>Feature sequence001 2817 625 gene locus_tag LOCUS_00010 2817 625 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_00010 4222 2909 gene locus_tag LOCUS_00020 4222 2909 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_00020 5108 4251 gene locus_tag LOCUS_00030 gene dapF 5108 4251 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_00030 7310 5982 gene locus_tag LOCUS_00040 7310 5982 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_00040 8938 7598 gene locus_tag LOCUS_00050 8938 7598 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_00050 9699 8935 gene locus_tag LOCUS_00060 9699 8935 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_00060 10104 9700 gene locus_tag LOCUS_00070 10104 9700 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_00070 10565 10110 gene locus_tag LOCUS_00080 10565 10110 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_00080 12885 10762 gene locus_tag LOCUS_00090 12885 10762 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_00090 13513 12932 gene locus_tag LOCUS_00100 13513 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14554 13565 gene locus_tag LOCUS_00110 14554 13565 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 protein_id gnl|my_center|LOCUS_00110 15364 14804 gene locus_tag LOCUS_00120 15364 14804 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_00120 15895 15566 gene locus_tag LOCUS_00130 15895 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16659 15898 gene locus_tag LOCUS_00140 16659 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_00140 17290 16739 gene locus_tag LOCUS_00150 17290 16739 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_00150 18620 17277 gene locus_tag LOCUS_00160 18620 17277 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_00160 18900 20735 gene locus_tag LOCUS_00170 18900 20735 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_00170 20789 22294 gene locus_tag LOCUS_00180 20789 22294 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766268.1 protein_id gnl|my_center|LOCUS_00180 24669 22441 gene locus_tag LOCUS_00190 gene pflB 24669 22441 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766750.1 protein_id gnl|my_center|LOCUS_00190 26658 25453 gene locus_tag LOCUS_00200 26658 25453 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_00200 27829 26672 gene locus_tag LOCUS_00210 27829 26672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_00210 28878 27892 gene locus_tag LOCUS_00220 28878 27892 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_00220 30434 28947 gene locus_tag LOCUS_00230 30434 28947 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_00230 30619 31329 gene locus_tag LOCUS_00240 gene pyrH 30619 31329 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_00240 31432 35880 gene locus_tag LOCUS_00250 31432 35880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 36156 36890 gene locus_tag LOCUS_00260 gene pflA 36156 36890 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303181.1 protein_id gnl|my_center|LOCUS_00260 36928 38229 gene locus_tag LOCUS_00270 36928 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 40172 39321 gene locus_tag LOCUS_00280 40172 39321 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_00280 41673 40477 gene locus_tag LOCUS_00290 41673 40477 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_00290 42431 41715 gene locus_tag LOCUS_00300 42431 41715 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_00300 43742 42528 gene locus_tag LOCUS_00310 43742 42528 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_00310 46036 43802 gene locus_tag LOCUS_00320 46036 43802 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_00320 46359 46433 gene locus_tag LOCUS_t00010 46359 46433 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47111 49207 gene locus_tag LOCUS_00330 47111 49207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 51586 50105 gene locus_tag LOCUS_00340 gene gcvPB 51586 50105 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_00340 52980 51619 gene locus_tag LOCUS_00350 gene gcvPA 52980 51619 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_00350 53446 53066 gene locus_tag LOCUS_00360 gene gcvH 53446 53066 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418363.1 protein_id gnl|my_center|LOCUS_00360 54568 53480 gene locus_tag LOCUS_00370 gene gcvT 54568 53480 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_00370 55613 54627 gene locus_tag LOCUS_00380 55613 54627 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288102.1 protein_id gnl|my_center|LOCUS_00380 55872 55957 gene locus_tag LOCUS_t00020 55872 55957 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56070 57086 gene locus_tag LOCUS_00390 56070 57086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 57102 58274 gene locus_tag LOCUS_00400 57102 58274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 60179 58542 gene locus_tag LOCUS_00410 gene groL 60179 58542 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_00410 60511 60239 gene locus_tag LOCUS_00420 60511 60239 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789740.1 protein_id gnl|my_center|LOCUS_00420 62930 60660 gene locus_tag LOCUS_00430 62930 60660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 63966 63034 gene locus_tag LOCUS_00440 63966 63034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 65681 64011 gene locus_tag LOCUS_00450 65681 64011 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_00450 66517 65663 gene locus_tag LOCUS_00460 gene rfbD 66517 65663 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_00460 67102 66554 gene locus_tag LOCUS_00470 67102 66554 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_00470 67942 67265 gene locus_tag LOCUS_00480 67942 67265 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_00480 68819 71683 gene locus_tag LOCUS_00490 68819 71683 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_00490 72680 71874 gene locus_tag LOCUS_00500 gene pgeF 72680 71874 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_00500 73873 72704 gene locus_tag LOCUS_00510 gene obgE 73873 72704 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_00510 74479 73910 gene locus_tag LOCUS_00520 74479 73910 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_00520 75143 74607 gene locus_tag LOCUS_00530 gene hpt 75143 74607 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_00530 76005 75313 gene locus_tag LOCUS_00540 76005 75313 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_00540 76385 76002 gene locus_tag LOCUS_00550 76385 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 77067 76507 gene locus_tag LOCUS_00560 77067 76507 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080454.1 protein_id gnl|my_center|LOCUS_00560 77478 78917 gene locus_tag LOCUS_00570 77478 78917 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_00570 79791 79528 gene locus_tag LOCUS_00580 79791 79528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 79784 80023 gene locus_tag LOCUS_00590 79784 80023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 80459 81604 gene locus_tag LOCUS_00600 80459 81604 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_00600 81643 82914 gene locus_tag LOCUS_00610 81643 82914 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_00610 83709 83014 gene locus_tag LOCUS_00620 83709 83014 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_00620 84343 83747 gene locus_tag LOCUS_00630 84343 83747 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_00630 85337 84414 gene locus_tag LOCUS_00640 85337 84414 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202197.1 protein_id gnl|my_center|LOCUS_00640 86120 85350 gene locus_tag LOCUS_00650 86120 85350 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_00650 86940 86203 gene locus_tag LOCUS_00660 gene ubiE 86940 86203 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_00660 87290 87934 gene locus_tag LOCUS_00670 87290 87934 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_00670 88023 89864 gene locus_tag LOCUS_00680 88023 89864 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_00680 89944 90882 gene locus_tag LOCUS_00690 gene fmt 89944 90882 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_00690 91133 92503 gene locus_tag LOCUS_00700 91133 92503 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_00700 92509 93345 gene locus_tag LOCUS_00710 92509 93345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_00710 93640 94623 gene locus_tag LOCUS_00720 93640 94623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 94604 96781 gene locus_tag LOCUS_00730 94604 96781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 97103 99514 gene locus_tag LOCUS_00740 97103 99514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 99587 100537 gene locus_tag LOCUS_00750 99587 100537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence002 1596 562 gene locus_tag LOCUS_00760 gene holA 1596 562 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_00760 2372 1596 gene locus_tag LOCUS_00770 2372 1596 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 protein_id gnl|my_center|LOCUS_00770 4408 2570 gene locus_tag LOCUS_00780 4408 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4607 5062 gene locus_tag LOCUS_00790 4607 5062 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_00790 6358 5069 gene locus_tag LOCUS_00800 6358 5069 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_00800 7497 6547 gene locus_tag LOCUS_00810 7497 6547 