3373 gene locus_tag LOCUS_09620 5685 3373 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_09620 6289 5807 gene locus_tag LOCUS_09630 6289 5807 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787688.1 protein_id gnl|my_center|LOCUS_09630 6687 7448 gene locus_tag LOCUS_09640 6687 7448 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_09640 7731 7402 gene locus_tag LOCUS_09650 7731 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787682.1 protein_id gnl|my_center|LOCUS_09650 8681 7740 gene locus_tag LOCUS_09660 8681 7740 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660240.1 protein_id gnl|my_center|LOCUS_09660 9429 8797 gene locus_tag LOCUS_09670 9429 8797 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_09670 9927 9547 gene locus_tag LOCUS_09680 9927 9547 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_09680 13387 9962 gene locus_tag LOCUS_09690 gene ileS 13387 9962 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_09690 13612 14661 gene locus_tag LOCUS_09700 13612 14661 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202808.1 protein_id gnl|my_center|LOCUS_09700 16036 14795 gene locus_tag LOCUS_09710 16036 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 16320 17207 gene locus_tag LOCUS_09720 16320 17207 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202804.1 protein_id gnl|my_center|LOCUS_09720 17290 17976 gene locus_tag LOCUS_09730 gene ccsA 17290 17976 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787665.1 protein_id gnl|my_center|LOCUS_09730 17992 19383 gene locus_tag LOCUS_09740 17992 19383 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793956.1 protein_id gnl|my_center|LOCUS_09740 19701 19456 gene locus_tag LOCUS_09750 19701 19456 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787659.1 protein_id gnl|my_center|LOCUS_09750 20544 19912 gene locus_tag LOCUS_09760 20544 19912 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_09760 22201 20663 gene locus_tag LOCUS_09770 22201 20663 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_09770 22307 23515 gene locus_tag LOCUS_09780 22307 23515 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_09780 25518 24070 gene locus_tag LOCUS_09790 gene xylE 25518 24070 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_09790 26903 25584 gene locus_tag LOCUS_09800 gene xylA 26903 25584 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787643.1 protein_id gnl|my_center|LOCUS_09800 28498 26993 gene locus_tag LOCUS_09810 28498 26993 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_09810 29282 28551 gene locus_tag LOCUS_09820 29282 28551 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 protein_id gnl|my_center|LOCUS_09820 29624 30457 gene locus_tag LOCUS_09830 gene thiD 29624 30457 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_09830 30504 31448 gene locus_tag LOCUS_09840 gene fabD 30504 31448 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_09840 31654 32802 gene locus_tag LOCUS_09850 gene sucC 31654 32802 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777701.1 protein_id gnl|my_center|LOCUS_09850 32799 33668 gene locus_tag LOCUS_09860 gene sucD 32799 33668 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787631.1 protein_id gnl|my_center|LOCUS_09860 33710 33880 gene locus_tag LOCUS_09870 33710 33880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 34778 34987 gene locus_tag LOCUS_09880 34778 34987 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787623.1 protein_id gnl|my_center|LOCUS_09880 35658 35068 gene locus_tag LOCUS_09890 35658 35068 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793972.1 protein_id gnl|my_center|LOCUS_09890 36564 35803 gene locus_tag LOCUS_09900 36564 35803 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_09900 37169 36588 gene locus_tag LOCUS_09910 37169 36588 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660207.1 protein_id gnl|my_center|LOCUS_09910 38760 37255 gene locus_tag LOCUS_09920 38760 37255 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_09920 38979 40193 gene locus_tag LOCUS_09930 38979 40193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660204.1 protein_id gnl|my_center|LOCUS_09930 40363 41169 gene locus_tag LOCUS_09940 40363 41169 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_09940 41160 42218 gene locus_tag LOCUS_09950 41160 42218 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_09950 42229 43926 gene locus_tag LOCUS_09960 42229 43926 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_09960 46014 44002 gene locus_tag LOCUS_09970 46014 44002 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_09970 46751 46083 gene locus_tag LOCUS_09980 46751 46083 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_09980 47635 47039 gene locus_tag LOCUS_09990 47635 47039 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_09990 48602 47619 gene locus_tag LOCUS_10000 48602 47619 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_10000 49457 48720 gene locus_tag LOCUS_10010 49457 48720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787597.1 protein_id gnl|my_center|LOCUS_10010 50633 50559 gene locus_tag LOCUS_t00110 50633 50559 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52142 50724 gene locus_tag LOCUS_10020 52142 50724 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202795.1 protein_id gnl|my_center|LOCUS_10020 52896 52168 gene locus_tag LOCUS_10030 52896 52168 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_10030 57367 52925 gene locus_tag LOCUS_10040 57367 52925 CDS product DUF5113 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202794.1 protein_id gnl|my_center|LOCUS_10040 57531 58469 gene locus_tag LOCUS_10050 57531 58469 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_10050 59711 58551 gene locus_tag LOCUS_10060 59711 58551 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_10060 61048 59762 gene locus_tag LOCUS_10070 61048 59762 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_10070 61479 61111 gene locus_tag LOCUS_10080 61479 61111 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803454.1 protein_id gnl|my_center|LOCUS_10080 63826 61493 gene locus_tag LOCUS_10090 63826 61493 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_10090 64504 64037 gene locus_tag LOCUS_10100 64504 64037 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803452.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence016 1104 1304 gene locus_tag LOCUS_10110 1104 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1327 1695 gene locus_tag LOCUS_10120 1327 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1894 5025 gene locus_tag LOCUS_10130 1894 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5610 5332 gene locus_tag LOCUS_10140 5610 5332 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311261.1 protein_id gnl|my_center|LOCUS_10140 5961 5668 gene locus_tag LOCUS_10150 5961 5668 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291426.1 protein_id gnl|my_center|LOCUS_10150 6815 7570 gene locus_tag LOCUS_10160 6815 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7573 7785 gene locus_tag LOCUS_10170 7573 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767260.1 protein_id gnl|my_center|LOCUS_10170 7830 8588 gene locus_tag LOCUS_10180 7830 8588 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_10180 8734 9597 gene locus_tag LOCUS_10190 8734 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9850 10443 gene locus_tag LOCUS_10200 9850 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 10847 10647 gene locus_tag LOCUS_10210 10847 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11679 10774 gene locus_tag LOCUS_10220 gene miaA 11679 10774 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_10220 12339 11776 gene locus_tag LOCUS_10230 12339 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_10230 13240 12473 gene locus_tag LOCUS_10240 gene lpxA 13240 12473 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_10240 14636 13251 gene locus_tag LOCUS_10250 14636 13251 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_10250 15680 14640 gene locus_tag LOCUS_10260 gene lpxD 15680 14640 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_10260 16992 15763 gene locus_tag LOCUS_10270 16992 15763 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785125.1 protein_id gnl|my_center|LOCUS_10270 17816 16992 gene locus_tag LOCUS_10280 gene pyrF 17816 16992 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_10280 18977 17865 gene locus_tag LOCUS_10290 gene prfA 18977 17865 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_10290 20207 19041 gene locus_tag LOCUS_10300 20207 19041 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_10300 21374 20793 gene locus_tag LOCUS_10310 21374 20793 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_10310 22389 21469 gene locus_tag LOCUS_10320 22389 21469 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_10320 23341 22391 gene locus_tag LOCUS_10330 23341 22391 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_10330 24085 23342 gene locus_tag LOCUS_10340 24085 23342 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_10340 24849 24112 gene locus_tag LOCUS_10350 gene ubiE 24849 24112 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_10350 25915 24971 gene locus_tag LOCUS_10360 25915 24971 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_10360 26948 25935 gene locus_tag LOCUS_10370 26948 25935 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_10370 27203 27793 gene locus_tag LOCUS_10380 27203 27793 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785158.1 protein_id gnl|my_center|LOCUS_10380 29502 27877 gene locus_tag LOCUS_10390 29502 27877 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_10390 30024 29527 gene locus_tag LOCUS_10400 30024 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785162.1 protein_id gnl|my_center|LOCUS_10400 30179 31966 gene locus_tag LOCUS_10410 gene glaB 30179 31966 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_10410 32037 33152 gene locus_tag LOCUS_10420 32037 33152 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658733.1 protein_id gnl|my_center|LOCUS_10420 33233 33991 gene locus_tag LOCUS_10430 gene truA 33233 33991 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_10430 34023 34922 gene locus_tag LOCUS_10440 34023 34922 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_10440 34950 35603 gene locus_tag LOCUS_10450 34950 35603 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_10450 36669 35584 gene locus_tag LOCUS_10460 36669 35584 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_10460 39990 36691 gene locus_tag LOCUS_10470 39990 36691 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_10470 40942 40052 gene locus_tag LOCUS_10480 40942 40052 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_10480 42448 41054 gene locus_tag LOCUS_10490 42448 41054 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_10490 45820 43553 gene locus_tag LOCUS_10500 45820 43553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 48715 45944 gene locus_tag LOCUS_10510 48715 45944 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_10510 52014 48712 gene locus_tag LOCUS_10520 52014 48712 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_10520 53359 52028 gene locus_tag LOCUS_10530 53359 52028 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_10530 53485 54441 gene locus_tag LOCUS_10540 53485 54441 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_10540 57247 54596 gene locus_tag LOCUS_10550 57247 54596 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202207.1 protein_id gnl|my_center|LOCUS_10550 58790 57354 gene locus_tag LOCUS_10560 58790 57354 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_10560 59698 58802 gene locus_tag LOCUS_10570 59698 58802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 60100 60237 gene locus_tag LOCUS_10580 60100 60237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 61995 60364 gene locus_tag LOCUS_10590 61995 60364 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_10590 <64914 62017 gene locus_tag LOCUS_10600 <64914 62017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202210.1:TonB-dependent receptor >Feature sequence017 184 876 gene locus_tag LOCUS_10610 184 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787535.1 protein_id gnl|my_center|LOCUS_10610 2837 1170 gene locus_tag LOCUS_10620 2837 1170 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_10620 3006 5015 gene locus_tag LOCUS_10630 3006 5015 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202779.1 protein_id gnl|my_center|LOCUS_10630 7159 5042 gene locus_tag LOCUS_10640 7159 5042 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202778.1 protein_id gnl|my_center|LOCUS_10640 7318 8895 gene locus_tag LOCUS_10650 7318 8895 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803428.1 protein_id gnl|my_center|LOCUS_10650 8892 9587 gene locus_tag LOCUS_10660 8892 9587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_10660 9597 10388 gene locus_tag LOCUS_10670 9597 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202776.1 protein_id gnl|my_center|LOCUS_10670 10452 10985 gene locus_tag LOCUS_10680 10452 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787524.1 protein_id gnl|my_center|LOCUS_10680 10998 11888 gene locus_tag LOCUS_10690 10998 11888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_10690 13050 12022 gene locus_tag LOCUS_10700 13050 12022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_10700 14070 13057 gene locus_tag LOCUS_10710 14070 13057 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_10710 15251 14103 gene locus_tag LOCUS_10720 15251 14103 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_10720 15483 15265 gene locus_tag LOCUS_10730 15483 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 15365 16072 gene locus_tag LOCUS_10740 15365 16072 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787514.1 protein_id gnl|my_center|LOCUS_10740 16261 18012 gene locus_tag LOCUS_10750 16261 18012 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555717.1 protein_id gnl|my_center|LOCUS_10750 18876 18202 gene locus_tag LOCUS_10760 18876 18202 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787510.1 protein_id gnl|my_center|LOCUS_10760 20397 19060 gene locus_tag LOCUS_10770 20397 19060 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202771.1 protein_id gnl|my_center|LOCUS_10770 21089 20415 gene locus_tag LOCUS_10780 21089 20415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660145.1 protein_id gnl|my_center|LOCUS_10780 24249 21124 gene locus_tag LOCUS_10790 24249 21124 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202770.1 protein_id gnl|my_center|LOCUS_10790 25314 24265 gene locus_tag LOCUS_10800 25314 24265 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787502.1 protein_id gnl|my_center|LOCUS_10800 26632 25370 gene locus_tag LOCUS_10810 26632 25370 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817697.1 protein_id gnl|my_center|LOCUS_10810 26861 27217 gene locus_tag LOCUS_10820 26861 27217 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787498.1 protein_id gnl|my_center|LOCUS_10820 29909 27375 gene locus_tag LOCUS_10830 29909 27375 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_10830 30939 30067 gene locus_tag LOCUS_10840 30939 30067 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_10840 32544 30961 gene locus_tag LOCUS_10850 gene atpA 32544 30961 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_10850 33118 32558 gene locus_tag LOCUS_10860 33118 32558 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768717.1 protein_id gnl|my_center|LOCUS_10860 33625 33128 gene locus_tag LOCUS_10870 gene atpF 33625 33128 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_10870 33898 33641 gene locus_tag LOCUS_10880 33898 33641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 35076 33925 gene locus_tag LOCUS_10890 gene atpB 35076 33925 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_10890 35488 35060 gene locus_tag LOCUS_10900 35488 35060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787480.1 protein_id gnl|my_center|LOCUS_10900 35767 35522 gene locus_tag LOCUS_10910 gene atpC 35767 35522 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_10910 37296 35779 gene locus_tag LOCUS_10920 gene atpD 37296 35779 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_10920 39105 37939 gene locus_tag LOCUS_10930 gene purT 39105 37939 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202767.1 protein_id gnl|my_center|LOCUS_10930 39753 39998 gene locus_tag LOCUS_10940 39753 39998 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787472.1 protein_id gnl|my_center|LOCUS_10940 41584 40067 gene locus_tag LOCUS_10950 41584 40067 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_10950 41692 43905 gene locus_tag LOCUS_10960 41692 43905 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_10960 43908 44294 gene locus_tag LOCUS_10970 43908 44294 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_10970 45448 44381 gene locus_tag LOCUS_10980 45448 44381 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202766.1 protein_id gnl|my_center|LOCUS_10980 46319 45555 gene locus_tag LOCUS_10990 gene panB 46319 45555 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_10990 47196 46426 gene locus_tag LOCUS_11000 47196 46426 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555716.1 protein_id gnl|my_center|LOCUS_11000 48206 47211 gene locus_tag LOCUS_11010 48206 47211 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202764.1 protein_id gnl|my_center|LOCUS_11010 48940 48278 gene locus_tag LOCUS_11020 48940 48278 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794216.1 protein_id gnl|my_center|LOCUS_11020 49048 50412 gene locus_tag LOCUS_11030 49048 50412 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787452.1 protein_id gnl|my_center|LOCUS_11030 52790 50496 gene locus_tag LOCUS_11040 52790 50496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202763.1 protein_id gnl|my_center|LOCUS_11040 55127 52821 gene locus_tag LOCUS_11050 55127 52821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202762.1 protein_id gnl|my_center|LOCUS_11050 55824 55144 gene locus_tag LOCUS_11060 55824 55144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794222.1 protein_id gnl|my_center|LOCUS_11060 58140 55834 gene locus_tag LOCUS_11070 58140 55834 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768704.1 protein_id gnl|my_center|LOCUS_11070 58395 59204 gene locus_tag LOCUS_11080 58395 59204 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_11080 59218 59889 gene locus_tag LOCUS_11090 59218 59889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794225.1 protein_id gnl|my_center|LOCUS_11090 60027 61358 gene locus_tag LOCUS_11100 60027 61358 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_11100 61355 62668 gene locus_tag LOCUS_11110 61355 62668 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_11110 62784 63449 gene locus_tag LOCUS_11120 62784 63449 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787429.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence018 39 227 gene locus_tag LOCUS_11130 39 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 202 363 gene locus_tag LOCUS_11140 202 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 703 1911 gene locus_tag LOCUS_11150 703 1911 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788030.1 protein_id gnl|my_center|LOCUS_11150 2588 2139 gene locus_tag LOCUS_11160 2588 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788028.1 protein_id gnl|my_center|LOCUS_11160 4750 2822 gene locus_tag LOCUS_11170 gene cbiD 4750 2822 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_11170 6552 4753 gene locus_tag LOCUS_11180 gene cobM 6552 4753 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_11180 7863 6559 gene locus_tag LOCUS_11190 7863 6559 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_11190 9329 7920 gene locus_tag LOCUS_11200 gene cobJ 9329 7920 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_11200 9711 9430 gene locus_tag LOCUS_11210 9711 9430 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_11210 10339 9722 gene locus_tag LOCUS_11220 10339 9722 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788015.1 protein_id gnl|my_center|LOCUS_11220 10919 10359 gene locus_tag LOCUS_11230 10919 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788013.1 protein_id gnl|my_center|LOCUS_11230 14862 10924 gene locus_tag LOCUS_11240 14862 10924 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202905.1 protein_id gnl|my_center|LOCUS_11240 16336 14864 gene locus_tag LOCUS_11250 16336 14864 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768920.1 protein_id gnl|my_center|LOCUS_11250 18690 16336 gene locus_tag LOCUS_11260 18690 16336 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_11260 19604 18687 gene locus_tag LOCUS_11270 19604 18687 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_11270 21632 19608 gene locus_tag LOCUS_11280 21632 19608 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_11280 22827 24515 gene locus_tag LOCUS_11290 22827 24515 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_11290 24642 25409 gene locus_tag LOCUS_11300 24642 25409 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787997.1 protein_id gnl|my_center|LOCUS_11300 25406 25891 gene locus_tag LOCUS_11310 25406 25891 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787995.1 protein_id gnl|my_center|LOCUS_11310 25926 26660 gene locus_tag LOCUS_11320 25926 26660 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793593.1 protein_id gnl|my_center|LOCUS_11320 26744 28066 gene locus_tag LOCUS_11330 26744 28066 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202899.1 protein_id gnl|my_center|LOCUS_11330 28063 28638 gene locus_tag LOCUS_11340 28063 28638 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_11340 28749 31187 gene locus_tag LOCUS_11350 28749 31187 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202898.1 protein_id gnl|my_center|LOCUS_11350 32340 31150 gene locus_tag LOCUS_11360 32340 31150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803622.1 protein_id gnl|my_center|LOCUS_11360 33496 32324 gene locus_tag LOCUS_11370 33496 32324 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202897.1 protein_id gnl|my_center|LOCUS_11370 34638 33640 gene locus_tag LOCUS_11380 34638 33640 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777960.1 protein_id gnl|my_center|LOCUS_11380 36162 34669 gene locus_tag LOCUS_11390 36162 34669 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202896.1 protein_id gnl|my_center|LOCUS_11390 36568 36245 gene locus_tag LOCUS_11400 36568 36245 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793605.1 protein_id gnl|my_center|LOCUS_11400 36912 36565 gene locus_tag LOCUS_11410 36912 36565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202895.1 protein_id gnl|my_center|LOCUS_11410 38440 37649 gene locus_tag LOCUS_11420 38440 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202894.1 protein_id gnl|my_center|LOCUS_11420 39058 40545 gene locus_tag LOCUS_11430 39058 40545 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_11430 40538 41551 gene locus_tag LOCUS_11440 gene cobD 40538 41551 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_11440 41578 42543 gene locus_tag LOCUS_11450 gene cbiB 41578 42543 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_11450 43066 42521 gene locus_tag LOCUS_11460 gene cobC 43066 42521 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_11460 43812 43069 gene locus_tag LOCUS_11470 43812 43069 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_11470 44862 43825 gene locus_tag LOCUS_11480 gene cobT 44862 43825 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_11480 45484 44885 gene locus_tag LOCUS_11490 gene cobU 45484 44885 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_11490 45549 45622 gene locus_tag LOCUS_t00120 45549 45622 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45775 49008 gene locus_tag LOCUS_11500 45775 49008 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_11500 49140 49874 gene locus_tag LOCUS_11510 49140 49874 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_11510 50169 51662 gene locus_tag LOCUS_11520 gene proS 50169 51662 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_11520 51755 52135 gene locus_tag LOCUS_11530 51755 52135 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_11530 56835 52231 gene locus_tag LOCUS_11540 56835 52231 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_11540 56868 57887 gene locus_tag LOCUS_11550 gene tsaD 56868 57887 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_11550 57895 59127 gene locus_tag LOCUS_11560 57895 59127 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_11560 59249 59509 gene locus_tag LOCUS_11570 gene rpmB 59249 59509 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_11570 59536 59724 gene locus_tag LOCUS_11580 gene rpmG 59536 59724 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_11580 59744 59902 gene locus_tag LOCUS_11590 59744 59902 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_11590 60052 61011 gene locus_tag LOCUS_11600 gene ftsY 60052 61011 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence019 338 2566 gene locus_tag LOCUS_11610 gene pflB 338 2566 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786073.1 protein_id gnl|my_center|LOCUS_11610 2598 3296 gene locus_tag LOCUS_11620 gene pflA 2598 3296 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202364.1 protein_id gnl|my_center|LOCUS_11620 4790 3528 gene locus_tag LOCUS_11630 4790 3528 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_11630 5390 4842 gene locus_tag LOCUS_11640 5390 4842 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_11640 5578 6330 gene locus_tag LOCUS_11650 5578 6330 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786065.1 protein_id gnl|my_center|LOCUS_11650 7433 6435 gene locus_tag LOCUS_11660 7433 6435 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816458.1 protein_id gnl|my_center|LOCUS_11660 7503 7976 gene locus_tag LOCUS_11670 7503 7976 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786060.1 protein_id gnl|my_center|LOCUS_11670 9078 8080 gene locus_tag LOCUS_11680 9078 8080 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_11680 10401 9133 gene locus_tag LOCUS_11690 10401 9133 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_11690 11664 10651 gene locus_tag LOCUS_11700 11664 10651 CDS product DUF1735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202362.1 protein_id gnl|my_center|LOCUS_11700 12772 11687 gene locus_tag LOCUS_11710 12772 11687 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202361.1 protein_id gnl|my_center|LOCUS_11710 13893 12841 gene locus_tag LOCUS_11720 13893 12841 CDS product glycoside hydrolase family 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786048.1 protein_id gnl|my_center|LOCUS_11720 15465 13921 gene locus_tag LOCUS_11730 15465 13921 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786046.1 protein_id gnl|my_center|LOCUS_11730 18729 15478 gene locus_tag LOCUS_11740 18729 15478 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786045.1 protein_id gnl|my_center|LOCUS_11740 20140 19094 gene locus_tag LOCUS_11750 20140 19094 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768135.1 protein_id gnl|my_center|LOCUS_11750 20270 20869 gene locus_tag LOCUS_11760 20270 20869 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786040.1 protein_id gnl|my_center|LOCUS_11760 22912 20846 gene locus_tag LOCUS_11770 22912 20846 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202360.1 protein_id gnl|my_center|LOCUS_11770 23741 22884 gene locus_tag LOCUS_11780 23741 22884 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_11780 24876 23812 gene locus_tag LOCUS_11790 24876 23812 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_11790 25939 24920 gene locus_tag LOCUS_11800 25939 24920 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_11800 26812 25988 gene locus_tag LOCUS_11810 gene menB 26812 25988 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_11810 27838 26834 gene locus_tag LOCUS_11820 27838 26834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_11820 29507 27840 gene locus_tag LOCUS_11830 gene menD 29507 27840 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_11830 30634 29528 gene locus_tag LOCUS_11840 30634 29528 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_11840 31863 30631 gene locus_tag LOCUS_11850 31863 30631 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786023.1 protein_id gnl|my_center|LOCUS_11850 34004 32430 gene locus_tag LOCUS_11860 34004 32430 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_11860 34892 34029 gene locus_tag LOCUS_11870 gene rfbD 34892 34029 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_11870 35573 35028 gene locus_tag LOCUS_11880 35573 35028 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_11880 36245 35592 gene locus_tag LOCUS_11890 36245 35592 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_11890 38551 36287 gene locus_tag LOCUS_11900 38551 36287 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_11900 39292 38627 gene locus_tag LOCUS_11910 39292 38627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800928.1 protein_id gnl|my_center|LOCUS_11910 40341 39352 gene locus_tag LOCUS_11920 40341 39352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 43184 42099 gene locus_tag LOCUS_11930 gene gcvT 43184 42099 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_11930 44441 43218 gene locus_tag LOCUS_11940 gene pepT 44441 43218 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_11940 45979 44573 gene locus_tag LOCUS_11950 45979 44573 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_11950 46455 46063 gene locus_tag LOCUS_11960 46455 46063 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202355.1 protein_id gnl|my_center|LOCUS_11960 46906 48075 gene locus_tag LOCUS_11970 46906 48075 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786002.1 protein_id gnl|my_center|LOCUS_11970 48566 48135 gene locus_tag LOCUS_11980 48566 48135 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_11980 50515 48569 gene locus_tag LOCUS_11990 50515 48569 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795578.1 protein_id gnl|my_center|LOCUS_11990 51667 50633 gene locus_tag LOCUS_12000 51667 50633 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_12000 54210 51832 gene locus_tag LOCUS_12010 54210 51832 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795582.1 protein_id gnl|my_center|LOCUS_12010 54479 55978 gene locus_tag LOCUS_12020 54479 55978 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202352.1 protein_id gnl|my_center|LOCUS_12020 56419 56096 gene locus_tag LOCUS_12030 56419 56096 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795584.1 protein_id gnl|my_center|LOCUS_12030 57482 56595 gene locus_tag LOCUS_12040 57482 56595 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795585.1 protein_id gnl|my_center|LOCUS_12040 58527 57487 gene locus_tag LOCUS_12050 58527 57487 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_12050 58810 59379 gene locus_tag LOCUS_12060 58810 59379 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795589.1 protein_id gnl|my_center|LOCUS_12060 59641 60363 gene locus_tag LOCUS_12070 59641 60363 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_12070 61763 60705 gene locus_tag LOCUS_12080 61763 60705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202350.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence020 1607 93 gene locus_tag LOCUS_12090 gene gpmI 1607 93 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_12090 1893 2819 gene locus_tag LOCUS_12100 1893 2819 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_12100 3432 2827 gene locus_tag LOCUS_12110 3432 2827 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_12110 5774 3648 gene locus_tag LOCUS_12120 5774 3648 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_12120 6530 5976 gene locus_tag LOCUS_12130 6530 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201925.1 protein_id gnl|my_center|LOCUS_12130 6774 8933 gene locus_tag LOCUS_12140 6774 8933 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_12140 9143 9706 gene locus_tag LOCUS_12150 9143 9706 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_12150 9793 10941 gene locus_tag LOCUS_12160 9793 10941 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201912.1 protein_id gnl|my_center|LOCUS_12160 11107 14505 gene locus_tag LOCUS_12170 11107 14505 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201911.1 protein_id gnl|my_center|LOCUS_12170 14520 16364 gene locus_tag LOCUS_12180 14520 16364 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813804.1 protein_id gnl|my_center|LOCUS_12180 16546 18048 gene locus_tag LOCUS_12190 16546 18048 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796777.1 protein_id gnl|my_center|LOCUS_12190 18443 18123 gene locus_tag LOCUS_12200 18443 18123 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_12200 19982 18741 gene locus_tag LOCUS_12210 19982 18741 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_12210 21319 19964 gene locus_tag LOCUS_12220 gene sufD 21319 19964 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_12220 22068 21316 gene locus_tag LOCUS_12230 gene sufC 22068 21316 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_12230 22838 22092 gene locus_tag LOCUS_12240 22838 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796779.1 protein_id gnl|my_center|LOCUS_12240 24295 22838 gene locus_tag LOCUS_12250 gene sufB 24295 22838 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_12250 24801 24298 gene locus_tag LOCUS_12260 24801 24298 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_12260 27923 24876 gene locus_tag LOCUS_12270 gene infB 27923 24876 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_12270 29306 28044 gene locus_tag LOCUS_12280 gene nusA 29306 28044 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_12280 29776 29309 gene locus_tag LOCUS_12290 gene rimP 29776 29309 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_12290 31131 29914 gene locus_tag LOCUS_12300 31131 29914 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201908.1 protein_id gnl|my_center|LOCUS_12300 32312 31128 gene locus_tag LOCUS_12310 32312 31128 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201907.1 protein_id gnl|my_center|LOCUS_12310 33433 32450 gene locus_tag LOCUS_12320 33433 32450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783913.1 protein_id gnl|my_center|LOCUS_12320 34898 33567 gene locus_tag LOCUS_12330 gene fucP 34898 33567 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_12330 36322 34910 gene locus_tag LOCUS_12340 36322 34910 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_12340 36978 36340 gene locus_tag LOCUS_12350 36978 36340 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783908.1 protein_id gnl|my_center|LOCUS_12350 38129 36975 gene locus_tag LOCUS_12360 gene fucO 38129 36975 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_12360 39920 38148 gene locus_tag LOCUS_12370 gene fucI 39920 38148 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_12370 40973 39993 gene locus_tag LOCUS_12380 40973 39993 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783903.1 protein_id gnl|my_center|LOCUS_12380 41738 41178 gene locus_tag LOCUS_12390 41738 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657987.1 protein_id gnl|my_center|LOCUS_12390 42819 41725 gene locus_tag LOCUS_12400 42819 41725 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032532492.1 protein_id gnl|my_center|LOCUS_12400 43246 42980 gene locus_tag LOCUS_12410 43246 42980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 43654 43427 gene locus_tag LOCUS_12420 43654 43427 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783893.1 protein_id gnl|my_center|LOCUS_12420 44933 43815 gene locus_tag LOCUS_12430 44933 43815 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298120.1 protein_id gnl|my_center|LOCUS_12430 44977 45375 gene locus_tag LOCUS_12440 44977 45375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801898.1 protein_id gnl|my_center|LOCUS_12440 46235 45537 gene locus_tag LOCUS_12450 46235 45537 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_12450 46356 47090 gene locus_tag LOCUS_12460 46356 47090 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801900.1 protein_id gnl|my_center|LOCUS_12460 47110 47889 gene locus_tag LOCUS_12470 47110 47889 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_12470 48526 48077 gene locus_tag LOCUS_12480 48526 48077 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801902.1 protein_id gnl|my_center|LOCUS_12480 49073 48558 gene locus_tag LOCUS_12490 49073 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_12490 49566 49057 gene locus_tag LOCUS_12500 49566 49057 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_12500 50413 49628 gene locus_tag LOCUS_12510 gene argB 50413 49628 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_12510 52433 50541 gene locus_tag LOCUS_12520 gene speA 52433 50541 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_12520 53570 52491 gene locus_tag LOCUS_12530 53570 52491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201904.1 protein_id gnl|my_center|LOCUS_12530 55345 53579 gene locus_tag LOCUS_12540 55345 53579 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201903.1 protein_id gnl|my_center|LOCUS_12540 57851 55353 gene locus_tag LOCUS_12550 57851 55353 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201902.1 protein_id gnl|my_center|LOCUS_12550 58537 57998 gene locus_tag LOCUS_12560 58537 57998 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_12560 58794 58642 gene locus_tag LOCUS_12570 58794 58642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768171.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence021 260 1525 gene locus_tag LOCUS_12580 260 1525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789653.1 protein_id gnl|my_center|LOCUS_12580 2250 1522 gene locus_tag LOCUS_12590 2250 1522 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_12590 2967 2269 gene locus_tag LOCUS_12600 2967 2269 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789656.1 protein_id gnl|my_center|LOCUS_12600 3936 3097 gene locus_tag LOCUS_12610 3936 3097 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_12610 6193 4004 gene locus_tag LOCUS_12620 6193 4004 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789660.1 protein_id gnl|my_center|LOCUS_12620 7950 6898 gene locus_tag LOCUS_12630 7950 6898 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_12630 8148 9473 gene locus_tag LOCUS_12640 8148 9473 CDS product DUF4270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769575.1 protein_id gnl|my_center|LOCUS_12640 9557 10675 gene locus_tag LOCUS_12650 9557 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203253.1 protein_id gnl|my_center|LOCUS_12650 11135 10677 gene locus_tag LOCUS_12660 11135 10677 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789670.1 protein_id gnl|my_center|LOCUS_12660 12527 11148 gene locus_tag LOCUS_12670 12527 11148 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789673.1 protein_id gnl|my_center|LOCUS_12670 15670 12545 gene locus_tag LOCUS_12680 15670 12545 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203255.1 protein_id gnl|my_center|LOCUS_12680 16698 15670 gene locus_tag LOCUS_12690 16698 15670 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203256.1 protein_id gnl|my_center|LOCUS_12690 16908 17786 gene locus_tag LOCUS_12700 16908 17786 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789684.1 protein_id gnl|my_center|LOCUS_12700 17876 19060 gene locus_tag LOCUS_12710 17876 19060 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_12710 19979 19242 gene locus_tag LOCUS_12720 19979 19242 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_12720 21145 19976 gene locus_tag LOCUS_12730 21145 19976 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_12730 21335 22015 gene locus_tag LOCUS_12740 21335 22015 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203257.1 protein_id gnl|my_center|LOCUS_12740 22908 26063 gene locus_tag LOCUS_12750 22908 26063 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203258.1 protein_id gnl|my_center|LOCUS_12750 26078 27769 gene locus_tag LOCUS_12760 26078 27769 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798974.1 protein_id gnl|my_center|LOCUS_12760 27846 29726 gene locus_tag LOCUS_12770 27846 29726 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_12770 30126 30998 gene locus_tag LOCUS_12780 30126 30998 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_12780 31014 32033 gene locus_tag LOCUS_12790 31014 32033 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_12790 32037 33740 gene locus_tag LOCUS_12800 32037 33740 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_12800 33973 37998 gene locus_tag LOCUS_12810 33973 37998 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_12810 38455 38144 gene locus_tag LOCUS_12820 38455 38144 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_12820 39412 38471 gene locus_tag LOCUS_12830 39412 38471 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_12830 41345 39714 gene locus_tag LOCUS_12840 41345 39714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555793.1 protein_id gnl|my_center|LOCUS_12840 43236 41536 gene locus_tag LOCUS_12850 43236 41536 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_12850 44443 43223 gene locus_tag LOCUS_12860 44443 43223 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_12860 44813 44529 gene locus_tag LOCUS_12870 44813 44529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 45185 47398 gene locus_tag LOCUS_12880 45185 47398 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203264.1 protein_id gnl|my_center|LOCUS_12880 48531 47518 gene locus_tag LOCUS_12890 48531 47518 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798984.1 protein_id gnl|my_center|LOCUS_12890 48992 48621 gene locus_tag LOCUS_12900 48992 48621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203265.1 protein_id gnl|my_center|LOCUS_12900 49543 48992 gene locus_tag LOCUS_12910 49543 48992 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_12910 49674 50102 gene locus_tag LOCUS_12920 49674 50102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789733.1 protein_id gnl|my_center|LOCUS_12920 50443 50225 gene locus_tag LOCUS_12930 50443 50225 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_12930 50684 52423 gene locus_tag LOCUS_12940 50684 52423 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_12940 53219 52644 gene locus_tag LOCUS_12950 53219 52644 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789736.1 protein_id gnl|my_center|LOCUS_12950 53908 53417 gene locus_tag LOCUS_12960 53908 53417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 54258 53893 gene locus_tag LOCUS_12970 54258 53893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12970 55578 54466 gene locus_tag LOCUS_12980 55578 54466 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203270.1 protein_id gnl|my_center|LOCUS_12980 57404 55767 gene locus_tag LOCUS_12990 gene groL 57404 55767 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_12990 57719 57447 gene locus_tag LOCUS_13000 57719 57447 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789740.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence022 4 77 gene locus_tag LOCUS_t00130 4 77 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 314 1219 gene locus_tag LOCUS_13010 314 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 1225 1542 gene locus_tag LOCUS_13020 1225 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 1910 1608 gene locus_tag LOCUS_13030 1910 1608 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108660.1 protein_id gnl|my_center|LOCUS_13030 2213 1917 gene locus_tag LOCUS_13040 2213 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2759 2466 gene locus_tag LOCUS_13050 2759 2466 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202095.1 protein_id gnl|my_center|LOCUS_13050 3134 2841 gene locus_tag LOCUS_13060 3134 2841 CDS product DUF3876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478799.1 protein_id gnl|my_center|LOCUS_13060 3435 3121 gene locus_tag LOCUS_13070 3435 3121 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478800.1 protein_id gnl|my_center|LOCUS_13070 3649 4272 gene locus_tag LOCUS_13080 3649 4272 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971537.1 protein_id gnl|my_center|LOCUS_13080 4262 5218 gene locus_tag LOCUS_13090 4262 5218 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_13090 5284 6006 gene locus_tag LOCUS_13100 5284 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6003 6527 gene locus_tag LOCUS_13110 6003 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6858 7238 gene locus_tag LOCUS_13120 6858 7238 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162173703.1 protein_id gnl|my_center|LOCUS_13120 7394 7726 gene locus_tag LOCUS_13130 7394 7726 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_13130 8011 8595 gene locus_tag LOCUS_13140 8011 8595 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_13140 8600 9553 gene locus_tag LOCUS_13150 8600 9553 CDS product DUF5712 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_13150 9601 10239 gene locus_tag LOCUS_13160 9601 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10243 11274 gene locus_tag LOCUS_13170 10243 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12318 11680 gene locus_tag LOCUS_13180 12318 11680 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203326.1 protein_id gnl|my_center|LOCUS_13180 12919 12296 gene locus_tag LOCUS_13190 12919 12296 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_13190 13449 12940 gene locus_tag LOCUS_13200 13449 12940 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790192.1 protein_id gnl|my_center|LOCUS_13200 13562 14401 gene locus_tag LOCUS_13210 13562 14401 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_13210 18316 14435 gene locus_tag LOCUS_13220 18316 14435 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203327.1 protein_id gnl|my_center|LOCUS_13220 20487 18718 gene locus_tag LOCUS_13230 20487 18718 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657202.1 protein_id gnl|my_center|LOCUS_13230 20887 22851 gene locus_tag LOCUS_13240 20887 22851 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_13240 24557 22965 gene locus_tag LOCUS_13250 24557 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203329.1 protein_id gnl|my_center|LOCUS_13250 25549 24563 gene locus_tag LOCUS_13260 25549 24563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_13260 27507 25642 gene locus_tag LOCUS_13270 27507 25642 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_13270 30617 27528 gene locus_tag LOCUS_13280 30617 27528 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203330.1 protein_id gnl|my_center|LOCUS_13280 32013 30814 gene locus_tag LOCUS_13290 32013 30814 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797749.1 protein_id gnl|my_center|LOCUS_13290 32598 33140 gene locus_tag LOCUS_13300 32598 33140 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797752.1 protein_id gnl|my_center|LOCUS_13300 34434 33148 gene locus_tag LOCUS_13310 34434 33148 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790215.1 protein_id gnl|my_center|LOCUS_13310 34747 35073 gene locus_tag LOCUS_13320 34747 35073 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_13320 35182 35844 gene locus_tag LOCUS_13330 gene ung 35182 35844 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802535.1 protein_id gnl|my_center|LOCUS_13330 36236 36787 gene locus_tag LOCUS_13340 36236 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 37068 38957 gene locus_tag LOCUS_13350 37068 38957 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203331.1 protein_id gnl|my_center|LOCUS_13350 39147 39746 gene locus_tag LOCUS_13360 39147 39746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797760.1 protein_id gnl|my_center|LOCUS_13360 40720 39983 gene locus_tag LOCUS_13370 gene ric 40720 39983 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_13370 41419 40955 gene locus_tag LOCUS_13380 41419 40955 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_13380 41857 41483 gene locus_tag LOCUS_13390 41857 41483 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790233.1 protein_id gnl|my_center|LOCUS_13390 42727 41867 gene locus_tag LOCUS_13400 42727 41867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769810.1 protein_id gnl|my_center|LOCUS_13400 43664 44443 gene locus_tag LOCUS_13410 43664 44443 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203333.1 protein_id gnl|my_center|LOCUS_13410 47759 44847 gene locus_tag LOCUS_13420 47759 44847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203334.1 protein_id gnl|my_center|LOCUS_13420 48445 47882 gene locus_tag LOCUS_13430 48445 47882 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790242.1 protein_id gnl|my_center|LOCUS_13430 48804 48442 gene locus_tag LOCUS_13440 48804 48442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790245.1 protein_id gnl|my_center|LOCUS_13440 49458 48823 gene locus_tag LOCUS_13450 49458 48823 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790247.1 protein_id gnl|my_center|LOCUS_13450 51153 49471 gene locus_tag LOCUS_13460 51153 49471 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802525.1 protein_id gnl|my_center|LOCUS_13460 52971 51277 gene locus_tag LOCUS_13470 52971 51277 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802524.1 protein_id gnl|my_center|LOCUS_13470 54764 52998 gene locus_tag LOCUS_13480 54764 52998 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790254.1 protein_id gnl|my_center|LOCUS_13480 55661 54810 gene locus_tag LOCUS_13490 55661 54810 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203337.1 protein_id gnl|my_center|LOCUS_13490 57107 55839 gene locus_tag LOCUS_13500 57107 55839 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993377.