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_00810 8609 7722 gene locus_tag LOCUS_00820 8609 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9120 8659 gene locus_tag LOCUS_00830 9120 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 9668 9234 gene locus_tag LOCUS_00840 9668 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10261 9722 gene locus_tag LOCUS_00850 10261 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11464 10394 gene locus_tag LOCUS_00860 11464 10394 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_00860 11930 11457 gene locus_tag LOCUS_00870 gene rlmH 11930 11457 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_00870 12918 12109 gene locus_tag LOCUS_00880 12918 12109 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_00880 13773 12988 gene locus_tag LOCUS_00890 13773 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 16474 14045 gene locus_tag LOCUS_00900 16474 14045 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_00900 18587 16560 gene locus_tag LOCUS_00910 18587 16560 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_00910 20026 20199 gene locus_tag LOCUS_00920 20026 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 21601 20525 gene locus_tag LOCUS_00930 gene aroC 21601 20525 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_00930 22362 21670 gene locus_tag LOCUS_00940 22362 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 24258 22441 gene locus_tag LOCUS_00950 24258 22441 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_00950 25165 24407 gene locus_tag LOCUS_00960 25165 24407 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_00960 26444 25170 gene locus_tag LOCUS_00970 26444 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 27423 26482 gene locus_tag LOCUS_00980 27423 26482 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_00980 28778 27438 gene locus_tag LOCUS_00990 28778 27438 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_00990 29598 28837 gene locus_tag LOCUS_01000 29598 28837 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_01000 30511 31176 gene locus_tag LOCUS_01010 30511 31176 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_01010 31322 31173 gene locus_tag LOCUS_01020 31322 31173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 31297 31677 gene locus_tag LOCUS_01030 31297 31677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01030 31706 32605 gene locus_tag LOCUS_01040 gene cynR 31706 32605 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952470.1 protein_id gnl|my_center|LOCUS_01040 32873 33841 gene locus_tag LOCUS_01050 32873 33841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 35299 34538 gene locus_tag LOCUS_01060 35299 34538 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_01060 36090 35305 gene locus_tag LOCUS_01070 36090 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 37031 36075 gene locus_tag LOCUS_01080 37031 36075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 38212 38406 gene locus_tag LOCUS_01090 38212 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 38418 39662 gene locus_tag LOCUS_01100 38418 39662 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460830.1 protein_id gnl|my_center|LOCUS_01100 39665 40669 gene locus_tag LOCUS_01110 39665 40669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 40662 40943 gene locus_tag LOCUS_01120 40662 40943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 40940 41203 gene locus_tag LOCUS_01130 40940 41203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 41187 41972 gene locus_tag LOCUS_01140 gene tatC 41187 41972 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_01140 42185 43249 gene locus_tag LOCUS_01150 42185 43249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 43750 44451 gene locus_tag LOCUS_01160 43750 44451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 44563 46479 gene locus_tag LOCUS_01170 44563 46479 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_01170 46580 46834 gene locus_tag LOCUS_01180 46580 46834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 46967 48043 gene locus_tag LOCUS_01190 46967 48043 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_01190 49045 48191 gene locus_tag LOCUS_01200 49045 48191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 49993 49094 gene locus_tag LOCUS_01210 49993 49094 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_01210 50803 50108 gene locus_tag LOCUS_01220 gene cmk 50803 50108 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_01220 53807 50868 gene locus_tag LOCUS_01230 53807 50868 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_01230 54397 53834 gene locus_tag LOCUS_01240 54397 53834 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_01240 54832 54569 gene locus_tag LOCUS_01250 54832 54569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 55404 54868 gene locus_tag LOCUS_01260 55404 54868 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_01260 56253 55444 gene locus_tag LOCUS_01270 56253 55444 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_01270 56704 56267 gene locus_tag LOCUS_01280 56704 56267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 57786 56701 gene locus_tag LOCUS_01290 57786 56701 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_01290 58095 57865 gene locus_tag LOCUS_01300 58095 57865 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_01300 58461 58189 gene locus_tag LOCUS_01310 58461 58189 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766138.1 protein_id gnl|my_center|LOCUS_01310 60132 59302 gene locus_tag LOCUS_01320 60132 59302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 61594 60179 gene locus_tag LOCUS_01330 61594 60179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 63858 61675 gene locus_tag LOCUS_01340 63858 61675 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_01340 64097 65053 gene locus_tag LOCUS_01350 64097 65053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 65532 67289 gene locus_tag LOCUS_01360 gene ilvD 65532 67289 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761033.1 protein_id gnl|my_center|LOCUS_01360 67465 69162 gene locus_tag LOCUS_01370 gene ilvB 67465 69162 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_01370 69197 69796 gene locus_tag LOCUS_01380 gene ilvN 69197 69796 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_01380 69816 70616 gene locus_tag LOCUS_01390 69816 70616 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_01390 70689 71732 gene locus_tag LOCUS_01400 gene ilvC 70689 71732 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761037.1 protein_id gnl|my_center|LOCUS_01400 71893 72408 gene locus_tag LOCUS_01410 gene cobC 71893 72408 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_01410 72449 74548 gene locus_tag LOCUS_01420 72449 74548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 76030 74732 gene locus_tag LOCUS_01430 76030 74732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 76665 76096 gene locus_tag LOCUS_01440 76665 76096 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_01440 76817 77434 gene locus_tag LOCUS_01450 gene udk 76817 77434 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_01450 78679 78101 gene locus_tag LOCUS_01460 78679 78101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 80902 78845 gene locus_tag LOCUS_01470 80902 78845 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_01470 81567 80926 gene locus_tag LOCUS_01480 81567 80926 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_01480 82250 81621 gene locus_tag LOCUS_01490 gene rsmG 82250 81621 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_01490 83176 82364 gene locus_tag LOCUS_01500 83176 82364 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_01500 85185 83167 gene locus_tag LOCUS_01510 85185 83167 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_01510 85595 85239 gene locus_tag LOCUS_01520 85595 85239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760554.1 protein_id gnl|my_center|LOCUS_01520 87088 86051 gene locus_tag LOCUS_01530 gene asnA 87088 86051 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_01530 90016 87197 gene locus_tag LOCUS_01540 90016 87197 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_01540 90405 92711 gene locus_tag LOCUS_01550 90405 92711 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_01550 92778 94646 gene locus_tag LOCUS_01560 92778 94646 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203243.1 protein_id gnl|my_center|LOCUS_01560 94814 95971 gene locus_tag LOCUS_01570 94814 95971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_01570 96042 96899 gene locus_tag LOCUS_01580 96042 96899 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence003 1576 515 gene locus_tag LOCUS_01590 gene leuB 1576 515 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_01590 2527 1607 gene locus_tag LOCUS_01600 2527 1607 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_01600 3871 2591 gene locus_tag LOCUS_01610 3871 2591 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_01610 4239 4835 gene locus_tag LOCUS_01620 4239 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5027 6070 gene locus_tag LOCUS_01630 5027 6070 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_01630 6237 7094 gene locus_tag LOCUS_01640 gene mreC 6237 7094 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_01640 7139 7684 gene locus_tag LOCUS_01650 7139 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7744 9594 gene locus_tag LOCUS_01660 gene mrdA 7744 9594 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_01660 9584 11047 gene locus_tag LOCUS_01670 gene rodA 9584 11047 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_01670 11100 11543 gene locus_tag LOCUS_01680 11100 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 11781 12275 gene locus_tag LOCUS_01690 11781 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 12526 13314 gene locus_tag LOCUS_01700 12526 13314 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_01700 13446 14549 gene locus_tag LOCUS_01710 13446 14549 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_01710 15328 14642 gene locus_tag LOCUS_01720 15328 14642 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_01720 16383 15370 gene locus_tag LOCUS_01730 16383 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 17345 16488 gene locus_tag LOCUS_01740 17345 16488 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_01740 18113 19570 gene locus_tag LOCUS_01750 18113 19570 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_01750 19655 22081 gene locus_tag LOCUS_01760 gene thrA 19655 22081 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_01760 22398 22718 gene locus_tag LOCUS_01770 22398 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 23157 24398 gene locus_tag LOCUS_01780 23157 24398 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_01780 24462 24959 gene locus_tag LOCUS_01790 24462 24959 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_01790 25976 25047 gene locus_tag LOCUS_01800 25976 25047 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_01800 26921 26070 gene locus_tag LOCUS_01810 26921 26070 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_01810 27918 26854 gene locus_tag LOCUS_01820 gene lpxK 27918 26854 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_01820 29690 27924 gene locus_tag LOCUS_01830 gene sppA 29690 27924 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_01830 30479 29721 gene locus_tag LOCUS_01840 30479 29721 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_01840 30744 31817 gene locus_tag LOCUS_01850 30744 31817 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_01850 31913 31986 gene locus_tag LOCUS_t00030 31913 31986 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32180 33625 gene locus_tag LOCUS_01860 gene cls 32180 33625 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_01860 33663 35618 gene locus_tag LOCUS_01870 33663 35618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 35705 37066 gene locus_tag LOCUS_01880 35705 37066 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_01880 38468 37200 gene locus_tag LOCUS_01890 38468 37200 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_01890 40362 38647 gene locus_tag LOCUS_01900 40362 38647 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_01900 41480 40491 gene locus_tag LOCUS_01910 41480 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 41860 41480 gene locus_tag LOCUS_01920 41860 41480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 43315 41918 gene locus_tag LOCUS_01930 gene tilS 43315 41918 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_01930 44149 43349 gene locus_tag LOCUS_01940 44149 43349 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_01940 44365 45729 gene locus_tag LOCUS_01950 44365 45729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_01950 45828 47024 gene locus_tag LOCUS_01960 45828 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 47030 48703 gene locus_tag LOCUS_01970 47030 48703 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695173.1 protein_id gnl|my_center|LOCUS_01970 48708 50906 gene locus_tag LOCUS_01980 gene ccsA 48708 50906 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_01980 51444 52238 gene locus_tag LOCUS_01990 51444 52238 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_01990 52320 54473 gene locus_tag LOCUS_02000 52320 54473 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_02000 54570 55364 gene locus_tag LOCUS_02010 54570 55364 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_02010 55411 55899 gene locus_tag LOCUS_02020 55411 55899 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_02020 55896 56909 gene locus_tag LOCUS_02030 55896 56909 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_02030 56940 57629 gene locus_tag LOCUS_02040 gene radC 56940 57629 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_02040 57686 58009 gene locus_tag LOCUS_02050 57686 58009 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_02050 58095 58865 gene locus_tag LOCUS_02060 58095 58865 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_02060 58892 59803 gene locus_tag LOCUS_02070 58892 59803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_02070 59837 61084 gene locus_tag LOCUS_02080 59837 61084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_02080 61321 61575 gene locus_tag LOCUS_02090 61321 61575 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678397.1 protein_id gnl|my_center|LOCUS_02090 61778 62980 gene locus_tag LOCUS_02100 61778 62980 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_02100 63024 64505 gene locus_tag LOCUS_02110 63024 64505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 64679 64753 gene locus_tag LOCUS_t00040 64679 64753 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 64966 65454 gene locus_tag LOCUS_02120 64966 65454 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_02120 65709 66362 gene locus_tag LOCUS_02130 65709 66362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_02130 66520 67719 gene locus_tag LOCUS_02140 66520 67719 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_02140 67763 68731 gene locus_tag LOCUS_02150 gene argC 67763 68731 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_02150 68805 69938 gene locus_tag LOCUS_02160 68805 69938 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_02160 70640 71239 gene locus_tag LOCUS_02170 70640 71239 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_02170 71308 71943 gene locus_tag LOCUS_02180 gene pth 71308 71943 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_02180 71961 72416 gene locus_tag LOCUS_02190 71961 72416 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_02190 72400 72819 gene locus_tag LOCUS_02200 72400 72819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 73509 72946 gene locus_tag LOCUS_02210 73509 72946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 73661 74809 gene locus_tag LOCUS_02220 gene glf 73661 74809 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_02220 75518 75048 gene locus_tag LOCUS_02230 75518 75048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 75811 76923 gene locus_tag LOCUS_02240 75811 76923 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_02240 77963 77001 gene locus_tag LOCUS_02250 77963 77001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 78245 79969 gene locus_tag LOCUS_02260 gene recJ 78245 79969 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_02260 79995 81950 gene locus_tag LOCUS_02270 79995 81950 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_02270 82373 84106 gene locus_tag LOCUS_02280 82373 84106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 84345 86126 gene locus_tag LOCUS_02290 84345 86126 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence004 385 951 gene locus_tag LOCUS_02300 385 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1066 3378 gene locus_tag LOCUS_02310 1066 3378 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_02310 3472 3837 gene locus_tag LOCUS_02320 3472 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4259 3960 gene locus_tag LOCUS_02330 4259 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7233 5071 gene locus_tag LOCUS_02340 7233 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 8109 7291 gene locus_tag LOCUS_02350 gene menB 8109 7291 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_02350 9870 8203 gene locus_tag LOCUS_02360 gene menD 9870 8203 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927100.1 protein_id gnl|my_center|LOCUS_02360 11105 10020 gene locus_tag LOCUS_02370 11105 10020 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_02370 11947 11105 gene locus_tag LOCUS_02380 11947 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12190 14334 gene locus_tag LOCUS_02390 12190 14334 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_02390 14735 16975 gene locus_tag LOCUS_02400 14735 16975 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_02400 17031 18224 gene locus_tag LOCUS_02410 gene icd 17031 18224 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108123.1 protein_id gnl|my_center|LOCUS_02410 18241 19590 gene locus_tag LOCUS_02420 18241 19590 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_02420 20820 20368 gene locus_tag LOCUS_02430 20820 20368 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_02430 21652 20897 gene locus_tag LOCUS_02440 21652 20897 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_02440 24011 21744 gene locus_tag LOCUS_02450 24011 21744 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_02450 25330 24104 gene locus_tag LOCUS_02460 gene pepT 25330 24104 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_02460 26364 25432 gene locus_tag LOCUS_02470 26364 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_02470 28984 26762 gene locus_tag LOCUS_02480 28984 26762 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533398.1 protein_id gnl|my_center|LOCUS_02480 29258 29333 gene locus_tag