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence023 2368 344 gene locus_tag LOCUS_13510 2368 344 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202218.1 protein_id gnl|my_center|LOCUS_13510 5590 2384 gene locus_tag LOCUS_13520 5590 2384 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202219.1 protein_id gnl|my_center|LOCUS_13520 8624 6582 gene locus_tag LOCUS_13530 8624 6582 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791957.1 protein_id gnl|my_center|LOCUS_13530 10326 8638 gene locus_tag LOCUS_13540 10326 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13540 11809 10271 gene locus_tag LOCUS_13550 11809 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 12823 13680 gene locus_tag LOCUS_13560 12823 13680 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_13560 13685 14698 gene locus_tag LOCUS_13570 gene gldB 13685 14698 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_13570 14725 15429 gene locus_tag LOCUS_13580 14725 15429 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_13580 16513 15395 gene locus_tag LOCUS_13590 16513 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785267.1 protein_id gnl|my_center|LOCUS_13590 17444 16578 gene locus_tag LOCUS_13600 gene lipA 17444 16578 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_13600 19781 17571 gene locus_tag LOCUS_13610 19781 17571 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_13610 20219 20947 gene locus_tag LOCUS_13620 20219 20947 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_13620 20957 21799 gene locus_tag LOCUS_13630 20957 21799 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202222.1 protein_id gnl|my_center|LOCUS_13630 22133 23068 gene locus_tag LOCUS_13640 22133 23068 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202224.1 protein_id gnl|my_center|LOCUS_13640 23187 24386 gene locus_tag LOCUS_13650 23187 24386 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_13650 24426 25238 gene locus_tag LOCUS_13660 gene nagB 24426 25238 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_13660 25757 25332 gene locus_tag LOCUS_13670 25757 25332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785284.1 protein_id gnl|my_center|LOCUS_13670 26435 25821 gene locus_tag LOCUS_13680 26435 25821 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_13680 28996 26483 gene locus_tag LOCUS_13690 28996 26483 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202225.1 protein_id gnl|my_center|LOCUS_13690 31234 29234 gene locus_tag LOCUS_13700 31234 29234 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_13700 32021 31236 gene locus_tag LOCUS_13710 32021 31236 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_13710 32193 33377 gene locus_tag LOCUS_13720 32193 33377 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_13720 33409 34644 gene locus_tag LOCUS_13730 33409 34644 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_13730 34670 35251 gene locus_tag LOCUS_13740 34670 35251 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795958.1 protein_id gnl|my_center|LOCUS_13740 35361 36467 gene locus_tag LOCUS_13750 35361 36467 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795956.1 protein_id gnl|my_center|LOCUS_13750 36785 37093 gene locus_tag LOCUS_13760 36785 37093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 37789 37106 gene locus_tag LOCUS_13770 37789 37106 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813083.1 protein_id gnl|my_center|LOCUS_13770 37965 38561 gene locus_tag LOCUS_13780 37965 38561 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_13780 39207 38599 gene locus_tag LOCUS_13790 39207 38599 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_13790 39447 41387 gene locus_tag LOCUS_13800 39447 41387 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_13800 41402 42676 gene locus_tag LOCUS_13810 41402 42676 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_13810 42689 44077 gene locus_tag LOCUS_13820 42689 44077 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_13820 45953 44463 gene locus_tag LOCUS_13830 45953 44463 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_13830 46801 45977 gene locus_tag LOCUS_13840 46801 45977 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_13840 47048 47896 gene locus_tag LOCUS_13850 gene panC 47048 47896 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_13850 47919 48272 gene locus_tag LOCUS_13860 47919 48272 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_13860 50743 48455 gene locus_tag LOCUS_13870 50743 48455 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202231.1 protein_id gnl|my_center|LOCUS_13870 52097 50886 gene locus_tag LOCUS_13880 gene gluP 52097 50886 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_13880 53571 52297 gene locus_tag LOCUS_13890 gene serS 53571 52297 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence024 2205 700 gene locus_tag LOCUS_13900 2205 700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657265.1 protein_id gnl|my_center|LOCUS_13900 6143 2385 gene locus_tag LOCUS_13910 6143 2385 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_13910 6728 6336 gene locus_tag LOCUS_13920 6728 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790349.1 protein_id gnl|my_center|LOCUS_13920 6859 7836 gene locus_tag LOCUS_13930 6859 7836 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790351.1 protein_id gnl|my_center|LOCUS_13930 7911 8780 gene locus_tag LOCUS_13940 7911 8780 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 protein_id gnl|my_center|LOCUS_13940 14643 8770 gene locus_tag LOCUS_13950 14643 8770 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_13950 15133 14762 gene locus_tag LOCUS_13960 15133 14762 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797821.1 protein_id gnl|my_center|LOCUS_13960 15358 16026 gene locus_tag LOCUS_13970 15358 16026 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802487.1 protein_id gnl|my_center|LOCUS_13970 16844 16029 gene locus_tag LOCUS_13980 16844 16029 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804815.1 protein_id gnl|my_center|LOCUS_13980 18075 16810 gene locus_tag LOCUS_13990 18075 16810 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802486.1 protein_id gnl|my_center|LOCUS_13990 18971 18072 gene locus_tag LOCUS_14000 18971 18072 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_14000 19143 20228 gene locus_tag LOCUS_14010 gene msrB 19143 20228 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203359.1 protein_id gnl|my_center|LOCUS_14010 20568 20392 gene locus_tag LOCUS_14020 20568 20392 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_14020 20717 21358 gene locus_tag LOCUS_14030 20717 21358 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_14030 21394 22773 gene locus_tag LOCUS_14040 21394 22773 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_14040 22874 23512 gene locus_tag LOCUS_14050 22874 23512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_14050 23727 25745 gene locus_tag LOCUS_14060 23727 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203361.1 protein_id gnl|my_center|LOCUS_14060 27161 25836 gene locus_tag LOCUS_14070 27161 25836 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790376.1 protein_id gnl|my_center|LOCUS_14070 27875 27168 gene locus_tag LOCUS_14080 27875 27168 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_14080 27982 28572 gene locus_tag LOCUS_14090 27982 28572 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_14090 28575 28928 gene locus_tag LOCUS_14100 28575 28928 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790381.1 protein_id gnl|my_center|LOCUS_14100 28994 29067 gene locus_tag LOCUS_t00140 28994 29067 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 30286 29117 gene locus_tag LOCUS_14110 30286 29117 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814671.1 protein_id gnl|my_center|LOCUS_14110 30858 30283 gene locus_tag LOCUS_14120 30858 30283 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_14120 31530 30859 gene locus_tag LOCUS_14130 31530 30859 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212702053.1 protein_id gnl|my_center|LOCUS_14130 32496 31540 gene locus_tag LOCUS_14140 32496 31540 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790388.1 protein_id gnl|my_center|LOCUS_14140 33149 32493 gene locus_tag LOCUS_14150 33149 32493 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790391.1 protein_id gnl|my_center|LOCUS_14150 33340 35172 gene locus_tag LOCUS_14160 33340 35172 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_14160 35375 35689 gene locus_tag LOCUS_14170 35375 35689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797835.1 protein_id gnl|my_center|LOCUS_14170 36762 35890 gene locus_tag LOCUS_14180 36762 35890 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_14180 37411 36833 gene locus_tag LOCUS_14190 37411 36833 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_14190 38793 37408 gene locus_tag LOCUS_14200 38793 37408 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790403.1 protein_id gnl|my_center|LOCUS_14200 39530 38790 gene locus_tag LOCUS_14210 39530 38790 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_14210 40212 39667 gene locus_tag LOCUS_14220 40212 39667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817247.1 protein_id gnl|my_center|LOCUS_14220 40510 40199 gene locus_tag LOCUS_14230 gene queD 40510 40199 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_14230 40648 41010 gene locus_tag LOCUS_14240 40648 41010 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790413.1 protein_id gnl|my_center|LOCUS_14240 41543 40977 gene locus_tag LOCUS_14250 41543 40977 CDS product MTA/SAH nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203366.1 protein_id gnl|my_center|LOCUS_14250 41696 42865 gene locus_tag LOCUS_14260 41696 42865 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790418.1 protein_id gnl|my_center|LOCUS_14260 43425 42943 gene locus_tag LOCUS_14270 43425 42943 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790420.1 protein_id gnl|my_center|LOCUS_14270 44290 43535 gene locus_tag LOCUS_14280 44290 43535 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_14280 45916 44381 gene locus_tag LOCUS_14290 gene rny 45916 44381 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_14290 46318 46025 gene locus_tag LOCUS_14300 46318 46025 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790425.1 protein_id gnl|my_center|LOCUS_14300 46648 46334 gene locus_tag LOCUS_14310 46648 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_14310 46983 46807 gene locus_tag LOCUS_14320 46983 46807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 46967 49255 gene locus_tag LOCUS_14330 46967 49255 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_14330 49593 50927 gene locus_tag LOCUS_14340 49593 50927 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_14340 51577 52116 gene locus_tag LOCUS_14350 51577 52116 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769868.1 protein_id gnl|my_center|LOCUS_14350 52163 53152 gene locus_tag LOCUS_14360 52163 53152 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802446.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence025 432 875 gene locus_tag LOCUS_14370 432 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792008.1 protein_id gnl|my_center|LOCUS_14370 1015 1827 gene locus_tag LOCUS_14380 1015 1827 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_14380 1855 2460 gene locus_tag LOCUS_14390 1855 2460 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_14390 2473 3123 gene locus_tag LOCUS_14400 2473 3123 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_14400 3153 3968 gene locus_tag LOCUS_14410 3153 3968 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_14410 3971 4918 gene locus_tag LOCUS_14420 3971 4918 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_14420 4938 6371 gene locus_tag LOCUS_14430 4938 6371 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_14430 6677 7537 gene locus_tag LOCUS_14440 6677 7537 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_14440 7534 8349 gene locus_tag LOCUS_14450 7534 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791993.1 protein_id gnl|my_center|LOCUS_14450 8365 8733 gene locus_tag LOCUS_14460 8365 8733 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_14460 8746 9543 gene locus_tag LOCUS_14470 8746 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203593.1 protein_id gnl|my_center|LOCUS_14470 9807 10955 gene locus_tag LOCUS_14480 9807 10955 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203592.1 protein_id gnl|my_center|LOCUS_14480 10991 11845 gene locus_tag LOCUS_14490 10991 11845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661347.1 protein_id gnl|my_center|LOCUS_14490 11842 12615 gene locus_tag LOCUS_14500 11842 12615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661346.1 protein_id gnl|my_center|LOCUS_14500 12790 14271 gene locus_tag LOCUS_14510 12790 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203591.1 protein_id gnl|my_center|LOCUS_14510 14834 14761 gene locus_tag LOCUS_t00150 14834 14761 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15073 15669 gene locus_tag LOCUS_14520 15073 15669 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_14520 15682 16428 gene locus_tag LOCUS_14530 gene fabG 15682 16428 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_14530 16437 17102 gene locus_tag LOCUS_14540 16437 17102 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_14540 17535 17251 gene locus_tag LOCUS_14550 17535 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792016.1 protein_id gnl|my_center|LOCUS_14550 19091 17748 gene locus_tag LOCUS_14560 19091 17748 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_14560 19185 20024 gene locus_tag LOCUS_14570 19185 20024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_14570 20027 21289 gene locus_tag LOCUS_14580 20027 21289 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_14580 21273 22598 gene locus_tag LOCUS_14590 21273 22598 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_14590 22602 24902 gene locus_tag LOCUS_14600 22602 24902 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792029.1 protein_id gnl|my_center|LOCUS_14600 25016 29560 gene locus_tag LOCUS_14610 25016 29560 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_14610 29645 31939 gene locus_tag LOCUS_14620 29645 31939 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_14620 32066 32968 gene locus_tag LOCUS_14630 32066 32968 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_14630 33845 36235 gene locus_tag LOCUS_14640 33845 36235 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203583.1 protein_id gnl|my_center|LOCUS_14640 36463 38418 gene locus_tag LOCUS_14650 36463 38418 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799194.1 protein_id gnl|my_center|LOCUS_14650 38476 40467 gene locus_tag LOCUS_14660 38476 40467 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_14660 40619 42142 gene locus_tag LOCUS_14670 gene purH 40619 42142 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_14670 42217 43239 gene locus_tag LOCUS_14680 42217 43239 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_14680 43341 44186 gene locus_tag LOCUS_14690 gene mreC 43341 44186 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_14690 44183 44680 gene locus_tag LOCUS_14700 gene mreD 44183 44680 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_14700 44683 46539 gene locus_tag LOCUS_14710 gene mrdA 44683 46539 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_14710 46520 47977 gene locus_tag LOCUS_14720 gene rodA 46520 47977 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_14720 48412 47972 gene locus_tag LOCUS_14730 48412 47972 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_14730 49877 48420 gene locus_tag LOCUS_14740 gene ricT 49877 48420 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_14740 51003 49894 gene locus_tag LOCUS_14750 51003 49894 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_14750 51960 51007 gene locus_tag LOCUS_14760 gene metF 51960 51007 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence026 213 3248 gene locus_tag LOCUS_14770 213 3248 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202099.1 protein_id gnl|my_center|LOCUS_14770 3266 4780 gene locus_tag LOCUS_14780 3266 4780 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_14780 5342 8245 gene locus_tag LOCUS_14790 5342 8245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_14790 8280 9674 gene locus_tag LOCUS_14800 8280 9674 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_14800 9791 11044 gene locus_tag LOCUS_14810 gene hflX 9791 11044 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_14810 11069 13060 gene locus_tag LOCUS_14820 11069 13060 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_14820 13090 15603 gene locus_tag LOCUS_14830 13090 15603 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_14830 16027 17673 gene locus_tag LOCUS_14840 16027 17673 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_14840 17810 18955 gene locus_tag LOCUS_14850 17810 18955 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992113.1 protein_id gnl|my_center|LOCUS_14850 19034 21136 gene locus_tag LOCUS_14860 19034 21136 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_14860 22896 21229 gene locus_tag LOCUS_14870 22896 21229 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_14870 24749 23424 gene locus_tag LOCUS_14880 24749 23424 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_14880 27781 24746 gene locus_tag LOCUS_14890 27781 24746 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784705.1 protein_id gnl|my_center|LOCUS_14890 28878 27796 gene locus_tag LOCUS_14900 28878 27796 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_14900 29437 29793 gene locus_tag LOCUS_14910 29437 29793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 29794 29997 gene locus_tag LOCUS_14920 29794 29997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 30919 31074 gene locus_tag LOCUS_14930 30919 31074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 32040 31108 gene locus_tag LOCUS_14940 gene rsgA 32040 31108 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_14940 32696 32136 gene locus_tag LOCUS_14950 gene frr 32696 32136 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_14950 33075 34235 gene locus_tag LOCUS_14960 33075 34235 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_14960 35193 34483 gene locus_tag LOCUS_14970 gene pyrH 35193 34483 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_14970 36561 35242 gene locus_tag LOCUS_14980 36561 35242 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_14980 36776 38077 gene locus_tag LOCUS_14990 36776 38077 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202109.1 protein_id gnl|my_center|LOCUS_14990 38183 38875 gene locus_tag LOCUS_15000 38183 38875 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784721.1 protein_id gnl|my_center|LOCUS_15000 40212 38902 gene locus_tag LOCUS_15010 40212 38902 CDS product zinc-dependent metalloproteinase lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547570.1 protein_id gnl|my_center|LOCUS_15010 41033 40278 gene locus_tag LOCUS_15020 41033 40278 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_15020 41373 41017 gene locus_tag LOCUS_15030 41373 41017 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784727.1 protein_id gnl|my_center|LOCUS_15030 41745 41380 gene locus_tag LOCUS_15040 41745 41380 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784729.1 protein_id gnl|my_center|LOCUS_15040 41883 42116 gene locus_tag LOCUS_15050 41883 42116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_15050 42121 42558 gene locus_tag LOCUS_15060 42121 42558 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_15060 42862 42575 gene locus_tag LOCUS_15070 42862 42575 CDS product DUF4834 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784735.1 protein_id gnl|my_center|LOCUS_15070 43635 42925 gene locus_tag LOCUS_15080 gene pssA 43635 42925 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_15080 44331 43645 gene locus_tag LOCUS_15090 44331 43645 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_15090 44468 48289 gene locus_tag LOCUS_15100 gene dnaE 44468 48289 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_15100 48350 48664 gene locus_tag LOCUS_15110 gene trxA 48350 48664 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_15110 48691 49026 gene locus_tag LOCUS_15120 48691 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784743.1 protein_id gnl|my_center|LOCUS_15120 49980 49249 gene locus_tag LOCUS_15130 49980 49249 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_15130 <51055 50126 gene locus_tag LOCUS_15140 <51055 50126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763619.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence027 149 727 gene locus_tag LOCUS_15150 149 727 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786232.1 protein_id gnl|my_center|LOCUS_15150 780 1715 gene locus_tag LOCUS_15160 780 1715 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_15160 1957 5259 gene locus_tag LOCUS_15170 1957 5259 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202438.1 protein_id gnl|my_center|LOCUS_15170 5275 6972 gene locus_tag LOCUS_15180 5275 6972 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786237.1 protein_id gnl|my_center|LOCUS_15180 7014 7472 gene locus_tag LOCUS_15190 7014 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202439.1 protein_id gnl|my_center|LOCUS_15190 7587 9089 gene locus_tag LOCUS_15200 7587 9089 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202440.1 protein_id gnl|my_center|LOCUS_15200 9571 9410 gene locus_tag LOCUS_15210 9571 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9619 10515 gene locus_tag LOCUS_15220 9619 10515 CDS product histidine decarboxylase, pyruvoyl type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786245.1 protein_id gnl|my_center|LOCUS_15220 11425 10643 gene locus_tag LOCUS_15230 gene nudC 11425 10643 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202441.1 protein_id gnl|my_center|LOCUS_15230 12902 11457 gene locus_tag LOCUS_15240 12902 11457 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202442.1 protein_id gnl|my_center|LOCUS_15240 14739 13363 gene locus_tag LOCUS_15250 14739 13363 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_15250 15398 14796 gene locus_tag LOCUS_15260 15398 14796 CDS product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786253.1 protein_id gnl|my_center|LOCUS_15260 16325 15486 gene locus_tag LOCUS_15270 16325 15486 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_15270 16810 16328 gene locus_tag LOCUS_15280 16810 16328 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_15280 16926 17825 gene locus_tag LOCUS_15290 16926 17825 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_15290 18150 19397 gene locus_tag LOCUS_15300 18150 19397 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_15300 19518 20783 gene locus_tag LOCUS_15310 19518 20783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_15310 20803 22071 gene locus_tag LOCUS_15320 20803 22071 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_15320 22090 23397 gene locus_tag LOCUS_15330 22090 23397 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202445.1 protein_id gnl|my_center|LOCUS_15330 23416 24687 gene locus_tag LOCUS_15340 23416 24687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202446.1 protein_id gnl|my_center|LOCUS_15340 24712 26019 gene locus_tag LOCUS_15350 24712 26019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202447.1 protein_id gnl|my_center|LOCUS_15350 26026 27297 gene locus_tag LOCUS_15360 26026 27297 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768224.1 protein_id gnl|my_center|LOCUS_15360 28344 27445 gene locus_tag LOCUS_15370 28344 27445 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_15370 28661 29326 gene locus_tag LOCUS_15380 28661 29326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786282.1 protein_id gnl|my_center|LOCUS_15380 29368 30642 gene locus_tag LOCUS_15390 29368 30642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202449.1 protein_id gnl|my_center|LOCUS_15390 30651 31901 gene locus_tag LOCUS_15400 30651 31901 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_15400 32061 32726 gene locus_tag LOCUS_15410 32061 32726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_15410 32742 33386 gene locus_tag LOCUS_15420 32742 33386 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786293.1 protein_id gnl|my_center|LOCUS_15420 33400 34698 gene locus_tag LOCUS_15430 33400 34698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816640.1 protein_id gnl|my_center|LOCUS_15430 34713 35957 gene locus_tag LOCUS_15440 34713 35957 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202451.1 protein_id gnl|my_center|LOCUS_15440 36053 38665 gene locus_tag LOCUS_15450 36053 38665 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202452.1 protein_id gnl|my_center|LOCUS_15450 39119 40591 gene locus_tag LOCUS_15460 39119 40591 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 protein_id gnl|my_center|LOCUS_15460 40741 42090 gene locus_tag LOCUS_15470 40741 42090 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_15470 42134 43426 gene locus_tag LOCUS_15480 42134 43426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786305.1 protein_id gnl|my_center|LOCUS_15480 45061 43415 gene locus_tag LOCUS_15490 gene aspD 45061 43415 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202454.1 protein_id gnl|my_center|LOCUS_15490 46800 45103 gene locus_tag LOCUS_15500 gene aspT 46800 45103 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786308.1 protein_id gnl|my_center|LOCUS_15500 46959 47921 gene locus_tag LOCUS_15510 46959 47921 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_15510 48252 48653 gene locus_tag LOCUS_15520 48252 48653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786310.1 protein_id gnl|my_center|LOCUS_15520 49218 48853 gene locus_tag LOCUS_15530 49218 48853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768232.1 protein_id gnl|my_center|LOCUS_15530 49777 49271 gene locus_tag LOCUS_15540 49777 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768233.1 protein_id gnl|my_center|LOCUS_15540 50265 49903 gene locus_tag LOCUS_15550 50265 49903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768234.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence028 <1 520 gene locus_tag LOCUS_15560 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005818015.1:sugar O-acetyltransferase 609 1376 gene locus_tag LOCUS_15570 609 1376 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_15570 1390 1959 gene locus_tag LOCUS_15580 1390 1959 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_15580 2313 2855 gene locus_tag LOCUS_15590 2313 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800391.1 protein_id gnl|my_center|LOCUS_15590 3057 4256 gene locus_tag LOCUS_15600 3057 4256 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_15600 4309 4860 gene locus_tag LOCUS_15610 4309 4860 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_15610 4857 5705 gene locus_tag LOCUS_15620 4857 5705 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202634.1 protein_id gnl|my_center|LOCUS_15620 5856 7289 gene locus_tag LOCUS_15630 5856 7289 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794770.1 protein_id gnl|my_center|LOCUS_15630 8207 7308 gene locus_tag LOCUS_15640 8207 7308 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786960.1 protein_id gnl|my_center|LOCUS_15640 8296 9639 gene locus_tag LOCUS_15650 8296 9639 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786958.1 protein_id gnl|my_center|LOCUS_15650 9794 10468 gene locus_tag LOCUS_15660 9794 10468 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786956.1 protein_id gnl|my_center|LOCUS_15660 10706 11338 gene locus_tag LOCUS_15670 gene mtgA 10706 11338 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786953.1 protein_id gnl|my_center|LOCUS_15670 13331 11442 gene locus_tag LOCUS_15680 13331 11442 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_15680 16730 13353 gene locus_tag LOCUS_15690 16730 13353 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_15690 19325 17550 gene locus_tag LOCUS_15700 19325 17550 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_15700 20077 19574 gene locus_tag LOCUS_15710 20077 19574 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 protein_id gnl|my_center|LOCUS_15710 20426 20247 gene locus_tag LOCUS_15720 20426 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20368 20928 gene locus_tag LOCUS_15730 20368 20928 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786942.1 protein_id gnl|my_center|LOCUS_15730 20950 21918 gene locus_tag LOCUS_15740 20950 21918 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786940.1 protein_id gnl|my_center|LOCUS_15740 22202 22696 gene locus_tag LOCUS_15750 22202 22696 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202632.1 protein_id gnl|my_center|LOCUS_15750 23336 22710 gene locus_tag LOCUS_15760 23336 22710 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_15760 23460 24506 gene locus_tag LOCUS_15770 gene wecB 23460 24506 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_15770 24620 27181 gene locus_tag LOCUS_15780 24620 27181 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_15780 27217 29811 gene locus_tag LOCUS_15790 27217 29811 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_15790 29835 31106 gene locus_tag LOCUS_15800 29835 31106 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_15800 31190 32146 gene locus_tag LOCUS_15810 31190 32146 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_15810 33687 32149 gene locus_tag LOCUS_15820 33687 32149 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202628.1 protein_id gnl|my_center|LOCUS_15820 34954 33674 gene locus_tag LOCUS_15830 34954 33674 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_15830 35802 34951 gene locus_tag LOCUS_15840 35802 34951 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_15840 36799 35789 gene locus_tag LOCUS_15850 36799 35789 CDS product STM4014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202625.1 protein_id gnl|my_center|LOCUS_15850 37868 36804 gene locus_tag LOCUS_15860 37868 36804 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992754.1 protein_id gnl|my_center|LOCUS_15860 39140 37992 gene locus_tag LOCUS_15870 gene cydB 39140 37992 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_15870 40719 39166 gene locus_tag LOCUS_15880 40719 39166 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_15880 40967 40752 gene locus_tag LOCUS_15890 40967 40752 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_15890 41420 42823 gene locus_tag LOCUS_15900 41420 42823 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_15900 42860 44083 gene locus_tag LOCUS_15910 42860 44083 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_15910 44086 44829 gene locus_tag LOCUS_15920 44086 44829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_15920 44843 46063 gene locus_tag LOCUS_15930 44843 46063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_15930 46196 47248 gene locus_tag LOCUS_15940 46196 47248 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_15940 47251 47949 gene locus_tag LOCUS_15950 47251 47949 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_15950 48320 48619 gene locus_tag LOCUS_15960 48320 48619 CDS product Arm DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768418.1 protein_id gnl|my_center|LOCUS_15960 49362 48940 gene locus_tag LOCUS_15970 49362 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202623.1 protein_id gnl|my_center|LOCUS_15970 49570 49373 gene locus_tag LOCUS_15980 49570 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence029 951 262 gene locus_tag LOCUS_15990 gene phoU 951 262 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_15990 1788 1027 gene locus_tag LOCUS_16000 gene pstB 1788 1027 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788575.1 protein_id gnl|my_center|LOCUS_16000 2699 1824 gene locus_tag LOCUS_16010 gene pstA 2699 1824 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_16010 3897 2701 gene locus_tag LOCUS_16020 gene pstC 3897 2701 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788582.1 protein_id gnl|my_center|LOCUS_16020 4222 5034 gene locus_tag LOCUS_16030 4222 5034 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803239.1 protein_id gnl|my_center|LOCUS_16030 5096 6844 gene locus_tag LOCUS_16040 5096 6844 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_16040 6931 8379 gene locus_tag LOCUS_16050 6931 8379 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788591.1 protein_id gnl|my_center|LOCUS_16050 8512 9153 gene locus_tag LOCUS_16060 8512 9153 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_16060 9504 10133 gene locus_tag LOCUS_16070 9504 10133 CDS product DUF4840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202997.1 protein_id gnl|my_center|LOCUS_16070 10782 10282 gene locus_tag LOCUS_16080 gene tpx 10782 10282 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788597.1 protein_id gnl|my_center|LOCUS_16080 10846 11457 gene locus_tag LOCUS_16090 10846 11457 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 protein_id gnl|my_center|LOCUS_16090 12189 11596 gene locus_tag LOCUS_16100 gene mpi 12189 11596 CDS product serine-type multi-promoter DNA invertase Mpi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788600.1 protein_id gnl|my_center|LOCUS_16100 12424 13344 gene locus_tag LOCUS_16110 12424 13344 CDS product Tsr19 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293248.1 protein_id gnl|my_center|LOCUS_16110 13988 15205 gene locus_tag LOCUS_16120 13988 15205 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_16120 15360 16148 gene locus_tag LOCUS_16130 15360 16148 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202998.1 protein_id gnl|my_center|LOCUS_16130 16162 18567 gene locus_tag LOCUS_16140 16162 18567 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 protein_id gnl|my_center|LOCUS_16140 19170 18697 gene locus_tag LOCUS_16150 19170 18697 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788614.1 protein_id gnl|my_center|LOCUS_16150 19879 19427 gene locus_tag LOCUS_16160 19879 19427 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788616.1 protein_id gnl|my_center|LOCUS_16160 20071 20319 gene locus_tag LOCUS_16170 20071 20319 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798527.1 protein_id gnl|my_center|LOCUS_16170 22964 20589 gene locus_tag LOCUS_16180 22964 20589 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769774.1 protein_id gnl|my_center|LOCUS_16180 23249 22971 gene locus_tag LOCUS_16190 23249 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 23341 23189 gene locus_tag LOCUS_16200 23341 23189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 23625 24143 gene locus_tag LOCUS_16210 23625 24143 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_16210 24316 25860 gene locus_tag LOCUS_16220 24316 25860 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_16220 26979 28064 gene locus_tag LOCUS_16230 26979 28064 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_16230 28061 29155 gene locus_tag LOCUS_16240 28061 29155 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_16240 29258 30271 gene locus_tag LOCUS_16250 29258 30271 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039957.1 protein_id gnl|my_center|LOCUS_16250 30277 31266 gene locus_tag LOCUS_16260 30277 31266 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_16260 31276 32265 gene locus_tag LOCUS_16270 31276 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 32279 32830 gene locus_tag LOCUS_16280 32279 32830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 33121 33873 gene locus_tag LOCUS_16290 33121 33873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 34608 35039 gene locus_tag LOCUS_16300 34608 35039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 35081 36109 gene locus_tag LOCUS_16310 35081 36109 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_16310 37149 37712 gene locus_tag LOCUS_16320 37149 37712 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765268.1 protein_id gnl|my_center|LOCUS_16320 37727 38758 gene locus_tag LOCUS_16330 37727 38758 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_16330 38796 40007 gene locus_tag LOCUS_16340 38796 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 40038 41201 gene locus_tag LOCUS_16350 40038 41201 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203004.1 protein_id gnl|my_center|LOCUS_16350 41237 42415 gene locus_tag LOCUS_16360 41237 42415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 42593 43312 gene locus_tag LOCUS_16370 42593 43312 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_16370 43322 44026 gene locus_tag LOCUS_16380 43322 44026 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769761.1 protein_id gnl|my_center|LOCUS_16380 44032 45273 gene locus_tag LOCUS_16390 44032 45273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788655.1 protein_id gnl|my_center|LOCUS_16390 45284 46585 gene locus_tag LOCUS_16400 45284 46585 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660805.1 protein_id gnl|my_center|LOCUS_16400 46625 47200 gene locus_tag LOCUS_16410 46625 47200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815284.1 protein_id gnl|my_center|LOCUS_16410 47307 47819 gene locus_tag LOCUS_16420 gene gldL 47307 47819 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788660.1 protein_id gnl|my_center|LOCUS_16420 47831 48277 gene locus_tag LOCUS_16430 47831 48277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 >Feature sequence030 372 103 gene locus_tag LOCUS_16440 gene rpmA 372 103 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_16440 760 395 gene locus_tag LOCUS_16450 gene rplU 760 395 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_16450 2160 1492 gene locus_tag LOCUS_16460 2160 1492 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_16460 2723 2208 gene locus_tag LOCUS_16470 2723 2208 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202236.1 protein_id gnl|my_center|LOCUS_16470 3435 2728 gene locus_tag LOCUS_16480 3435 2728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_16480 4948 3467 gene locus_tag LOCUS_16490 4948 3467 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785346.1 protein_id gnl|my_center|LOCUS_16490 7864 5045 gene locus_tag LOCUS_16500 7864 5045 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_16500 8816 8013 gene locus_tag LOCUS_16510 gene kdsA 8816 8013 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785350.1 protein_id gnl|my_center|LOCUS_16510 9758 8832 gene locus_tag LOCUS_16520 9758 8832 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_16520 10976 10050 gene locus_tag LOCUS_16530 gene miaA 10976 10050 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_16530 12395 11190 gene locus_tag LOCUS_16540 12395 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795935.1 protein_id gnl|my_center|LOCUS_16540 13036 12392 gene locus_tag LOCUS_16550 13036 12392 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_16550 14602 13049 gene locus_tag LOCUS_16560 14602 13049 CDS product DUF4836 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801225.1 protein_id gnl|my_center|LOCUS_16560 15319 14630 gene locus_tag LOCUS_16570 15319 14630 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_16570 15894 15325 gene locus_tag LOCUS_16580 15894 15325 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_16580 17156 15897 gene locus_tag LOCUS_16590 17156 15897 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_16590 18271 19428 gene locus_tag LOCUS_16600 18271 19428 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202241.1 protein_id gnl|my_center|LOCUS_16600 20989 19811 gene locus_tag LOCUS_16610 20989 19811 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_16610 21664 21014 gene locus_tag LOCUS_16620 21664 21014 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_16620 22306 21671 gene locus_tag LOCUS_16630 22306 21671 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_16630 22419 24908 gene locus_tag LOCUS_16640 22419 24908 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_16640 24933 25574 gene locus_tag LOCUS_16650 24933 25574 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795926.1 protein_id gnl|my_center|LOCUS_16650 25630 26577 gene locus_tag LOCUS_16660 gene trxB 25630 26577 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_16660 29175 26731 gene locus_tag LOCUS_16670 29175 26731 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_16670 29921 29220 gene locus_tag LOCUS_16680 29921 29220 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_16680 32452 30263 gene locus_tag LOCUS_16690 32452 30263 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785391.1 protein_id gnl|my_center|LOCUS_16690 32755 34911 gene locus_tag LOCUS_16700 32755 34911 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_16700 35118 36230 gene locus_tag LOCUS_16710 35118 36230 CDS product reverse transcriptase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202243.1 protein_id gnl|my_center|LOCUS_16710 36372 38165 gene locus_tag LOCUS_16720 gene rpsA 36372 38165 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_16720 38315 39229 gene locus_tag LOCUS_16730 38315 39229 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_16730 39302 39853 gene locus_tag LOCUS_16740 39302 39853 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_16740 39871 40284 gene locus_tag LOCUS_16750 39871 40284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785404.1 protein_id gnl|my_center|LOCUS_16750 40313 40786 gene locus_tag LOCUS_16760 40313 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_16760 41672 40887 gene locus_tag LOCUS_16770 gene mazG 41672 40887 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_16770 42739 41678 gene locus_tag LOCUS_16780 42739 41678 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_16780 42856 45486 gene locus_tag LOCUS_16790 42856 45486 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_16790 45707 47506 gene locus_tag LOCUS_16800 45707 47506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202245.1 protein_id gnl|my_center|LOCUS_16800 47900 47472 gene locus_tag LOCUS_16810 47900 47472 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795912.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence031 55 3090 gene locus_tag LOCUS_16820 55 3090 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798910.1 protein_id gnl|my_center|LOCUS_16820 3118 4392 gene locus_tag LOCUS_16830 3118 4392 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789589.1 protein_id gnl|my_center|LOCUS_16830 4635 5927 gene locus_tag LOCUS_16840 4635 5927 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292941.1 protein_id gnl|my_center|LOCUS_16840 6108 9812 gene locus_tag LOCUS_16850 gene purL 6108 9812 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814911.1 protein_id gnl|my_center|LOCUS_16850 10023 13976 gene locus_tag LOCUS_16860 10023 13976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_16860 14004 14546 gene locus_tag LOCUS_16870 14004 14546 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_16870 14572 15120 gene locus_tag LOCUS_16880 14572 15120 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_16880 16800 15292 gene locus_tag LOCUS_16890 16800 15292 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_16890 16970 19747 gene locus_tag LOCUS_16900 gene uvrA 16970 19747 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_16900 20398 19916 gene locus_tag LOCUS_16910 20398 19916 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_16910 20636 20406 gene locus_tag LOCUS_16920 20636 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780694.1 protein_id gnl|my_center|LOCUS_16920 22083 20656 gene locus_tag LOCUS_16930 22083 20656 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 protein_id gnl|my_center|LOCUS_16930 22351 23871 gene locus_tag LOCUS_16940 22351 23871 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_16940 23997 26225 gene locus_tag LOCUS_16950 23997 26225 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203234.1 protein_id gnl|my_center|LOCUS_16950 27417 26230 gene locus_tag LOCUS_16960 27417 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_16960 28183 29361 gene locus_tag LOCUS_16970 28183 29361 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203237.1 protein_id gnl|my_center|LOCUS_16970 29380 29940 gene locus_tag LOCUS_16980 29380 29940 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203238.1 protein_id gnl|my_center|LOCUS_16980 29977 33531 gene locus_tag LOCUS_16990 gene nifJ 29977 33531 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_16990 33736 34239 gene locus_tag LOCUS_17000 33736 34239 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203239.1 protein_id gnl|my_center|LOCUS_17000 35135 34281 gene locus_tag LOCUS_17010 35135 34281 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769585.1 protein_id gnl|my_center|LOCUS_17010 35979 35155 gene locus_tag LOCUS_17020 35979 35155 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798933.1 protein_id gnl|my_center|LOCUS_17020 37202 35976 gene locus_tag LOCUS_17030 37202 35976 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789627.1 protein_id gnl|my_center|LOCUS_17030 37881 37537 gene locus_tag LOCUS_17040 37881 37537 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802790.1 protein_id gnl|my_center|LOCUS_17040 40635 37912 gene locus_tag LOCUS_17050 40635 37912 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203241.1 protein_id gnl|my_center|LOCUS_17050 41709 40819 gene locus_tag LOCUS_17060 41709 40819 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 protein_id gnl|my_center|LOCUS_17060 42907 41741 gene locus_tag LOCUS_17070 42907 41741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_17070 44821 42953 gene locus_tag LOCUS_17080 44821 42953 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203243.1 protein_id gnl|my_center|LOCUS_17080 47297 44946 gene locus_tag LOCUS_17090 47297 44946 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_17090 47841 47485 gene locus_tag LOCUS_17100 47841 47485 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789642.