LOCUS_t00050 29258 29333 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29375 29452 gene locus_tag LOCUS_t00060 29375 29452 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29487 29562 gene locus_tag LOCUS_t00070 29487 29562 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29759 30637 gene locus_tag LOCUS_02490 29759 30637 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_02490 30692 31267 gene locus_tag LOCUS_02500 gene gmk 30692 31267 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_02500 31301 31888 gene locus_tag LOCUS_02510 gene nadD 31301 31888 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_02510 34940 32838 gene locus_tag LOCUS_02520 34940 32838 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_02520 34846 35061 gene locus_tag LOCUS_02530 34846 35061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 35223 35633 gene locus_tag LOCUS_02540 35223 35633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 35714 36865 gene locus_tag LOCUS_02550 35714 36865 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803349.1 protein_id gnl|my_center|LOCUS_02550 36882 40010 gene locus_tag LOCUS_02560 36882 40010 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_02560 39989 41179 gene locus_tag LOCUS_02570 39989 41179 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_02570 41717 41331 gene locus_tag LOCUS_02580 41717 41331 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706385.1 protein_id gnl|my_center|LOCUS_02580 41935 42396 gene locus_tag LOCUS_02590 41935 42396 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_02590 42933 42595 gene locus_tag LOCUS_02600 42933 42595 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_02600 43329 42937 gene locus_tag LOCUS_02610 43329 42937 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_02610 44068 45270 gene locus_tag LOCUS_02620 gene trpB 44068 45270 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_02620 45263 46735 gene locus_tag LOCUS_02630 45263 46735 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_02630 46722 47351 gene locus_tag LOCUS_02640 46722 47351 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792933.1 protein_id gnl|my_center|LOCUS_02640 47401 48399 gene locus_tag LOCUS_02650 gene trpD 47401 48399 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803789.1 protein_id gnl|my_center|LOCUS_02650 48466 49308 gene locus_tag LOCUS_02660 gene trpC 48466 49308 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_02660 49378 50016 gene locus_tag LOCUS_02670 49378 50016 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_02670 50013 50789 gene locus_tag LOCUS_02680 gene trpA 50013 50789 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765046.1 protein_id gnl|my_center|LOCUS_02680 51666 50938 gene locus_tag LOCUS_02690 51666 50938 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_02690 52012 53013 gene locus_tag LOCUS_02700 52012 53013 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_02700 53052 53240 gene locus_tag LOCUS_02710 53052 53240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389845.1 protein_id gnl|my_center|LOCUS_02710 53240 53827 gene locus_tag LOCUS_02720 53240 53827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 54144 56351 gene locus_tag LOCUS_02730 54144 56351 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109237.1 protein_id gnl|my_center|LOCUS_02730 56478 57659 gene locus_tag LOCUS_02740 56478 57659 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_02740 57695 57925 gene locus_tag LOCUS_02750 57695 57925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 58198 59547 gene locus_tag LOCUS_02760 58198 59547 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_02760 59558 60736 gene locus_tag LOCUS_02770 59558 60736 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_02770 60758 61534 gene locus_tag LOCUS_02780 60758 61534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_02780 61578 62804 gene locus_tag LOCUS_02790 61578 62804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_02790 62904 64004 gene locus_tag LOCUS_02800 62904 64004 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_02800 64058 64819 gene locus_tag LOCUS_02810 64058 64819 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_02810 64877 66106 gene locus_tag LOCUS_02820 64877 66106 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_02820 67723 66113 gene locus_tag LOCUS_02830 67723 66113 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_02830 68358 67834 gene locus_tag LOCUS_02840 68358 67834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 68526 68359 gene locus_tag LOCUS_02850 68526 68359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 68873 70513 gene locus_tag LOCUS_02860 68873 70513 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_02860 72192 70564 gene locus_tag LOCUS_02870 72192 70564 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence005 523 451 gene locus_tag LOCUS_t00080 523 451 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 768 2165 gene locus_tag LOCUS_02880 gene nhaD 768 2165 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_02880 2201 2845 gene locus_tag LOCUS_02890 2201 2845 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203608.1 protein_id gnl|my_center|LOCUS_02890 2877 3161 gene locus_tag LOCUS_02900 2877 3161 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_02900 3625 6537 gene locus_tag LOCUS_02910 gene secDF 3625 6537 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_02910 8385 7021 gene locus_tag LOCUS_02920 gene hisS 8385 7021 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_02920 8645 10240 gene locus_tag LOCUS_02930 8645 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10322 11776 gene locus_tag LOCUS_02940 10322 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11929 14499 gene locus_tag LOCUS_02950 11929 14499 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_02950 14550 15908 gene locus_tag LOCUS_02960 14550 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 16824 17861 gene locus_tag LOCUS_02970 16824 17861 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_02970 18113 18349 gene locus_tag LOCUS_02980 18113 18349 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_02980 18485 19750 gene locus_tag LOCUS_02990 gene fabF 18485 19750 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_02990 19925 21895 gene locus_tag LOCUS_03000 19925 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 24616 21992 gene locus_tag LOCUS_03010 24616 21992 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_03010 24910 28755 gene locus_tag LOCUS_03020 24910 28755 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108684.1 protein_id gnl|my_center|LOCUS_03020 29273 29136 gene locus_tag LOCUS_03030 29273 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 30174 29326 gene locus_tag LOCUS_03040 30174 29326 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_03040 32302 30197 gene locus_tag LOCUS_03050 gene ftsH 32302 30197 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_03050 32679 32320 gene locus_tag LOCUS_03060 gene rsfS 32679 32320 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_03060 32997 33069 gene locus_tag LOCUS_t00090 32997 33069 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33940 33578 gene locus_tag LOCUS_03070 gene crcB 33940 33578 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_03070 35661 34057 gene locus_tag LOCUS_03080 gene pckA 35661 34057 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_03080 36078 36689 gene locus_tag LOCUS_03090 gene upp 36078 36689 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_03090 37952 36867 gene locus_tag LOCUS_03100 37952 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 39636 38077 gene locus_tag LOCUS_03110 gene gldM 39636 38077 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_03110 40707 39763 gene locus_tag LOCUS_03120 40707 39763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 42236 40758 gene locus_tag LOCUS_03130 gene gldK 42236 40758 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_03130 43254 42289 gene locus_tag LOCUS_03140 43254 42289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 44802 46328 gene locus_tag LOCUS_03150 gene gltX 44802 46328 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_03150 46411 47622 gene locus_tag LOCUS_03160 46411 47622 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_03160 47656 48864 gene locus_tag LOCUS_03170 gene rmuC 47656 48864 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_03170 49051 49374 gene locus_tag LOCUS_03180 49051 49374 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_03180 49451 49999 gene locus_tag LOCUS_03190 49451 49999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 50263 50336 gene locus_tag LOCUS_t00100 50263 50336 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50643 54698 gene locus_tag LOCUS_03200 50643 54698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 54726 54935 gene locus_tag LOCUS_03210 54726 54935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 55264 55188 gene locus_tag LOCUS_t00110 55264 55188 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55354 55280 gene locus_tag LOCUS_t00120 55354 55280 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 55779 61361 gene locus_tag LOCUS_03220 55779 61361 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202133.