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence032 421 840 gene locus_tag LOCUS_17110 gene tssD 421 840 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292156.1 protein_id gnl|my_center|LOCUS_17110 845 1303 gene locus_tag LOCUS_17120 845 1303 CDS product DUF5456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787085.1 protein_id gnl|my_center|LOCUS_17120 1300 1740 gene locus_tag LOCUS_17130 1300 1740 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202658.1 protein_id gnl|my_center|LOCUS_17130 1771 3588 gene locus_tag LOCUS_17140 1771 3588 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787081.1 protein_id gnl|my_center|LOCUS_17140 3614 5464 gene locus_tag LOCUS_17150 3614 5464 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202657.1 protein_id gnl|my_center|LOCUS_17150 5483 6169 gene locus_tag LOCUS_17160 5483 6169 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768470.1 protein_id gnl|my_center|LOCUS_17160 6180 9149 gene locus_tag LOCUS_17170 6180 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202656.1 protein_id gnl|my_center|LOCUS_17170 9137 10165 gene locus_tag LOCUS_17180 9137 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298724.1 protein_id gnl|my_center|LOCUS_17180 10225 11073 gene locus_tag LOCUS_17190 10225 11073 CDS product TssN family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202654.1 protein_id gnl|my_center|LOCUS_17190 11101 12243 gene locus_tag LOCUS_17200 11101 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202653.1 protein_id gnl|my_center|LOCUS_17200 12245 13201 gene locus_tag LOCUS_17210 12245 13201 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787052.1 protein_id gnl|my_center|LOCUS_17210 13207 13710 gene locus_tag LOCUS_17220 gene tssO 13207 13710 CDS product type VI secretion system TssO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202652.1 protein_id gnl|my_center|LOCUS_17220 13723 14250 gene locus_tag LOCUS_17230 13723 14250 CDS product type VI secretion system transmembrane protein TssO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768464.1 protein_id gnl|my_center|LOCUS_17230 14247 15140 gene locus_tag LOCUS_17240 14247 15140 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202651.1 protein_id gnl|my_center|LOCUS_17240 15142 17514 gene locus_tag LOCUS_17250 gene tssR 15142 17514 CDS product type VI secretion system protein TssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992791.1 protein_id gnl|my_center|LOCUS_17250 20376 18127 gene locus_tag LOCUS_17260 20376 18127 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555543.1 protein_id gnl|my_center|LOCUS_17260 21286 20366 gene locus_tag LOCUS_17270 21286 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794702.1 protein_id gnl|my_center|LOCUS_17270 22417 21314 gene locus_tag LOCUS_17280 22417 21314 CDS product carbohydrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817982.1 protein_id gnl|my_center|LOCUS_17280 23608 22421 gene locus_tag LOCUS_17290 23608 22421 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659730.1 protein_id gnl|my_center|LOCUS_17290 24297 23626 gene locus_tag LOCUS_17300 24297 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794707.1 protein_id gnl|my_center|LOCUS_17300 25318 24287 gene locus_tag LOCUS_17310 25318 24287 CDS product DUF4302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202648.1 protein_id gnl|my_center|LOCUS_17310 26271 25315 gene locus_tag LOCUS_17320 26271 25315 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992784.1 protein_id gnl|my_center|LOCUS_17320 27896 26367 gene locus_tag LOCUS_17330 27896 26367 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_17330 31215 27883 gene locus_tag LOCUS_17340 31215 27883 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202647.1 protein_id gnl|my_center|LOCUS_17340 33547 31316 gene locus_tag LOCUS_17350 33547 31316 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_17350 35226 34360 gene locus_tag LOCUS_17360 35226 34360 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787018.1 protein_id gnl|my_center|LOCUS_17360 36725 35526 gene locus_tag LOCUS_17370 36725 35526 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659719.1 protein_id gnl|my_center|LOCUS_17370 39056 36738 gene locus_tag LOCUS_17380 39056 36738 CDS product collagen-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202645.1 protein_id gnl|my_center|LOCUS_17380 39228 39434 gene locus_tag LOCUS_17390 39228 39434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 39500 41569 gene locus_tag LOCUS_17400 39500 41569 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202643.1 protein_id gnl|my_center|LOCUS_17400 41579 42817 gene locus_tag LOCUS_17410 41579 42817 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202642.1 protein_id gnl|my_center|LOCUS_17410 43033 44187 gene locus_tag LOCUS_17420 gene hemN 43033 44187 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202641.1 protein_id gnl|my_center|LOCUS_17420 44190 45578 gene locus_tag LOCUS_17430 gene hemG 44190 45578 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_17430 46104 45757 gene locus_tag LOCUS_17440 46104 45757 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_17440 46478 46326 gene locus_tag LOCUS_17450 46478 46326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence033 190 498 gene locus_tag LOCUS_17460 190 498 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789042.1 protein_id gnl|my_center|LOCUS_17460 679 1800 gene locus_tag LOCUS_17470 679 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1909 3822 gene locus_tag LOCUS_17480 1909 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202019.1 protein_id gnl|my_center|LOCUS_17480 3899 5065 gene locus_tag LOCUS_17490 3899 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5343 6455 gene locus_tag LOCUS_17500 5343 6455 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201847.1 protein_id gnl|my_center|LOCUS_17500 7522 6503 gene locus_tag LOCUS_17510 7522 6503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202020.1 protein_id gnl|my_center|LOCUS_17510 8449 7532 gene locus_tag LOCUS_17520 8449 7532 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_17520 9199 8504 gene locus_tag LOCUS_17530 9199 8504 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784312.1 protein_id gnl|my_center|LOCUS_17530 9534 9196 gene locus_tag LOCUS_17540 9534 9196 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784314.1 protein_id gnl|my_center|LOCUS_17540 9572 9712 gene locus_tag LOCUS_17550 9572 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9743 10426 gene locus_tag LOCUS_17560 9743 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784319.1 protein_id gnl|my_center|LOCUS_17560 10452 11249 gene locus_tag LOCUS_17570 10452 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796546.1 protein_id gnl|my_center|LOCUS_17570 11291 12847 gene locus_tag LOCUS_17580 11291 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_17580 12981 14000 gene locus_tag LOCUS_17590 gene pta 12981 14000 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_17590 14019 15215 gene locus_tag LOCUS_17600 14019 15215 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_17600 15437 16837 gene locus_tag LOCUS_17610 15437 16837 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_17610 16920 17231 gene locus_tag LOCUS_17620 16920 17231 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_17620 17277 18041 gene locus_tag LOCUS_17630 17277 18041 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_17630 18762 18070 gene locus_tag LOCUS_17640 gene radC 18762 18070 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_17640 19818 18805 gene locus_tag LOCUS_17650 19818 18805 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_17650 20820 20254 gene locus_tag LOCUS_17660 gene efp 20820 20254 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_17660 21014 21175 gene locus_tag LOCUS_17670 gene rpmH 21014 21175 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_17670 21387 22028 gene locus_tag LOCUS_17680 21387 22028 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784340.1 protein_id gnl|my_center|LOCUS_17680 22058 23131 gene locus_tag LOCUS_17690 22058 23131 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_17690 23128 24102 gene locus_tag LOCUS_17700 23128 24102 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_17700 24243 25391 gene locus_tag LOCUS_17710 24243 25391 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_17710 25388 26083 gene locus_tag LOCUS_17720 25388 26083 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813546.1 protein_id gnl|my_center|LOCUS_17720 26088 26483 gene locus_tag LOCUS_17730 26088 26483 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_17730 27538 26582 gene locus_tag LOCUS_17740 27538 26582 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_17740 28320 27592 gene locus_tag LOCUS_17750 28320 27592 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_17750 29303 28359 gene locus_tag LOCUS_17760 29303 28359 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202025.1 protein_id gnl|my_center|LOCUS_17760 31115 29868 gene locus_tag LOCUS_17770 31115 29868 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_17770 32210 31128 gene locus_tag LOCUS_17780 gene proB 32210 31128 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_17780 32560 32324 gene locus_tag LOCUS_17790 32560 32324 CDS product DUF2007-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784361.1 protein_id gnl|my_center|LOCUS_17790 33479 32637 gene locus_tag LOCUS_17800 gene murI 33479 32637 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_17800 34091 33582 gene locus_tag LOCUS_17810 34091 33582 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_17810 34664 34149 gene locus_tag LOCUS_17820 34664 34149 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_17820 37325 34689 gene locus_tag LOCUS_17830 37325 34689 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_17830 38083 37349 gene locus_tag LOCUS_17840 38083 37349 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_17840 39446 38088 gene locus_tag LOCUS_17850 39446 38088 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_17850 40625 39585 gene locus_tag LOCUS_17860 gene ribD 40625 39585 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_17860 40679 41515 gene locus_tag LOCUS_17870 gene prmC 40679 41515 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_17870 41512 41976 gene locus_tag LOCUS_17880 41512 41976 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_17880 42072 42710 gene locus_tag LOCUS_17890 gene pyrE 42072 42710 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_17890 42810 43220 gene locus_tag LOCUS_17900 42810 43220 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_17900 43226 44569 gene locus_tag LOCUS_17910 gene argH 43226 44569 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_17910 44714 44787 gene locus_tag LOCUS_t00160 44714 44787 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 44801 44885 gene locus_tag LOCUS_t00170 44801 44885 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45717 45792 gene locus_tag LOCUS_t00180 45717 45792 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 538 708 gene locus_tag LOCUS_17920 538 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202415.1 protein_id gnl|my_center|LOCUS_17920 2047 1043 gene locus_tag LOCUS_17930 2047 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202414.1 protein_id gnl|my_center|LOCUS_17930 3180 2167 gene locus_tag LOCUS_17940 3180 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768168.1 protein_id gnl|my_center|LOCUS_17940 4289 3177 gene locus_tag LOCUS_17950 4289 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202413.1 protein_id gnl|my_center|LOCUS_17950 4491 7520 gene locus_tag LOCUS_17960 4491 7520 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_17960 8442 7909 gene locus_tag LOCUS_17970 8442 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555508.1 protein_id gnl|my_center|LOCUS_17970 9034 8864 gene locus_tag LOCUS_17980 9034 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 9955 9212 gene locus_tag LOCUS_17990 9955 9212 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202410.1 protein_id gnl|my_center|LOCUS_17990 10757 10685 gene locus_tag LOCUS_t00190 10757 10685 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13501 11018 gene locus_tag LOCUS_18000 gene feoB 13501 11018 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_18000 13626 14933 gene locus_tag LOCUS_18010 gene tilS 13626 14933 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_18010 15192 20786 gene locus_tag LOCUS_18020 15192 20786 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_18020 20795 23134 gene locus_tag LOCUS_18030 gene pbpC 20795 23134 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_18030 23159 24334 gene locus_tag LOCUS_18040 23159 24334 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_18040 24367 24795 gene locus_tag LOCUS_18050 24367 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800831.1 protein_id gnl|my_center|LOCUS_18050 25019 26002 gene locus_tag LOCUS_18060 25019 26002 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_18060 26027 27457 gene locus_tag LOCUS_18070 26027 27457 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_18070 27526 28116 gene locus_tag LOCUS_18080 27526 28116 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_18080 28222 28899 gene locus_tag LOCUS_18090 28222 28899 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_18090 30085 29024 gene locus_tag LOCUS_18100 gene mnmA 30085 29024 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 protein_id gnl|my_center|LOCUS_18100 31376 30090 gene locus_tag LOCUS_18110 31376 30090 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786117.1 protein_id gnl|my_center|LOCUS_18110 31546 32370 gene locus_tag LOCUS_18120 31546 32370 CDS product DUF4595 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659124.1 protein_id gnl|my_center|LOCUS_18120 33384 32587 gene locus_tag LOCUS_18130 33384 32587 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_18130 33874 33437 gene locus_tag LOCUS_18140 33874 33437 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786108.1 protein_id gnl|my_center|LOCUS_18140 33981 36353 gene locus_tag LOCUS_18150 33981 36353 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_18150 36395 37195 gene locus_tag LOCUS_18160 36395 37195 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_18160 37352 38641 gene locus_tag LOCUS_18170 37352 38641 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202405.1 protein_id gnl|my_center|LOCUS_18170 38678 39151 gene locus_tag LOCUS_18180 38678 39151 CDS product copper resistance protein NlpE N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768150.1 protein_id gnl|my_center|LOCUS_18180 40826 39237 gene locus_tag LOCUS_18190 40826 39237 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_18190 41207 41605 gene locus_tag LOCUS_18200 41207 41605 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202402.1 protein_id gnl|my_center|LOCUS_18200 41657 44230 gene locus_tag LOCUS_18210 41657 44230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202401.1 protein_id gnl|my_center|LOCUS_18210 44882 44415 gene locus_tag LOCUS_18220 44882 44415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202400.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence035 83 1 gene locus_tag LOCUS_t00200 83 1 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 181 108 gene locus_tag LOCUS_t00210 181 108 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1451 312 gene locus_tag LOCUS_18230 gene nspC 1451 312 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_18230 3938 1578 gene locus_tag LOCUS_18240 3938 1578 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_18240 4060 4677 gene locus_tag LOCUS_18250 4060 4677 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788037.1 protein_id gnl|my_center|LOCUS_18250 5047 5244 gene locus_tag LOCUS_18260 gene thiS 5047 5244 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815690.1 protein_id gnl|my_center|LOCUS_18260 5248 5862 gene locus_tag LOCUS_18270 5248 5862 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768961.1 protein_id gnl|my_center|LOCUS_18270 6004 6780 gene locus_tag LOCUS_18280 6004 6780 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_18280 6866 8560 gene locus_tag LOCUS_18290 gene thiC 6866 8560 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_18290 8562 9116 gene locus_tag LOCUS_18300 8562 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793498.1 protein_id gnl|my_center|LOCUS_18300 9118 10242 gene locus_tag LOCUS_18310 gene thiH 9118 10242 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788055.1 protein_id gnl|my_center|LOCUS_18310 10265 10966 gene locus_tag LOCUS_18320 10265 10966 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788057.1 protein_id gnl|my_center|LOCUS_18320 11028 11636 gene locus_tag LOCUS_18330 11028 11636 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_18330 12226 11714 gene locus_tag LOCUS_18340 12226 11714 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_18340 12997 12428 gene locus_tag LOCUS_18350 12997 12428 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788064.1 protein_id gnl|my_center|LOCUS_18350 15930 13210 gene locus_tag LOCUS_18360 gene ppdK 15930 13210 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_18360 16197 17615 gene locus_tag LOCUS_18370 gene rlmD 16197 17615 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_18370 17620 18543 gene locus_tag LOCUS_18380 17620 18543 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_18380 19110 18706 gene locus_tag LOCUS_18390 19110 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788073.1 protein_id gnl|my_center|LOCUS_18390 19576 19133 gene locus_tag LOCUS_18400 19576 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788076.1 protein_id gnl|my_center|LOCUS_18400 20403 21257 gene locus_tag LOCUS_18410 gene map 20403 21257 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_18410 21258 22484 gene locus_tag LOCUS_18420 gene rmuC 21258 22484 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_18420 22512 23258 gene locus_tag LOCUS_18430 22512 23258 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_18430 24735 23458 gene locus_tag LOCUS_18440 gene nhaA 24735 23458 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788084.1 protein_id gnl|my_center|LOCUS_18440 25994 24816 gene locus_tag LOCUS_18450 25994 24816 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788087.1 protein_id gnl|my_center|LOCUS_18450 27921 26140 gene locus_tag LOCUS_18460 gene lepA 27921 26140 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788089.1 protein_id gnl|my_center|LOCUS_18460 28247 28047 gene locus_tag LOCUS_18470 28247 28047 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_18470 28858 28394 gene locus_tag LOCUS_18480 28858 28394 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_18480 28919 29338 gene locus_tag LOCUS_18490 28919 29338 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_18490 30101 29340 gene locus_tag LOCUS_18500 30101 29340 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788098.1 protein_id gnl|my_center|LOCUS_18500 31365 30112 gene locus_tag LOCUS_18510 31365 30112 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788100.1 protein_id gnl|my_center|LOCUS_18510 31508 31900 gene locus_tag LOCUS_18520 31508 31900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788103.1 protein_id gnl|my_center|LOCUS_18520 32295 32050 gene locus_tag LOCUS_18530 32295 32050 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_18530 33032 32295 gene locus_tag LOCUS_18540 33032 32295 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_18540 35590 33128 gene locus_tag LOCUS_18550 gene pheT 35590 33128 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_18550 36693 35740 gene locus_tag LOCUS_18560 36693 35740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 protein_id gnl|my_center|LOCUS_18560 37716 36697 gene locus_tag LOCUS_18570 37716 36697 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_18570 38477 37713 gene locus_tag LOCUS_18580 38477 37713 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_18580 39189 38494 gene locus_tag LOCUS_18590 39189 38494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 40551 39772 gene locus_tag LOCUS_18600 40551 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 41539 40544 gene locus_tag LOCUS_18610 41539 40544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 42950 41664 gene locus_tag LOCUS_18620 42950 41664 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795347.1 protein_id gnl|my_center|LOCUS_18620 43937 42966 gene locus_tag LOCUS_18630 43937 42966 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054958832.1 protein_id gnl|my_center|LOCUS_18630 44712 43966 gene locus_tag LOCUS_18640 44712 43966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence036 338 1432 gene locus_tag LOCUS_18650 gene mnmA 338 1432 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203548.1 protein_id gnl|my_center|LOCUS_18650 1460 2815 gene locus_tag LOCUS_18660 1460 2815 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_18660 2819 4051 gene locus_tag LOCUS_18670 gene xseA 2819 4051 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_18670 4147 4359 gene locus_tag LOCUS_18680 gene xseB 4147 4359 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791731.1 protein_id gnl|my_center|LOCUS_18680 4405 5424 gene locus_tag LOCUS_18690 4405 5424 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_18690 5436 6242 gene locus_tag LOCUS_18700 5436 6242 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791727.1 protein_id gnl|my_center|LOCUS_18700 6252 7010 gene locus_tag LOCUS_18710 gene trmB 6252 7010 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_18710 7019 8125 gene locus_tag LOCUS_18720 7019 8125 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_18720 10117 8216 gene locus_tag LOCUS_18730 10117 8216 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203546.1 protein_id gnl|my_center|LOCUS_18730 11893 10160 gene locus_tag LOCUS_18740 11893 10160 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203545.1 protein_id gnl|my_center|LOCUS_18740 12279 11914 gene locus_tag LOCUS_18750 12279 11914 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791717.1 protein_id gnl|my_center|LOCUS_18750 13229 12480 gene locus_tag LOCUS_18760 13229 12480 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661702.1 protein_id gnl|my_center|LOCUS_18760 13957 13250 gene locus_tag LOCUS_18770 13957 13250 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_18770 16014 14080 gene locus_tag LOCUS_18780 16014 14080 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203543.1 protein_id gnl|my_center|LOCUS_18780 17456 16206 gene locus_tag LOCUS_18790 17456 16206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_18790 18637 17456 gene locus_tag LOCUS_18800 18637 17456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_18800 19626 18634 gene locus_tag LOCUS_18810 19626 18634 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_18810 21158 19704 gene locus_tag LOCUS_18820 21158 19704 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_18820 21739 24306 gene locus_tag LOCUS_18830 21739 24306 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661694.1 protein_id gnl|my_center|LOCUS_18830 24346 24900 gene locus_tag LOCUS_18840 24346 24900 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791699.1 protein_id gnl|my_center|LOCUS_18840 24881 25822 gene locus_tag LOCUS_18850 24881 25822 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661692.1 protein_id gnl|my_center|LOCUS_18850 26817 25945 gene locus_tag LOCUS_18860 26817 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_18860 27004 27945 gene locus_tag LOCUS_18870 gene mdh 27004 27945 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791692.1 protein_id gnl|my_center|LOCUS_18870 28052 31339 gene locus_tag LOCUS_18880 28052 31339 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_18880 31554 31928 gene locus_tag LOCUS_18890 31554 31928 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_18890 31932 34124 gene locus_tag LOCUS_18900 31932 34124 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203540.1 protein_id gnl|my_center|LOCUS_18900 36256 34220 gene locus_tag LOCUS_18910 36256 34220 CDS product BNR-repeat neuraminidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203539.1 protein_id gnl|my_center|LOCUS_18910 36638 36264 gene locus_tag LOCUS_18920 36638 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203538.1 protein_id gnl|my_center|LOCUS_18920 38295 36676 gene locus_tag LOCUS_18930 38295 36676 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_18930 41758 38318 gene locus_tag LOCUS_18940 41758 38318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_18940 42913 41945 gene locus_tag LOCUS_18950 42913 41945 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791673.1 protein_id gnl|my_center|LOCUS_18950 43484 42987 gene locus_tag LOCUS_18960 43484 42987 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_18960 43861 44343 gene locus_tag LOCUS_18970 43861 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence037 1684 113 gene locus_tag LOCUS_18980 1684 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203245.1 protein_id gnl|my_center|LOCUS_18980 1854 2219 gene locus_tag LOCUS_18990 1854 2219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768079.1 protein_id gnl|my_center|LOCUS_18990 4781 2631 gene locus_tag LOCUS_19000 4781 2631 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_19000 4945 5328 gene locus_tag LOCUS_19010 gene crcB 4945 5328 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_19010 5343 6008 gene locus_tag LOCUS_19020 5343 6008 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785742.1 protein_id gnl|my_center|LOCUS_19020 6156 7445 gene locus_tag LOCUS_19030 gene eno 6156 7445 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_19030 7691 7617 gene locus_tag LOCUS_t00220 7691 7617 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7999 8547 gene locus_tag LOCUS_19040 7999 8547 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_19040 8574 9527 gene locus_tag LOCUS_19050 8574 9527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_19050 9552 10079 gene locus_tag LOCUS_19060 9552 10079 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785734.1 protein_id gnl|my_center|LOCUS_19060 10036 10788 gene locus_tag LOCUS_19070 10036 10788 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_19070 10793 11377 gene locus_tag LOCUS_19080 10793 11377 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_19080 11449 12465 gene locus_tag LOCUS_19090 11449 12465 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_19090 13167 12802 gene locus_tag LOCUS_19100 13167 12802 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_19100 13930 13181 gene locus_tag LOCUS_19110 13930 13181 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_19110 14155 15498 gene locus_tag LOCUS_19120 14155 15498 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202308.1 protein_id gnl|my_center|LOCUS_19120 15505 15975 gene locus_tag LOCUS_19130 15505 15975 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785717.1 protein_id gnl|my_center|LOCUS_19130 16001 17002 gene locus_tag LOCUS_19140 gene floA 16001 17002 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_19140 17090 18007 gene locus_tag LOCUS_19150 17090 18007 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_19150 18007 18534 gene locus_tag LOCUS_19160 18007 18534 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785712.1 protein_id gnl|my_center|LOCUS_19160 19168 18518 gene locus_tag LOCUS_19170 19168 18518 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801072.1 protein_id gnl|my_center|LOCUS_19170 21168 19255 gene locus_tag LOCUS_19180 21168 19255 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528853.1 protein_id gnl|my_center|LOCUS_19180 21284 22681 gene locus_tag LOCUS_19190 gene mnmE 21284 22681 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_19190 23147 24454 gene locus_tag LOCUS_19200 23147 24454 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768520.1 protein_id gnl|my_center|LOCUS_19200 24564 25679 gene locus_tag LOCUS_19210 24564 25679 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202303.1 protein_id gnl|my_center|LOCUS_19210 25964 26650 gene locus_tag LOCUS_19220 25964 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202302.1 protein_id gnl|my_center|LOCUS_19220 26821 27123 gene locus_tag LOCUS_19230 26821 27123 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845215.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19230 27127 28197 gene locus_tag LOCUS_19240 27127 28197 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202301.1 protein_id gnl|my_center|LOCUS_19240 28500 28919 gene locus_tag LOCUS_19250 28500 28919 CDS product metalloproteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143868537.1 protein_id gnl|my_center|LOCUS_19250 28916 30127 gene locus_tag LOCUS_19260 28916 30127 CDS product relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202298.1 protein_id gnl|my_center|LOCUS_19260 30132 30659 gene locus_tag LOCUS_19270 30132 30659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202297.1 protein_id gnl|my_center|LOCUS_19270 31911 30985 gene locus_tag LOCUS_19280 31911 30985 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_19280 32036 33061 gene locus_tag LOCUS_19290 32036 33061 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476041.1 protein_id gnl|my_center|LOCUS_19290 33727 34197 gene locus_tag LOCUS_19300 33727 34197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 35413 34190 gene locus_tag LOCUS_19310 35413 34190 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109319.1 protein_id gnl|my_center|LOCUS_19310 36819 35413 gene locus_tag LOCUS_19320 gene rhuM 36819 35413 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303134.1 protein_id gnl|my_center|LOCUS_19320 38380 36827 gene locus_tag LOCUS_19330 38380 36827 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109317.1 protein_id gnl|my_center|LOCUS_19330 39132 38386 gene locus_tag LOCUS_19340 39132 38386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 41969 39141 gene locus_tag LOCUS_19350 41969 39141 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109314.1 protein_id gnl|my_center|LOCUS_19350 42283 41993 gene locus_tag LOCUS_19360 42283 41993 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109313.1 protein_id gnl|my_center|LOCUS_19360 43414 42410 gene locus_tag LOCUS_19370 43414 42410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence038 85 1716 gene locus_tag LOCUS_19380 gene hcp 85 1716 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062937.1 protein_id gnl|my_center|LOCUS_19380 3030 1843 gene locus_tag LOCUS_19390 3030 1843 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_19390 3202 4668 gene locus_tag LOCUS_19400 3202 4668 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_19400 4882 6546 gene locus_tag LOCUS_19410 4882 6546 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794233.1 protein_id gnl|my_center|LOCUS_19410 6935 6552 gene locus_tag LOCUS_19420 6935 6552 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_19420 7695 6913 gene locus_tag LOCUS_19430 7695 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_19430 7883 9457 gene locus_tag LOCUS_19440 7883 9457 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202758.1 protein_id gnl|my_center|LOCUS_19440 9432 10802 gene locus_tag LOCUS_19450 9432 10802 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817735.1 protein_id gnl|my_center|LOCUS_19450 12635 11304 gene locus_tag LOCUS_19460 12635 11304 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_19460 15963 12658 gene locus_tag LOCUS_19470 15963 12658 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_19470 18731 16092 gene locus_tag LOCUS_19480 18731 16092 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202756.1 protein_id gnl|my_center|LOCUS_19480 18988 20565 gene locus_tag LOCUS_19490 18988 20565 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660080.1 protein_id gnl|my_center|LOCUS_19490 20589 23762 gene locus_tag LOCUS_19500 20589 23762 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_19500 23759 26632 gene locus_tag LOCUS_19510 23759 26632 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_19510 28004 26877 gene locus_tag LOCUS_19520 28004 26877 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_19520 28977 28039 gene locus_tag LOCUS_19530 28977 28039 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_19530 29435 29118 gene locus_tag LOCUS_19540 29435 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787402.1 protein_id gnl|my_center|LOCUS_19540 29687 30646 gene locus_tag LOCUS_19550 29687 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202753.1 protein_id gnl|my_center|LOCUS_19550 30896 31855 gene locus_tag LOCUS_19560 30896 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202752.1 protein_id gnl|my_center|LOCUS_19560 32875 31970 gene locus_tag LOCUS_19570 32875 31970 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794256.1 protein_id gnl|my_center|LOCUS_19570 34541 32982 gene locus_tag LOCUS_19580 34541 32982 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787397.1 protein_id gnl|my_center|LOCUS_19580 36043 34583 gene locus_tag LOCUS_19590 36043 34583 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794258.1 protein_id gnl|my_center|LOCUS_19590 36627 36061 gene locus_tag LOCUS_19600 36627 36061 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_19600 37509 36964 gene locus_tag LOCUS_19610 37509 36964 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787394.1 protein_id gnl|my_center|LOCUS_19610 38810 37506 gene locus_tag LOCUS_19620 38810 37506 CDS product DUF3440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202749.1 protein_id gnl|my_center|LOCUS_19620 39202 38807 gene locus_tag LOCUS_19630 39202 38807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787390.1 protein_id gnl|my_center|LOCUS_19630 39844 40251 gene locus_tag LOCUS_19640 39844 40251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 40271 40594 gene locus_tag LOCUS_19650 40271 40594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787386.1 protein_id gnl|my_center|LOCUS_19650 41103 40636 gene locus_tag LOCUS_19660 41103 40636 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_19660 41233 41697 gene locus_tag LOCUS_19670 41233 41697 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787381.1 protein_id gnl|my_center|LOCUS_19670 42613 41741 gene locus_tag LOCUS_19680 42613 41741 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794262.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence039 1522 8 gene locus_tag LOCUS_19690 1522 8 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795828.1 protein_id gnl|my_center|LOCUS_19690 2183 1536 gene locus_tag LOCUS_19700 2183 1536 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785524.1 protein_id gnl|my_center|LOCUS_19700 4263 2200 gene locus_tag LOCUS_19710 4263 2200 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202268.1 protein_id gnl|my_center|LOCUS_19710 4511 5047 gene locus_tag LOCUS_19720 gene hpt 4511 5047 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_19720 5103 5672 gene locus_tag LOCUS_19730 5103 5672 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_19730 5837 6922 gene locus_tag LOCUS_19740 gene obgE 5837 6922 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_19740 6919 7731 gene locus_tag LOCUS_19750 gene pgeF 6919 7731 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_19750 7753 8418 gene locus_tag LOCUS_19760 7753 8418 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_19760 8430 9161 gene locus_tag LOCUS_19770 8430 9161 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785544.1 protein_id gnl|my_center|LOCUS_19770 10284 9100 gene locus_tag LOCUS_19780 10284 9100 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_19780 11551 10397 gene locus_tag LOCUS_19790 11551 10397 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_19790 11729 11532 gene locus_tag LOCUS_19800 11729 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768054.1 protein_id gnl|my_center|LOCUS_19800 11745 12140 gene locus_tag LOCUS_tm00010 11745 12140 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 12786 15470 gene locus_tag LOCUS_19810 12786 15470 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202270.1 protein_id gnl|my_center|LOCUS_19810 15509 16525 gene locus_tag LOCUS_19820 15509 16525 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795797.1 protein_id gnl|my_center|LOCUS_19820 16659 17753 gene locus_tag LOCUS_19830 gene dinB 16659 17753 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_19830 17865 18293 gene locus_tag LOCUS_19840 17865 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785554.1 protein_id gnl|my_center|LOCUS_19840 21205 18416 gene locus_tag LOCUS_19850 21205 18416 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_19850 22929 21334 gene locus_tag LOCUS_19860 22929 21334 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_19860 23448 23831 gene locus_tag LOCUS_19870 23448 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202273.1 protein_id gnl|my_center|LOCUS_19870 23975 24412 gene locus_tag LOCUS_19880 23975 24412 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768060.1 protein_id gnl|my_center|LOCUS_19880 24424 25638 gene locus_tag LOCUS_19890 24424 25638 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202275.1 protein_id gnl|my_center|LOCUS_19890 27433 25943 gene locus_tag LOCUS_19900 27433 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 27656 28522 gene locus_tag LOCUS_19910 27656 28522 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_19910 28700 28864 gene locus_tag LOCUS_19920 28700 28864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 31741 28883 gene locus_tag LOCUS_19930 31741 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_19930 32699 31800 gene locus_tag LOCUS_19940 32699 31800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202278.1 protein_id gnl|my_center|LOCUS_19940 34329 32710 gene locus_tag LOCUS_19950 34329 32710 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_19950 37377 34345 gene locus_tag LOCUS_19960 37377 34345 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_19960 39405 37399 gene locus_tag LOCUS_19970 39405 37399 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence040 2119 620 gene locus_tag LOCUS_19980 2119 620 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822175.1 protein_id gnl|my_center|LOCUS_19980 2485 4044 gene locus_tag LOCUS_19990 gene istA 2485 4044 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_19990 4031 4804 gene locus_tag LOCUS_20000 gene istB 4031 4804 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268417.1 protein_id gnl|my_center|LOCUS_20000 5319 8927 gene locus_tag LOCUS_20010 5319 8927 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822169.1 protein_id gnl|my_center|LOCUS_20010 8931 9236 gene locus_tag LOCUS_20020 8931 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 9907 9497 gene locus_tag LOCUS_20030 9907 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 10631 10203 gene locus_tag LOCUS_20040 10631 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811437.1 protein_id gnl|my_center|LOCUS_20040 10940 10761 gene locus_tag LOCUS_20050 10940 10761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811434.1 protein_id gnl|my_center|LOCUS_20050 11819 11166 gene locus_tag LOCUS_20060 11819 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20060 12064 11852 gene locus_tag LOCUS_20070 12064 11852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20070 12273 11998 gene locus_tag LOCUS_20080 12273 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20080 13390 12905 gene locus_tag LOCUS_20090 13390 12905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20090 13910 13560 gene locus_tag LOCUS_20100 13910 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20100 14307 13897 gene locus_tag LOCUS_20110 14307 13897 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811425.1 protein_id gnl|my_center|LOCUS_20110 15126 14311 gene locus_tag LOCUS_20120 15126 14311 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203610.1 protein_id gnl|my_center|LOCUS_20120 15450 15193 gene locus_tag LOCUS_20130 15450 15193 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811423.1 protein_id gnl|my_center|LOCUS_20130 15874 15455 gene locus_tag LOCUS_20140 15874 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 16565 17563 gene locus_tag LOCUS_20150 16565 17563 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822162.1 protein_id gnl|my_center|LOCUS_20150 19266 18079 gene locus_tag LOCUS_20160 19266 18079 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_20160 20357 19299 gene locus_tag LOCUS_20170 gene ansB 20357 19299 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791484.1 protein_id gnl|my_center|LOCUS_20170 21713 20403 gene locus_tag LOCUS_20180 21713 20403 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_20180 22032 23465 gene locus_tag LOCUS_20190 gene aspA 22032 23465 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_20190 23612 23836 gene locus_tag LOCUS_20200 23612 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20200 23833 24771 gene locus_tag LOCUS_20210 23833 24771 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203609.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20210 25043 24955 gene locus_tag LOCUS_t00230 25043 24955 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25452 26030 gene locus_tag LOCUS_20220 25452 26030 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203608.1 protein_id gnl|my_center|LOCUS_20220 26105 28564 gene locus_tag LOCUS_20230 gene priA 26105 28564 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_20230 28564 30405 gene locus_tag LOCUS_20240 28564 30405 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_20240 30520 30993 gene locus_tag LOCUS_20250 30520 30993 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203605.1 protein_id gnl|my_center|LOCUS_20250 33025 30968 gene locus_tag LOCUS_20260 33025 30968 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_20260 33120 34637 gene locus_tag LOCUS_20270 gene gltX 33120 34637 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_20270 34650 35870 gene locus_tag LOCUS_20280 34650 35870 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_20280 36571 36059 gene locus_tag LOCUS_20290 36571 36059 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 protein_id gnl|my_center|LOCUS_20290 38444 36666 gene locus_tag LOCUS_20300 38444 36666 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_20300 38618 38809 gene locus_tag LOCUS_20310 gene rpsU 38618 38809 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_20310 38883 39764 gene locus_tag LOCUS_20320 gene xerC 38883 39764 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_20320 39779 40078 gene locus_tag LOCUS_20330 gene raiA 39779 40078 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_20330 40177 40251 gene locus_tag LOCUS_t00240 40177 40251 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40325 40408 gene locus_tag LOCUS_t00250 40325 40408 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 40439 40512 gene locus_tag LOCUS_t00260 40439 40512 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 40522 40594 gene locus_tag LOCUS_t00270 40522 40594 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40644 41828 gene locus_tag LOCUS_20340 gene tuf 40644 41828 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_20340 41882 41955 gene locus_tag LOCUS_t00280 41882 41955 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 41969 42160 gene locus_tag LOCUS_20350 gene secE 41969 42160 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_20350 42177 42719 gene locus_tag LOCUS_20360 gene nusG 42177 42719 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence041 206 2479 gene locus_tag LOCUS_20370 206 2479 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_20370 2802 4997 gene locus_tag LOCUS_20380 2802 4997 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762721.1 protein_id gnl|my_center|LOCUS_20380 5042 7534 gene locus_tag LOCUS_20390 5042 7534 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555785.1 protein_id gnl|my_center|LOCUS_20390 7689 9275 gene locus_tag LOCUS_20400 7689 9275 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_20400 9639 12716 gene locus_tag LOCUS_20410 9639 12716 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_20410 12768 14414 gene locus_tag LOCUS_20420 12768 14414 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_20420 14554 16335 gene locus_tag LOCUS_20430 14554 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 16348 17796 gene locus_tag LOCUS_20440 16348 17796 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_20440 17907 20720 gene locus_tag LOCUS_20450 17907 20720 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769358.1 protein_id gnl|my_center|LOCUS_20450 20878 23667 gene locus_tag LOCUS_20460 20878 23667 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_20460 23674 24459 gene locus_tag LOCUS_20470 23674 24459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 24529 26634 gene locus_tag LOCUS_20480 24529 26634 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_20480 26902 28002 gene locus_tag LOCUS_20490 26902 28002 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_20490 28079 31321 gene locus_tag LOCUS_20500 28079 31321 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_20500 31371 33020 gene locus_tag LOCUS_20510 31371 33020 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_20510 33689 33042 gene locus_tag LOCUS_20520 33689 33042 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_20520 34022 34300 gene locus_tag LOCUS_20530 34022 34300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 34297 34782 gene locus_tag LOCUS_20540 34297 34782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20540 35115 34876 gene locus_tag LOCUS_20550 35115 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778611.1 protein_id gnl|my_center|LOCUS_20550 35339 35830 gene locus_tag LOCUS_20560 35339 35830 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801526.1 protein_id gnl|my_center|LOCUS_20560 35892 37019 gene locus_tag LOCUS_20570 35892 37019 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801525.1 protein_id gnl|my_center|LOCUS_20570 37375 37199 gene locus_tag LOCUS_20580 37375 37199 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_20580 38676 37471 gene locus_tag LOCUS_20590 38676 37471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784605.1 protein_id gnl|my_center|LOCUS_20590 41067 38728 gene locus_tag LOCUS_20600 41067 38728 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202081.1 protein_id gnl|my_center|LOCUS_20600 41398 42405 gene locus_tag LOCUS_20610 41398 42405 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796357.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence042 2 703 gene locus_tag LOCUS_20620 2 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2661 5729 gene locus_tag LOCUS_20630 2661 5729 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769257.1 protein_id gnl|my_center|LOCUS_20630 5741 7261 gene locus_tag LOCUS_20640 5741 7261 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_20640 7364 9664 gene locus_tag LOCUS_20650 gene bglX 7364 9664 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_20650 9956 11185 gene locus_tag LOCUS_20660 9956 11185 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_20660 11372 11929 gene locus_tag LOCUS_20670 11372 11929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 12183 14507 gene locus_tag LOCUS_20680 12183 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 16250 14601 gene locus_tag LOCUS_20690 16250 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 16684 19968 gene locus_tag LOCUS_20700 16684 19968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_20700 19986 21833 gene locus_tag LOCUS_20710 19986 21833 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_20710 22185 24092 gene locus_tag LOCUS_20720 22185 24092 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_20720 24096 25307 gene locus_tag LOCUS_20730 24096 25307 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769253.1 protein_id gnl|my_center|LOCUS_20730 25328 26239 gene locus_tag LOCUS_20740 25328 26239 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_20740 26270 27805 gene locus_tag LOCUS_20750 26270 27805 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201965.1 protein_id gnl|my_center|LOCUS_20750 27862 29949 gene locus_tag LOCUS_20760 27862 29949 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_20760 29949 31169 gene locus_tag LOCUS_20770 29949 31169 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_20770 34026 31450 gene locus_tag LOCUS_20780 34026 31450 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_20780 35492 34197 gene locus_tag LOCUS_20790 35492 34197 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_20790 36019 35549 gene locus_tag LOCUS_20800 36019 35549 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_20800 37346 36027 gene locus_tag LOCUS_20810 37346 36027 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_20810 37597 37463 gene locus_tag LOCUS_20820 37597 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 38709 37750 gene locus_tag LOCUS_20830 gene prfB 38709 37750 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_20830 40732 38927 gene locus_tag LOCUS_20840 40732 38927 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_20840 40921 41982 gene locus_tag LOCUS_20850 40921 41982 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_20850 42629 42162 gene locus_tag LOCUS_20860 42629 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence043 780 2012 gene locus_tag LOCUS_20870 780 2012 CDS product TIGR04157 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993590.1 protein_id gnl|my_center|LOCUS_20870 2061 2303 gene locus_tag LOCUS_20880 2061 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2567 3715 gene locus_tag LOCUS_20890 2567 3715 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797437.1 protein_id gnl|my_center|LOCUS_20890 3722 5206 gene locus_tag LOCUS_20900 3722 5206 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993584.1 protein_id gnl|my_center|LOCUS_20900 5206 6453 gene locus_tag LOCUS_20910 5206 6453 CDS product TIGR04150 pseudo-rSAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203565.1 protein_id gnl|my_center|LOCUS_20910 6567 8372 gene locus_tag LOCUS_20920 6567 8372 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_20920 8369 8995 gene locus_tag LOCUS_20930 8369 8995 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791235.1 protein_id gnl|my_center|LOCUS_20930 9000 9629 gene locus_tag LOCUS_20940 9000 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797449.1 protein_id gnl|my_center|LOCUS_20940 9620 10381 gene locus_tag LOCUS_20950 9620 10381 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797451.1 protein_id gnl|my_center|LOCUS_20950 10520 11710 gene locus_tag LOCUS_20960 10520 11710 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797453.1 protein_id gnl|my_center|LOCUS_20960 11719 12852 gene locus_tag LOCUS_20970 11719 12852 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797455.1 protein_id gnl|my_center|LOCUS_20970 12924 14369 gene locus_tag LOCUS_20980 12924 14369 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797457.1 protein_id gnl|my_center|LOCUS_20980 15178 14453 gene locus_tag LOCUS_20990 15178 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797459.1 protein_id gnl|my_center|LOCUS_20990 15281 16087 gene locus_tag LOCUS_21000 15281 16087 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_21000 16122 16814 gene locus_tag LOCUS_21010 16122 16814 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 protein_id gnl|my_center|LOCUS_21010 17142 16861 gene locus_tag LOCUS_21020 17142 16861 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791253.1 protein_id gnl|my_center|LOCUS_21020 19325 17250 gene locus_tag LOCUS_21030 19325 17250 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797464.1 protein_id gnl|my_center|LOCUS_21030 20461 19322 gene locus_tag LOCUS_21040 20461 19322 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_21040 21807 20488 gene locus_tag LOCUS_21050 21807 20488 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_21050 23889 21820 gene locus_tag LOCUS_21060 23889 21820 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_21060 24671 23886 gene locus_tag LOCUS_21070 24671 23886 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203682.1 protein_id gnl|my_center|LOCUS_21070 28898 24870 gene locus_tag LOCUS_21080 28898 24870 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203681.1 protein_id gnl|my_center|LOCUS_21080 29218 32388 gene locus_tag LOCUS_21090 29218 32388 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797471.1 protein_id gnl|my_center|LOCUS_21090 32401 34380 gene locus_tag LOCUS_21100 32401 34380 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797472.1 protein_id gnl|my_center|LOCUS_21100 34393 35706 gene locus_tag LOCUS_21110 34393 35706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791272.1 protein_id gnl|my_center|LOCUS_21110 35936 38605 gene locus_tag LOCUS_21120 35936 38605 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797475.1 protein_id gnl|my_center|LOCUS_21120 38736 41069 gene locus_tag LOCUS_21130 38736 41069 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797477.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence044 1535 1260 gene locus_tag LOCUS_21140 1535 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21140 1845 3125 gene locus_tag LOCUS_21150 1845 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3160 4830 gene locus_tag LOCUS_21160 3160 4830 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_21160 5385 4918 gene locus_tag LOCUS_21170 5385 4918 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_21170 6446 5553 gene locus_tag LOCUS_21180 6446 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291991.1 protein_id gnl|my_center|LOCUS_21180 6909 6460 gene locus_tag LOCUS_21190 6909 6460 CDS product DUF6108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786482.1 protein_id gnl|my_center|LOCUS_21190 7363 6938 gene locus_tag LOCUS_21200 7363 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768304.1 protein_id gnl|my_center|LOCUS_21200 7881 7360 gene locus_tag LOCUS_21210 7881 7360 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786485.1 protein_id gnl|my_center|LOCUS_21210 9021 8035 gene locus_tag LOCUS_21220 9021 8035 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_21220 10061 9237 gene locus_tag LOCUS_21230 10061 9237 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202508.1 protein_id gnl|my_center|LOCUS_21230 12112 10070 gene locus_tag LOCUS_21240 12112 10070 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_21240 12777 12235 gene locus_tag LOCUS_21250 12777 12235 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_21250 13557 12796 gene locus_tag LOCUS_21260 13557 12796 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_21260 14920 13838 gene locus_tag LOCUS_21270 14920 13838 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_21270 15159 14932 gene locus_tag LOCUS_21280 15159 14932 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_21280 15453 15178 gene locus_tag LOCUS_21290 15453 15178 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_21290 16197 15763 gene locus_tag LOCUS_21300 gene rpiB 16197 15763 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_21300 18289 16280 gene locus_tag LOCUS_21310 18289 16280 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_21310 19597 18443 gene locus_tag LOCUS_21320 gene galK 19597 18443 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_21320 20958 19633 gene locus_tag LOCUS_21330 20958 19633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_21330 22106 21009 gene locus_tag LOCUS_21340 22106 21009 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786509.1 protein_id gnl|my_center|LOCUS_21340 22370 23341 gene locus_tag LOCUS_21350 22370 23341 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_21350 23670 23407 gene locus_tag LOCUS_21360 23670 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800631.1 protein_id gnl|my_center|LOCUS_21360 24040 23675 gene locus_tag LOCUS_21370 24040 23675 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786515.1 protein_id gnl|my_center|LOCUS_21370 24276 24067 gene locus_tag LOCUS_21380 24276 24067 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776445.1 protein_id gnl|my_center|LOCUS_21380 25857 24574 gene locus_tag LOCUS_21390 25857 24574 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_21390 26048 26818 gene locus_tag LOCUS_21400 26048 26818 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_21400 26933 27430 gene locus_tag LOCUS_21410 26933 27430 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786521.1 protein_id gnl|my_center|LOCUS_21410 27748 28560 gene locus_tag LOCUS_21420 27748 28560 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202509.1 protein_id gnl|my_center|LOCUS_21420 31359 28813 gene locus_tag LOCUS_21430 31359 28813 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202510.1 protein_id gnl|my_center|LOCUS_21430 32125 32943 gene locus_tag LOCUS_21440 gene cysQ 32125 32943 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_21440 32964 34520 gene locus_tag LOCUS_21450 32964 34520 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_21450 34549 35157 gene locus_tag LOCUS_21460 gene cysC 34549 35157 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202511.1 protein_id gnl|my_center|LOCUS_21460 35185 36096 gene locus_tag LOCUS_21470 gene cysD 35185 36096 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_21470 36108 37538 gene locus_tag LOCUS_21480 gene cysN 36108 37538 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786535.1 protein_id gnl|my_center|LOCUS_21480 37609 38715 gene locus_tag LOCUS_21490 37609 38715 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_21490 38731 39693 gene locus_tag LOCUS_21500 38731 39693 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_21500 40361 39963 gene locus_tag LOCUS_21510 40361 39963 CDS product AraC family ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786540.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence045 256 630 gene locus_tag LOCUS_21520 256 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815229.1 protein_id gnl|my_center|LOCUS_21520 667 1224 gene locus_tag LOCUS_21530 667 1224 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203097.1 protein_id gnl|my_center|LOCUS_21530 1460 1260 gene locus_tag LOCUS_21540 1460 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1386 2636 gene locus_tag LOCUS_21550 1386 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203096.1 protein_id gnl|my_center|LOCUS_21550 2662 4317 gene locus_tag LOCUS_21560 2662 4317 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203095.1 protein_id gnl|my_center|LOCUS_21560 4656 5549 gene locus_tag LOCUS_21570 4656 5549 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203094.1 protein_id gnl|my_center|LOCUS_21570 5623 7089 gene locus_tag LOCUS_21580 5623 7089 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203093.1 protein_id gnl|my_center|LOCUS_21580 7235 8257 gene locus_tag LOCUS_21590 7235 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203092.1 protein_id gnl|my_center|LOCUS_21590 8360 10480 gene locus_tag LOCUS_21600 8360 10480 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203091.1 protein_id gnl|my_center|LOCUS_21600 10494 11540 gene locus_tag LOCUS_21610 10494 11540 CDS product BF2992 family fimbrillin-A clan protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203090.1 protein_id gnl|my_center|LOCUS_21610 11658 12569 gene locus_tag LOCUS_21620 11658 12569 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203089.1 protein_id gnl|my_center|LOCUS_21620 13113 12709 gene locus_tag LOCUS_21630 13113 12709 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_21630 14350 13163 gene locus_tag LOCUS_21640 gene kbl 14350 13163 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_21640 14487 15440 gene locus_tag LOCUS_21650 14487 15440 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_21650 15548 16390 gene locus_tag LOCUS_21660 15548 16390 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_21660 16410 17408 gene locus_tag LOCUS_21670 gene murB 16410 17408 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_21670 17469 18227 gene locus_tag LOCUS_21680 17469 18227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_21680 18320 19957 gene locus_tag LOCUS_21690 18320 19957 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203086.1 protein_id gnl|my_center|LOCUS_21690 20409 20035 gene locus_tag LOCUS_21700 20409 20035 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_21700 20562 21686 gene locus_tag LOCUS_21710 gene dnaN 20562 21686 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_21710 21817 22590 gene locus_tag LOCUS_21720 21817 22590 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_21720 22593 23786 gene locus_tag LOCUS_21730 gene coaBC 22593 23786 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_21730 23790 25475 gene locus_tag LOCUS_21740 gene recN 23790 25475 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_21740 25536 26276 gene locus_tag LOCUS_21750 gene rlmB 25536 26276 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_21750 26297 28003 gene locus_tag LOCUS_21760 26297 28003 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_21760 28301 28675 gene locus_tag LOCUS_21770 28301 28675 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_21770 30019 28643 gene locus_tag LOCUS_21780 30019 28643 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_21780 30149 31474 gene locus_tag LOCUS_21790 30149 31474 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_21790 31732 33540 gene locus_tag LOCUS_21800 31732 33540 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_21800 33638 34159 gene locus_tag LOCUS_21810 33638 34159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21810 34201 34383 gene locus_tag LOCUS_21820 34201 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 34383 34940 gene locus_tag LOCUS_21830 34383 34940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21830 35669 35103 gene locus_tag LOCUS_21840 35669 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 36133 36429 gene locus_tag LOCUS_21850 36133 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21850 36590 36787 gene locus_tag LOCUS_21860 36590 36787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21860 36796 37104 gene locus_tag LOCUS_21870 36796 37104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21870 37946 38398 gene locus_tag LOCUS_21880 37946 38398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 38531 39388 gene locus_tag LOCUS_21890 38531 39388 CDS product DUF2589 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788700.1 protein_id gnl|my_center|LOCUS_21890 39432 40247 gene locus_tag LOCUS_21900 39432 40247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788697.1 protein_id gnl|my_center|LOCUS_21900 40311 40754 gene locus_tag LOCUS_21910 40311 40754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence046 455 1138 gene locus_tag LOCUS_21920 455 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_21920 1146 1940 gene locus_tag LOCUS_21930 1146 1940 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_21930 1931 2464 gene locus_tag LOCUS_21940 1931 2464 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_21940 3921 2482 gene locus_tag LOCUS_21950 gene cls 3921 2482 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_21950 6996 4084 gene locus_tag LOCUS_21960 6996 4084 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_21960 7494 7069 gene locus_tag LOCUS_21970 7494 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784807.1 protein_id gnl|my_center|LOCUS_21970 7610 8671 gene locus_tag LOCUS_21980 gene aroB 7610 8671 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_21980 8684 9079 gene locus_tag LOCUS_21990 8684 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784803.1 protein_id gnl|my_center|LOCUS_21990 9365 9440 gene locus_tag LOCUS_t00290 9365 9440 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10495 10878 gene locus_tag LOCUS_22000 10495 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 13075 11114 gene locus_tag LOCUS_22010 13075 11114 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_22010 14522 13353 gene locus_tag LOCUS_22020 14522 13353 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784797.1 protein_id gnl|my_center|LOCUS_22020 15410 14535 gene locus_tag LOCUS_22030 15410 14535 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291581.1 protein_id gnl|my_center|LOCUS_22030 15695 16927 gene locus_tag LOCUS_22040 gene aroA 15695 16927 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_22040 20627 17073 gene locus_tag LOCUS_22050 20627 17073 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555770.1 protein_id gnl|my_center|LOCUS_22050 22196 20745 gene locus_tag LOCUS_22060 22196 20745 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784787.1 protein_id gnl|my_center|LOCUS_22060 23190 22225 gene locus_tag LOCUS_22070 23190 22225 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555768.1 protein_id gnl|my_center|LOCUS_22070 24882 23200 gene locus_tag LOCUS_22080 24882 23200 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_22080 28036 24896 gene locus_tag LOCUS_22090 28036 24896 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_22090 31529 28863 gene locus_tag LOCUS_22100 31529 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139262169.1 protein_id gnl|my_center|LOCUS_22100 33855 31570 gene locus_tag LOCUS_22110 33855 31570 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202115.1 protein_id gnl|my_center|LOCUS_22110 35177 34005 gene locus_tag LOCUS_22120 35177 34005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796266.1 protein_id gnl|my_center|LOCUS_22120 36186 35185 gene locus_tag LOCUS_22130 36186 35185 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_22130 36289 36711 gene locus_tag LOCUS_22140 36289 36711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784767.1 protein_id gnl|my_center|LOCUS_22140 36750 37559 gene locus_tag LOCUS_22150 36750 37559 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_22150 37574 37993 gene locus_tag LOCUS_22160 gene tsaE 37574 37993 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_22160 38005 38229 gene locus_tag LOCUS_22170 38005 38229 CDS product immunity 17 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796270.1 protein_id gnl|my_center|LOCUS_22170 39531 38221 gene locus_tag LOCUS_22180 39531 38221 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_22180 <40544 39534 gene locus_tag LOCUS_22190 <40544 39534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784757.1:MoxR family ATPase >Feature sequence047 1484 162 gene locus_tag LOCUS_22200 1484 162 CDS product DUF1735 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203443.1 protein_id gnl|my_center|LOCUS_22200 3399 1513 gene locus_tag LOCUS_22210 3399 1513 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798153.1 protein_id gnl|my_center|LOCUS_22210 6779 3429 gene locus_tag LOCUS_22220 6779 3429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798155.1 protein_id gnl|my_center|LOCUS_22220 8206 7010 gene locus_tag LOCUS_22230 8206 7010 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203444.1 protein_id gnl|my_center|LOCUS_22230 8884 8306 gene locus_tag LOCUS_22240 8884 8306 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_22240 9145 10221 gene locus_tag LOCUS_22250 gene aroC 9145 10221 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_22250 10228 11598 gene locus_tag LOCUS_22260 10228 11598 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_22260 12723 11683 gene locus_tag LOCUS_22270 12723 11683 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769957.1 protein_id gnl|my_center|LOCUS_22270 13369 13037 gene locus_tag LOCUS_22280 13369 13037 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769959.1 protein_id gnl|my_center|LOCUS_22280 14179 13568 gene locus_tag LOCUS_22290 14179 13568 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790879.1 protein_id gnl|my_center|LOCUS_22290 16530 14380 gene locus_tag LOCUS_22300 16530 14380 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_22300 16657 18057 gene locus_tag LOCUS_22310 16657 18057 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_22310 20310 18163 gene locus_tag LOCUS_22320 gene scpA 20310 18163 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_22320 22210 20312 gene locus_tag LOCUS_22330 gene mutA 22210 20312 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_22330 22459 24123 gene locus_tag LOCUS_22340 22459 24123 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790885.1 protein_id gnl|my_center|LOCUS_22340 24840 24211 gene locus_tag LOCUS_22350 24840 24211 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_22350 25006 26358 gene locus_tag LOCUS_22360 25006 26358 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_22360 26399 26968 gene locus_tag LOCUS_22370 26399 26968 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_22370 27230 27721 gene locus_tag LOCUS_22380 27230 27721 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790892.1 protein_id gnl|my_center|LOCUS_22380 30149 27939 gene locus_tag LOCUS_22390 30149 27939 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203451.1 protein_id gnl|my_center|LOCUS_22390 31699 30338 gene locus_tag LOCUS_22400 31699 30338 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_22400 31837 33564 gene locus_tag LOCUS_22410 gene lysS 31837 33564 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_22410 33664 34659 gene locus_tag LOCUS_22420 33664 34659 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_22420 34707 36044 gene locus_tag LOCUS_22430 34707 36044 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_22430 36635 36129 gene locus_tag LOCUS_22440 36635 36129 CDS product DUF5035 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203454.1 protein_id gnl|my_center|LOCUS_22440 36733 37461 gene locus_tag LOCUS_22450 36733 37461 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_22450 37691 39025 gene locus_tag LOCUS_22460 37691 39025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence048 805 608 gene locus_tag LOCUS_22470 805 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22470 2117 1068 gene locus_tag LOCUS_22480 2117 1068 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_22480 2195 3418 gene locus_tag LOCUS_22490 2195 3418 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_22490 3422 3952 gene locus_tag LOCUS_22500 3422 3952 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_22500 4613 4071 gene locus_tag LOCUS_22510 4613 4071 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_22510 7021 4676 gene locus_tag LOCUS_22520 7021 4676 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203497.1 protein_id gnl|my_center|LOCUS_22520 7200 11519 gene locus_tag LOCUS_22530 7200 11519 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_22530 11542 12429 gene locus_tag LOCUS_22540 11542 12429 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791002.1 protein_id gnl|my_center|LOCUS_22540 12458 13519 gene locus_tag LOCUS_22550 12458 13519 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_22550 13516 14295 gene locus_tag LOCUS_22560 13516 14295 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_22560 14384 15853 gene locus_tag LOCUS_22570 14384 15853 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798358.1 protein_id gnl|my_center|LOCUS_22570 15834 16871 gene locus_tag LOCUS_22580 gene hydE 15834 16871 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203500.1 protein_id gnl|my_center|LOCUS_22580 16884 18302 gene locus_tag LOCUS_22590 gene hydG 16884 18302 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_22590 18299 19474 gene locus_tag LOCUS_22600 gene hydF 18299 19474 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_22600 20770 19595 gene locus_tag LOCUS_22610 20770 19595 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802156.1 protein_id gnl|my_center|LOCUS_22610 23520 21211 gene locus_tag LOCUS_22620 23520 21211 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_22620 25153 23765 gene locus_tag LOCUS_22630 gene glmM 25153 23765 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_22630 25786 25190 gene locus_tag LOCUS_22640 25786 25190 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_22640 27008 25977 gene locus_tag LOCUS_22650 27008 25977 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_22650 28526 27060 gene locus_tag LOCUS_22660 28526 27060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 29828 29169 gene locus_tag LOCUS_22670 gene rpe 29828 29169 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_22670 30957 29983 gene locus_tag LOCUS_22680 gene fmt 30957 29983 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_22680 32845 31052 gene locus_tag LOCUS_22690 32845 31052 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_22690 33405 32842 gene locus_tag LOCUS_22700 33405 32842 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_22700 33485 33919 gene locus_tag LOCUS_22710 33485 33919 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_22710 36041 33969 gene locus_tag LOCUS_22720 36041 33969 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203505.1 protein_id gnl|my_center|LOCUS_22720 36363 36205 gene locus_tag LOCUS_22730 36363 36205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 37239 36760 gene locus_tag LOCUS_22740 37239 36760 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791037.1 protein_id gnl|my_center|LOCUS_22740 37740 37558 gene locus_tag LOCUS_22750 37740 37558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 <38593 37751 gene locus_tag LOCUS_22760 <38593 37751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816723.1:glycosyltransferase family 4 protein >Feature sequence049 292 1584 gene locus_tag LOCUS_22770 292 1584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202988.1 protein_id gnl|my_center|LOCUS_22770 1800 2168 gene locus_tag LOCUS_22780 1800 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2373 3608 gene locus_tag LOCUS_22790 2373 3608 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202987.1 protein_id gnl|my_center|LOCUS_22790 3608 4003 gene locus_tag LOCUS_22800 3608 4003 CDS product DUF4891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769053.1 protein_id gnl|my_center|LOCUS_22800 4663 4118 gene locus_tag LOCUS_22810 4663 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 6263 4857 gene locus_tag LOCUS_22820 6263 4857 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_22820 6759 8156 gene locus_tag LOCUS_22830 6759 8156 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202983.1 protein_id gnl|my_center|LOCUS_22830 8161 8781 gene locus_tag LOCUS_22840 gene prfH 8161 8781 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 protein_id gnl|my_center|LOCUS_22840 8807 9520 gene locus_tag LOCUS_22850 8807 9520 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_22850 9517 10629 gene locus_tag LOCUS_22860 9517 10629 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 protein_id gnl|my_center|LOCUS_22860 14112 11065 gene locus_tag LOCUS_22870 14112 11065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202980.1 protein_id gnl|my_center|LOCUS_22870 14575 14931 gene locus_tag LOCUS_22880 14575 14931 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_22880 14928 15374 gene locus_tag LOCUS_22890 14928 15374 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788385.1 protein_id gnl|my_center|LOCUS_22890 16502 15438 gene locus_tag LOCUS_22900 16502 15438 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_22900 16756 17781 gene locus_tag LOCUS_22910 16756 17781 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_22910 17828 18496 gene locus_tag LOCUS_22920 17828 18496 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_22920 19099 18575 gene locus_tag LOCUS_22930 19099 18575 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_22930 19869 19096 gene locus_tag LOCUS_22940 19869 19096 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_22940 20127 19879 gene locus_tag LOCUS_22950 20127 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788372.1 protein_id gnl|my_center|LOCUS_22950 21605 20556 gene locus_tag LOCUS_22960 21605 20556 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_22960 24150 21631 gene locus_tag LOCUS_22970 24150 21631 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_22970 24936 24610 gene locus_tag LOCUS_22980 24936 24610 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778408.1 protein_id gnl|my_center|LOCUS_22980 25535 24933 gene locus_tag LOCUS_22990 25535 24933 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788367.1 protein_id gnl|my_center|LOCUS_22990 26263 25580 gene locus_tag LOCUS_23000 26263 25580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202978.1 protein_id gnl|my_center|LOCUS_23000 30591 26272 gene locus_tag LOCUS_23010 30591 26272 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202977.1 protein_id gnl|my_center|LOCUS_23010 32820 30676 gene locus_tag LOCUS_23020 32820 30676 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815393.1 protein_id gnl|my_center|LOCUS_23020 33521 32850 gene locus_tag LOCUS_23030 33521 32850 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793333.1 protein_id gnl|my_center|LOCUS_23030 34334 33528 gene locus_tag LOCUS_23040 34334 33528 CDS product calycin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793335.1 protein_id gnl|my_center|LOCUS_23040 35940 34420 gene locus_tag LOCUS_23050 35940 34420 CDS product MAC/perforin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793337.1 protein_id gnl|my_center|LOCUS_23050 36518 36862 gene locus_tag LOCUS_23060 36518 36862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788354.1 protein_id gnl|my_center|LOCUS_23060 36910 37818 gene locus_tag LOCUS_23070 36910 37818 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence050 <1 1150 gene locus_tag LOCUS_23080 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202124.1:AAA family ATPase 2979 1246 gene locus_tag LOCUS_23090 2979 1246 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784821.1 protein_id gnl|my_center|LOCUS_23090 6223 3002 gene locus_tag LOCUS_23100 6223 3002 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_23100 8889 6664 gene locus_tag LOCUS_23110 8889 6664 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_23110 11304 9037 gene locus_tag LOCUS_23120 11304 9037 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_23120 12332 11334 gene locus_tag LOCUS_23130 12332 11334 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_23130 12939 12385 gene locus_tag LOCUS_23140 12939 12385 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_23140 15194 12978 gene locus_tag LOCUS_23150 15194 12978 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_23150 16751 15693 gene locus_tag LOCUS_23160 16751 15693 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784833.1 protein_id gnl|my_center|LOCUS_23160 17036 17890 gene locus_tag LOCUS_23170 17036 17890 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202128.1 protein_id gnl|my_center|LOCUS_23170 20755 18137 gene locus_tag LOCUS_23180 gene alaS 20755 18137 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_23180 20859 21827 gene locus_tag LOCUS_23190 20859 21827 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_23190 21842 22207 gene locus_tag LOCUS_23200 21842 22207 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_23200 24505 22262 gene locus_tag LOCUS_23210 24505 22262 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_23210 25893 24574 gene locus_tag LOCUS_23220 25893 24574 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_23220 26763 25897 gene locus_tag LOCUS_23230 26763 25897 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784846.1 protein_id gnl|my_center|LOCUS_23230 27654 26764 gene locus_tag LOCUS_23240 27654 26764 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_23240 28430 27663 gene locus_tag LOCUS_23250 28430 27663 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_23250 28824 29702 gene locus_tag LOCUS_23260 gene surE 28824 29702 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_23260 29699 30832 gene locus_tag LOCUS_23270 gene lpxB 29699 30832 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_23270 30920 31663 gene locus_tag LOCUS_23280 30920 31663 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992150.1 protein_id gnl|my_center|LOCUS_23280 32617 31778 gene locus_tag LOCUS_23290 32617 31778 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_23290 34666 32633 gene locus_tag LOCUS_23300 gene ftsH 34666 32633 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_23300 35035 34676 gene locus_tag LOCUS_23310 gene rsfS 35035 34676 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_23310 35337 35408 gene locus_tag LOCUS_t00300 35337 35408 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <36997 35749 gene locus_tag LOCUS_23320 <36997 35749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202130.1:DUF349 domain-containing protein >Feature sequence051 1237 1839 gene locus_tag LOCUS_23330 1237 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1871 2389 gene locus_tag LOCUS_23340 1871 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2438 3430 gene locus_tag LOCUS_23350 2438 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202350.1 protein_id gnl|my_center|LOCUS_23350 3448 3867 gene locus_tag LOCUS_23360 3448 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3937 4653 gene locus_tag LOCUS_23370 3937 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4713 5027 gene locus_tag LOCUS_23380 4713 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6470 7684 gene locus_tag LOCUS_23390 6470 7684 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202578.1 protein_id gnl|my_center|LOCUS_23390 8307 8873 gene locus_tag LOCUS_23400 8307 8873 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800526.1 protein_id gnl|my_center|LOCUS_23400 8887 9999 gene locus_tag LOCUS_23410 8887 9999 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786720.1 protein_id gnl|my_center|LOCUS_23410 10004 11140 gene locus_tag LOCUS_23420 10004 11140 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202581.1 protein_id gnl|my_center|LOCUS_23420 11379 13028 gene locus_tag LOCUS_23430 11379 13028 CDS product DUF5029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202582.1 protein_id gnl|my_center|LOCUS_23430 13123 14046 gene locus_tag LOCUS_23440 13123 14046 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202583.1 protein_id gnl|my_center|LOCUS_23440 14073 15638 gene locus_tag LOCUS_23450 14073 15638 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202584.1 protein_id gnl|my_center|LOCUS_23450 15663 16781 gene locus_tag LOCUS_23460 15663 16781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202585.1 protein_id gnl|my_center|LOCUS_23460 16866 17789 gene locus_tag LOCUS_23470 16866 17789 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202586.1 protein_id gnl|my_center|LOCUS_23470 17810 18787 gene locus_tag LOCUS_23480 17810 18787 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202587.1 protein_id gnl|my_center|LOCUS_23480 18814 19749 gene locus_tag LOCUS_23490 18814 19749 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794904.1 protein_id gnl|my_center|LOCUS_23490 19762 20763 gene locus_tag LOCUS_23500 19762 20763 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202589.1 protein_id gnl|my_center|LOCUS_23500 20767 21750 gene locus_tag LOCUS_23510 20767 21750 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172676417.1 protein_id gnl|my_center|LOCUS_23510 21775 22776 gene locus_tag LOCUS_23520 21775 22776 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202591.1 protein_id gnl|my_center|LOCUS_23520 22754 23851 gene locus_tag LOCUS_23530 22754 23851 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298668.1 protein_id gnl|my_center|LOCUS_23530 23867 24793 gene locus_tag LOCUS_23540 23867 24793 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202593.1 protein_id gnl|my_center|LOCUS_23540 24812 26383 gene locus_tag LOCUS_23550 24812 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202594.1 protein_id gnl|my_center|LOCUS_23550 26427 27497 gene locus_tag LOCUS_23560 26427 27497 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202595.1 protein_id gnl|my_center|LOCUS_23560 27509 28450 gene locus_tag LOCUS_23570 27509 28450 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202596.1 protein_id gnl|my_center|LOCUS_23570 28605 30023 gene locus_tag LOCUS_23580 28605 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768387.1 protein_id gnl|my_center|LOCUS_23580 30024 30974 gene locus_tag LOCUS_23590 30024 30974 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555695.1 protein_id gnl|my_center|LOCUS_23590 31069 32253 gene locus_tag LOCUS_23600 31069 32253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202599.1 protein_id gnl|my_center|LOCUS_23600 32390 34390 gene locus_tag LOCUS_23610 32390 34390 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202600.1 protein_id gnl|my_center|LOCUS_23610 34396 34764 gene locus_tag LOCUS_23620 34396 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786767.1 protein_id gnl|my_center|LOCUS_23620 34806 35789 gene locus_tag LOCUS_23630 34806 35789 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202601.1 protein_id gnl|my_center|LOCUS_23630 <36703 35923 gene locus_tag LOCUS_23640 <36703 35923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202602.1:Tex family protein >Feature sequence052 1657 1091 gene locus_tag LOCUS_23650 gene ruvC 1657 1091 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062938.1 protein_id gnl|my_center|LOCUS_23650 1992 1654 gene locus_tag LOCUS_23660 1992 1654 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203211.1 protein_id gnl|my_center|LOCUS_23660 2072 2146 gene locus_tag LOCUS_t00310 2072 2146 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3649 2309 gene locus_tag LOCUS_23670 3649 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661122.1 protein_id gnl|my_center|LOCUS_23670 4274 5293 gene locus_tag LOCUS_23680 gene pheS 4274 5293 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_23680 5406 6602 gene locus_tag LOCUS_23690 5406 6602 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769619.1 protein_id gnl|my_center|LOCUS_23690 6599 7276 gene locus_tag LOCUS_23700 gene nth 6599 7276 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_23700 7366 8625 gene locus_tag LOCUS_23710 7366 8625 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_23710 8633 9655 gene locus_tag LOCUS_23720 8633 9655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203215.1 protein_id gnl|my_center|LOCUS_23720 9672 10709 gene locus_tag LOCUS_23730 9672 10709 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_23730 10733 11923 gene locus_tag LOCUS_23740 10733 11923 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798870.1 protein_id gnl|my_center|LOCUS_23740 11927 14125 gene locus_tag LOCUS_23750 11927 14125 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_23750 14371 14880 gene locus_tag LOCUS_23760 14371 14880 CDS product DUF3836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789313.1 protein_id gnl|my_center|LOCUS_23760 15963 15205 gene locus_tag LOCUS_23770 15963 15205 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798873.1 protein_id gnl|my_center|LOCUS_23770 16412 17932 gene locus_tag LOCUS_23780 16412 17932 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769615.1 protein_id gnl|my_center|LOCUS_23780 17947 18189 gene locus_tag LOCUS_23790 17947 18189 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_23790 18193 19575 gene locus_tag LOCUS_23800 18193 19575 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203218.1 protein_id gnl|my_center|LOCUS_23800 19594 20634 gene locus_tag LOCUS_23810 19594 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203219.1 protein_id gnl|my_center|LOCUS_23810 20835 21131 gene locus_tag LOCUS_23820 20835 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789333.1 protein_id gnl|my_center|LOCUS_23820 21953 21324 gene locus_tag LOCUS_23830 21953 21324 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_23830 22458 21937 gene locus_tag LOCUS_23840 22458 21937 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_23840 23270 22479 gene locus_tag LOCUS_23850 23270 22479 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_23850 23599 23267 gene locus_tag LOCUS_23860 23599 23267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789521.1 protein_id gnl|my_center|LOCUS_23860 24138 23602 gene locus_tag LOCUS_23870 24138 23602 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203222.1 protein_id gnl|my_center|LOCUS_23870 24847 24305 gene locus_tag LOCUS_23880 24847 24305 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_23880 24965 25948 gene locus_tag LOCUS_23890 24965 25948 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_23890 26181 26585 gene locus_tag LOCUS_23900 gene mce 26181 26585 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_23900 26711 28264 gene locus_tag LOCUS_23910 26711 28264 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_23910 28285 29199 gene locus_tag LOCUS_23920 28285 29199 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_23920 29225 29656 gene locus_tag LOCUS_23930 29225 29656 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_23930 29659 30819 gene locus_tag LOCUS_23940 29659 30819 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_23940 31064 32299 gene locus_tag LOCUS_23950 31064 32299 CDS product CDC27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798885.1 protein_id gnl|my_center|LOCUS_23950 32394 33605 gene locus_tag LOCUS_23960 32394 33605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769608.1 protein_id gnl|my_center|LOCUS_23960 34131 35981 gene locus_tag LOCUS_23970 34131 35981 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence053 151 747 gene locus_tag LOCUS_23980 151 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 776 1534 gene locus_tag LOCUS_23990 776 1534 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201858.1 protein_id gnl|my_center|LOCUS_23990 2516 1707 gene locus_tag LOCUS_24000 2516 1707 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_24000 3316 2537 gene locus_tag LOCUS_24010 3316 2537 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797001.1 protein_id gnl|my_center|LOCUS_24010 4251 3475 gene locus_tag LOCUS_24020 gene mnmD 4251 3475 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_24020 4736 4260 gene locus_tag LOCUS_24030 4736 4260 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_24030 5713 4721 gene locus_tag LOCUS_24040 5713 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_24040 6987 5713 gene locus_tag LOCUS_24050 gene purD 6987 5713 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_24050 9084 7009 gene locus_tag LOCUS_24060 9084 7009 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_24060 10658 9303 gene locus_tag LOCUS_24070 10658 9303 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_24070 11620 10721 gene locus_tag LOCUS_24080 11620 10721 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783689.1 protein_id gnl|my_center|LOCUS_24080 11849 13777 gene locus_tag LOCUS_24090 11849 13777 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_24090 13790 14545 gene locus_tag LOCUS_24100 13790 14545 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796993.1 protein_id gnl|my_center|LOCUS_24100 15317 14922 gene locus_tag LOCUS_24110 15317 14922 CDS product DUF3836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783692.1 protein_id gnl|my_center|LOCUS_24110 18412 15587 gene locus_tag LOCUS_24120 gene polA 18412 15587 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_24120 18621 19454 gene locus_tag LOCUS_24130 18621 19454 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_24130 20171 19464 gene locus_tag LOCUS_24140 20171 19464 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801982.1 protein_id gnl|my_center|LOCUS_24140 21474 20572 gene locus_tag LOCUS_24150 gene deoC 21474 20572 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_24150 21799 21461 gene locus_tag LOCUS_24160 21799 21461 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_24160 22251 21799 gene locus_tag LOCUS_24170 gene dtd 22251 21799 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_24170 24123 22297 gene locus_tag LOCUS_24180 gene uvrC 24123 22297 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783702.1 protein_id gnl|my_center|LOCUS_24180 24712 24176 gene locus_tag LOCUS_24190 24712 24176 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_24190 26640 24763 gene locus_tag LOCUS_24200 gene mnmG 26640 24763 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_24200 27377 29065 gene locus_tag LOCUS_24210 27377 29065 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201865.1 protein_id gnl|my_center|LOCUS_24210 29235 29585 gene locus_tag LOCUS_24220 29235 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783706.1 protein_id gnl|my_center|LOCUS_24220 29621 30844 gene locus_tag LOCUS_24230 29621 30844 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783712.1 protein_id gnl|my_center|LOCUS_24230 30862 31242 gene locus_tag LOCUS_24240 30862 31242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783715.1 protein_id gnl|my_center|LOCUS_24240 31953 31534 gene locus_tag LOCUS_24250 gene ybeY 31953 31534 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_24250 32403 32828 gene locus_tag LOCUS_24260 32403 32828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783718.1 protein_id gnl|my_center|LOCUS_24260 32993 33874 gene locus_tag LOCUS_24270 32993 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201871.1 protein_id gnl|my_center|LOCUS_24270 <35181 34543 gene locus_tag LOCUS_24280 <35181 34543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201872.1:fimbrillin family protein >Feature sequence054 235 792 gene locus_tag LOCUS_24290 235 792 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203146.1 protein_id gnl|my_center|LOCUS_24290 881 4207 gene locus_tag LOCUS_24300 881 4207 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203145.1 protein_id gnl|my_center|LOCUS_24300 4217 6127 gene locus_tag LOCUS_24310 4217 6127 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788911.1 protein_id gnl|my_center|LOCUS_24310 6143 7045 gene locus_tag LOCUS_24320 6143 7045 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788909.1 protein_id gnl|my_center|LOCUS_24320 7435 10233 gene locus_tag LOCUS_24330 7435 10233 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798674.1 protein_id gnl|my_center|LOCUS_24330 10448 12091 gene locus_tag LOCUS_24340 10448 12091 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_24340 12188 13891 gene locus_tag LOCUS_24350 12188 13891 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798670.1 protein_id gnl|my_center|LOCUS_24350 14128 13958 gene locus_tag LOCUS_24360 14128 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 14139 14885 gene locus_tag LOCUS_24370 14139 14885 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_24370 14934 16259 gene locus_tag LOCUS_24380 14934 16259 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203144.1 protein_id gnl|my_center|LOCUS_24380 16294 16557 gene locus_tag LOCUS_24390 16294 16557 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788897.1 protein_id gnl|my_center|LOCUS_24390 17115 16846 gene locus_tag LOCUS_24400 17115 16846 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_24400 17979 17137 gene locus_tag LOCUS_24410 17979 17137 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788892.1 protein_id gnl|my_center|LOCUS_24410 18800 18036 gene locus_tag LOCUS_24420 18800 18036 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_24420 20088 18916 gene locus_tag LOCUS_24430 20088 18916 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_24430 21388 22776 gene locus_tag LOCUS_24440 21388 22776 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_24440 23694 23398 gene locus_tag LOCUS_24450 23694 23398 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803030.1 protein_id gnl|my_center|LOCUS_24450 23780 24712 gene locus_tag LOCUS_24460 23780 24712 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_24460 24744 25958 gene locus_tag LOCUS_24470 24744 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788880.1 protein_id gnl|my_center|LOCUS_24470 26092 26652 gene locus_tag LOCUS_24480 26092 26652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788879.1 protein_id gnl|my_center|LOCUS_24480 26636 30301 gene locus_tag LOCUS_24490 26636 30301 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203140.1 protein_id gnl|my_center|LOCUS_24490 30699 30307 gene locus_tag LOCUS_24500 30699 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203139.1 protein_id gnl|my_center|LOCUS_24500 31977 31060 gene locus_tag LOCUS_24510 gene rlmF 31977 31060 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203138.1 protein_id gnl|my_center|LOCUS_24510 32606 32175 gene locus_tag LOCUS_24520 32606 32175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 33300 33692 gene locus_tag LOCUS_24530 33300 33692 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203134.1 protein_id gnl|my_center|LOCUS_24530 34866 34273 gene locus_tag LOCUS_24540 34866 34273 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203132.