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence006 518 1525 gene locus_tag LOCUS_03230 518 1525 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920236.1 protein_id gnl|my_center|LOCUS_03230 1633 2160 gene locus_tag LOCUS_03240 1633 2160 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202153.1 protein_id gnl|my_center|LOCUS_03240 2147 3340 gene locus_tag LOCUS_03250 gene lysA 2147 3340 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_03250 3509 4366 gene locus_tag LOCUS_03260 3509 4366 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_03260 5059 6339 gene locus_tag LOCUS_03270 5059 6339 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_03270 6649 6566 gene locus_tag LOCUS_t00130 6649 6566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9321 7483 gene locus_tag LOCUS_03280 9321 7483 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_03280 9745 11877 gene locus_tag LOCUS_03290 9745 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 12024 14429 gene locus_tag LOCUS_03300 12024 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 14443 14616 gene locus_tag LOCUS_03310 14443 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 17124 14803 gene locus_tag LOCUS_03320 17124 14803 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_03320 17621 17256 gene locus_tag LOCUS_03330 17621 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 20499 17839 gene locus_tag LOCUS_03340 20499 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 22096 20537 gene locus_tag LOCUS_03350 22096 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 24937 22151 gene locus_tag LOCUS_03360 24937 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 25692 26216 gene locus_tag LOCUS_03370 25692 26216 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_03370 26283 28523 gene locus_tag LOCUS_03380 26283 28523 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_03380 28673 28747 gene locus_tag LOCUS_t00140 28673 28747 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 29430 28828 gene locus_tag LOCUS_03390 gene feR 29430 28828 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_03390 29662 30744 gene locus_tag LOCUS_03400 gene rlmN 29662 30744 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_03400 30802 31950 gene locus_tag LOCUS_03410 gene pdxA 30802 31950 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_03410 32030 32746 gene locus_tag LOCUS_03420 32030 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 32743 33618 gene locus_tag LOCUS_03430 32743 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 33661 34587 gene locus_tag LOCUS_03440 33661 34587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 34571 35605 gene locus_tag LOCUS_03450 34571 35605 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_03450 35637 36356 gene locus_tag LOCUS_03460 35637 36356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 37526 39481 gene locus_tag LOCUS_03470 37526 39481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 39393 40235 gene locus_tag LOCUS_03480 39393 40235 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764801.1 protein_id gnl|my_center|LOCUS_03480 40403 40732 gene locus_tag LOCUS_03490 40403 40732 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_03490 40716 41825 gene locus_tag LOCUS_03500 40716 41825 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203491.1 protein_id gnl|my_center|LOCUS_03500 42090 41848 gene locus_tag LOCUS_03510 42090 41848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 42470 42180 gene locus_tag LOCUS_03520 42470 42180 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721408.1 protein_id gnl|my_center|LOCUS_03520 43948 42569 gene locus_tag LOCUS_03530 43948 42569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 44808 43945 gene locus_tag LOCUS_03540 44808 43945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45535 44912 gene locus_tag LOCUS_03550 45535 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 46456 45605 gene locus_tag LOCUS_03560 46456 45605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 48651 46456 gene locus_tag LOCUS_03570 48651 46456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 50602 48707 gene locus_tag LOCUS_03580 50602 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 51611 50628 gene locus_tag LOCUS_03590 51611 50628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 53721 51682 gene locus_tag LOCUS_03600 53721 51682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 56758 53870 gene locus_tag LOCUS_03610 56758 53870 CDS product putative virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267840.1 protein_id gnl|my_center|LOCUS_03610 60008 56823 gene locus_tag LOCUS_03620 60008 56823 CDS product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816324.1 protein_id gnl|my_center|LOCUS_03620 60637 60709 gene locus_tag LOCUS_t00150 60637 60709 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 232 432 gene locus_tag LOCUS_03630 232 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1823 435 gene locus_tag LOCUS_03640 1823 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 3741 1885 gene locus_tag LOCUS_03650 3741 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4108 6762 gene locus_tag LOCUS_03660 4108 6762 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_03660 7941 6892 gene locus_tag LOCUS_03670 gene thiL 7941 6892 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_03670 8525 8046 gene locus_tag LOCUS_03680 8525 8046 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_03680 8982 9224 gene locus_tag LOCUS_03690 8982 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 9258 9971 gene locus_tag LOCUS_03700 9258 9971 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_03700 10094 10495 gene locus_tag LOCUS_03710 10094 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 10532 11449 gene locus_tag LOCUS_03720 10532 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_03720 11518 12027 gene locus_tag LOCUS_03730 11518 12027 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_03730 12082 12351 gene locus_tag LOCUS_03740 12082 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 13608 12520 gene locus_tag LOCUS_03750 13608 12520 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_03750 14295 13750 gene locus_tag LOCUS_03760 14295 13750 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_03760 14951 14304 gene locus_tag LOCUS_03770 14951 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 17340 15007 gene locus_tag LOCUS_03780 17340 15007 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_03780 18296 17529 gene locus_tag LOCUS_03790 18296 17529 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108143.1 protein_id gnl|my_center|LOCUS_03790 19645 18296 gene locus_tag LOCUS_03800 19645 18296 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_03800 21399 19879 gene locus_tag LOCUS_03810 21399 19879 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_03810 23165 21444 gene locus_tag LOCUS_03820 23165 21444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 26258 23316 gene locus_tag LOCUS_03830 26258 23316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 27035 28753 gene locus_tag LOCUS_03840 gene lysS 27035 28753 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_03840 28735 29778 gene locus_tag LOCUS_03850 28735 29778 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_03850 29983 32319 gene locus_tag LOCUS_03860 29983 32319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 32357 33766 gene locus_tag LOCUS_03870 32357 33766 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_03870 34880 33741 gene locus_tag LOCUS_03880 34880 33741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_03880 35102 36502 gene locus_tag LOCUS_03890 35102 36502 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_03890 36546 37733 gene locus_tag LOCUS_03900 36546 37733 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_03900 38085 39164 gene locus_tag LOCUS_03910 38085 39164 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049592283.1 protein_id gnl|my_center|LOCUS_03910 39607 39942 gene locus_tag LOCUS_03920 39607 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41116 40058 gene locus_tag LOCUS_03930 gene mutY 41116 40058 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_03930 42266 41214 gene locus_tag LOCUS_03940 42266 41214 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_03940 42680 42324 gene locus_tag LOCUS_03950 42680 42324 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_03950 42869 43522 gene locus_tag LOCUS_03960 gene ruvC 42869 43522 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_03960 43559 44965 gene locus_tag LOCUS_03970 43559 44965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_03970 45020 45502 gene locus_tag LOCUS_03980 45020 45502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 45593 46858 gene locus_tag LOCUS_03990 45593 46858 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788166.1 protein_id gnl|my_center|LOCUS_03990 46943 47557 gene locus_tag LOCUS_04000 46943 47557 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_04000 47567 51427 gene locus_tag LOCUS_04010 gene porU 47567 51427 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_04010 51795 52796 gene locus_tag LOCUS_04020 gene porV 51795 52796 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_04020 52874 53353 gene locus_tag LOCUS_04030 gene ispF 52874 53353 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_04030 53996 56719 gene locus_tag LOCUS_04040 gene ppdK 53996 56719 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_04040 56740 56961 gene locus_tag LOCUS_04050 56740 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 57074 57469 gene locus_tag LOCUS_04060 57074 57469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence008 648 1061 gene locus_tag LOCUS_04070 648 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938800.1 protein_id gnl|my_center|LOCUS_04070 1307 1495 gene locus_tag LOCUS_04080 1307 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3415 1535 gene locus_tag LOCUS_04090 3415 1535 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_04090 3921 3415 gene locus_tag LOCUS_04100 gene purE 3921 3415 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_04100 4575 3958 gene locus_tag LOCUS_04110 4575 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6142 4643 gene locus_tag LOCUS_04120 gene rpoN 6142 4643 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_04120 8053 6383 gene locus_tag LOCUS_04130 8053 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9029 8142 gene locus_tag LOCUS_04140 9029 8142 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798129.1 protein_id gnl|my_center|LOCUS_04140 10189 9011 gene locus_tag LOCUS_04150 10189 9011 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_04150 12613 10529 gene locus_tag LOCUS_04160 12613 10529 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_04160 15687 13363 gene locus_tag LOCUS_04170 gene rnr 15687 13363 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_04170 15870 16508 gene locus_tag LOCUS_04180 15870 16508 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_04180 16891 16607 gene locus_tag LOCUS_04190 16891 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 17928 17020 gene locus_tag LOCUS_04200 17928 17020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 18468 19004 gene locus_tag LOCUS_04210 18468 19004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19823 20818 gene locus_tag LOCUS_04220 19823 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 20828 21685 gene locus_tag LOCUS_04230 gene dinD 20828 21685 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_04230 21689 22798 gene locus_tag LOCUS_04240 21689 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 23289 23020 gene locus_tag LOCUS_04250 gene rpsO 23289 23020 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_04250 23512 24108 gene locus_tag LOCUS_04260 23512 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24182 25030 gene locus_tag LOCUS_04270 gene murI 24182 25030 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_04270 25079 26086 gene locus_tag LOCUS_04280 25079 26086 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_04280 26077 27072 gene locus_tag LOCUS_04290 26077 27072 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_04290 27137 28531 gene locus_tag LOCUS_04300 27137 28531 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_04300 30205 28616 gene locus_tag LOCUS_04310 gene nadB 30205 28616 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_04310 30360 33185 gene locus_tag LOCUS_04320 30360 33185 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_04320 33358 34356 gene locus_tag LOCUS_04330 gene nadA 33358 34356 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_04330 34372 35442 gene locus_tag LOCUS_04340 gene pdxB 34372 35442 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_04340 35729 39169 gene locus_tag LOCUS_04350 35729 39169 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202182.1 protein_id gnl|my_center|LOCUS_04350 39387 40310 gene locus_tag LOCUS_04360 gene rsmH 39387 40310 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_04360 40380 41072 gene locus_tag LOCUS_04370 40380 41072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 41150 43519 gene locus_tag LOCUS_04380 41150 43519 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_04380 43524 44984 gene locus_tag LOCUS_04390 43524 44984 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_04390 45054 46328 gene locus_tag LOCUS_04400 gene mraY 45054 46328 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_04400 46355 47689 gene locus_tag LOCUS_04410 gene murD 46355 47689 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_04410 47822 49096 gene locus_tag LOCUS_04420 47822 49096 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_04420 49174 49845 gene locus_tag LOCUS_04430 49174 49845 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_04430 49899 50942 gene locus_tag LOCUS_04440 gene ruvB 49899 50942 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_04440 50958 51395 gene locus_tag LOCUS_04450 gene ybeY 50958 51395 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_04450 51481 52776 gene locus_tag LOCUS_04460 gene tyrS 51481 52776 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_04460 52873 53625 gene locus_tag LOCUS_04470 gene dapB 52873 53625 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_04470 53635 55146 gene locus_tag LOCUS_04480 53635 55146 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_04480 55190 55717 gene locus_tag LOCUS_04490 55190 55717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 55804 56439 gene locus_tag LOCUS_04500 55804 56439 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence009 3171 928 gene locus_tag LOCUS_04510 3171 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 6586 3245 gene locus_tag LOCUS_04520 6586 3245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_04520 8535 6679 gene locus_tag LOCUS_04530 8535 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 10685 8565 gene locus_tag LOCUS_04540 10685 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 12590 10713 gene locus_tag LOCUS_04550 12590 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 15913 12602 gene locus_tag LOCUS_04560 15913 12602 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_04560 18999 16042 gene locus_tag LOCUS_04570 18999 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21620 20490 gene locus_tag LOCUS_04580 21620 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 22135 21735 gene locus_tag LOCUS_tm00010 22135 21735 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 23862 22351 gene locus_tag LOCUS_04590 23862 22351 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_04590 25430 23892 gene locus_tag LOCUS_04600 25430 23892 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785038.1 protein_id gnl|my_center|LOCUS_04600 27410 25464 gene locus_tag LOCUS_04610 gene nuoL 27410 25464 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_04610 27782 27474 gene locus_tag LOCUS_04620 gene nuoK 27782 27474 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007764713.1 protein_id gnl|my_center|LOCUS_04620 28334 27804 gene locus_tag LOCUS_04630 28334 27804 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_04630 28880 28353 gene locus_tag LOCUS_04640 28880 28353 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_04640 29997 28912 gene locus_tag LOCUS_04650 gene nuoH 29997 28912 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_04650 31773 30103 gene locus_tag LOCUS_04660 31773 30103 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760950.1 protein_id gnl|my_center|LOCUS_04660 32399 31770 gene locus_tag LOCUS_04670 32399 31770 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_04670 32746 32396 gene locus_tag LOCUS_04680 32746 32396 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760952.1 protein_id gnl|my_center|LOCUS_04680 36543 33922 gene locus_tag LOCUS_04690 36543 33922 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_04690 37746 36652 gene locus_tag LOCUS_04700 37746 36652 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760937.1 protein_id gnl|my_center|LOCUS_04700 38610 37780 gene locus_tag LOCUS_04710 38610 37780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_04710 40172 38817 gene locus_tag LOCUS_04720 40172 38817 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_04720 40457 43558 gene locus_tag LOCUS_04730 40457 43558 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_04730 43828 46044 gene locus_tag LOCUS_04740 gene pnp 43828 46044 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765197.1 protein_id gnl|my_center|LOCUS_04740 46952 46473 gene locus_tag LOCUS_04750 46952 46473 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801902.1 protein_id gnl|my_center|LOCUS_04750 47485 46949 gene locus_tag LOCUS_04760 47485 46949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_04760 47987 47475 gene locus_tag LOCUS_04770 47987 47475 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence010 748 948 gene locus_tag LOCUS_04780 748 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1977 2894 gene locus_tag LOCUS_04790 1977 2894 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_04790 2962 3777 gene locus_tag LOCUS_04800 2962 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3817 4278 gene locus_tag LOCUS_04810 3817 4278 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_04810 5314 4616 gene locus_tag LOCUS_04820 5314 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_04820 7133 5475 gene locus_tag LOCUS_04830 7133 5475 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107423.1 protein_id gnl|my_center|LOCUS_04830 7844 7233 gene locus_tag LOCUS_04840 7844 7233 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759972.1 protein_id gnl|my_center|LOCUS_04840 8196 9380 gene locus_tag LOCUS_04850 8196 9380 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_04850 9655 10668 gene locus_tag LOCUS_04860 9655 10668 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_04860 