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence055 323 1420 gene locus_tag LOCUS_24550 323 1420 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203063.1 protein_id gnl|my_center|LOCUS_24550 1448 1876 gene locus_tag LOCUS_24560 1448 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_24560 1892 2941 gene locus_tag LOCUS_24570 1892 2941 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203064.1 protein_id gnl|my_center|LOCUS_24570 4852 3080 gene locus_tag LOCUS_24580 4852 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6165 4858 gene locus_tag LOCUS_24590 6165 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 6762 6178 gene locus_tag LOCUS_24600 6762 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 9716 6759 gene locus_tag LOCUS_24610 9716 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 11499 9703 gene locus_tag LOCUS_24620 11499 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 12222 11500 gene locus_tag LOCUS_24630 12222 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 15428 12228 gene locus_tag LOCUS_24640 15428 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 15822 15412 gene locus_tag LOCUS_24650 15822 15412 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_24650 16130 15828 gene locus_tag LOCUS_24660 16130 15828 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_24660 17953 16157 gene locus_tag LOCUS_24670 17953 16157 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_24670 18639 17965 gene locus_tag LOCUS_24680 18639 17965 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_24680 18811 18641 gene locus_tag LOCUS_24690 18811 18641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 19274 18813 gene locus_tag LOCUS_24700 19274 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 19740 19288 gene locus_tag LOCUS_24710 19740 19288 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_24710 21395 19896 gene locus_tag LOCUS_24720 21395 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 22179 21427 gene locus_tag LOCUS_24730 22179 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 22715 22176 gene locus_tag LOCUS_24740 22715 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 24177 22939 gene locus_tag LOCUS_24750 24177 22939 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788673.1 protein_id gnl|my_center|LOCUS_24750 26009 24174 gene locus_tag LOCUS_24760 26009 24174 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_24760 26301 26044 gene locus_tag LOCUS_24770 26301 26044 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798575.1 protein_id gnl|my_center|LOCUS_24770 28112 26475 gene locus_tag LOCUS_24780 28112 26475 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203065.1 protein_id gnl|my_center|LOCUS_24780 29620 29018 gene locus_tag LOCUS_24790 29620 29018 CDS product DUF4858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788682.1 protein_id gnl|my_center|LOCUS_24790 30200 30658 gene locus_tag LOCUS_24800 30200 30658 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_24800 30805 31473 gene locus_tag LOCUS_24810 30805 31473 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_24810 31529 32503 gene locus_tag LOCUS_24820 31529 32503 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_24820 33411 32617 gene locus_tag LOCUS_24830 33411 32617 CDS product N-acetylmuramidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788692.1 protein_id gnl|my_center|LOCUS_24830 33771 33433 gene locus_tag LOCUS_24840 33771 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203073.1 protein_id gnl|my_center|LOCUS_24840 34284 33778 gene locus_tag LOCUS_24850 34284 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788694.1 protein_id gnl|my_center|LOCUS_24850 34529 34293 gene locus_tag LOCUS_24860 34529 34293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788695.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence056 437 1555 gene locus_tag LOCUS_24870 437 1555 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813749.1 protein_id gnl|my_center|LOCUS_24870 1584 3746 gene locus_tag LOCUS_24880 1584 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201942.1 protein_id gnl|my_center|LOCUS_24880 3740 6253 gene locus_tag LOCUS_24890 3740 6253 CDS product DUF4965 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658082.1 protein_id gnl|my_center|LOCUS_24890 6372 8657 gene locus_tag LOCUS_24900 6372 8657 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784085.1 protein_id gnl|my_center|LOCUS_24900 8725 10167 gene locus_tag LOCUS_24910 8725 10167 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_24910 10371 11507 gene locus_tag LOCUS_24920 10371 11507 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_24920 11611 12831 gene locus_tag LOCUS_24930 11611 12831 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201946.1 protein_id gnl|my_center|LOCUS_24930 12881 15874 gene locus_tag LOCUS_24940 12881 15874 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201947.1 protein_id gnl|my_center|LOCUS_24940 15906 16874 gene locus_tag LOCUS_24950 15906 16874 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_24950 17348 17641 gene locus_tag LOCUS_24960 17348 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784099.1 protein_id gnl|my_center|LOCUS_24960 17782 18711 gene locus_tag LOCUS_24970 17782 18711 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201949.1 protein_id gnl|my_center|LOCUS_24970 18797 19219 gene locus_tag LOCUS_24980 18797 19219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24980 20040 21071 gene locus_tag LOCUS_24990 20040 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201954.1 protein_id gnl|my_center|LOCUS_24990 22460 21306 gene locus_tag LOCUS_25000 22460 21306 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_25000 23120 22557 gene locus_tag LOCUS_25010 23120 22557 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784111.1 protein_id gnl|my_center|LOCUS_25010 23525 24805 gene locus_tag LOCUS_25020 23525 24805 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201957.1 protein_id gnl|my_center|LOCUS_25020 25943 24966 gene locus_tag LOCUS_25030 25943 24966 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_25030 26194 28242 gene locus_tag LOCUS_25040 26194 28242 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658102.1 protein_id gnl|my_center|LOCUS_25040 28244 30670 gene locus_tag LOCUS_25050 28244 30670 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658103.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence057 77 3 gene locus_tag LOCUS_t00320 77 3 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 218 814 gene locus_tag LOCUS_25060 218 814 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202425.1 protein_id gnl|my_center|LOCUS_25060 874 2739 gene locus_tag LOCUS_25070 874 2739 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795334.1 protein_id gnl|my_center|LOCUS_25070 3480 2782 gene locus_tag LOCUS_25080 3480 2782 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_25080 3614 3802 gene locus_tag LOCUS_25090 3614 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 4258 3878 gene locus_tag LOCUS_25100 4258 3878 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_25100 5456 4380 gene locus_tag LOCUS_25110 5456 4380 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_25110 6201 5476 gene locus_tag LOCUS_25120 6201 5476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_25120 6980 6273 gene locus_tag LOCUS_25130 gene pdxH 6980 6273 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786189.1 protein_id gnl|my_center|LOCUS_25130 7702 6998 gene locus_tag LOCUS_25140 7702 6998 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202428.1 protein_id gnl|my_center|LOCUS_25140 7955 9772 gene locus_tag LOCUS_25150 7955 9772 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202429.1 protein_id gnl|my_center|LOCUS_25150 10009 10551 gene locus_tag LOCUS_25160 10009 10551 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768204.1 protein_id gnl|my_center|LOCUS_25160 11780 10770 gene locus_tag LOCUS_25170 11780 10770 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_25170 12107 13507 gene locus_tag LOCUS_25180 12107 13507 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_25180 13638 14789 gene locus_tag LOCUS_25190 13638 14789 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816589.1 protein_id gnl|my_center|LOCUS_25190 16167 14878 gene locus_tag LOCUS_25200 16167 14878 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202431.1 protein_id gnl|my_center|LOCUS_25200 16331 16834 gene locus_tag LOCUS_25210 16331 16834 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786203.1 protein_id gnl|my_center|LOCUS_25210 17054 17734 gene locus_tag LOCUS_25220 17054 17734 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_25220 17770 18432 gene locus_tag LOCUS_25230 gene queC 17770 18432 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786207.1 protein_id gnl|my_center|LOCUS_25230 18446 18901 gene locus_tag LOCUS_25240 gene queF 18446 18901 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_25240 19384 18911 gene locus_tag LOCUS_25250 gene rlmH 19384 18911 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_25250 19505 19873 gene locus_tag LOCUS_25260 19505 19873 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_25260 19866 20705 gene locus_tag LOCUS_25270 gene nadC 19866 20705 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_25270 20970 21527 gene locus_tag LOCUS_25280 20970 21527 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_25280 21511 22551 gene locus_tag LOCUS_25290 21511 22551 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992462.1 protein_id gnl|my_center|LOCUS_25290 22570 23100 gene locus_tag LOCUS_25300 22570 23100 CDS product DUF4943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795312.1 protein_id gnl|my_center|LOCUS_25300 23114 23818 gene locus_tag LOCUS_25310 23114 23818 CDS product DUF4858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291914.1 protein_id gnl|my_center|LOCUS_25310 23876 24820 gene locus_tag LOCUS_25320 23876 24820 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_25320 26025 24916 gene locus_tag LOCUS_25330 gene ald 26025 24916 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_25330 26214 27866 gene locus_tag LOCUS_25340 26214 27866 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202435.1 protein_id gnl|my_center|LOCUS_25340 27915 29552 gene locus_tag LOCUS_25350 27915 29552 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_25350 29660 31405 gene locus_tag LOCUS_25360 29660 31405 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence058 509 24 gene locus_tag LOCUS_25370 509 24 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_25370 1001 1189 gene locus_tag LOCUS_25380 1001 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1544 1741 gene locus_tag LOCUS_25390 1544 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 1805 3034 gene locus_tag LOCUS_25400 1805 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791438.1 protein_id gnl|my_center|LOCUS_25400 3039 3494 gene locus_tag LOCUS_25410 3039 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797557.1 protein_id gnl|my_center|LOCUS_25410 3519 4073 gene locus_tag LOCUS_25420 3519 4073 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_25420 4772 4176 gene locus_tag LOCUS_25430 4772 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 5390 5848 gene locus_tag LOCUS_25440 5390 5848 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791433.1 protein_id gnl|my_center|LOCUS_25440 5809 6618 gene locus_tag LOCUS_25450 5809 6618 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797553.1 protein_id gnl|my_center|LOCUS_25450 6888 7478 gene locus_tag LOCUS_25460 6888 7478 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_25460 8408 9013 gene locus_tag LOCUS_25470 8408 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 9183 9497 gene locus_tag LOCUS_25480 9183 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 9502 10689 gene locus_tag LOCUS_25490 9502 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 10921 11871 gene locus_tag LOCUS_25500 10921 11871 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_25500 12176 13498 gene locus_tag LOCUS_25510 12176 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 13794 14270 gene locus_tag LOCUS_25520 13794 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 14286 16208 gene locus_tag LOCUS_25530 14286 16208 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_25530 16475 16391 gene locus_tag LOCUS_t00330 16475 16391 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16632 17714 gene locus_tag LOCUS_25540 16632 17714 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_25540 18287 17883 gene locus_tag LOCUS_25550 18287 17883 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_25550 18802 18338 gene locus_tag LOCUS_25560 gene greA 18802 18338 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_25560 20134 18983 gene locus_tag LOCUS_25570 20134 18983 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_25570 20331 22457 gene locus_tag LOCUS_25580 gene pnp 20331 22457 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_25580 22621 23181 gene locus_tag LOCUS_25590 22621 23181 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 protein_id gnl|my_center|LOCUS_25590 23282 24214 gene locus_tag LOCUS_25600 23282 24214 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_25600 24475 27795 gene locus_tag LOCUS_25610 24475 27795 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_25610 27808 29424 gene locus_tag LOCUS_25620 27808 29424 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_25620 29974 31545 gene locus_tag LOCUS_25630 29974 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203659.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence059 48 320 gene locus_tag LOCUS_25640 gene rpsR 48 320 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_25640 332 775 gene locus_tag LOCUS_25650 gene rplI 332 775 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_25650 1317 1099 gene locus_tag LOCUS_25660 1317 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3149 1476 gene locus_tag LOCUS_25670 3149 1476 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_25670 3578 4897 gene locus_tag LOCUS_25680 gene mtaB 3578 4897 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203485.1 protein_id gnl|my_center|LOCUS_25680 4900 5796 gene locus_tag LOCUS_25690 4900 5796 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_25690 5789 6820 gene locus_tag LOCUS_25700 5789 6820 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_25700 6825 7343 gene locus_tag LOCUS_25710 6825 7343 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790931.1 protein_id gnl|my_center|LOCUS_25710 9329 7908 gene locus_tag LOCUS_25720 9329 7908 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203463.1 protein_id gnl|my_center|LOCUS_25720 9721 9353 gene locus_tag LOCUS_25730 gene folB 9721 9353 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203462.1 protein_id gnl|my_center|LOCUS_25730 10803 9772 gene locus_tag LOCUS_25740 10803 9772 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790927.1 protein_id gnl|my_center|LOCUS_25740 13635 10933 gene locus_tag LOCUS_25750 13635 10933 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_25750 16436 13833 gene locus_tag LOCUS_25760 16436 13833 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_25760 16625 17404 gene locus_tag LOCUS_25770 16625 17404 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203459.1 protein_id gnl|my_center|LOCUS_25770 18922 17492 gene locus_tag LOCUS_25780 gene dnaA 18922 17492 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_25780 20164 19271 gene locus_tag LOCUS_25790 20164 19271 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_25790 21428 20184 gene locus_tag LOCUS_25800 21428 20184 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_25800 21536 22432 gene locus_tag LOCUS_25810 21536 22432 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_25810 22611 23804 gene locus_tag LOCUS_25820 22611 23804 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_25820 23916 24839 gene locus_tag LOCUS_25830 23916 24839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 24971 25258 gene locus_tag LOCUS_25840 24971 25258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 25264 26337 gene locus_tag LOCUS_25850 25264 26337 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203014.1 protein_id gnl|my_center|LOCUS_25850 26500 27465 gene locus_tag LOCUS_25860 26500 27465 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_25860 27611 27994 gene locus_tag LOCUS_25870 gene mobC 27611 27994 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650044.1 protein_id gnl|my_center|LOCUS_25870 27960 28880 gene locus_tag LOCUS_25880 27960 28880 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_25880 28885 29604 gene locus_tag LOCUS_25890 28885 29604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 30016 29657 gene locus_tag LOCUS_25900 30016 29657 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485505.1 protein_id gnl|my_center|LOCUS_25900 30515 30120 gene locus_tag LOCUS_25910 30515 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203317.1 protein_id gnl|my_center|LOCUS_25910 30732 30493 gene locus_tag LOCUS_25920 30732 30493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292732.1 protein_id gnl|my_center|LOCUS_25920 31696 30764 gene locus_tag LOCUS_25930 31696 30764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence060 1007 87 gene locus_tag LOCUS_25940 1007 87 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788972.1 protein_id gnl|my_center|LOCUS_25940 2002 1064 gene locus_tag LOCUS_25950 2002 1064 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_25950 3757 2378 gene locus_tag LOCUS_25960 3757 2378 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788965.1 protein_id gnl|my_center|LOCUS_25960 4513 3761 gene locus_tag LOCUS_25970 4513 3761 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_25970 4706 8083 gene locus_tag LOCUS_25980 gene mfd 4706 8083 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_25980 9964 8108 gene locus_tag LOCUS_25990 9964 8108 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_25990 10466 9990 gene locus_tag LOCUS_26000 10466 9990 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_26000 10815 10471 gene locus_tag LOCUS_26010 10815 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203154.1 protein_id gnl|my_center|LOCUS_26010 11027 10812 gene locus_tag LOCUS_26020 11027 10812 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788955.1 protein_id gnl|my_center|LOCUS_26020 11344 11024 gene locus_tag LOCUS_26030 11344 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_26030 12031 11597 gene locus_tag LOCUS_26040 12031 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798706.1 protein_id gnl|my_center|LOCUS_26040 12046 12210 gene locus_tag LOCUS_26050 12046 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 15360 12451 gene locus_tag LOCUS_26060 15360 12451 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_26060 16184 15462 gene locus_tag LOCUS_26070 16184 15462 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203150.1 protein_id gnl|my_center|LOCUS_26070 18183 16279 gene locus_tag LOCUS_26080 18183 16279 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_26080 19716 18550 gene locus_tag LOCUS_26090 gene nagA 19716 18550 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 protein_id gnl|my_center|LOCUS_26090 20624 19854 gene locus_tag LOCUS_26100 20624 19854 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_26100 21188 20631 gene locus_tag LOCUS_26110 21188 20631 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_26110 21460 21191 gene locus_tag LOCUS_26120 21460 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788933.1 protein_id gnl|my_center|LOCUS_26120 23919 21709 gene locus_tag LOCUS_26130 23919 21709 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_26130 24238 25428 gene locus_tag LOCUS_26140 24238 25428 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_26140 25489 28668 gene locus_tag LOCUS_26150 25489 28668 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 protein_id gnl|my_center|LOCUS_26150 28672 30048 gene locus_tag LOCUS_26160 28672 30048 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_26160 30615 30067 gene locus_tag LOCUS_26170 30615 30067 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence061 2499 1012 gene locus_tag LOCUS_26180 2499 1012 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_26180 3259 2486 gene locus_tag LOCUS_26190 3259 2486 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182127386.1 protein_id gnl|my_center|LOCUS_26190 4742 3369 gene locus_tag LOCUS_26200 4742 3369 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_26200 5152 4859 gene locus_tag LOCUS_26210 5152 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791607.1 protein_id gnl|my_center|LOCUS_26210 8329 5171 gene locus_tag LOCUS_26220 8329 5171 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_26220 9446 8430 gene locus_tag LOCUS_26230 9446 8430 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_26230 10827 9475 gene locus_tag LOCUS_26240 10827 9475 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_26240 11522 10878 gene locus_tag LOCUS_26250 11522 10878 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_26250 13329 11833 gene locus_tag LOCUS_26260 gene hutH 13329 11833 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797649.1 protein_id gnl|my_center|LOCUS_26260 13955 13326 gene locus_tag LOCUS_26270 13955 13326 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_26270 15243 13990 gene locus_tag LOCUS_26280 gene hutI 15243 13990 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203599.1 protein_id gnl|my_center|LOCUS_26280 16152 15250 gene locus_tag LOCUS_26290 gene ftcD 16152 15250 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_26290 18206 16221 gene locus_tag LOCUS_26300 18206 16221 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203600.1 protein_id gnl|my_center|LOCUS_26300 19037 18405 gene locus_tag LOCUS_26310 19037 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203601.1 protein_id gnl|my_center|LOCUS_26310 19431 19610 gene locus_tag LOCUS_26320 19431 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 19598 21412 gene locus_tag LOCUS_26330 19598 21412 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_26330 21983 21444 gene locus_tag LOCUS_26340 21983 21444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791581.1 protein_id gnl|my_center|LOCUS_26340 22499 22092 gene locus_tag LOCUS_26350 22499 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770214.1 protein_id gnl|my_center|LOCUS_26350 23123 22638 gene locus_tag LOCUS_26360 gene rplQ 23123 22638 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791577.1 protein_id gnl|my_center|LOCUS_26360 24119 23127 gene locus_tag LOCUS_26370 24119 23127 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_26370 24736 24131 gene locus_tag LOCUS_26380 gene rpsD 24736 24131 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_26380 25245 24856 gene locus_tag LOCUS_26390 gene rpsK 25245 24856 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_26390 25637 25257 gene locus_tag LOCUS_26400 gene rpsM 25637 25257 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_26400 26014 25796 gene locus_tag LOCUS_26410 gene infA 26014 25796 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_26410 26815 26018 gene locus_tag LOCUS_26420 gene map 26815 26018 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_26420 28176 26830 gene locus_tag LOCUS_26430 gene secY 28176 26830 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_26430 28627 28181 gene locus_tag LOCUS_26440 gene rplO 28627 28181 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_26440 28867 28658 gene locus_tag LOCUS_26450 gene rpmD 28867 28658 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_26450 29363 28845 gene locus_tag LOCUS_26460 gene rpsE 29363 28845 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791564.1 protein_id gnl|my_center|LOCUS_26460 29713 29369 gene locus_tag LOCUS_26470 gene rplR 29713 29369 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_26470 30304 29735 gene locus_tag LOCUS_26480 gene rplF 30304 29735 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence062 <1 1244 gene locus_tag LOCUS_26490 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202696.1:BamA/TamA family outer membrane protein 1557 2306 gene locus_tag LOCUS_26500 1557 2306 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202695.1 protein_id gnl|my_center|LOCUS_26500 2317 4533 gene locus_tag LOCUS_26510 2317 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_26510 4520 5860 gene locus_tag LOCUS_26520 4520 5860 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202694.1 protein_id gnl|my_center|LOCUS_26520 5903 6793 gene locus_tag LOCUS_26530 5903 6793 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_26530 7007 8227 gene locus_tag LOCUS_26540 7007 8227 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794515.1 protein_id gnl|my_center|LOCUS_26540 8536 8387 gene locus_tag LOCUS_26550 8536 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 8617 9570 gene locus_tag LOCUS_26560 8617 9570 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054958832.1 protein_id gnl|my_center|LOCUS_26560 9652 11106 gene locus_tag LOCUS_26570 9652 11106 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768493.1 protein_id gnl|my_center|LOCUS_26570 11103 12215 gene locus_tag LOCUS_26580 11103 12215 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765892.1 protein_id gnl|my_center|LOCUS_26580 12236 13270 gene locus_tag LOCUS_26590 12236 13270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 13267 14418 gene locus_tag LOCUS_26600 13267 14418 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202689.1 protein_id gnl|my_center|LOCUS_26600 14431 15282 gene locus_tag LOCUS_26610 14431 15282 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202688.1 protein_id gnl|my_center|LOCUS_26610 16442 17854 gene locus_tag LOCUS_26620 16442 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202687.1 protein_id gnl|my_center|LOCUS_26620 17863 19071 gene locus_tag LOCUS_26630 17863 19071 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_26630 19084 21783 gene locus_tag LOCUS_26640 19084 21783 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202686.1 protein_id gnl|my_center|LOCUS_26640 21914 22999 gene locus_tag LOCUS_26650 21914 22999 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202685.1 protein_id gnl|my_center|LOCUS_26650 25012 23114 gene locus_tag LOCUS_26660 25012 23114 CDS product choice-of-anchor J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787155.1 protein_id gnl|my_center|LOCUS_26660 27825 25036 gene locus_tag LOCUS_26670 27825 25036 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_26670 29679 28021 gene locus_tag LOCUS_26680 gene ettA 29679 28021 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_26680 29826 29899 gene locus_tag LOCUS_t00340 29826 29899 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 2036 696 gene locus_tag LOCUS_26690 gene mgtE 2036 696 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_26690 2955 2137 gene locus_tag LOCUS_26700 gene rsmA 2955 2137 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_26700 3005 4006 gene locus_tag LOCUS_26710 3005 4006 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_26710 4173 5630 gene locus_tag LOCUS_26720 4173 5630 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_26720 7966 6284 gene locus_tag LOCUS_26730 7966 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_26730 9139 7988 gene locus_tag LOCUS_26740 9139 7988 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801400.1 protein_id gnl|my_center|LOCUS_26740 11870 9144 gene locus_tag LOCUS_26750 11870 9144 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_26750 12631 11891 gene locus_tag LOCUS_26760 12631 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784880.1 protein_id gnl|my_center|LOCUS_26760 12854 18634 gene locus_tag LOCUS_26770 12854 18634 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202133.1 protein_id gnl|my_center|LOCUS_26770 18812 19162 gene locus_tag LOCUS_26780 18812 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 19233 20306 gene locus_tag LOCUS_26790 19233 20306 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201848.1 protein_id gnl|my_center|LOCUS_26790 20314 20844 gene locus_tag LOCUS_26800 20314 20844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 20978 22066 gene locus_tag LOCUS_26810 20978 22066 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_26810 22075 23166 gene locus_tag LOCUS_26820 gene meaB 22075 23166 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_26820 24106 23198 gene locus_tag LOCUS_26830 24106 23198 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_26830 24188 25027 gene locus_tag LOCUS_26840 24188 25027 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_26840 25049 26065 gene locus_tag LOCUS_26850 25049 26065 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_26850 26037 27284 gene locus_tag LOCUS_26860 26037 27284 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_26860 27302 28219 gene locus_tag LOCUS_26870 27302 28219 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_26870 29232 28222 gene locus_tag LOCUS_26880 29232 28222 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_26880 29554 29225 gene locus_tag LOCUS_26890 29554 29225 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_26890 29832 29551 gene locus_tag LOCUS_26900 29832 29551 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784908.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence064 23 457 gene locus_tag LOCUS_26910 23 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 537 1580 gene locus_tag LOCUS_26920 537 1580 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797044.1 protein_id gnl|my_center|LOCUS_26920 1655 3664 gene locus_tag LOCUS_26930 1655 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291317.1 protein_id gnl|my_center|LOCUS_26930 3874 4713 gene locus_tag LOCUS_26940 3874 4713 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_26940 4713 5594 gene locus_tag LOCUS_26950 4713 5594 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_26950 5635 5868 gene locus_tag LOCUS_26960 5635 5868 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_26960 5875 6675 gene locus_tag LOCUS_26970 5875 6675 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_26970 6683 7384 gene locus_tag LOCUS_26980 gene truB 6683 7384 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_26980 7432 8490 gene locus_tag LOCUS_26990 gene queA 7432 8490 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_26990 8490 8951 gene locus_tag LOCUS_27000 gene folK 8490 8951 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_27000 9125 8931 gene locus_tag LOCUS_27010 9125 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783641.1 protein_id gnl|my_center|LOCUS_27010 9334 10626 gene locus_tag LOCUS_27020 gene metK 9334 10626 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_27020 10758 11354 gene locus_tag LOCUS_27030 10758 11354 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_27030 11351 12181 gene locus_tag LOCUS_27040 11351 12181 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802005.1 protein_id gnl|my_center|LOCUS_27040 12186 12938 gene locus_tag LOCUS_27050 12186 12938 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_27050 13029 13409 gene locus_tag LOCUS_27060 gene rnpA 13029 13409 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_27060 13406 13627 gene locus_tag LOCUS_27070 gene yidD 13406 13627 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_27070 13634 14269 gene locus_tag LOCUS_27080 13634 14269 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_27080 14337 15629 gene locus_tag LOCUS_27090 gene tyrS 14337 15629 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_27090 19015 15743 gene locus_tag LOCUS_27100 19015 15743 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_27100 19179 19250 gene locus_tag LOCUS_t00350 19179 19250 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19575 21155 gene locus_tag LOCUS_27110 19575 21155 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_27110 21288 22130 gene locus_tag LOCUS_27120 gene kduI 21288 22130 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_27120 22197 22988 gene locus_tag LOCUS_27130 22197 22988 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_27130 22988 24259 gene locus_tag LOCUS_27140 22988 24259 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_27140 25222 24293 gene locus_tag LOCUS_27150 gene queG 25222 24293 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_27150 25836 25222 gene locus_tag LOCUS_27160 25836 25222 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_27160 29212 25853 gene locus_tag LOCUS_27170 29212 25853 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence065 <1 1629 gene locus_tag LOCUS_27180 <1 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203646.1:1-deoxy-D-xylulose-5-phosphate synthase 2698 1802 gene locus_tag LOCUS_27190 2698 1802 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203645.1 protein_id gnl|my_center|LOCUS_27190 3069 3422 gene locus_tag LOCUS_27200 3069 3422 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_27200 3764 4282 gene locus_tag LOCUS_27210 3764 4282 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791444.1 protein_id gnl|my_center|LOCUS_27210 5098 4343 gene locus_tag LOCUS_27220 5098 4343 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_27220 5188 5775 gene locus_tag LOCUS_27230 5188 5775 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_27230 5800 6450 gene locus_tag LOCUS_27240 5800 6450 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_27240 7054 6542 gene locus_tag LOCUS_27250 7054 6542 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203641.1 protein_id gnl|my_center|LOCUS_27250 9371 7071 gene locus_tag LOCUS_27260 9371 7071 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_27260 10750 9368 gene locus_tag LOCUS_27270 10750 9368 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_27270 12278 10773 gene locus_tag LOCUS_27280 12278 10773 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_27280 13066 12302 gene locus_tag LOCUS_27290 13066 12302 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_27290 14088 13066 gene locus_tag LOCUS_27300 14088 13066 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203638.1 protein_id gnl|my_center|LOCUS_27300 14918 14361 gene locus_tag LOCUS_27310 14918 14361 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_27310 15595 16803 gene locus_tag LOCUS_27320 15595 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 16820 17833 gene locus_tag LOCUS_27330 16820 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 17866 18846 gene locus_tag LOCUS_27340 17866 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 18883 21495 gene locus_tag LOCUS_27350 18883 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 21501 23765 gene locus_tag LOCUS_27360 21501 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 23778 24650 gene locus_tag LOCUS_27370 23778 24650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 24720 25838 gene locus_tag LOCUS_27380 24720 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 26132 28630 gene locus_tag LOCUS_27390 26132 28630 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203637.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence066 <1 607 gene locus_tag LOCUS_27400 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800614.1:YjbH domain-containing protein 669 1787 gene locus_tag LOCUS_27410 669 1787 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786560.1 protein_id gnl|my_center|LOCUS_27410 1909 2325 gene locus_tag LOCUS_27420 gene ruvX 1909 2325 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_27420 2361 2915 gene locus_tag LOCUS_27430 gene def 2361 2915 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_27430 4242 3025 gene locus_tag LOCUS_27440 4242 3025 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202517.1 protein_id gnl|my_center|LOCUS_27440 4544 6592 gene locus_tag LOCUS_27450 4544 6592 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_27450 6673 8613 gene locus_tag LOCUS_27460 gene thrS 6673 8613 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_27460 8732 9343 gene locus_tag LOCUS_27470 gene infC 8732 9343 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_27470 9758 10057 gene locus_tag LOCUS_27480 gene rplT 9758 10057 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_27480 10486 11277 gene locus_tag LOCUS_27490 10486 11277 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_27490 11921 11352 gene locus_tag LOCUS_27500 gene xpt 11921 11352 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786581.1 protein_id gnl|my_center|LOCUS_27500 13314 12007 gene locus_tag LOCUS_27510 13314 12007 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786583.1 protein_id gnl|my_center|LOCUS_27510 14003 13419 gene locus_tag LOCUS_27520 14003 13419 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786586.1 protein_id gnl|my_center|LOCUS_27520 15599 14007 gene locus_tag LOCUS_27530 15599 14007 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_27530 16720 15683 gene locus_tag LOCUS_27540 gene mltG 16720 15683 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_27540 17756 16878 gene locus_tag LOCUS_27550 17756 16878 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786594.1 protein_id gnl|my_center|LOCUS_27550 17902 18048 gene locus_tag LOCUS_27560 17902 18048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 19860 18343 gene locus_tag LOCUS_27570 19860 18343 CDS product leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202521.1 protein_id gnl|my_center|LOCUS_27570 20521 20448 gene locus_tag LOCUS_t00360 20521 20448 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21308 22624 gene locus_tag LOCUS_27580 21308 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 22739 25288 gene locus_tag LOCUS_27590 22739 25288 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_27590 25294 26406 gene locus_tag LOCUS_27600 25294 26406 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_27600 26382 26912 gene locus_tag LOCUS_27610 26382 26912 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202523.1 protein_id gnl|my_center|LOCUS_27610 26912 27376 gene locus_tag LOCUS_27620 26912 27376 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_27620 28581 27373 gene locus_tag LOCUS_27630 28581 27373 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence067 1171 2397 gene locus_tag LOCUS_27640 1171 2397 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_27640 2394 3968 gene locus_tag LOCUS_27650 2394 3968 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_27650 4076 7405 gene locus_tag LOCUS_27660 gene secA 4076 7405 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_27660 7525 8625 gene locus_tag LOCUS_27670 7525 8625 CDS product DUF6340 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785441.1 protein_id gnl|my_center|LOCUS_27670 8690 9136 gene locus_tag LOCUS_27680 8690 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_27680 10787 9216 gene locus_tag LOCUS_27690 10787 9216 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_27690 12513 10939 gene locus_tag LOCUS_27700 12513 10939 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795907.1 protein_id gnl|my_center|LOCUS_27700 14170 12530 gene locus_tag LOCUS_27710 14170 12530 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_27710 17443 14177 gene locus_tag LOCUS_27720 17443 14177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_27720 18733 17726 gene locus_tag LOCUS_27730 18733 17726 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_27730 18869 19444 gene locus_tag LOCUS_27740 18869 19444 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_27740 20720 19647 gene locus_tag LOCUS_27750 20720 19647 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_27750 21833 20805 gene locus_tag LOCUS_27760 21833 20805 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 protein_id gnl|my_center|LOCUS_27760 23432 21912 gene locus_tag LOCUS_27770 23432 21912 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785422.1 protein_id gnl|my_center|LOCUS_27770 26730 23446 gene locus_tag LOCUS_27780 26730 23446 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785421.1 protein_id gnl|my_center|LOCUS_27780 28030 27005 gene locus_tag LOCUS_27790 28030 27005 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence068 296 39 gene locus_tag LOCUS_27800 296 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 777 2273 gene locus_tag LOCUS_27810 777 2273 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_27810 2321 3715 gene locus_tag LOCUS_27820 gene leuC 2321 3715 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_27820 3828 4418 gene locus_tag LOCUS_27830 gene leuD 3828 4418 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_27830 4397 5926 gene locus_tag LOCUS_27840 4397 5926 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_27840 5939 7000 gene locus_tag LOCUS_27850 gene leuB 5939 7000 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_27850 7218 7952 gene locus_tag LOCUS_27860 7218 7952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_27860 8062 8604 gene locus_tag LOCUS_27870 8062 8604 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_27870 8594 10147 gene locus_tag LOCUS_27880 8594 10147 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203291.1 protein_id gnl|my_center|LOCUS_27880 10161 11171 gene locus_tag LOCUS_27890 10161 11171 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_27890 12044 15223 gene locus_tag LOCUS_27900 12044 15223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_27900 15236 16855 gene locus_tag LOCUS_27910 15236 16855 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_27910 18093 17077 gene locus_tag LOCUS_27920 18093 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769531.1 protein_id gnl|my_center|LOCUS_27920 20281 18143 gene locus_tag LOCUS_27930 20281 18143 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_27930 21543 20878 gene locus_tag LOCUS_27940 21543 20878 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_27940 23328 21568 gene locus_tag LOCUS_27950 23328 21568 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_27950 23497 24447 gene locus_tag LOCUS_27960 gene cysK 23497 24447 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203286.1 protein_id gnl|my_center|LOCUS_27960 24588 25373 gene locus_tag LOCUS_27970 24588 25373 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_27970 27591 25768 gene locus_tag LOCUS_27980 gene recQ 27591 25768 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence069 396 166 gene locus_tag LOCUS_27990 396 166 CDS product DUF3873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485418.1 protein_id gnl|my_center|LOCUS_27990 673 416 gene locus_tag LOCUS_28000 673 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291531.1 protein_id gnl|my_center|LOCUS_28000 1714 698 gene locus_tag LOCUS_28010 1714 698 CDS product PcfJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291532.1 protein_id gnl|my_center|LOCUS_28010 2406 1984 gene locus_tag LOCUS_28020 2406 1984 CDS product PcfK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291533.1 protein_id gnl|my_center|LOCUS_28020 2641 2420 gene locus_tag LOCUS_28030 2641 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291534.1 protein_id gnl|my_center|LOCUS_28030 2868 2653 gene locus_tag LOCUS_28040 2868 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3683 5728 gene locus_tag LOCUS_28050 3683 5728 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065317.1 protein_id gnl|my_center|LOCUS_28050 5713 7374 gene locus_tag LOCUS_28060 5713 7374 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022126.1 protein_id gnl|my_center|LOCUS_28060 7932 8117 gene locus_tag LOCUS_28070 7932 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 8851 8300 gene locus_tag LOCUS_28080 8851 8300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783757.1 protein_id gnl|my_center|LOCUS_28080 9079 9429 gene locus_tag LOCUS_28090 9079 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201878.1 protein_id gnl|my_center|LOCUS_28090 10842 9595 gene locus_tag LOCUS_28100 10842 9595 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_28100 10944 11474 gene locus_tag LOCUS_28110 10944 11474 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_28110 11474 12079 gene locus_tag LOCUS_28120 11474 12079 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_28120 12067 12987 gene locus_tag LOCUS_28130 12067 12987 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_28130 13172 14227 gene locus_tag LOCUS_28140 13172 14227 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201876.1 protein_id gnl|my_center|LOCUS_28140 14322 16232 gene locus_tag LOCUS_28150 14322 16232 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_28150 16979 17842 gene locus_tag LOCUS_28160 16979 17842 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_28160 20069 17892 gene locus_tag LOCUS_28170 20069 17892 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_28170 21488 20121 gene locus_tag LOCUS_28180 21488 20121 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_28180 23023 21491 gene locus_tag LOCUS_28190 23023 21491 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_28190 24044 23016 gene locus_tag LOCUS_28200 gene ruvB 24044 23016 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_28200 25071 24373 gene locus_tag LOCUS_28210 25071 24373 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_28210 25178 26410 gene locus_tag LOCUS_28220 25178 26410 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence070 252 1295 gene locus_tag LOCUS_28230 252 1295 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203727.1 protein_id gnl|my_center|LOCUS_28230 1292 4324 gene locus_tag LOCUS_28240 1292 4324 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203726.1 protein_id gnl|my_center|LOCUS_28240 4420 5616 gene locus_tag LOCUS_28250 4420 5616 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555881.1 protein_id gnl|my_center|LOCUS_28250 5659 6684 gene locus_tag LOCUS_28260 5659 6684 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661662.1 protein_id gnl|my_center|LOCUS_28260 6677 7450 gene locus_tag LOCUS_28270 6677 7450 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797186.1 protein_id gnl|my_center|LOCUS_28270 7591 7517 gene locus_tag LOCUS_t00370 7591 7517 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7999 7688 gene locus_tag LOCUS_28280 7999 7688 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_28280 8488 8003 gene locus_tag LOCUS_28290 8488 8003 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_28290 9523 8660 gene locus_tag LOCUS_28300 9523 8660 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791913.1 protein_id gnl|my_center|LOCUS_28300 10128 9544 gene locus_tag LOCUS_28310 10128 9544 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_28310 10595 11305 gene locus_tag LOCUS_28320 10595 11305 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_28320 12012 11239 gene locus_tag LOCUS_28330 12012 11239 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_28330 13270 12005 gene locus_tag LOCUS_28340 13270 12005 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_28340 13375 14577 gene locus_tag LOCUS_28350 gene wecC 13375 14577 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791918.1 protein_id gnl|my_center|LOCUS_28350 14632 15762 gene locus_tag LOCUS_28360 gene wecB 14632 15762 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791919.1 protein_id gnl|my_center|LOCUS_28360 16461 15814 gene locus_tag LOCUS_28370 16461 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791920.1 protein_id gnl|my_center|LOCUS_28370 17729 16530 gene locus_tag LOCUS_28380 17729 16530 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814093.1 protein_id gnl|my_center|LOCUS_28380 18739 17729 gene locus_tag LOCUS_28390 18739 17729 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203721.1 protein_id gnl|my_center|LOCUS_28390 19936 18749 gene locus_tag LOCUS_28400 19936 18749 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203720.1 protein_id gnl|my_center|LOCUS_28400 21385 19940 gene locus_tag LOCUS_28410 21385 19940 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_28410 23515 21476 gene locus_tag LOCUS_28420 gene metG 23515 21476 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_28420 24767 23679 gene locus_tag LOCUS_28430 24767 23679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791926.1 protein_id gnl|my_center|LOCUS_28430 25137 24784 gene locus_tag LOCUS_28440 25137 24784 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797207.1 protein_id gnl|my_center|LOCUS_28440 25362 26147 gene locus_tag LOCUS_28450 25362 26147 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661641.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence071 2540 465 gene locus_tag LOCUS_28460 2540 465 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203121.1 protein_id gnl|my_center|LOCUS_28460 2671 2877 gene locus_tag LOCUS_28470 2671 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2996 3169 gene locus_tag LOCUS_28480 2996 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3900 3493 gene locus_tag LOCUS_28490 3900 3493 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788828.1 protein_id gnl|my_center|LOCUS_28490 4930 4109 gene locus_tag LOCUS_28500 4930 4109 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798627.1 protein_id gnl|my_center|LOCUS_28500 5338 4973 gene locus_tag LOCUS_28510 5338 4973 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798628.1 protein_id gnl|my_center|LOCUS_28510 6124 5444 gene locus_tag LOCUS_28520 6124 5444 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_28520 10411 6635 gene locus_tag LOCUS_28530 10411 6635 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203125.1 protein_id gnl|my_center|LOCUS_28530 13000 10421 gene locus_tag LOCUS_28540 13000 10421 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203126.1 protein_id gnl|my_center|LOCUS_28540 14023 13019 gene locus_tag LOCUS_28550 14023 13019 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203127.1 protein_id gnl|my_center|LOCUS_28550 14715 14032 gene locus_tag LOCUS_28560 14715 14032 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203128.1 protein_id gnl|my_center|LOCUS_28560 15352 14717 gene locus_tag LOCUS_28570 15352 14717 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_28570 16626 15376 gene locus_tag LOCUS_28580 16626 15376 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_28580 19225 16640 gene locus_tag LOCUS_28590 19225 16640 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815203.1 protein_id gnl|my_center|LOCUS_28590 21085 19397 gene locus_tag LOCUS_28600 21085 19397 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203129.1 protein_id gnl|my_center|LOCUS_28600 24333 21106 gene locus_tag LOCUS_28610 24333 21106 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_28610 25603 24572 gene locus_tag LOCUS_28620 25603 24572 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049100798.1 protein_id gnl|my_center|LOCUS_28620 26409 25813 gene locus_tag LOCUS_28630 26409 25813 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788857.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence072 42 773 gene locus_tag LOCUS_28640 42 773 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_28640 760 2034 gene locus_tag LOCUS_28650 760 2034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_28650 2080 3405 gene locus_tag LOCUS_28660 2080 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_28660 3524 4027 gene locus_tag LOCUS_28670 gene lptC 3524 4027 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813036.1 protein_id gnl|my_center|LOCUS_28670 4030 5286 gene locus_tag LOCUS_28680 4030 5286 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_28680 5407 7545 gene locus_tag LOCUS_28690 5407 7545 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_28690 7723 8757 gene locus_tag LOCUS_28700 gene rlmN 7723 8757 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_28700 8832 9878 gene locus_tag LOCUS_28710 8832 9878 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_28710 9883 10980 gene locus_tag LOCUS_28720 gene pdxA 9883 10980 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_28720 11005 12231 gene locus_tag LOCUS_28730 11005 12231 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_28730 12218 12739 gene locus_tag LOCUS_28740 12218 12739 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_28740 12745 13500 gene locus_tag LOCUS_28750 12745 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_28750 13505 13885 gene locus_tag LOCUS_28760 gene secG 13505 13885 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_28760 14056 15444 gene locus_tag LOCUS_28770 14056 15444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_28770 15451 15804 gene locus_tag LOCUS_28780 15451 15804 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785477.1 protein_id gnl|my_center|LOCUS_28780 16993 15938 gene locus_tag LOCUS_28790 16993 15938 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_28790 18577 17066 gene locus_tag LOCUS_28800 18577 17066 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_28800 19961 18621 gene locus_tag LOCUS_28810 19961 18621 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801181.1 protein_id gnl|my_center|LOCUS_28810 20351 20902 gene locus_tag LOCUS_28820 20351 20902 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_28820 21616 22134 gene locus_tag LOCUS_28830 gene upcY 21616 22134 CDS product capsular polysaccharide transcription antiterminator UpcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658901.1 protein_id gnl|my_center|LOCUS_28830 22317 22709 gene locus_tag LOCUS_28840 22317 22709 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785489.1 protein_id gnl|my_center|LOCUS_28840 22712 23596 gene locus_tag LOCUS_28850 gene rfbA 22712 23596 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795876.1 protein_id gnl|my_center|LOCUS_28850 23914 25443 gene locus_tag LOCUS_28860 23914 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202254.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence073 96 22 gene locus_tag LOCUS_t00380 96 22 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 199 125 gene locus_tag LOCUS_t00390 199 125 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 282 1271 gene locus_tag LOCUS_28870 282 1271 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_28870 1316 3001 gene locus_tag LOCUS_28880 1316 3001 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_28880 3176 6019 gene locus_tag LOCUS_28890 3176 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_28890 6218 8491 gene locus_tag LOCUS_28900 gene bglX 6218 8491 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_28900 9238 12234 gene locus_tag LOCUS_28910 9238 12234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_28910 12374 13861 gene locus_tag LOCUS_28920 12374 13861 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_28920 14123 15388 gene locus_tag LOCUS_28930 14123 15388 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_28930 15410 17131 gene locus_tag LOCUS_28940 15410 17131 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_28940 17144 17917 gene locus_tag LOCUS_28950 17144 17917 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_28950 19990 18110 gene locus_tag LOCUS_28960 19990 18110 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_28960 20501 19995 gene locus_tag LOCUS_28970 gene purE 20501 19995 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_28970 21073 20693 gene locus_tag LOCUS_28980 gene gcvH 21073 20693 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_28980 21784 21104 gene locus_tag LOCUS_28990 21784 21104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_28990 23290 21812 gene locus_tag LOCUS_29000 gene rpoN 23290 21812 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_29000 23555 24928 gene locus_tag LOCUS_29010 23555 24928 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence074 1695 196 gene locus_tag LOCUS_29020 1695 196 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992604.1 protein_id gnl|my_center|LOCUS_29020 3348 1900 gene locus_tag LOCUS_29030 3348 1900 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786444.1 protein_id gnl|my_center|LOCUS_29030 3993 3400 gene locus_tag LOCUS_29040 3993 3400 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202498.1 protein_id gnl|my_center|LOCUS_29040 4255 5799 gene locus_tag LOCUS_29050 4255 5799 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_29050 5818 7329 gene locus_tag LOCUS_29060 gene accC 5818 7329 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_29060 7337 7867 gene locus_tag LOCUS_29070 7337 7867 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786452.1 protein_id gnl|my_center|LOCUS_29070 9235 7973 gene locus_tag LOCUS_29080 9235 7973 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 protein_id gnl|my_center|LOCUS_29080 9682 11343 gene locus_tag LOCUS_29090 9682 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555691.1 protein_id gnl|my_center|LOCUS_29090 11365 12957 gene locus_tag LOCUS_29100 11365 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786457.1 protein_id gnl|my_center|LOCUS_29100 13344 13138 gene locus_tag LOCUS_29110 13344 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786459.1 protein_id gnl|my_center|LOCUS_29110 13909 15258 gene locus_tag LOCUS_29120 gene lpdA 13909 15258 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786461.1 protein_id gnl|my_center|LOCUS_29120 15258 15959 gene locus_tag LOCUS_29130 15258 15959 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202501.1 protein_id gnl|my_center|LOCUS_29130 16358 16146 gene locus_tag LOCUS_29140 16358 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 16488 17834 gene locus_tag LOCUS_29150 16488 17834 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291985.1 protein_id gnl|my_center|LOCUS_29150 17930 20014 gene locus_tag LOCUS_29160 17930 20014 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202503.1 protein_id gnl|my_center|LOCUS_29160 20033 20539 gene locus_tag LOCUS_29170 20033 20539 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800645.1 protein_id gnl|my_center|LOCUS_29170 21458 20616 gene locus_tag LOCUS_29180 gene prmA 21458 20616 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_29180 22101 22430 gene locus_tag LOCUS_29190 22101 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795112.1 protein_id gnl|my_center|LOCUS_29190 23448 24905 gene locus_tag LOCUS_29200 23448 24905 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795105.1 protein_id gnl|my_center|LOCUS_29200 24997 25446 gene locus_tag LOCUS_29210 24997 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768297.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence075 399 2402 gene locus_tag LOCUS_29220 gene dnaG 399 2402 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_29220 4029 2437 gene locus_tag LOCUS_29230 4029 2437 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_29230 5537 4056 gene locus_tag LOCUS_29240 5537 4056 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_29240 7229 5622 gene locus_tag LOCUS_29250 7229 5622 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_29250 10620 7243 gene locus_tag LOCUS_29260 10620 7243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791110.1 protein_id gnl|my_center|LOCUS_29260 11718 10786 gene locus_tag LOCUS_29270 11718 10786 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798453.1 protein_id gnl|my_center|LOCUS_29270 12372 11794 gene locus_tag LOCUS_29280 12372 11794 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791112.1 protein_id gnl|my_center|LOCUS_29280 13084 12500 gene locus_tag LOCUS_29290 gene folE 13084 12500 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_29290 13536 13087 gene locus_tag LOCUS_29300 13536 13087 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_29300 14416 13613 gene locus_tag LOCUS_29310 gene tpiA 14416 13613 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_29310 15748 14417 gene locus_tag LOCUS_29320 15748 14417 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_29320 16280 15738 gene locus_tag LOCUS_29330 16280 15738 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_29330 17266 16385 gene locus_tag LOCUS_29340 17266 16385 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_29340 17750 17289 gene locus_tag LOCUS_29350 gene ndk 17750 17289 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_29350 20068 17972 gene locus_tag LOCUS_29360 gene recG 20068 17972 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_29360 20727 20068 gene locus_tag LOCUS_29370 20727 20068 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_29370 21283 20732 gene locus_tag LOCUS_29380 21283 20732 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_29380 22197 21355 gene locus_tag LOCUS_29390 22197 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 22529 22194 gene locus_tag LOCUS_29400 22529 22194 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_29400 23409 22687 gene locus_tag LOCUS_29410 23409 22687 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_29410 24122 23409 gene locus_tag LOCUS_29420 24122 23409 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_29420 24255 25127 gene locus_tag LOCUS_29430 24255 25127 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_29430 >Feature sequence076 2222 345 gene locus_tag LOCUS_29440 gene mutL 2222 345 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_29440 2555 2259 gene locus_tag LOCUS_29450 2555 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791850.1 protein_id gnl|my_center|LOCUS_29450 4171 2558 gene locus_tag LOCUS_29460 4171 2558 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_29460 5644 4274 gene locus_tag LOCUS_29470 5644 4274 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_29470 6553 5654 gene locus_tag LOCUS_29480 6553 5654 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_29480 8106 6553 gene locus_tag LOCUS_29490 8106 6553 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203579.1 protein_id gnl|my_center|LOCUS_29490 9726 8251 gene locus_tag LOCUS_29500 gene guaB 9726 8251 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_29500 11993 9813 gene locus_tag LOCUS_29510 gene recQ 11993 9813 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_29510 13411 12164 gene locus_tag LOCUS_29520 gene clpX 13411 12164 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_29520 14076 13414 gene locus_tag LOCUS_29530 gene clpP 14076 13414 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_29530 15569 14214 gene locus_tag LOCUS_29540 gene tig 15569 14214 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_29540 16818 17063 gene locus_tag LOCUS_29550 16818 17063 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791868.1 protein_id gnl|my_center|LOCUS_29550 17943 17182 gene locus_tag LOCUS_29560 gene lptB 17943 17182 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_29560 18019 18762 gene locus_tag LOCUS_29570 18019 18762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_29570 18759 19529 gene locus_tag LOCUS_29580 18759 19529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_29580 20408 19761 gene locus_tag LOCUS_29590 20408 19761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_29590 21898 20585 gene locus_tag LOCUS_29600 gene der 21898 20585 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_29600 22868 21951 gene locus_tag LOCUS_29610 gene era 22868 21951 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_29610 23924 22920 gene locus_tag LOCUS_29620 23924 22920 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_29620 24207 24022 gene locus_tag LOCUS_29630 gene rpmF 24207 24022 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_29630 24796 24221 gene locus_tag LOCUS_29640 24796 24221 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence077 1023 559 gene locus_tag LOCUS_29650 1023 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793705.1 protein_id gnl|my_center|LOCUS_29650 1514 1020 gene locus_tag LOCUS_29660 1514 1020 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_29660 2834 2400 gene locus_tag LOCUS_29670 2834 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3455 3123 gene locus_tag LOCUS_29680 3455 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 3743 3459 gene locus_tag LOCUS_29690 3743 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7423 3794 gene locus_tag LOCUS_29700 7423 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 9450 7402 gene locus_tag LOCUS_29710 9450 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793696.1 protein_id gnl|my_center|LOCUS_29710 12446 9447 gene locus_tag LOCUS_29720 12446 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 13158 12541 gene locus_tag LOCUS_29730 13158 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 13734 13225 gene locus_tag LOCUS_29740 13734 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 14104 13736 gene locus_tag LOCUS_29750 14104 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 14559 14104 gene locus_tag LOCUS_29760 14559 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 14879 14556 gene locus_tag LOCUS_29770 14879 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 15184 14876 gene locus_tag LOCUS_29780 15184 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 16432 15188 gene locus_tag LOCUS_29790 16432 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 17039 16443 gene locus_tag LOCUS_29800 17039 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 18292 17042 gene locus_tag LOCUS_29810 18292 17042 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938794.1 protein_id gnl|my_center|LOCUS_29810 19955 18333 gene locus_tag LOCUS_29820 19955 18333 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_29820 20335 19952 gene locus_tag LOCUS_29830 20335 19952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 21030 20638 gene locus_tag LOCUS_29840 21030 20638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 21297 21079 gene locus_tag LOCUS_29850 21297 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 21566 21312 gene locus_tag LOCUS_29860 21566 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 21897 21568 gene locus_tag LOCUS_29870 21897 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 22365 22090 gene locus_tag LOCUS_29880 22365 22090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 22741 22379 gene locus_tag LOCUS_29890 22741 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 22948 22757 gene locus_tag LOCUS_29900 22948 22757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 23241 22960 gene locus_tag LOCUS_29910 23241 22960 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202882.1 protein_id gnl|my_center|LOCUS_29910 24378 23437 gene locus_tag LOCUS_29920 24378 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202883.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence078 <1 724 gene locus_tag LOCUS_29930 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787899.1:tetratricopeptide repeat protein 935 1219 gene locus_tag LOCUS_29940 935 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_29940 1298 2419 gene locus_tag LOCUS_29950 1298 2419 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_29950 3959 2769 gene locus_tag LOCUS_29960 3959 2769 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_29960 6550 4013 gene locus_tag LOCUS_29970 gene gyrA 6550 4013 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_29970 6942 9476 gene locus_tag LOCUS_29980 6942 9476 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_29980 9607 11652 gene locus_tag LOCUS_29990 gene htpG 9607 11652 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_29990 11870 14122 gene locus_tag LOCUS_30000 11870 14122 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768894.1 protein_id gnl|my_center|LOCUS_30000 14203 14277 gene locus_tag LOCUS_t00400 14203 14277 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14295 14369 gene locus_tag LOCUS_t00410 14295 14369 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14391 14465 gene locus_tag LOCUS_t00420 14391 14465 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15452 14559 gene locus_tag LOCUS_30010 15452 14559 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_30010 15751 16125 gene locus_tag LOCUS_30020 15751 16125 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_30020 16222 16848 gene locus_tag LOCUS_30030 16222 16848 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_30030 17893 17000 gene locus_tag LOCUS_30040 gene dapA 17893 17000 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_30040 19994 17997 gene locus_tag LOCUS_30050 gene ligA 19994 17997 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_30050 20071 20748 gene locus_tag LOCUS_30060 gene trmD 20071 20748 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_30060 21877 20966 gene locus_tag LOCUS_30070 21877 20966 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_30070 22641 21865 gene locus_tag LOCUS_30080 22641 21865 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_30080 23226 22714 gene locus_tag LOCUS_30090 23226 22714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence079 66 506 gene locus_tag LOCUS_30100 66 506 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789554.1 protein_id gnl|my_center|LOCUS_30100 519 1586 gene locus_tag LOCUS_30110 519 1586 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203225.1 protein_id gnl|my_center|LOCUS_30110 1591 3186 gene locus_tag LOCUS_30120 1591 3186 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203226.1 protein_id gnl|my_center|LOCUS_30120 4285 3281 gene locus_tag LOCUS_30130 4285 3281 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_30130 5485 4466 gene locus_tag LOCUS_30140 5485 4466 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769604.1 protein_id gnl|my_center|LOCUS_30140 5865 6116 gene locus_tag LOCUS_30150 5865 6116 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_30150 6514 8040 gene locus_tag LOCUS_30160 6514 8040 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203229.1 protein_id gnl|my_center|LOCUS_30160 11012 8151 gene locus_tag LOCUS_30170 11012 8151 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203230.1 protein_id gnl|my_center|LOCUS_30170 12715 11117 gene locus_tag LOCUS_30180 12715 11117 CDS product SusF/SusE family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203231.1 protein_id gnl|my_center|LOCUS_30180 14370 12751 gene locus_tag LOCUS_30190 14370 12751 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_30190 17359 14381 gene locus_tag LOCUS_30200 17359 14381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_30200 17705 18715 gene locus_tag LOCUS_30210 17705 18715 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_30210 18736 20052 gene locus_tag LOCUS_30220 18736 20052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_30220 20403 22718 gene locus_tag LOCUS_30230 20403 22718 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292939.1 protein_id gnl|my_center|LOCUS_30230 23061 24122 gene locus_tag LOCUS_30240 23061 24122 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789585.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence080 438 1136 gene locus_tag LOCUS_30250 gene rplA 438 1136 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_30250 1152 1664 gene locus_tag LOCUS_30260 gene rplJ 1152 1664 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_30260 1713 2087 gene locus_tag LOCUS_30270 gene rplL 1713 2087 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_30270 2192 6004 gene locus_tag LOCUS_30280 gene rpoB 2192 6004 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_30280 6151 10434 gene locus_tag LOCUS_30290 gene rpoC 6151 10434 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_30290 11646 10510 gene locus_tag LOCUS_30300 11646 10510 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_30300 12477 12722 gene locus_tag LOCUS_30310 12477 12722 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 protein_id gnl|my_center|LOCUS_30310 12785 13045 gene locus_tag LOCUS_30320 12785 13045 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791531.1 protein_id gnl|my_center|LOCUS_30320 13359 13670 gene locus_tag LOCUS_30330 13359 13670 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_30330 13918 14319 gene locus_tag LOCUS_30340 gene rpsL 13918 14319 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_30340 14479 14955 gene locus_tag LOCUS_30350 gene rpsG 14479 14955 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_30350 15009 17126 gene locus_tag LOCUS_30360 gene fusA 15009 17126 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_30360 17208 17513 gene locus_tag LOCUS_30370 gene rpsJ 17208 17513 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_30370 17532 18149 gene locus_tag LOCUS_30380 gene rplC 17532 18149 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_30380 18149 18775 gene locus_tag LOCUS_30390 gene rplD 18149 18775 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_30390 18792 19082 gene locus_tag LOCUS_30400 gene rplW 18792 19082 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_30400 19088 19912 gene locus_tag LOCUS_30410 gene rplB 19088 19912 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_30410 19933 20202 gene locus_tag LOCUS_30420 gene rpsS 19933 20202 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_30420 20238 20648 gene locus_tag LOCUS_30430 gene rplV 20238 20648 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_30430 20654 21388 gene locus_tag LOCUS_30440 gene rpsC 20654 21388 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_30440 21412 21846 gene locus_tag LOCUS_30450 gene rplP 21412 21846 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_30450 21852 22049 gene locus_tag LOCUS_30460 gene rpmC 21852 22049 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_30460 22046 22315 gene locus_tag LOCUS_30470 gene rpsQ 22046 22315 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_30470 22318 22683 gene locus_tag LOCUS_30480 gene rplN 22318 22683 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_30480 22704 23024 gene locus_tag LOCUS_30490 gene rplX 22704 23024 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_30490 23024 23581 gene locus_tag LOCUS_30500 gene rplE 23024 23581 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_30500 23588 23887 gene locus_tag LOCUS_30510 gene rpsN 23588 23887 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_30510 >Feature sequence081 1948 1220 gene locus_tag LOCUS_30520 1948 1220 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787542.1 protein_id gnl|my_center|LOCUS_30520 2514 1945 gene locus_tag LOCUS_30530 2514 1945 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_30530 3061 2600 gene locus_tag LOCUS_30540 gene pyrI 3061 2600 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_30540 3935 3066 gene locus_tag LOCUS_30550 gene pyrB 3935 3066 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_30550 4445 4702 gene locus_tag LOCUS_30560 4445 4702 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803434.1 protein_id gnl|my_center|LOCUS_30560 4699 5319 gene locus_tag LOCUS_30570 4699 5319 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_30570 6150 5320 gene locus_tag LOCUS_30580 6150 5320 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794168.1 protein_id gnl|my_center|LOCUS_30580 7640 6261 gene locus_tag LOCUS_30590 7640 6261 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202781.1 protein_id gnl|my_center|LOCUS_30590 7875 8837 gene locus_tag LOCUS_30600 7875 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787556.1 protein_id gnl|my_center|LOCUS_30600 9017 11188 gene locus_tag LOCUS_30610 9017 11188 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202783.1 protein_id gnl|my_center|LOCUS_30610 12142 11192 gene locus_tag LOCUS_30620 12142 11192 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202784.1 protein_id gnl|my_center|LOCUS_30620 14477 12363 gene locus_tag LOCUS_30630 14477 12363 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202785.1 protein_id gnl|my_center|LOCUS_30630 17733 14464 gene locus_tag LOCUS_30640 17733 14464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202786.1 protein_id gnl|my_center|LOCUS_30640 18070 18558 gene locus_tag LOCUS_30650 18070 18558 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817665.1 protein_id gnl|my_center|LOCUS_30650 19917 18646 gene locus_tag LOCUS_30660 19917 18646 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202787.1 protein_id gnl|my_center|LOCUS_30660 21190 19889 gene locus_tag LOCUS_30670 21190 19889 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202788.1 protein_id gnl|my_center|LOCUS_30670 22017 21187 gene locus_tag LOCUS_30680 gene kdsB 22017 21187 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence082 1056 37 gene locus_tag LOCUS_30690 gene holA 1056 37 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_30690 1851 1075 gene locus_tag LOCUS_30700 1851 1075 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_30700 1916 2365 gene locus_tag LOCUS_30710 1916 2365 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_30710 5832 2710 gene locus_tag LOCUS_30720 5832 2710 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202854.1 protein_id gnl|my_center|LOCUS_30720 6976 5837 gene locus_tag LOCUS_30730 6976 5837 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292376.1 protein_id gnl|my_center|LOCUS_30730 8401 6995 gene locus_tag LOCUS_30740 8401 6995 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202853.1 protein_id gnl|my_center|LOCUS_30740 9461 8637 gene locus_tag LOCUS_30750 9461 8637 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_30750 10561 9467 gene locus_tag LOCUS_30760 10561 9467 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_30760 10668 11081 gene locus_tag LOCUS_30770 10668 11081 CDS product DUF4891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787822.1 protein_id gnl|my_center|LOCUS_30770 11457 11074 gene locus_tag LOCUS_30780 11457 11074 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803565.1 protein_id gnl|my_center|LOCUS_30780 11821 11549 gene locus_tag LOCUS_30790 11821 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202851.1 protein_id gnl|my_center|LOCUS_30790 12623 11829 gene locus_tag LOCUS_30800 12623 11829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_30800 13247 12627 gene locus_tag LOCUS_30810 13247 12627 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_30810 13342 13869 gene locus_tag LOCUS_30820 13342 13869 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_30820 13923 15065 gene locus_tag LOCUS_30830 13923 15065 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202849.1 protein_id gnl|my_center|LOCUS_30830 15077 15961 gene locus_tag LOCUS_30840 15077 15961 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_30840 16424 16041 gene locus_tag LOCUS_30850 16424 16041 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_30850 18182 16425 gene locus_tag LOCUS_30860 gene aspS 18182 16425 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202848.1 protein_id gnl|my_center|LOCUS_30860 19307 18264 gene locus_tag LOCUS_30870 19307 18264 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_30870 19542 20726 gene locus_tag LOCUS_30880 19542 20726 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_30880 20937 20782 gene locus_tag LOCUS_30890 20937 20782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30890 21213 20995 gene locus_tag LOCUS_30900 21213 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30900 21633 22231 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccttattatactggaatacatctacat >Feature sequence083 378 1520 gene locus_tag LOCUS_30910 378 1520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_30910 1517 2521 gene locus_tag LOCUS_30920 1517 2521 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785797.1 protein_id gnl|my_center|LOCUS_30920 3482 2718 gene locus_tag LOCUS_30930 3482 2718 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785793.1 protein_id gnl|my_center|LOCUS_30930 3820 4884 gene locus_tag LOCUS_30940 3820 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202314.1 protein_id gnl|my_center|LOCUS_30940 4979 6172 gene locus_tag LOCUS_30950 4979 6172 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_30950 6242 6688 gene locus_tag LOCUS_30960 gene bcp 6242 6688 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_30960 6699 7742 gene locus_tag LOCUS_30970 gene recA 6699 7742 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_30970 8089 7808 gene locus_tag LOCUS_30980 8089 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785786.1 protein_id gnl|my_center|LOCUS_30980 8174 8689 gene locus_tag LOCUS_30990 8174 8689 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_30990 8670 9197 gene locus_tag LOCUS_31000 8670 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795692.1 protein_id gnl|my_center|LOCUS_31000 9204 9887 gene locus_tag LOCUS_31010 9204 9887 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785780.1 protein_id gnl|my_center|LOCUS_31010 10968 9976 gene locus_tag LOCUS_31020 10968 9976 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_31020 11944 11048 gene locus_tag LOCUS_31030 11944 11048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_31030 12550 11969 gene locus_tag LOCUS_31040 12550 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785774.1 protein_id gnl|my_center|LOCUS_31040 12773 15361 gene locus_tag LOCUS_31050 gene clpB 12773 15361 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_31050 15676 15437 gene locus_tag LOCUS_31060 15676 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768082.1 protein_id gnl|my_center|LOCUS_31060 16579 16163 gene locus_tag LOCUS_31070 16579 16163 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_31070 17214 16597 gene locus_tag LOCUS_31080 gene coaE 17214 16597 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_31080 18217 17204 gene locus_tag LOCUS_31090 18217 17204 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768081.1 protein_id gnl|my_center|LOCUS_31090 18510 18241 gene locus_tag LOCUS_31100 gene yajC 18510 18241 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_31100 19540 18614 gene locus_tag LOCUS_31110 gene nusB 19540 18614 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_31110 19709 20095 gene locus_tag LOCUS_31120 19709 20095 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_31120 20240 20830 gene locus_tag LOCUS_31130 20240 20830 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_31130 20937 21500 gene locus_tag LOCUS_31140 gene pth 20937 21500 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_31140 21527 21952 gene locus_tag LOCUS_31150 21527 21952 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence084 354 797 gene locus_tag LOCUS_31160 gene umuD 354 797 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_31160 797 2080 gene locus_tag LOCUS_31170 797 2080 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_31170 2883 2194 gene locus_tag LOCUS_31180 2883 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202619.1 protein_id gnl|my_center|LOCUS_31180 4258 3095 gene locus_tag LOCUS_31190 4258 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202618.1 protein_id gnl|my_center|LOCUS_31190 5565 4714 gene locus_tag LOCUS_31200 5565 4714 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 protein_id gnl|my_center|LOCUS_31200 7792 5726 gene locus_tag LOCUS_31210 7792 5726 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202616.1 protein_id gnl|my_center|LOCUS_31210 8356 8075 gene locus_tag LOCUS_31220 8356 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786878.1 protein_id gnl|my_center|LOCUS_31220 8859 8635 gene locus_tag LOCUS_31230 8859 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786876.1 protein_id gnl|my_center|LOCUS_31230 9932 9216 gene locus_tag LOCUS_31240 gene pgl 9932 9216 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786873.1 protein_id gnl|my_center|LOCUS_31240 11425 9929 gene locus_tag LOCUS_31250 gene zwf 11425 9929 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800449.1 protein_id gnl|my_center|LOCUS_31250 12915 11440 gene locus_tag LOCUS_31260 gene gnd 12915 11440 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794816.1 protein_id gnl|my_center|LOCUS_31260 13048 14226 gene locus_tag LOCUS_31270 13048 14226 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_31270 14891 14418 gene locus_tag LOCUS_31280 14891 14418 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786864.1 protein_id gnl|my_center|LOCUS_31280 16665 15673 gene locus_tag LOCUS_31290 gene rhuM 16665 15673 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_31290 17063 16695 gene locus_tag LOCUS_31300 17063 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202681.1 protein_id gnl|my_center|LOCUS_31300 17307 17125 gene locus_tag LOCUS_31310 17307 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 18515 17565 gene locus_tag LOCUS_31320 18515 17565 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786860.1 protein_id gnl|my_center|LOCUS_31320 19526 18519 gene locus_tag LOCUS_31330 19526 18519 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 protein_id gnl|my_center|LOCUS_31330 20287 19523 gene locus_tag LOCUS_31340 20287 19523 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_31340 <21209 20291 gene locus_tag LOCUS_31350 <21209 20291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203512.1:glycosyltransferase family 4 protein >Feature sequence085 466 1431 gene locus_tag LOCUS_31360 466 1431 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785896.1 protein_id gnl|my_center|LOCUS_31360 1787 4990 gene locus_tag LOCUS_31370 1787 4990 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202338.1 protein_id gnl|my_center|LOCUS_31370 5002 6525 gene locus_tag LOCUS_31380 5002 6525 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_31380 6613 7599 gene locus_tag LOCUS_31390 6613 7599 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_31390 7641 8540 gene locus_tag LOCUS_31400 7641 8540 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_31400 8595 9620 gene locus_tag LOCUS_31410 8595 9620 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785910.1 protein_id gnl|my_center|LOCUS_31410 11320 9770 gene locus_tag LOCUS_31420 gene ahpF 11320 9770 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202340.1 protein_id gnl|my_center|LOCUS_31420 11987 11421 gene locus_tag LOCUS_31430 gene ahpC 11987 11421 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775969.1 protein_id gnl|my_center|LOCUS_31430 12962 13393 gene locus_tag LOCUS_31440 12962 13393 CDS product DUF4890 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202341.1 protein_id gnl|my_center|LOCUS_31440 13543 14097 gene locus_tag LOCUS_31450 13543 14097 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785920.1 protein_id gnl|my_center|LOCUS_31450 14215 14658 gene locus_tag LOCUS_31460 14215 14658 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785921.1 protein_id gnl|my_center|LOCUS_31460 14696 15196 gene locus_tag LOCUS_31470 14696 15196 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816392.1 protein_id gnl|my_center|LOCUS_31470 16508 15300 gene locus_tag LOCUS_31480 16508 15300 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_31480 17626 16565 gene locus_tag LOCUS_31490 gene corA 17626 16565 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785927.1 protein_id gnl|my_center|LOCUS_31490 20137 17639 gene locus_tag LOCUS_31500 20137 17639 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_31500 20292 20377 gene locus_tag LOCUS_t00430 20292 20377 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 740 69 gene locus_tag LOCUS_31510 740 69 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_31510 1022 1225 gene locus_tag LOCUS_31520 1022 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1137 2750 gene locus_tag LOCUS_31530 1137 2750 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203343.1 protein_id gnl|my_center|LOCUS_31530 4639 3146 gene locus_tag LOCUS_31540 4639 3146 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_31540 5147 4860 gene locus_tag LOCUS_31550 5147 4860 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790301.1 protein_id gnl|my_center|LOCUS_31550 5325 5558 gene locus_tag LOCUS_31560 5325 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790304.1 protein_id gnl|my_center|LOCUS_31560 6428 5583 gene locus_tag LOCUS_31570 6428 5583 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108071.1 protein_id gnl|my_center|LOCUS_31570 6579 7694 gene locus_tag LOCUS_31580 6579 7694 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797794.1 protein_id gnl|my_center|LOCUS_31580 7777 10983 gene locus_tag LOCUS_31590 7777 10983 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203349.1 protein_id gnl|my_center|LOCUS_31590 10994 12421 gene locus_tag LOCUS_31600 10994 12421 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790315.1 protein_id gnl|my_center|LOCUS_31600 13850 12570 gene locus_tag LOCUS_31610 13850 12570 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_31610 14062 15060 gene locus_tag LOCUS_31620 14062 15060 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797797.1 protein_id gnl|my_center|LOCUS_31620 15188 16144 gene locus_tag LOCUS_31630 15188 16144 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790322.1 protein_id gnl|my_center|LOCUS_31630 17190 16192 gene locus_tag LOCUS_31640 17190 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797800.1 protein_id gnl|my_center|LOCUS_31640 17344 17607 gene locus_tag LOCUS_31650 17344 17607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797802.1 protein_id gnl|my_center|LOCUS_31650 17709 17984 gene locus_tag LOCUS_31660 17709 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790330.1 protein_id gnl|my_center|LOCUS_31660 18279 18713 gene locus_tag LOCUS_31670 18279 18713 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797803.