12085 10841 gene locus_tag LOCUS_04870 12085 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12504 12082 gene locus_tag LOCUS_04880 12504 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13404 12556 gene locus_tag LOCUS_04890 13404 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14128 13457 gene locus_tag LOCUS_04900 14128 13457 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_04900 14984 14205 gene locus_tag LOCUS_04910 14984 14205 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_04910 15727 16182 gene locus_tag LOCUS_04920 15727 16182 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_04920 16221 16772 gene locus_tag LOCUS_04930 16221 16772 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_04930 18974 16899 gene locus_tag LOCUS_04940 18974 16899 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_04940 19811 19062 gene locus_tag LOCUS_04950 19811 19062 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_04950 21112 19811 gene locus_tag LOCUS_04960 21112 19811 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_04960 22697 21165 gene locus_tag LOCUS_04970 22697 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 22893 23471 gene locus_tag LOCUS_04980 22893 23471 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_04980 23576 24394 gene locus_tag LOCUS_04990 23576 24394 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_04990 26673 24874 gene locus_tag LOCUS_05000 gene typA 26673 24874 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_05000 28997 26802 gene locus_tag LOCUS_05010 gene recG 28997 26802 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_05010 29671 29108 gene locus_tag LOCUS_05020 29671 29108 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_05020 30543 29830 gene locus_tag LOCUS_05030 30543 29830 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_05030 30840 31718 gene locus_tag LOCUS_05040 30840 31718 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_05040 31763 33448 gene locus_tag LOCUS_05050 31763 33448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_05050 34027 33620 gene locus_tag LOCUS_05060 34027 33620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 34929 34093 gene locus_tag LOCUS_05070 34929 34093 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932424.1 protein_id gnl|my_center|LOCUS_05070 35638 34964 gene locus_tag LOCUS_05080 35638 34964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 36648 35716 gene locus_tag LOCUS_05090 36648 35716 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_05090 37554 36703 gene locus_tag LOCUS_05100 37554 36703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 37827 39251 gene locus_tag LOCUS_05110 37827 39251 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766999.1 protein_id gnl|my_center|LOCUS_05110 39432 43163 gene locus_tag LOCUS_05120 gene purL 39432 43163 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814911.1 protein_id gnl|my_center|LOCUS_05120 43335 43916 gene locus_tag LOCUS_05130 43335 43916 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_05130 43988 44323 gene locus_tag LOCUS_05140 43988 44323 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_05140 44379 45761 gene locus_tag LOCUS_05150 gene radA 44379 45761 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764082.1 protein_id gnl|my_center|LOCUS_05150 45758 47461 gene locus_tag LOCUS_05160 45758 47461 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence011 43 228 gene locus_tag LOCUS_05170 43 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3600 382 gene locus_tag LOCUS_05180 3600 382 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_05180 4265 3633 gene locus_tag LOCUS_05190 4265 3633 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_05190 4966 4304 gene locus_tag LOCUS_05200 gene ung 4966 4304 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_05200 6245 4980 gene locus_tag LOCUS_05210 gene hflX 6245 4980 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_05210 7162 6275 gene locus_tag LOCUS_05220 7162 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7997 7128 gene locus_tag LOCUS_05230 7997 7128 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761368.1 protein_id gnl|my_center|LOCUS_05230 8727 8053 gene locus_tag LOCUS_05240 8727 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10403 8853 gene locus_tag LOCUS_05250 10403 8853 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_05250 12517 14433 gene locus_tag LOCUS_05260 12517 14433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 14498 15754 gene locus_tag LOCUS_05270 14498 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17211 15886 gene locus_tag LOCUS_05280 17211 15886 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_05280 17407 19479 gene locus_tag LOCUS_05290 17407 19479 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_05290 19591 22014 gene locus_tag LOCUS_05300 gene priA 19591 22014 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_05300 22173 23540 gene locus_tag LOCUS_05310 gene dnaA 22173 23540 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_05310 26210 24060 gene locus_tag LOCUS_05320 26210 24060 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_05320 27014 26322 gene locus_tag LOCUS_05330 27014 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 27829 27074 gene locus_tag LOCUS_05340 27829 27074 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_05340 29756 27918 gene locus_tag LOCUS_05350 29756 27918 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_05350 30429 29779 gene locus_tag LOCUS_05360 30429 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 31442 30426 gene locus_tag LOCUS_05370 31442 30426 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_05370 32536 31529 gene locus_tag LOCUS_05380 32536 31529 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_05380 33644 32565 gene locus_tag LOCUS_05390 33644 32565 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_05390 34626 33745 gene locus_tag LOCUS_05400 34626 33745 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_05400 35742 34753 gene locus_tag LOCUS_05410 35742 34753 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761573.1 protein_id gnl|my_center|LOCUS_05410 36123 36839 gene locus_tag LOCUS_05420 36123 36839 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_05420 37051 36836 gene locus_tag LOCUS_05430 37051 36836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 36932 37516 gene locus_tag LOCUS_05440 gene queC 36932 37516 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762201.1 protein_id gnl|my_center|LOCUS_05440 37562 38020 gene locus_tag LOCUS_05450 gene queF 37562 38020 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_05450 38575 39237 gene locus_tag LOCUS_05460 38575 39237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 39295 39471 gene locus_tag LOCUS_05470 39295 39471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 39655 40269 gene locus_tag LOCUS_05480 39655 40269 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761320.1 protein_id gnl|my_center|LOCUS_05480 40938 41540 gene locus_tag LOCUS_05490 40938 41540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 42769 42176 gene locus_tag LOCUS_05500 42769 42176 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_05500 43999 42836 gene locus_tag LOCUS_05510 gene purT 43999 42836 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_05510 45451 44261 gene locus_tag LOCUS_05520 45451 44261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 46012 45533 gene locus_tag LOCUS_05530 46012 45533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 <46867 46085 gene locus_tag LOCUS_05540 <46867 46085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108918.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence012 1174 1413 gene locus_tag LOCUS_05550 1174 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2384 1479 gene locus_tag LOCUS_05560 2384 1479 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_05560 3163 2366 gene locus_tag LOCUS_05570 3163 2366 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_05570 4624 3230 gene locus_tag LOCUS_05580 gene asnS 4624 3230 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_05580 6084 4777 gene locus_tag LOCUS_05590 6084 4777 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760797.1 protein_id gnl|my_center|LOCUS_05590 7532 6186 gene locus_tag LOCUS_05600 gene purB 7532 6186 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_05600 8844 7570 gene locus_tag LOCUS_05610 gene serS 8844 7570 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_05610 9725 11884 gene locus_tag LOCUS_05620 9725 11884 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_05620 12374 15151 gene locus_tag LOCUS_05630 12374 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 15261 16373 gene locus_tag LOCUS_05640 15261 16373 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764801.1 protein_id gnl|my_center|LOCUS_05640 16521 17654 gene locus_tag LOCUS_05650 16521 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 17765 18718 gene locus_tag LOCUS_05660 17765 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 19071 18901 gene locus_tag LOCUS_05670 19071 18901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 20320 19292 gene locus_tag LOCUS_05680 20320 19292 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760779.1 protein_id gnl|my_center|LOCUS_05680 22690 20666 gene locus_tag LOCUS_05690 gene mutL 22690 20666 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760778.1 