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence087 1134 361 gene locus_tag LOCUS_31680 1134 361 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_31680 2211 1150 gene locus_tag LOCUS_31690 2211 1150 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_31690 3418 2234 gene locus_tag LOCUS_31700 3418 2234 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_31700 4277 3393 gene locus_tag LOCUS_31710 4277 3393 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_31710 4706 5428 gene locus_tag LOCUS_31720 4706 5428 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_31720 5634 6542 gene locus_tag LOCUS_31730 5634 6542 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_31730 6632 9928 gene locus_tag LOCUS_31740 6632 9928 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_31740 10002 11402 gene locus_tag LOCUS_31750 10002 11402 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_31750 11495 12595 gene locus_tag LOCUS_31760 11495 12595 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_31760 12619 14277 gene locus_tag LOCUS_31770 12619 14277 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_31770 14283 15518 gene locus_tag LOCUS_31780 14283 15518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_31780 16548 15586 gene locus_tag LOCUS_31790 16548 15586 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203527.1 protein_id gnl|my_center|LOCUS_31790 18515 16611 gene locus_tag LOCUS_31800 18515 16611 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_31800 <20300 18512 gene locus_tag LOCUS_31810 <20300 18512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203525.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence088 <1 525 gene locus_tag LOCUS_31820 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202544.1:cyclically-permuted mutarotase family protein 593 2665 gene locus_tag LOCUS_31830 593 2665 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202545.1 protein_id gnl|my_center|LOCUS_31830 2726 4975 gene locus_tag LOCUS_31840 2726 4975 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_31840 4989 7490 gene locus_tag LOCUS_31850 gene galB 4989 7490 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_31850 7587 10331 gene locus_tag LOCUS_31860 7587 10331 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_31860 10346 11977 gene locus_tag LOCUS_31870 10346 11977 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_31870 13363 12179 gene locus_tag LOCUS_31880 gene dnaJ 13363 12179 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_31880 14044 13415 gene locus_tag LOCUS_31890 14044 13415 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_31890 14238 15851 gene locus_tag LOCUS_31900 14238 15851 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_31900 16014 16577 gene locus_tag LOCUS_31910 16014 16577 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_31910 16574 16996 gene locus_tag LOCUS_31920 16574 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202550.1 protein_id gnl|my_center|LOCUS_31920 17010 18083 gene locus_tag LOCUS_31930 17010 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202551.1 protein_id gnl|my_center|LOCUS_31930 19270 18224 gene locus_tag LOCUS_31940 19270 18224 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794961.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence089 1985 462 gene locus_tag LOCUS_31950 gene guaA 1985 462 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_31950 2456 2016 gene locus_tag LOCUS_31960 gene mscL 2456 2016 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_31960 2585 3586 gene locus_tag LOCUS_31970 gene gap 2585 3586 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_31970 3810 5867 gene locus_tag LOCUS_31980 3810 5867 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_31980 5874 6383 gene locus_tag LOCUS_31990 5874 6383 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785244.1 protein_id gnl|my_center|LOCUS_31990 6395 6832 gene locus_tag LOCUS_32000 6395 6832 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_32000 6910 8637 gene locus_tag LOCUS_32010 6910 8637 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_32010 8567 9097 gene locus_tag LOCUS_32020 8567 9097 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_32020 9130 9882 gene locus_tag LOCUS_32030 9130 9882 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_32030 10295 10005 gene locus_tag LOCUS_32040 10295 10005 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_32040 11404 10292 gene locus_tag LOCUS_32050 gene recF 11404 10292 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_32050 11565 12248 gene locus_tag LOCUS_32060 11565 12248 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_32060 12334 12828 gene locus_tag LOCUS_32070 gene ribH 12334 12828 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_32070 12901 12984 gene locus_tag LOCUS_t00440 12901 12984 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12992 13065 gene locus_tag LOCUS_t00450 12992 13065 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13128 14378 gene locus_tag LOCUS_32080 13128 14378 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_32080 16253 14469 gene locus_tag LOCUS_32090 16253 14469 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785224.1 protein_id gnl|my_center|LOCUS_32090 19616 16272 gene locus_tag LOCUS_32100 19616 16272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202214.1 protein_id gnl|my_center|LOCUS_32100 >Feature sequence090 1568 1933 gene locus_tag LOCUS_32110 1568 1933 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_32110 1949 3511 gene locus_tag LOCUS_32120 1949 3511 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202189.1 protein_id gnl|my_center|LOCUS_32120 3843 5795 gene locus_tag LOCUS_32130 3843 5795 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_32130 6970 5891 gene locus_tag LOCUS_32140 6970 5891 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291639.1 protein_id gnl|my_center|LOCUS_32140 7630 8727 gene locus_tag LOCUS_32150 7630 8727 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036858670.1 protein_id gnl|my_center|LOCUS_32150 12078 9388 gene locus_tag LOCUS_32160 12078 9388 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_32160 12644 12324 gene locus_tag LOCUS_32170 12644 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 14172 12694 gene locus_tag LOCUS_32180 14172 12694 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_32180 15567 14185 gene locus_tag LOCUS_32190 15567 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 16622 15570 gene locus_tag LOCUS_32200 16622 15570 CDS product TerY-C metal binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253656.1 protein_id gnl|my_center|LOCUS_32200 17257 16622 gene locus_tag LOCUS_32210 17257 16622 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253659.1 protein_id gnl|my_center|LOCUS_32210 17957 17319 gene locus_tag LOCUS_32220 17957 17319 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_32220 18645 17962 gene locus_tag LOCUS_32230 18645 17962 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964723.1 protein_id gnl|my_center|LOCUS_32230 19347 18658 gene locus_tag LOCUS_32240 19347 18658 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236643.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence091 83 244 gene locus_tag LOCUS_32250 83 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 213 881 gene locus_tag LOCUS_32260 213 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1303 2370 gene locus_tag LOCUS_32270 1303 2370 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_32270 3835 2384 gene locus_tag LOCUS_32280 3835 2384 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659530.1 protein_id gnl|my_center|LOCUS_32280 5370 3919 gene locus_tag LOCUS_32290 5370 3919 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794945.1 protein_id gnl|my_center|LOCUS_32290 6987 5383 gene locus_tag LOCUS_32300 6987 5383 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_32300 8157 7006 gene locus_tag LOCUS_32310 8157 7006 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_32310 8965 8195 gene locus_tag LOCUS_32320 8965 8195 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_32320 12005 9075 gene locus_tag LOCUS_32330 12005 9075 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_32330 13659 12028 gene locus_tag LOCUS_32340 13659 12028 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_32340 16817 13671 gene locus_tag LOCUS_32350 16817 13671 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_32350 17823 16966 gene locus_tag LOCUS_32360 17823 16966 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_32360 19025 17988 gene locus_tag LOCUS_32370 19025 17988 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794959.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence092 266 45 gene locus_tag LOCUS_32380 266 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 3598 1109 gene locus_tag LOCUS_32390 3598 1109 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_32390 5505 4378 gene locus_tag LOCUS_32400 5505 4378 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_32400 7335 5518 gene locus_tag LOCUS_32410 7335 5518 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_32410 8043 7564 gene locus_tag LOCUS_32420 8043 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791963.1 protein_id gnl|my_center|LOCUS_32420 9939 8086 gene locus_tag LOCUS_32430 9939 8086 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203703.1 protein_id gnl|my_center|LOCUS_32430 13067 9969 gene locus_tag LOCUS_32440 13067 9969 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797388.1 protein_id gnl|my_center|LOCUS_32440 16182 14182 gene locus_tag LOCUS_32450 16182 14182 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797392.1 protein_id gnl|my_center|LOCUS_32450 19389 16195 gene locus_tag LOCUS_32460 19389 16195 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791968.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence093 1872 2804 gene locus_tag LOCUS_32470 1872 2804 CDS product Tsr26 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797599.1 protein_id gnl|my_center|LOCUS_32470 3250 5730 gene locus_tag LOCUS_32480 3250 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203632.1 protein_id gnl|my_center|LOCUS_32480 5809 6720 gene locus_tag LOCUS_32490 5809 6720 CDS product BT1926 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203631.1 protein_id gnl|my_center|LOCUS_32490 6813 7400 gene locus_tag LOCUS_32500 6813 7400 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203630.1 protein_id gnl|my_center|LOCUS_32500 8546 7599 gene locus_tag LOCUS_32510 8546 7599 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797605.1 protein_id gnl|my_center|LOCUS_32510 8661 9290 gene locus_tag LOCUS_32520 8661 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_32520 9339 9902 gene locus_tag LOCUS_32530 9339 9902 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_32530 9973 10194 gene locus_tag LOCUS_32540 9973 10194 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_32540 10397 11755 gene locus_tag LOCUS_32550 10397 11755 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822203.1 protein_id gnl|my_center|LOCUS_32550 11925 12485 gene locus_tag LOCUS_32560 11925 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811504.1 protein_id gnl|my_center|LOCUS_32560 12718 13050 gene locus_tag LOCUS_32570 12718 13050 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811501.1 protein_id gnl|my_center|LOCUS_32570 13043 14542 gene locus_tag LOCUS_32580 13043 14542 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_32580 14535 15563 gene locus_tag LOCUS_32590 14535 15563 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_32590 15714 17255 gene locus_tag LOCUS_32600 gene mobV 15714 17255 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203628.1 protein_id gnl|my_center|LOCUS_32600 17342 18661 gene locus_tag LOCUS_32610 17342 18661 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_32610 18646 18924 gene locus_tag LOCUS_32620 18646 18924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203627.1 protein_id gnl|my_center|LOCUS_32620 >Feature sequence094 <1 698 gene locus_tag LOCUS_32630 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202941.1:RnfABCDGE type electron transport complex subunit G 716 1303 gene locus_tag LOCUS_32640 716 1303 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_32640 1317 1889 gene locus_tag LOCUS_32650 gene rsxA 1317 1889 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_32650 2094 3128 gene locus_tag LOCUS_32660 gene galE 2094 3128 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_32660 4712 3453 gene locus_tag LOCUS_32670 4712 3453 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803746.1 protein_id gnl|my_center|LOCUS_32670 6090 4846 gene locus_tag LOCUS_32680 6090 4846 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788145.1 protein_id gnl|my_center|LOCUS_32680 6937 6113 gene locus_tag LOCUS_32690 gene ispE 6937 6113 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_32690 7115 8662 gene locus_tag LOCUS_32700 gene dnaB 7115 8662 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_32700 8692 9021 gene locus_tag LOCUS_32710 8692 9021 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_32710 9026 11875 gene locus_tag LOCUS_32720 9026 11875 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_32720 13016 13534 gene locus_tag LOCUS_32730 gene upeY 13016 13534 CDS product capsular polysaccharide transcription antiterminator UpeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778177.1 protein_id gnl|my_center|LOCUS_32730 13558 14043 gene locus_tag LOCUS_32740 13558 14043 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788135.1 protein_id gnl|my_center|LOCUS_32740 14037 15347 gene locus_tag LOCUS_32750 gene aepX 14037 15347 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_32750 15355 16482 gene locus_tag LOCUS_32760 gene aepY 15355 16482 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202932.1 protein_id gnl|my_center|LOCUS_32760 16484 17605 gene locus_tag LOCUS_32770 16484 17605 CDS product phosphonoacetaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202931.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence095 1353 34 gene locus_tag LOCUS_32780 1353 34 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_32780 3569 1356 gene locus_tag LOCUS_32790 3569 1356 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_32790 6032 3765 gene locus_tag LOCUS_32800 6032 3765 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303097.1 protein_id gnl|my_center|LOCUS_32800 7025 6426 gene locus_tag LOCUS_32810 7025 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799104.1 protein_id gnl|my_center|LOCUS_32810 7625 7038 gene locus_tag LOCUS_32820 7625 7038 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799102.1 protein_id gnl|my_center|LOCUS_32820 8766 7771 gene locus_tag LOCUS_32830 8766 7771 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804212.1 protein_id gnl|my_center|LOCUS_32830 9653 8763 gene locus_tag LOCUS_32840 9653 8763 CDS product glycosyltransferase family 10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203562.1 protein_id gnl|my_center|LOCUS_32840 12177 9703 gene locus_tag LOCUS_32850 12177 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203563.1 protein_id gnl|my_center|LOCUS_32850 12860 12189 gene locus_tag LOCUS_32860 12860 12189 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203564.1 protein_id gnl|my_center|LOCUS_32860 14115 12874 gene locus_tag LOCUS_32870 14115 12874 CDS product TIGR04150 pseudo-rSAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203565.1 protein_id gnl|my_center|LOCUS_32870 15376 14129 gene locus_tag LOCUS_32880 15376 14129 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993584.1 protein_id gnl|my_center|LOCUS_32880 16699 15380 gene locus_tag LOCUS_32890 16699 15380 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993585.1 protein_id gnl|my_center|LOCUS_32890 17986 16730 gene locus_tag LOCUS_32900 17986 16730 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203566.1 protein_id gnl|my_center|LOCUS_32900 >Feature sequence096 168 1340 gene locus_tag LOCUS_32910 168 1340 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_32910 2538 1447 gene locus_tag LOCUS_32920 gene trpS 2538 1447 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_32920 2847 6083 gene locus_tag LOCUS_32930 gene carB 2847 6083 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_32930 6229 6711 gene locus_tag LOCUS_32940 6229 6711 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 protein_id gnl|my_center|LOCUS_32940 6927 7871 gene locus_tag LOCUS_32950 6927 7871 CDS product Tsr15 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799110.1 protein_id gnl|my_center|LOCUS_32950 8313 9518 gene locus_tag LOCUS_32960 8313 9518 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203559.1 protein_id gnl|my_center|LOCUS_32960 9628 10539 gene locus_tag LOCUS_32970 9628 10539 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203558.1 protein_id gnl|my_center|LOCUS_32970 10569 11165 gene locus_tag LOCUS_32980 10569 11165 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799113.1 protein_id gnl|my_center|LOCUS_32980 11190 13040 gene locus_tag LOCUS_32990 11190 13040 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791774.1 protein_id gnl|my_center|LOCUS_32990 13064 15526 gene locus_tag LOCUS_33000 13064 15526 CDS product Calx-beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293274.1 protein_id gnl|my_center|LOCUS_33000 15528 18116 gene locus_tag LOCUS_33010 15528 18116 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203555.1 protein_id gnl|my_center|LOCUS_33010 >Feature sequence097 317 2197 gene locus_tag LOCUS_33020 317 2197 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203669.1 protein_id gnl|my_center|LOCUS_33020 2215 3801 gene locus_tag LOCUS_33030 2215 3801 CDS product DUF3858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203668.1 protein_id gnl|my_center|LOCUS_33030 4112 5938 gene locus_tag LOCUS_33040 4112 5938 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203666.1 protein_id gnl|my_center|LOCUS_33040 7718 6165 gene locus_tag LOCUS_33050 7718 6165 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_33050 9629 7956 gene locus_tag LOCUS_33060 9629 7956 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_33060 9713 11410 gene locus_tag LOCUS_33070 9713 11410 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_33070 11649 11488 gene locus_tag LOCUS_33080 11649 11488 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804009.1 protein_id gnl|my_center|LOCUS_33080 11784 13457 gene locus_tag LOCUS_33090 11784 13457 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791324.1 protein_id gnl|my_center|LOCUS_33090 13521 16205 gene locus_tag LOCUS_33100 13521 16205 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_33100 16323 16946 gene locus_tag LOCUS_33110 16323 16946 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_33110 16966 17907 gene locus_tag LOCUS_33120 16966 17907 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence098 232 3351 gene locus_tag LOCUS_33130 232 3351 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992680.1 protein_id gnl|my_center|LOCUS_33130 3363 5378 gene locus_tag LOCUS_33140 3363 5378 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202538.1 protein_id gnl|my_center|LOCUS_33140 5662 7296 gene locus_tag LOCUS_33150 5662 7296 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786655.1 protein_id gnl|my_center|LOCUS_33150 7328 9340 gene locus_tag LOCUS_33160 7328 9340 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_33160 9361 10023 gene locus_tag LOCUS_33170 9361 10023 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_33170 10020 12092 gene locus_tag LOCUS_33180 10020 12092 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_33180 12114 14684 gene locus_tag LOCUS_33190 12114 14684 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_33190 14704 17028 gene locus_tag LOCUS_33200 14704 17028 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence099 165 1625 gene locus_tag LOCUS_33210 165 1625 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785885.1 protein_id gnl|my_center|LOCUS_33210 2408 1722 gene locus_tag LOCUS_33220 2408 1722 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_33220 4184 2424 gene locus_tag LOCUS_33230 4184 2424 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_33230 4395 5762 gene locus_tag LOCUS_33240 4395 5762 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_33240 5828 6727 gene locus_tag LOCUS_33250 gene nfo 5828 6727 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_33250 8292 6721 gene locus_tag LOCUS_33260 8292 6721 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202333.1 protein_id gnl|my_center|LOCUS_33260 8704 10296 gene locus_tag LOCUS_33270 8704 10296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_33270 10430 11008 gene locus_tag LOCUS_33280 10430 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818837.1 protein_id gnl|my_center|LOCUS_33280 11042 14512 gene locus_tag LOCUS_33290 11042 14512 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_33290 >Feature sequence100 281 871 gene locus_tag LOCUS_33300 281 871 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_33300 883 1722 gene locus_tag LOCUS_33310 883 1722 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_33310 1759 3516 gene locus_tag LOCUS_33320 1759 3516 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_33320 3546 4865 gene locus_tag LOCUS_33330 3546 4865 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_33330 4878 5483 gene locus_tag LOCUS_33340 4878 5483 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_33340 5480 7297 gene locus_tag LOCUS_33350 5480 7297 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_33350 7342 7803 gene locus_tag LOCUS_33360 7342 7803 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_33360 8033 9694 gene locus_tag LOCUS_33370 8033 9694 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_33370 9728 12292 gene locus_tag LOCUS_33380 9728 12292 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_33380 12393 13043 gene locus_tag LOCUS_33390 12393 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788422.1 protein_id gnl|my_center|LOCUS_33390 14288 13185 gene locus_tag LOCUS_33400 14288 13185 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_33400 14399 15811 gene locus_tag LOCUS_33410 gene potA 14399 15811 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_33410 15928 16626 gene locus_tag LOCUS_33420 15928 16626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence101 235 573 gene locus_tag LOCUS_33430 235 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786811.1 protein_id gnl|my_center|LOCUS_33430 714 1061 gene locus_tag LOCUS_33440 714 1061 CDS product SH3 beta-barrel fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786809.1 protein_id gnl|my_center|LOCUS_33440 1111 1914 gene locus_tag LOCUS_33450 1111 1914 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202608.1 protein_id gnl|my_center|LOCUS_33450 3479 2208 gene locus_tag LOCUS_33460 3479 2208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_33460 3693 4766 gene locus_tag LOCUS_33470 gene gmd 3693 4766 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_33470 4771 5841 gene locus_tag LOCUS_33480 4771 5841 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_33480 6035 7693 gene locus_tag LOCUS_33490 6035 7693 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_33490 7802 8959 gene locus_tag LOCUS_33500 7802 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_33500 11045 9051 gene locus_tag LOCUS_33510 11045 9051 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_33510 12755 11094 gene locus_tag LOCUS_33520 12755 11094 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_33520 14193 12841 gene locus_tag LOCUS_33530 14193 12841 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_33530 14751 14305 gene locus_tag LOCUS_33540 14751 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786789.1 protein_id gnl|my_center|LOCUS_33540 16758 15397 gene locus_tag LOCUS_33550 16758 15397 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786787.1 protein_id gnl|my_center|LOCUS_33550 16888 16816 gene locus_tag LOCUS_t00460 16888 16816 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence102 910 1365 gene locus_tag LOCUS_33560 910 1365 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769971.1 protein_id gnl|my_center|LOCUS_33560 4085 1779 gene locus_tag LOCUS_33570 4085 1779 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203457.1 protein_id gnl|my_center|LOCUS_33570 4522 5058 gene locus_tag LOCUS_33580 4522 5058 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_33580 5207 7888 gene locus_tag LOCUS_33590 5207 7888 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_33590 8654 7992 gene locus_tag LOCUS_33600 gene ung 8654 7992 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_33600 9698 8661 gene locus_tag LOCUS_33610 gene asnA 9698 8661 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_33610 9918 9990 gene locus_tag LOCUS_t00470 9918 9990 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10854 10198 gene locus_tag LOCUS_33620 10854 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 12104 10851 gene locus_tag LOCUS_33630 12104 10851 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_33630 12287 12466 gene locus_tag LOCUS_33640 12287 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 12810 12454 gene locus_tag LOCUS_33650 12810 12454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 13166 12945 gene locus_tag LOCUS_33660 13166 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 13654 13265 gene locus_tag LOCUS_33670 13654 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 13809 14015 gene locus_tag LOCUS_33680 13809 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 14294 14878 gene locus_tag LOCUS_33690 14294 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793645.1 protein_id gnl|my_center|LOCUS_33690 14868 15182 gene locus_tag LOCUS_33700 14868 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 15175 15399 gene locus_tag LOCUS_33710 15175 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793902.1 protein_id gnl|my_center|LOCUS_33710 15418 15846 gene locus_tag LOCUS_33720 15418 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 15858 16298 gene locus_tag LOCUS_33730 15858 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence103 <1 669 gene locus_tag LOCUS_33740 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766276.1:Eco57I restriction-modification methylase domain-containing protein 1343 633 gene locus_tag LOCUS_33750 1343 633 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766277.1 protein_id gnl|my_center|LOCUS_33750 1534 1806 gene locus_tag LOCUS_33760 1534 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3945 1753 gene locus_tag LOCUS_33770 3945 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311265.1 protein_id gnl|my_center|LOCUS_33770 6149 3948 gene locus_tag LOCUS_33780 6149 3948 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108060.1 protein_id gnl|my_center|LOCUS_33780 8303 6156 gene locus_tag LOCUS_33790 8303 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651733.1 protein_id gnl|my_center|LOCUS_33790 9923 8361 gene locus_tag LOCUS_33800 9923 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327091.1 protein_id gnl|my_center|LOCUS_33800 11146 9947 gene locus_tag LOCUS_33810 11146 9947 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_33810 14156 11232 gene locus_tag LOCUS_33820 14156 11232 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005829323.1 protein_id gnl|my_center|LOCUS_33820 <16255 15013 gene locus_tag LOCUS_33830 <16255 15013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081342050.1:toprim domain-containing protein >Feature sequence104 <1 1267 gene locus_tag LOCUS_33840 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789791.1:adenylosuccinate synthase 1405 2709 gene locus_tag LOCUS_33850 1405 2709 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_33850 2828 3514 gene locus_tag LOCUS_33860 2828 3514 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_33860 3986 4960 gene locus_tag LOCUS_33870 3986 4960 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203282.1 protein_id gnl|my_center|LOCUS_33870 6304 5063 gene locus_tag LOCUS_33880 6304 5063 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203281.1 protein_id gnl|my_center|LOCUS_33880 6547 7911 gene locus_tag LOCUS_33890 gene hisS 6547 7911 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_33890 10704 8167 gene locus_tag LOCUS_33900 10704 8167 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_33900 12911 10728 gene locus_tag LOCUS_33910 12911 10728 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203279.1 protein_id gnl|my_center|LOCUS_33910 13214 14365 gene locus_tag LOCUS_33920 13214 14365 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_33920 14395 15414 gene locus_tag LOCUS_33930 14395 15414 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_33930 15497 15658 gene locus_tag LOCUS_33940 15497 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence105 384 1559 gene locus_tag LOCUS_33950 384 1559 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_33950 1687 2196 gene locus_tag LOCUS_33960 gene fldA 1687 2196 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793355.1 protein_id gnl|my_center|LOCUS_33960 2219 2581 gene locus_tag LOCUS_33970 2219 2581 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_33970 3092 3307 gene locus_tag LOCUS_33980 3092 3307 CDS product DUF6132 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788321.1 protein_id gnl|my_center|LOCUS_33980 3319 4353 gene locus_tag LOCUS_33990 3319 4353 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202970.1 protein_id gnl|my_center|LOCUS_33990 4375 4860 gene locus_tag LOCUS_34000 gene trxA 4375 4860 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_34000 6022 4913 gene locus_tag LOCUS_34010 6022 4913 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803796.1 protein_id gnl|my_center|LOCUS_34010 7158 6181 gene locus_tag LOCUS_34020 7158 6181 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202971.1 protein_id gnl|my_center|LOCUS_34020 9885 7576 gene locus_tag LOCUS_34030 9885 7576 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_34030 11711 10524 gene locus_tag LOCUS_34040 11711 10524 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793345.1 protein_id gnl|my_center|LOCUS_34040 13391 11862 gene locus_tag LOCUS_34050 13391 11862 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202972.1 protein_id gnl|my_center|LOCUS_34050 14068 13388 gene locus_tag LOCUS_34060 14068 13388 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202973.1 protein_id gnl|my_center|LOCUS_34060 15836 14238 gene locus_tag LOCUS_34070 15836 14238 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_34070 >Feature sequence106 1744 515 gene locus_tag LOCUS_34080 1744 515 CDS product TIGR04157 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993590.1 protein_id gnl|my_center|LOCUS_34080 2421 1741 gene locus_tag LOCUS_34090 2421 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799088.1 protein_id gnl|my_center|LOCUS_34090 3172 2405 gene locus_tag LOCUS_34100 3172 2405 CDS product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993592.1 protein_id gnl|my_center|LOCUS_34100 3774 3169 gene locus_tag LOCUS_34110 3774 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203568.1 protein_id gnl|my_center|LOCUS_34110 4265 3789 gene locus_tag LOCUS_34120 4265 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 6141 4357 gene locus_tag LOCUS_34130 6141 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203570.1 protein_id gnl|my_center|LOCUS_34130 6522 7040 gene locus_tag LOCUS_34140 6522 7040 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203572.1 protein_id gnl|my_center|LOCUS_34140 8846 7629 gene locus_tag LOCUS_34150 8846 7629 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804234.1 protein_id gnl|my_center|LOCUS_34150 10348 9074 gene locus_tag LOCUS_34160 10348 9074 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203574.1 protein_id gnl|my_center|LOCUS_34160 11706 10462 gene locus_tag LOCUS_34170 11706 10462 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203575.1 protein_id gnl|my_center|LOCUS_34170 11973 11731 gene locus_tag LOCUS_34180 11973 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34180 12902 11970 gene locus_tag LOCUS_34190 12902 11970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34190 14399 13227 gene locus_tag LOCUS_34200 14399 13227 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203577.1 protein_id gnl|my_center|LOCUS_34200 14689 14982 gene locus_tag LOCUS_34210 14689 14982 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_34210 14994 15359 gene locus_tag LOCUS_34220 14994 15359 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence107 782 279 gene locus_tag LOCUS_34230 782 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202739.1 protein_id gnl|my_center|LOCUS_34230 2242 824 gene locus_tag LOCUS_34240 2242 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794272.1 protein_id gnl|my_center|LOCUS_34240 4821 2356 gene locus_tag LOCUS_34250 4821 2356 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202738.1 protein_id gnl|my_center|LOCUS_34250 5859 6593 gene locus_tag LOCUS_34260 5859 6593 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803357.1 protein_id gnl|my_center|LOCUS_34260 6605 8281 gene locus_tag LOCUS_34270 6605 8281 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787345.1 protein_id gnl|my_center|LOCUS_34270 8713 8477 gene locus_tag LOCUS_34280 8713 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787343.1 protein_id gnl|my_center|LOCUS_34280 9879 8725 gene locus_tag LOCUS_34290 9879 8725 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_34290 13015 9902 gene locus_tag LOCUS_34300 13015 9902 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_34300 14242 13034 gene locus_tag LOCUS_34310 14242 13034 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 protein_id gnl|my_center|LOCUS_34310 15234 14749 gene locus_tag LOCUS_34320 15234 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992882.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence108 1713 124 gene locus_tag LOCUS_34330 1713 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 2444 1851 gene locus_tag LOCUS_34340 2444 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3291 3130 gene locus_tag LOCUS_34350 3291 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 5274 4210 gene locus_tag LOCUS_34360 5274 4210 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107963.1 protein_id gnl|my_center|LOCUS_34360 6304 5564 gene locus_tag LOCUS_34370 6304 5564 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203021.1 protein_id gnl|my_center|LOCUS_34370 7392 6826 gene locus_tag LOCUS_34380 7392 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 8102 7704 gene locus_tag LOCUS_34390 8102 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202681.1 protein_id gnl|my_center|LOCUS_34390 9287 8127 gene locus_tag LOCUS_34400 9287 8127 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005643867.1 protein_id gnl|my_center|LOCUS_34400 9677 9429 gene locus_tag LOCUS_34410 9677 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 9812 10045 gene locus_tag LOCUS_34420 9812 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34420 11190 11795 gene locus_tag LOCUS_34430 11190 11795 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202562.1 protein_id gnl|my_center|LOCUS_34430 11807 13936 gene locus_tag LOCUS_34440 11807 13936 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202561.1 protein_id gnl|my_center|LOCUS_34440 13933 15108 gene locus_tag LOCUS_34450 13933 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555692.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence109 513 160 gene locus_tag LOCUS_34460 513 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790982.1 protein_id gnl|my_center|LOCUS_34460 1380 778 gene locus_tag LOCUS_34470 1380 778 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_34470 1664 1377 gene locus_tag LOCUS_34480 1664 1377 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790978.1 protein_id gnl|my_center|LOCUS_34480 2736 1702 gene locus_tag LOCUS_34490 2736 1702 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_34490 5421 2743 gene locus_tag LOCUS_34500 5421 2743 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_34500 6302 5424 gene locus_tag LOCUS_34510 6302 5424 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790969.1 protein_id gnl|my_center|LOCUS_34510 6751 6314 gene locus_tag LOCUS_34520 6751 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790964.1 protein_id gnl|my_center|LOCUS_34520 7447 6890 gene locus_tag LOCUS_34530 7447 6890 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_34530 8593 7460 gene locus_tag LOCUS_34540 gene hemW 8593 7460 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_34540 9429 11585 gene locus_tag LOCUS_34550 9429 11585 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_34550 11975 13534 gene locus_tag LOCUS_34560 11975 13534 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_34560 13527 14237 gene locus_tag LOCUS_34570 13527 14237 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_34570 14490 14314 gene locus_tag LOCUS_34580 14490 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 15078 14632 gene locus_tag LOCUS_34590 15078 14632 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence110 362 1309 gene locus_tag LOCUS_34600 362 1309 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_34600 1324 2742 gene locus_tag LOCUS_34610 1324 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 2818 4044 gene locus_tag LOCUS_34620 gene wecC 2818 4044 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_34620 4041 5195 gene locus_tag LOCUS_34630 gene wecB 4041 5195 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_34630 5192 6283 gene locus_tag LOCUS_34640 5192 6283 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795857.1 protein_id gnl|my_center|LOCUS_34640 6271 6702 gene locus_tag LOCUS_34650 6271 6702 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795855.1 protein_id gnl|my_center|LOCUS_34650 6677 7102 gene locus_tag LOCUS_34660 6677 7102 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202258.1 protein_id gnl|my_center|LOCUS_34660 7099 8199 gene locus_tag LOCUS_34670 7099 8199 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795850.1 protein_id gnl|my_center|LOCUS_34670 8196 9191 gene locus_tag LOCUS_34680 8196 9191 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202259.1 protein_id gnl|my_center|LOCUS_34680 9193 10218 gene locus_tag LOCUS_34690 9193 10218 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_34690 10263 11414 gene locus_tag LOCUS_34700 10263 11414 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_34700 11422 12606 gene locus_tag LOCUS_34710 gene wecB 11422 12606 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202262.1 protein_id gnl|my_center|LOCUS_34710 12617 13825 gene locus_tag LOCUS_34720 12617 13825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_34720 13828 14436 gene locus_tag LOCUS_34730 13828 14436 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_34730 14449 15033 gene locus_tag LOCUS_34740 14449 15033 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_34740 >Feature sequence111 459 1031 gene locus_tag LOCUS_34750 459 1031 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203441.1 protein_id gnl|my_center|LOCUS_34750 1106 2131 gene locus_tag LOCUS_34760 1106 2131 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_34760 2364 5738 gene locus_tag LOCUS_34770 2364 5738 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_34770 5751 7544 gene locus_tag LOCUS_34780 5751 7544 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817445.1 protein_id gnl|my_center|LOCUS_34780 7649 10105 gene locus_tag LOCUS_34790 7649 10105 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203439.1 protein_id gnl|my_center|LOCUS_34790 10119 11042 gene locus_tag LOCUS_34800 10119 11042 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_34800 11121 12059 gene locus_tag LOCUS_34810 11121 12059 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798133.1 protein_id gnl|my_center|LOCUS_34810 12712 14232 gene locus_tag LOCUS_34820 12712 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 14282 14656 gene locus_tag LOCUS_34830 14282 14656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence112 2037 1177 gene locus_tag LOCUS_34840 2037 1177 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822185.1 protein_id gnl|my_center|LOCUS_34840 4428 2068 gene locus_tag LOCUS_34850 4428 2068 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_34850 5605 4685 gene locus_tag LOCUS_34860 5605 4685 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005682606.1 protein_id gnl|my_center|LOCUS_34860 7222 5606 gene locus_tag LOCUS_34870 7222 5606 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993680.1 protein_id gnl|my_center|LOCUS_34870 10482 7237 gene locus_tag LOCUS_34880 10482 7237 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822182.1 protein_id gnl|my_center|LOCUS_34880 11889 10750 gene locus_tag LOCUS_34890 11889 10750 CDS product cyclically-permuted mutarotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295062.1 protein_id gnl|my_center|LOCUS_34890 13224 11986 gene locus_tag LOCUS_34900 13224 11986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822181.1 protein_id gnl|my_center|LOCUS_34900 13914 13234 gene locus_tag LOCUS_34910 13914 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence113 98 628 gene locus_tag LOCUS_34920 98 628 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793922.1 protein_id gnl|my_center|LOCUS_34920 1588 875 gene locus_tag LOCUS_34930 1588 875 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_34930 1773 4241 gene locus_tag LOCUS_34940 gene lon 1773 4241 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_34940 4238 5368 gene locus_tag LOCUS_34950 gene tgt 4238 5368 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_34950 5373 6470 gene locus_tag LOCUS_34960 5373 6470 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_34960 7145 6636 gene locus_tag LOCUS_34970 7145 6636 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815892.1 protein_id gnl|my_center|LOCUS_34970 7417 8640 gene locus_tag LOCUS_34980 gene serB 7417 8640 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_34980 8720 9976 gene locus_tag LOCUS_34990 8720 9976 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_34990 10850 10047 gene locus_tag LOCUS_35000 10850 10047 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_35000 12305 10992 gene locus_tag LOCUS_35010 12305 10992 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_35010 12877 12329 gene locus_tag LOCUS_35020 gene rfbC 12877 12329 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_35020 >Feature sequence114 1421 861 gene locus_tag LOCUS_35030 1421 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 1973 1422 gene locus_tag LOCUS_35040 1973 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 2341 2048 gene locus_tag LOCUS_35050 2341 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 4042 2684 gene locus_tag LOCUS_35060 4042 2684 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767165.1 protein_id gnl|my_center|LOCUS_35060 6926 5181 gene locus_tag LOCUS_35070 6926 5181 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555800.1 protein_id gnl|my_center|LOCUS_35070 7472 7245 gene locus_tag LOCUS_35080 7472 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8132 9409 gene locus_tag LOCUS_35090 8132 9409 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201883.1 protein_id gnl|my_center|LOCUS_35090 9413 10120 gene locus_tag LOCUS_35100 9413 10120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813846.1 protein_id gnl|my_center|LOCUS_35100 10276 11238 gene locus_tag LOCUS_35110 10276 11238 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_35110 11219 12151 gene locus_tag LOCUS_35120 11219 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818289.1 protein_id gnl|my_center|LOCUS_35120 12162 12785 gene locus_tag LOCUS_35130 12162 12785 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801447.1 protein_id gnl|my_center|LOCUS_35130 >Feature sequence115 1401 250 gene locus_tag LOCUS_35140 gene nagA 1401 250 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788533.1 protein_id gnl|my_center|LOCUS_35140 1558 2235 gene locus_tag LOCUS_35150 1558 2235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_35150 2253 3551 gene locus_tag LOCUS_35160 2253 3551 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_35160 3870 4307 gene locus_tag LOCUS_35170 3870 4307 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788539.1 protein_id gnl|my_center|LOCUS_35170 4323 5162 gene locus_tag LOCUS_35180 4323 5162 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202990.1 protein_id gnl|my_center|LOCUS_35180 6398 5217 gene locus_tag LOCUS_35190 6398 5217 CDS product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 protein_id gnl|my_center|LOCUS_35190 6890 6489 gene locus_tag LOCUS_35200 6890 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798505.1 protein_id gnl|my_center|LOCUS_35200 7851 6991 gene locus_tag LOCUS_35210 7851 6991 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_35210 8083 7886 gene locus_tag LOCUS_35220 8083 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9748 8183 gene locus_tag LOCUS_35230 9748 8183 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788554.1 protein_id gnl|my_center|LOCUS_35230 11370 10036 gene locus_tag LOCUS_35240 11370 10036 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_35240 12553 11402 gene locus_tag LOCUS_35250 12553 11402 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_35250 13769 12567 gene locus_tag LOCUS_35260 13769 12567 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_35260 >Feature sequence116 648 166 gene locus_tag LOCUS_35270 648 166 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295284.1 protein_id gnl|my_center|LOCUS_35270 1295 699 gene locus_tag LOCUS_35280 1295 699 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650034.1 protein_id gnl|my_center|LOCUS_35280 1901 1449 gene locus_tag LOCUS_35290 1901 1449 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005641945.1 protein_id gnl|my_center|LOCUS_35290 2271 2062 gene locus_tag LOCUS_35300 2271 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295287.1 protein_id gnl|my_center|LOCUS_35300 2734 2913 gene locus_tag LOCUS_35310 2734 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 3060 3335 gene locus_tag LOCUS_35320 3060 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 4016 3477 gene locus_tag LOCUS_35330 4016 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35330 4336 3899 gene locus_tag LOCUS_35340 4336 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35340 5453 5121 gene locus_tag LOCUS_35350 5453 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783170.1 protein_id gnl|my_center|LOCUS_35350 5973 5737 gene locus_tag LOCUS_35360 5973 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 6692 6075 gene locus_tag LOCUS_35370 6692 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35370 6954 7136 gene locus_tag LOCUS_35380 6954 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 8463 7633 gene locus_tag LOCUS_35390 8463 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 9021 9965 gene locus_tag LOCUS_35400 9021 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786548.1 protein_id gnl|my_center|LOCUS_35400 9976 12195 gene locus_tag LOCUS_35410 9976 12195 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795055.1 protein_id gnl|my_center|LOCUS_35410 12307 13062 gene locus_tag LOCUS_35420 12307 13062 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_35420 >Feature sequence117 1610 75 gene locus_tag LOCUS_35430 1610 75 CDS product FISUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203661.1 protein_id gnl|my_center|LOCUS_35430 2238 3611 gene locus_tag LOCUS_35440 2238 3611 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802077.1 protein_id gnl|my_center|LOCUS_35440 3713 5287 gene locus_tag LOCUS_35450 3713 5287 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_35450 5444 8530 gene locus_tag LOCUS_35460 5444 8530 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783448.1 protein_id gnl|my_center|LOCUS_35460 8542 10287 gene locus_tag LOCUS_35470 8542 10287 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783447.1 protein_id gnl|my_center|LOCUS_35470 10304 10711 gene locus_tag LOCUS_35480 10304 10711 CDS product DUF4945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783445.1 protein_id gnl|my_center|LOCUS_35480 11956 10757 gene locus_tag LOCUS_35490 11956 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_35490 12714 11965 gene locus_tag LOCUS_35500 12714 11965 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814072.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence118 1565 30 gene locus_tag LOCUS_35510 1565 30 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203341.1 protein_id gnl|my_center|LOCUS_35510 2085 1585 gene locus_tag LOCUS_35520 2085 1585 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790282.1 protein_id gnl|my_center|LOCUS_35520 3610 2090 gene locus_tag LOCUS_35530 gene accC 3610 2090 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_35530 4146 6410 gene locus_tag LOCUS_35540 4146 6410 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_35540 7028 6867 gene locus_tag LOCUS_35550 7028 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 7159 8370 gene locus_tag LOCUS_35560 7159 8370 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802516.1 protein_id gnl|my_center|LOCUS_35560 9560 8394 gene locus_tag LOCUS_35570 gene pncB 9560 8394 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_35570 9790 10656 gene locus_tag LOCUS_35580 9790 10656 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797785.1 protein_id gnl|my_center|LOCUS_35580 11089 12300 gene locus_tag LOCUS_35590 11089 12300 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790263.1 protein_id gnl|my_center|LOCUS_35590 13341 12463 gene locus_tag LOCUS_35600 13341 12463 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814709.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence119 284 66 gene locus_tag LOCUS_35610 284 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811483.1 protein_id gnl|my_center|LOCUS_35610 675 304 gene locus_tag LOCUS_35620 675 304 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811481.1 protein_id gnl|my_center|LOCUS_35620 1835 1563 gene locus_tag LOCUS_35630 1835 1563 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203625.1 protein_id gnl|my_center|LOCUS_35630 2171 1974 gene locus_tag LOCUS_35640 2171 1974 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008775183.1 protein_id gnl|my_center|LOCUS_35640 2499 2149 gene locus_tag LOCUS_35650 2499 2149 CDS product reverse transcriptase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308130.1 protein_id gnl|my_center|LOCUS_35650 4404 3349 gene locus_tag LOCUS_35660 4404 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811475.1 protein_id gnl|my_center|LOCUS_35660 5714 4401 gene locus_tag LOCUS_35670 5714 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075964974.1 protein_id gnl|my_center|LOCUS_35670 8156 6552 gene locus_tag LOCUS_35680 8156 6552 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_35680 11172 8176 gene locus_tag LOCUS_35690 11172 8176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_35690 <13242 11398 gene locus_tag LOCUS_35700 <13242 11398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811467.1:beta-galactosidase >Feature sequence120 19 666 gene locus_tag LOCUS_35710 19 666 CDS product DUF4903 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787354.1 protein_id gnl|my_center|LOCUS_35710 733 3060 gene locus_tag LOCUS_35720 733 3060 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202740.1 protein_id gnl|my_center|LOCUS_35720 3057 3773 gene locus_tag LOCUS_35730 3057 3773 CDS product HmuY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768678.1 protein_id gnl|my_center|LOCUS_35730 3864 4784 gene locus_tag LOCUS_35740 3864 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_35740 4786 5685 gene locus_tag LOCUS_35750 4786 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794270.1 protein_id gnl|my_center|LOCUS_35750 6112 5792 gene locus_tag LOCUS_35760 6112 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794268.1 protein_id gnl|my_center|LOCUS_35760 6439 7050 gene locus_tag LOCUS_35770 6439 7050 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787373.1 protein_id gnl|my_center|LOCUS_35770 7200 8018 gene locus_tag LOCUS_35780 7200 8018 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202744.1 protein_id gnl|my_center|LOCUS_35780 8034 9845 gene locus_tag LOCUS_35790 8034 9845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768683.1 protein_id gnl|my_center|LOCUS_35790 9849 11579 gene locus_tag LOCUS_35800 9849 11579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202746.1 protein_id gnl|my_center|LOCUS_35800 13102 11867 gene locus_tag LOCUS_35810 13102 11867 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202748.1 protein_id gnl|my_center|LOCUS_35810 >Feature sequence121 77 4 gene locus_tag LOCUS_t00480 77 4 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 908 1753 gene locus_tag LOCUS_35820 908 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3444 1846 gene locus_tag LOCUS_35830 3444 1846 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784405.1 protein_id gnl|my_center|LOCUS_35830 3661 4398 gene locus_tag LOCUS_35840 3661 4398 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784407.1 protein_id gnl|my_center|LOCUS_35840 5491 4490 gene locus_tag LOCUS_35850 5491 4490 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202049.1 protein_id gnl|my_center|LOCUS_35850 5703 6551 gene locus_tag LOCUS_35860 5703 6551 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_35860 6654 7307 gene locus_tag LOCUS_35870 6654 7307 CDS product DUF4476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784413.1 protein_id gnl|my_center|LOCUS_35870 7415 7990 gene locus_tag LOCUS_35880 7415 7990 CDS product DUF4476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784415.1 protein_id gnl|my_center|LOCUS_35880 8000 8863 gene locus_tag LOCUS_35890 8000 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784416.1 protein_id gnl|my_center|LOCUS_35890 10905 8983 gene locus_tag LOCUS_35900 10905 8983 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202050.1 protein_id gnl|my_center|LOCUS_35900 11021 12319 gene locus_tag LOCUS_35910 11021 12319 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_35910 12398 12958 gene locus_tag LOCUS_35920 12398 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813511.1 protein_id gnl|my_center|LOCUS_35920 >Feature sequence122 <1 3130 gene locus_tag LOCUS_35930 <1 3130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202528.1:TonB-dependent receptor 3159 4775 gene locus_tag LOCUS_35940 3159 4775 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202529.1 protein_id gnl|my_center|LOCUS_35940 6131 4881 gene locus_tag LOCUS_35950 6131 4881 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_35950 8144 6822 gene locus_tag LOCUS_35960 8144 6822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_35960 8676 11948 gene locus_tag LOCUS_35970 8676 11948 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202536.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence123 92 19 gene locus_tag LOCUS_t00490 92 19 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1059 187 gene locus_tag LOCUS_35980 1059 187 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_35980 1916 1389 gene locus_tag LOCUS_35990 1916 1389 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_35990 2104 2832 gene locus_tag LOCUS_36000 2104 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796354.1 protein_id gnl|my_center|LOCUS_36000 2852 3526 gene locus_tag LOCUS_36010 gene rsmI 2852 3526 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_36010 3562 4419 gene locus_tag LOCUS_36020 3562 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_36020 4509 5201 gene locus_tag LOCUS_36030 4509 5201 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_36030 5258 5902 gene locus_tag LOCUS_36040 5258 5902 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778522.1 protein_id gnl|my_center|LOCUS_36040 7601 6006 gene locus_tag LOCUS_36050 7601 6006 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784672.1 protein_id gnl|my_center|LOCUS_36050 10558 7613 gene locus_tag LOCUS_36060 10558 7613 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_36060 12372 11191 gene locus_tag LOCUS_36070 12372 11191 CDS product Tsr0667 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784676.1 protein_id gnl|my_center|LOCUS_36070 >Feature sequence124 649 1164 gene locus_tag LOCUS_36080 649 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292012.1 protein_id gnl|my_center|LOCUS_36080 2744 1314 gene locus_tag LOCUS_36090 2744 1314 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_36090 4608 2989 gene locus_tag LOCUS_36100 4608 2989 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202534.1 protein_id gnl|my_center|LOCUS_36100 7829 4629 gene locus_tag LOCUS_36110 7829 4629 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202533.1 protein_id gnl|my_center|LOCUS_36110 8795 8349 gene locus_tag LOCUS_36120 8795 8349 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_36120 10048 8810 gene locus_tag LOCUS_36130 10048 8810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_36130 11248 10064 gene locus_tag LOCUS_36140 11248 10064 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_36140 12189 11272 gene locus_tag LOCUS_36150 12189 11272 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence125 <1 924 gene locus_tag LOCUS_36160 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791757.1:pseudouridine synthase 1031 2434 gene locus_tag LOCUS_36170 gene asnS 1031 2434 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_36170 2592 3080 gene locus_tag LOCUS_36180 2592 3080 CDS product DUF4488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791753.1 protein_id gnl|my_center|LOCUS_36180 3415 3876 gene locus_tag LOCUS_36190 gene rplM 3415 3876 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_36190 3883 4269 gene locus_tag LOCUS_36200 gene rpsI 3883 4269 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_36200 4390 5226 gene locus_tag LOCUS_36210 gene rpsB 4390 5226 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_36210 5350 6342 gene locus_tag LOCUS_36220 gene tsf 5350 6342 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_36220 6883 6533 gene locus_tag LOCUS_36230 6883 6533 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_36230 7066 7722 gene locus_tag LOCUS_36240 7066 7722 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_36240 7726 8340 gene locus_tag LOCUS_36250 7726 8340 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_36250 8379 8858 gene locus_tag LOCUS_36260 gene ispF 8379 8858 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_36260 9588 8998 gene locus_tag LOCUS_36270 9588 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791740.1 protein_id gnl|my_center|LOCUS_36270 9811 10656 gene locus_tag LOCUS_36280 9811 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203549.1 protein_id gnl|my_center|LOCUS_36280 11589 10729 gene locus_tag LOCUS_36290 11589 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791738.1 protein_id gnl|my_center|LOCUS_36290 >Feature sequence126 320 1519 gene locus_tag LOCUS_36300 320 1519 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292991.1 protein_id gnl|my_center|LOCUS_36300 1550 2689 gene locus_tag LOCUS_36310 1550 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203271.1 protein_id gnl|my_center|LOCUS_36310 2703 3836 gene locus_tag LOCUS_36320 2703 3836 CDS product DUF5031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789743.1 protein_id gnl|my_center|LOCUS_36320 3827 4936 gene locus_tag LOCUS_36330 3827 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555811.1 protein_id gnl|my_center|LOCUS_36330 5020 5838 gene locus_tag LOCUS_36340 5020 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171031189.1 protein_id gnl|my_center|LOCUS_36340 5864 7900 gene locus_tag LOCUS_36350 5864 7900 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769548.1 protein_id gnl|my_center|LOCUS_36350 7904 8446 gene locus_tag LOCUS_36360 7904 8446 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799003.1 protein_id gnl|my_center|LOCUS_36360 9514 8633 gene locus_tag LOCUS_36370 9514 8633 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_36370 10421 9843 gene locus_tag LOCUS_36380 10421 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799006.1 protein_id gnl|my_center|LOCUS_36380 10906 10433 gene locus_tag LOCUS_36390 10906 10433 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence127 75 1 gene locus_tag LOCUS_t00500 75 1 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 426 1016 gene locus_tag LOCUS_36400 gene hisH 426 1016 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_36400 1056 1775 gene locus_tag LOCUS_36410 gene hisA 1056 1775 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_36410 1877 2629 gene locus_tag LOCUS_36420 gene hisF 1877 2629 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_36420 2818 3429 gene locus_tag LOCUS_36430 gene hisIE 2818 3429 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_36430 3414 4112 gene locus_tag LOCUS_36440 3414 4112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_36440 4144 5463 gene locus_tag LOCUS_36450 4144 5463 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788816.1 protein_id gnl|my_center|LOCUS_36450 5620 6783 gene locus_tag LOCUS_36460 gene lysA 5620 6783 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_36460 6909 7400 gene locus_tag LOCUS_36470 6909 7400 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788812.1 protein_id gnl|my_center|LOCUS_36470 7574 8545 gene locus_tag LOCUS_36480 7574 8545 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_36480 9927 8563 gene locus_tag LOCUS_36490 gene dnaB 9927 8563 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229347.1 protein_id gnl|my_center|LOCUS_36490 10571 9951 gene locus_tag LOCUS_36500 10571 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107833.1 protein_id gnl|my_center|LOCUS_36500 >Feature sequence128 2702 2502 gene locus_tag LOCUS_36510 2702 2502 CDS product DUF2007-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784389.1 protein_id gnl|my_center|LOCUS_36510 4506 2851 gene locus_tag LOCUS_36520 4506 2851 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_36520 5078 4524 gene locus_tag LOCUS_36530 5078 4524 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_36530 5911 5138 gene locus_tag LOCUS_36540 gene proC 5911 5138 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796496.1 protein_id gnl|my_center|LOCUS_36540 7148 6024 gene locus_tag LOCUS_36550 7148 6024 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_36550 8126 7158 gene locus_tag LOCUS_36560 gene argC 8126 7158 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_36560 9328 8123 gene locus_tag LOCUS_36570 9328 8123 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_36570 9920 9342 gene locus_tag LOCUS_36580 9920 9342 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_36580 10427 9954 gene locus_tag LOCUS_36590 gene argR 10427 9954 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence129 <1 504 gene locus_tag LOCUS_36600 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202968.1:hemerythrin domain-containing protein 494 1102 gene locus_tag LOCUS_36610 494 1102 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_36610 2330 1692 gene locus_tag LOCUS_36620 2330 1692 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202967.1 protein_id gnl|my_center|LOCUS_36620 3239 2346 gene locus_tag LOCUS_36630 3239 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202966.1 protein_id gnl|my_center|LOCUS_36630 4417 3257 gene locus_tag LOCUS_36640 4417 3257 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793362.1 protein_id gnl|my_center|LOCUS_36640 4783 4418 gene locus_tag LOCUS_36650 4783 4418 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788296.1 protein_id gnl|my_center|LOCUS_36650 7412 4986 gene locus_tag LOCUS_36660 7412 4986 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202965.1 protein_id gnl|my_center|LOCUS_36660 8674 7628 gene locus_tag LOCUS_36670 8674 7628 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_36670 9713 8922 gene locus_tag LOCUS_36680 gene trpA 9713 8922 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_36680 10360 9773 gene locus_tag LOCUS_36690 10360 9773 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence130 1663 2046 gene locus_tag LOCUS_36700 1663 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791766.1 protein_id gnl|my_center|LOCUS_36700 4464 2245 gene locus_tag LOCUS_36710 4464 2245 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203553.1 protein_id gnl|my_center|LOCUS_36710 4580 5359 gene locus_tag LOCUS_36720 gene yaaA 4580 5359 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032557521.1 protein_id gnl|my_center|LOCUS_36720 5366 5917 gene locus_tag LOCUS_36730 5366 5917 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791762.1 protein_id gnl|my_center|LOCUS_36730 6107 6182 gene locus_tag LOCUS_t00510 6107 6182 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6211 6286 gene locus_tag LOCUS_t00520 6211 6286 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6337 6412 gene locus_tag LOCUS_t00530 6337 6412 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6627 8471 gene locus_tag LOCUS_36740 6627 8471 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203551.1 protein_id gnl|my_center|LOCUS_36740 8693 10039 gene locus_tag LOCUS_36750 gene purB 8693 10039 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_36750 >Feature sequence131 143 667 gene locus_tag LOCUS_36760 143 667 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767808.1 protein_id gnl|my_center|LOCUS_36760 1088 3007 gene locus_tag LOCUS_36770 gene dnaK 1088 3007 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_36770 3168 3785 gene locus_tag LOCUS_36780 3168 3785 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202319.1 protein_id gnl|my_center|LOCUS_36780 3782 5044 gene locus_tag LOCUS_36790 3782 5044 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818825.1 protein_id gnl|my_center|LOCUS_36790 5359 5712 gene locus_tag LOCUS_36800 5359 5712 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313943.1 protein_id gnl|my_center|LOCUS_36800 5709 6308 gene locus_tag LOCUS_36810 5709 6308 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313940.1 protein_id gnl|my_center|LOCUS_36810 6259 8061 gene locus_tag LOCUS_36820 6259 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 8157 8531 gene locus_tag LOCUS_36830 8157 8531 CDS product MobC family plasmid mobilization relaxosome protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313937.1 protein_id gnl|my_center|LOCUS_36830 8515 9414 gene locus_tag LOCUS_36840 8515 9414 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313935.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence132 261 842 gene locus_tag LOCUS_36850 261 842 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_36850 1776 1015 gene locus_tag LOCUS_36860 1776 1015 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_36860 4127 1836 gene locus_tag LOCUS_36870 4127 1836 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_36870 4595 4332 gene locus_tag LOCUS_36880 4595 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786780.1 protein_id gnl|my_center|LOCUS_36880 5181 4708 gene locus_tag LOCUS_36890 5181 4708 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_36890 6936 5188 gene locus_tag LOCUS_36900 6936 5188 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_36900 7436 7044 gene locus_tag LOCUS_36910 7436 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36910 8890 7328 gene locus_tag LOCUS_36920 8890 7328 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817106.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36920 >Feature sequence133 <1 3164 gene locus_tag LOCUS_36930 <1 3164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202056.1:TonB-dependent receptor 3151 4896 gene locus_tag LOCUS_36940 3151 4896 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796471.1 protein_id gnl|my_center|LOCUS_36940 5130 7241 gene locus_tag LOCUS_36950 5130 7241 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202054.1 protein_id gnl|my_center|LOCUS_36950 7355 9523 gene locus_tag LOCUS_36960 7355 9523 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence134 465 100 gene locus_tag LOCUS_36970 465 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793920.1 protein_id gnl|my_center|LOCUS_36970 1295 909 gene locus_tag LOCUS_36980 1295 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806115.1 protein_id gnl|my_center|LOCUS_36980 1736 1302 gene locus_tag LOCUS_36990 1736 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806117.1 protein_id gnl|my_center|LOCUS_36990 2386 1820 gene locus_tag LOCUS_37000 2386 1820 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806119.1 protein_id gnl|my_center|LOCUS_37000 2949 2449 gene locus_tag LOCUS_37010 2949 2449 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202816.1 protein_id gnl|my_center|LOCUS_37010 3501 3154 gene locus_tag LOCUS_37020 3501 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 3850 4458 gene locus_tag LOCUS_37030 3850 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4659 4949 gene locus_tag LOCUS_37040 4659 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793904.1 protein_id gnl|my_center|LOCUS_37040 4921 5166 gene locus_tag LOCUS_37050 4921 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793902.1 protein_id gnl|my_center|LOCUS_37050 5190 5648 gene locus_tag LOCUS_37060 5190 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202818.1 protein_id gnl|my_center|LOCUS_37060 5645 6010 gene locus_tag LOCUS_37070 5645 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806128.1 protein_id gnl|my_center|LOCUS_37070 6033 6242 gene locus_tag LOCUS_37080 6033 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 6719 7165 gene locus_tag LOCUS_37090 6719 7165 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806131.1 protein_id gnl|my_center|LOCUS_37090 7179 8174 gene locus_tag LOCUS_37100 7179 8174 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202820.1 protein_id gnl|my_center|LOCUS_37100 8177 8350 gene locus_tag LOCUS_37110 8177 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 8528 8334 gene locus_tag LOCUS_37120 8528 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806135.1 protein_id gnl|my_center|LOCUS_37120 8680 8916 gene locus_tag LOCUS_37130 8680 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence135 927 1715 gene locus_tag LOCUS_37140 927 1715 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_37140 1751 2389 gene locus_tag LOCUS_37150 1751 2389 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791337.1 protein_id gnl|my_center|LOCUS_37150 2418 2645 gene locus_tag LOCUS_37160 2418 2645 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_37160 3201 2773 gene locus_tag LOCUS_37170 3201 2773 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_37170 4200 3211 gene locus_tag LOCUS_37180 4200 3211 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_37180 5186 4272 gene locus_tag LOCUS_37190 5186 4272 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_37190 6045 5251 gene locus_tag LOCUS_37200 6045 5251 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_37200 6228 7169 gene locus_tag LOCUS_37210 6228 7169 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791349.1 protein_id gnl|my_center|LOCUS_37210 7192 8307 gene locus_tag LOCUS_37220 gene buk 7192 8307 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814251.1 protein_id gnl|my_center|LOCUS_37220 <8987 8418 gene locus_tag LOCUS_37230 <8987 8418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791353.1:DNA-binding domain-containing protein >Feature sequence136 238 1110 gene locus_tag LOCUS_37240 238 1110 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202137.1 protein_id gnl|my_center|LOCUS_37240 2137 1346 gene locus_tag LOCUS_37250 gene istB 2137 1346 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268417.1 protein_id gnl|my_center|LOCUS_37250 3623 2106 gene locus_tag LOCUS_37260 gene istA 3623 2106 CDS product IS21-like element ISBf2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203618.1 protein_id gnl|my_center|LOCUS_37260 4793 4548 gene locus_tag LOCUS_37270 4793 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 5013 4783 gene locus_tag LOCUS_37280 5013 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 5128 5883 gene locus_tag LOCUS_37290 5128 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 7619 6087 gene locus_tag LOCUS_37300 7619 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence137 1172 186 gene locus_tag LOCUS_37310 1172 186 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_37310 1873 1298 gene locus_tag LOCUS_37320 1873 1298 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_37320 2753 6073 gene locus_tag LOCUS_37330 2753 6073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_37330 6087 7853 gene locus_tag LOCUS_37340 6087 7853 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence138 51 584 gene locus_tag LOCUS_37350 51 584 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_37350 976 2382 gene locus_tag LOCUS_37360 gene uxaC 976 2382 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793937.1 protein_id gnl|my_center|LOCUS_37360 2532 3920 gene locus_tag LOCUS_37370 2532 3920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202813.1 protein_id gnl|my_center|LOCUS_37370 3999 4802 gene locus_tag LOCUS_37380 3999 4802 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_37380 4891 4964 gene locus_tag LOCUS_t00540 4891 4964 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5219 6430 gene locus_tag LOCUS_37390 5219 6430 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_37390 7730 6588 gene locus_tag LOCUS_37400 7730 6588 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202812.1 protein_id gnl|my_center|LOCUS_37400 >Feature sequence139 1969 125 gene locus_tag LOCUS_37410 1969 125 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_37410 2700 1984 gene locus_tag LOCUS_37420 2700 1984 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_37420 3728 2703 gene locus_tag LOCUS_37430 3728 2703 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_37430 4656 3742 gene locus_tag LOCUS_37440 4656 3742 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_37440 5850 4777 gene locus_tag LOCUS_37450 5850 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_37450 6728 5859 gene locus_tag LOCUS_37460 6728 5859 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_37460 <7462 6785 gene locus_tag LOCUS_37470 <7462 6785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787927.1:AAA family ATPase >Feature sequence140 528 166 gene locus_tag LOCUS_37480 528 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794661.1 protein_id gnl|my_center|LOCUS_37480 1559 564 gene locus_tag LOCUS_37490 1559 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202659.1 protein_id gnl|my_center|LOCUS_37490 1976 1572 gene locus_tag LOCUS_37500 gene tssD 1976 1572 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202660.1 protein_id gnl|my_center|LOCUS_37500 2410 1982 gene locus_tag LOCUS_37510 gene tssD 2410 1982 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202661.1 protein_id gnl|my_center|LOCUS_37510 4909 2426 gene locus_tag LOCUS_37520 4909 2426 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202662.1 protein_id gnl|my_center|LOCUS_37520 6301 4922 gene locus_tag LOCUS_37530 6301 4922 CDS product DUF5458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787102.1 protein_id gnl|my_center|LOCUS_37530 6767 6318 gene locus_tag LOCUS_37540 6767 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202663.1 protein_id gnl|my_center|LOCUS_37540 7245 6856 gene locus_tag LOCUS_37550 gene tssD 7245 6856 CDS product type VI secretion system tube protein TssD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787106.1 protein_id gnl|my_center|LOCUS_37550 >Feature sequence141 711 436 gene locus_tag LOCUS_37560 711 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37560 1497 2060 gene locus_tag LOCUS_37570 1497 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 2398 3471 gene locus_tag LOCUS_37580 2398 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 3464 4687 gene locus_tag LOCUS_37590 3464 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4665 6860 gene locus_tag LOCUS_37600 4665 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 >Feature sequence142 116 355 gene locus_tag LOCUS_37610 116 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 1284 496 gene locus_tag LOCUS_37620 1284 496 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787146.1 protein_id gnl|my_center|LOCUS_37620 1833 1375 gene locus_tag LOCUS_37630 1833 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202669.1 protein_id gnl|my_center|LOCUS_37630 2482 2051 gene locus_tag LOCUS_37640 2482 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787140.1 protein_id gnl|my_center|LOCUS_37640 2993 2526 gene locus_tag LOCUS_37650 2993 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 4328 3534 gene locus_tag LOCUS_37660 4328 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 4821 4441 gene locus_tag LOCUS_37670 4821 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 6017 5133 gene locus_tag LOCUS_37680 6017 5133 CDS product phage integrase N-terminal SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202667.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 6796 6176 gene locus_tag LOCUS_37690 6796 6176 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787121.1 protein_id gnl|my_center|LOCUS_37690 >Feature sequence143 133 393 gene locus_tag LOCUS_37700 133 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1060 1572 gene locus_tag LOCUS_37710 1060 1572 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_37710 1810 3588 gene locus_tag LOCUS_37720 gene sppA 1810 3588 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_37720 3597 4727 gene locus_tag LOCUS_37730 gene lpxK 3597 4727 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_37730 4666 5475 gene locus_tag LOCUS_37740 4666 5475 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_37740 5503 6537 gene locus_tag LOCUS_37750 gene thiL 5503 6537 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_37750 6656 6729 gene locus_tag LOCUS_t00550 6656 6729 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 <1 988 gene locus_tag LOCUS_37760 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:efflux RND transporter periplasmic adaptor subunit 1335 2123 gene locus_tag LOCUS_37770 1335 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790342.1 protein_id gnl|my_center|LOCUS_37770 2948 2124 gene locus_tag LOCUS_37780 2948 2124 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790340.1 protein_id gnl|my_center|LOCUS_37780 3867 3031 gene locus_tag LOCUS_37790 3867 3031 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797807.1 protein_id gnl|my_center|LOCUS_37790 4092 4778 gene locus_tag LOCUS_37800 4092 4778 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790337.1 protein_id gnl|my_center|LOCUS_37800 <6471 5068 gene locus_tag LOCUS_37810 <6471 5068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203351.1:ABC transporter permease >Feature sequence145 37 501 gene locus_tag LOCUS_37820 37 501 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789808.1 protein_id gnl|my_center|LOCUS_37820 594 2645 gene locus_tag LOCUS_37830 594 2645 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_37830 2649 3311 gene locus_tag LOCUS_37840 2649 3311 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_37840 4968 3409 gene locus_tag LOCUS_37850 4968 3409 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_37850 5172 5660 gene locus_tag LOCUS_37860 5172 5660 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence146 570 3785 gene locus_tag LOCUS_37870 570 3785 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203442.1 protein_id gnl|my_center|LOCUS_37870 3808 5649 gene locus_tag LOCUS_37880 3808 5649 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790751.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence147 301 1203 gene locus_tag LOCUS_37890 301 1203 CDS product CepA family extended-spectrum class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202336.1 protein_id gnl|my_center|LOCUS_37890 2388 1387 gene locus_tag LOCUS_37900 2388 1387 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_37900 2990 2445 gene locus_tag LOCUS_37910 2990 2445 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_37910 3125 5662 gene locus_tag LOCUS_37920 3125 5662 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence148 205 3423 gene locus_tag LOCUS_37930 205 3423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_37930 3430 5022 gene locus_tag LOCUS_37940 gene nanU 3430 5022 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_37940 <5640 5137 gene locus_tag LOCUS_37950 <5640 5137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795013.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence149 2004 244 gene locus_tag LOCUS_37960 2004 244 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785207.1 protein_id gnl|my_center|LOCUS_37960 5443 2033 gene locus_tag LOCUS_37970 5443 2033 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785209.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence150 933 583 gene locus_tag LOCUS_37980 933 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813671.1 protein_id gnl|my_center|LOCUS_37980 3356 1731 gene locus_tag LOCUS_37990 gene ade 3356 1731 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_37990 3670 3395 gene locus_tag LOCUS_38000 3670 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 4320 3901 gene locus_tag LOCUS_38010 4320 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence151 1994 729 gene locus_tag LOCUS_38020 1994 729 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_38020 2302 1997 gene locus_tag LOCUS_38030 2302 1997 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_38030 3058 2939 gene locus_tag LOCUS_38040 3058 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 3305 4189 gene locus_tag LOCUS_38050 3305 4189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 protein_id gnl|my_center|LOCUS_38050 <5192 4399 gene locus_tag LOCUS_38060 <5192 4399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202282.1:glycoside hydrolase family 31 protein >Feature sequence152 3 626 gene locus_tag LOCUS_38070 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 630 1652 gene locus_tag LOCUS_38080 630 1652 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202925.1 protein_id gnl|my_center|LOCUS_38080 1640 2770 gene locus_tag LOCUS_38090 gene wecB 1640 2770 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817161.1 protein_id gnl|my_center|LOCUS_38090 2790 3653 gene locus_tag LOCUS_38100 2790 3653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_38100 3650 4861 gene locus_tag LOCUS_38110 3650 4861 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_38110 >Feature sequence153 <1 3190 gene locus_tag LOCUS_38120 <1 3190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202526.1:TonB-dependent receptor 3212 4780 gene locus_tag LOCUS_38130 3212 4780 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence154 1510 530 gene locus_tag LOCUS_38140 1510 530 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_38140 2767 1514 gene locus_tag LOCUS_38150 2767 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 3699 2764 gene locus_tag LOCUS_38160 3699 2764 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_38160 4545 3706 gene locus_tag LOCUS_38170 4545 3706 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202928.1 protein_id gnl|my_center|LOCUS_38170 >Feature sequence155 2297 555 gene locus_tag LOCUS_38180 2297 555 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804093.1 protein_id gnl|my_center|LOCUS_38180 3274 2330 gene locus_tag LOCUS_38190 3274 2330 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184138029.1 protein_id gnl|my_center|LOCUS_38190 4146 3685 gene locus_tag LOCUS_38200 4146 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38200 >Feature sequence156 1082 135 gene locus_tag LOCUS_38210 1082 135 CDS product Tsr25 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788799.1 protein_id gnl|my_center|LOCUS_38210 1290 1664 gene locus_tag LOCUS_38220 1290 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788800.1 protein_id gnl|my_center|LOCUS_38220 3977 2424 gene locus_tag LOCUS_38230 3977 2424 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_38230 4148 4459 gene locus_tag LOCUS_38240 4148 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence157 1853 831 gene locus_tag LOCUS_38250 gene trpD 1853 831 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_38250 2478 1873 gene locus_tag LOCUS_38260 2478 1873 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792933.1 protein_id gnl|my_center|LOCUS_38260 4028 2622 gene locus_tag LOCUS_38270 4028 2622 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence158 649 374 gene locus_tag LOCUS_38280 649 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202666.1 protein_id gnl|my_center|LOCUS_38280 1005 1190 gene locus_tag LOCUS_38290 1005 1190 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_38290 1219 4293 gene locus_tag LOCUS_38300 1219 4293 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202665.1 protein_id gnl|my_center|LOCUS_38300 >Feature sequence159 879 55 gene locus_tag LOCUS_38310 879 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 1761 1342 gene locus_tag LOCUS_38320 1761 1342 CDS product PcfK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793657.1 protein_id gnl|my_center|LOCUS_38320 2585 1830 gene locus_tag LOCUS_38330 2585 1830 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_38330 2959 2585 gene locus_tag LOCUS_38340 2959 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071146135.1 protein_id gnl|my_center|LOCUS_38340 3607 3167 gene locus_tag LOCUS_38350 3607 3167 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_38350 3932 3582 gene locus_tag LOCUS_38360 3932 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793652.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence160 264 800 gene locus_tag LOCUS_38370 264 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 1976 861 gene locus_tag LOCUS_38380 1976 861 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797441.1 protein_id gnl|my_center|LOCUS_38380 3438 2194 gene locus_tag LOCUS_38390 3438 2194 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199805949.1 protein_id gnl|my_center|LOCUS_38390 3587 3435 gene locus_tag LOCUS_38400 3587 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 >Feature sequence161 212 814 gene locus_tag LOCUS_38410 212 814 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788568.1 protein_id gnl|my_center|LOCUS_38410 845 1384 gene locus_tag LOCUS_38420 845 1384 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_38420 2948 1629 gene locus_tag LOCUS_38430 2948 1629 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_38430 >Feature sequence162 1198 83 gene locus_tag LOCUS_38440 1198 83 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203491.1 protein_id gnl|my_center|LOCUS_38440 1511 1188 gene locus_tag LOCUS_38450 1511 1188 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_38450 2945 1815 gene locus_tag LOCUS_38460 2945 1815 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence163 1252 764 gene locus_tag LOCUS_38470 1252 764 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202140.1 protein_id gnl|my_center|LOCUS_38470 1808 1272 gene locus_tag LOCUS_38480 gene upgY 1808 1272 CDS product capsular polysaccharide transcription antiterminator UpgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784914.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence164 410 934 gene locus_tag LOCUS_38490 gene upbY 410 934 CDS product capsular polysaccharide transcription antiterminator UpbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786813.1 protein_id gnl|my_center|LOCUS_38490 938 1417 gene locus_tag LOCUS_38500 938 1417 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817126.1 protein_id gnl|my_center|LOCUS_38500 >Feature sequence165 211 690 gene locus_tag LOCUS_38510 211 690 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107835.1 protein_id gnl|my_center|LOCUS_38510 918 1361 gene locus_tag LOCUS_38520 918 1361 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788614.1 protein_id gnl|my_center|LOCUS_38520 1875 1564 gene locus_tag LOCUS_38530 1875 1564 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_38530 2326 2253 gene locus_tag LOCUS_t00560 2326 2253 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2415 2333 gene locus_tag LOCUS_t00570 2415 2333 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2553 2480 gene locus_tag LOCUS_t00580 2553 2480 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2659 2575 gene locus_tag LOCUS_t00590 2659 2575 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 946 203 gene locus_tag LOCUS_38540 946 203 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992806.1 protein_id gnl|my_center|LOCUS_38540 1501 2562 gene locus_tag LOCUS_38550 1501 2562 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787114.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence167 1131 1769 gene locus_tag LOCUS_38560 gene upfY 1131 1769 CDS product capsular polysaccharide transcription antiterminator UpfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202460.1 protein_id gnl|my_center|LOCUS_38560 1781 2263 gene locus_tag LOCUS_38570 1781 2263 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202461.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence168 7 510 gene locus_tag LOCUS_38580 7 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 2251 692 gene locus_tag LOCUS_38590 2251 692 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_38590 >Feature sequence169 2389 1175 gene locus_tag LOCUS_38600 2389 1175 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797433.1 protein_id gnl|my_center|LOCUS_38600 >Feature sequence170 210 371 gene locus_tag LOCUS_38610 210 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 1956 379 gene locus_tag LOCUS_38620 1956 379 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence171 1271 1068 gene locus_tag LOCUS_38630 1271 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 <2330 1537 gene locus_tag LOCUS_38640 <2330 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107814.1:ATP-binding protein >Feature sequence172 >Feature sequence173 485 1741 gene locus_tag LOCUS_38650 485 1741 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792258.1 protein_id gnl|my_center|LOCUS_38650 1818 2051 gene locus_tag LOCUS_38660 1818 2051 CDS product NVEALA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797070.1 protein_id gnl|my_center|LOCUS_38660 >Feature sequence174 325 615 gene locus_tag LOCUS_38670 325 615 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787931.1 protein_id gnl|my_center|LOCUS_38670 608 2059 gene locus_tag LOCUS_38680 608 2059 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202863.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence175 167 739 gene locus_tag LOCUS_38690 167 739 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802121.1 protein_id gnl|my_center|LOCUS_38690 959 801 gene locus_tag LOCUS_38700 959 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 1899 1066 gene locus_tag LOCUS_38710 1899 1066 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203523.1 protein_id gnl|my_center|LOCUS_38710 >Feature sequence176 >Feature sequence177 724 137 gene locus_tag LOCUS_38720 724 137 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795339.1 protein_id gnl|my_center|LOCUS_38720 1979 756 gene locus_tag LOCUS_38730 1979 756 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_38730 >Feature sequence178 <1946 777 gene locus_tag LOCUS_38740 <1946 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680416.1:fimbrillin family protein >Feature sequence179 1240 359 gene locus_tag LOCUS_38750 1240 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 >Feature sequence180 37 945 gene locus_tag LOCUS_38760 37 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 >Feature sequence181 1619 342 gene locus_tag LOCUS_38770 1619 342 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_38770 >Feature sequence182 1351 113 gene locus_tag LOCUS_38780 1351 113 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203566.1 protein_id gnl|my_center|LOCUS_38780 >Feature sequence183 <1 656 gene locus_tag LOCUS_38790 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128955176.1:IS21 family transposase 668 1423 gene locus_tag LOCUS_38800 gene istB 668 1423 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_38800 >Feature sequence184 >Feature sequence185 529 47 gene locus_tag LOCUS_38810 529 47 CDS product UpxZ family transcription anti-terminator antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203521.1 protein_id gnl|my_center|LOCUS_38810 1166 588 gene locus_tag LOCUS_38820 gene updY 1166 588 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_38820 >Feature sequence186 >Feature sequence187 >Feature sequence188 <1297 240 gene locus_tag LOCUS_38830 <1297 240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786556.1:DUF3869 domain-containing protein >Feature sequence189 <1 725 gene locus_tag LOCUS_38840 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203730.1:fimbrillin family protein 884 1018 gene locus_tag LOCUS_38850 884 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 >Feature sequence190 >Feature sequence191 215 18 gene locus_tag LOCUS_38860 215 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38860 588 154 gene locus_tag LOCUS_38870 588 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38870 >Feature sequence192 789 103 gene locus_tag LOCUS_38880 789 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880