protein_id gnl|my_center|LOCUS_05690 24370 22715 gene locus_tag LOCUS_05700 24370 22715 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_05700 25849 24500 gene locus_tag LOCUS_05710 25849 24500 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_05710 27329 25896 gene locus_tag LOCUS_05720 27329 25896 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108995.1 protein_id gnl|my_center|LOCUS_05720 28952 27471 gene locus_tag LOCUS_05730 gene guaB 28952 27471 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_05730 30894 29602 gene locus_tag LOCUS_05740 30894 29602 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_05740 31379 30930 gene locus_tag LOCUS_05750 gene pyrI 31379 30930 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_05750 32390 31446 gene locus_tag LOCUS_05760 gene pyrB 32390 31446 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_05760 32734 34974 gene locus_tag LOCUS_05770 32734 34974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 35040 36425 gene locus_tag LOCUS_05780 35040 36425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 36573 36989 gene locus_tag LOCUS_05790 gene ruvX 36573 36989 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_05790 37066 37623 gene locus_tag LOCUS_05800 gene def 37066 37623 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_05800 37748 39706 gene locus_tag LOCUS_05810 37748 39706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 39727 41232 gene locus_tag LOCUS_05820 gene rlmD 39727 41232 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_05820 40230 40317 gene locus_tag LOCUS_t00160 40230 40317 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41279 41983 gene locus_tag LOCUS_05830 41279 41983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 42041 44362 gene locus_tag LOCUS_05840 42041 44362 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence013 936 190 gene locus_tag LOCUS_05850 936 190 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_05850 2761 944 gene locus_tag LOCUS_05860 gene argS 2761 944 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_05860 3362 2811 gene locus_tag LOCUS_05870 3362 2811 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_05870 6943 3467 gene locus_tag LOCUS_05880 6943 3467 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_05880 7372 8253 gene locus_tag LOCUS_05890 7372 8253 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_05890 8392 9876 gene locus_tag LOCUS_05900 8392 9876 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_05900 9999 12179 gene locus_tag LOCUS_05910 9999 12179 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_05910 13224 12346 gene locus_tag LOCUS_05920 13224 12346 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_05920 14353 13454 gene locus_tag LOCUS_05930 14353 13454 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_05930 16297 14405 gene locus_tag LOCUS_05940 16297 14405 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_05940 19330 16337 gene locus_tag LOCUS_05950 gene uvrA 19330 16337 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_05950 20210 19440 gene locus_tag LOCUS_05960 20210 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 22506 20320 gene locus_tag LOCUS_05970 22506 20320 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_05970 23763 22549 gene locus_tag LOCUS_05980 23763 22549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_05980 24581 23835 gene locus_tag LOCUS_05990 24581 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 26639 29803 gene locus_tag LOCUS_06000 26639 29803 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_06000 29873 31402 gene locus_tag LOCUS_06010 29873 31402 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_06010 31497 32522 gene locus_tag LOCUS_06020 31497 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 32827 33753 gene locus_tag LOCUS_06030 32827 33753 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_06030 33855 35771 gene locus_tag LOCUS_06040 33855 35771 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_06040 35879 37144 gene locus_tag LOCUS_06050 gene aroA 35879 37144 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_06050 37141 37572 gene locus_tag LOCUS_06060 37141 37572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 37606 38412 gene locus_tag LOCUS_06070 37606 38412 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_06070 38477 41365 gene locus_tag LOCUS_06080 38477 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 42991 45015 gene locus_tag LOCUS_06090 gene gyrB 42991 45015 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_06090 45209 45526 gene locus_tag LOCUS_06100 gene rplU 45209 45526 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_06100 45547 45810 gene locus_tag LOCUS_06110 gene rpmA 45547 45810 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence014 438 259 gene locus_tag LOCUS_06120 438 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1079 1423 gene locus_tag LOCUS_06130 gene rpsF 1079 1423 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_06130 1427 1696 gene locus_tag LOCUS_06140 gene rpsR 1427 1696 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_06140 1716 2165 gene locus_tag LOCUS_06150 gene rplI 1716 2165 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_06150 2251 2997 gene locus_tag LOCUS_06160 gene truA 2251 2997 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_06160 3374 5245 gene locus_tag LOCUS_06170 3374 5245 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_06170 5485 6822 gene locus_tag LOCUS_06180 gene gdhA 5485 6822 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_06180 7591 6950 gene locus_tag LOCUS_06190 7591 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10571 7764 gene locus_tag LOCUS_06200 10571 7764 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_06200 12504 10915 gene locus_tag LOCUS_06210 12504 10915 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_06210 12867 13202 gene locus_tag LOCUS_06220 12867 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 13377 13300 gene locus_tag LOCUS_t00170 13377 13300 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13441 13659 gene locus_tag LOCUS_06230 13441 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 13675 14232 gene locus_tag LOCUS_06240 13675 14232 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_06240 14207 14971 gene locus_tag LOCUS_06250 14207 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 15020 15919 gene locus_tag LOCUS_06260 15020 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 16141 19002 gene locus_tag LOCUS_06270 16141 19002 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_06270 22298 19587 gene locus_tag LOCUS_06280 22298 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 22861 22337 gene locus_tag LOCUS_06290 22861 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 24153 23077 gene locus_tag LOCUS_06300 24153 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 24544 24795 gene locus_tag LOCUS_06310 24544 24795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06310 24779 25081 gene locus_tag LOCUS_06320 24779 25081 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764435.1 protein_id gnl|my_center|LOCUS_06320 26086 25349 gene locus_tag LOCUS_06330 26086 25349 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_06330 27710 26262 gene locus_tag LOCUS_06340 27710 26262 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_06340 28761 27937 gene locus_tag LOCUS_06350 28761 27937 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_06350 29160 29972 gene locus_tag LOCUS_06360 gene panC 29160 29972 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764495.1 protein_id gnl|my_center|LOCUS_06360 30054 30401 gene locus_tag LOCUS_06370 30054 30401 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_06370 30415 31218 gene locus_tag LOCUS_06380 30415 31218 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_06380 31271 32365 gene locus_tag LOCUS_06390 gene mnmA 31271 32365 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_06390 34037 33030 gene locus_tag LOCUS_06400 34037 33030 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_06400 35700 34243 gene locus_tag LOCUS_06410 35700 34243 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_06410 36725 35754 gene locus_tag LOCUS_06420 36725 35754 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694299.1 protein_id gnl|my_center|LOCUS_06420 38161 36755 gene locus_tag LOCUS_06430 38161 36755 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_06430 38429 42940 gene locus_tag LOCUS_06440 gene gltB 38429 42940 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_06440 42998 44347 gene locus_tag LOCUS_06450 42998 44347 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence015 1350 241 gene locus_tag LOCUS_06460 1350 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2142 2798 gene locus_tag LOCUS_06470 2142 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2833 4101 gene locus_tag LOCUS_06480 2833 4101 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_06480 5953 4190 gene locus_tag LOCUS_06490 5953 4190 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_06490 6359 7405 gene locus_tag LOCUS_06500 6359 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7635 7898 gene locus_tag LOCUS_06510 7635 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 7913 9544 gene locus_tag LOCUS_06520 7913 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9671 10912 gene locus_tag LOCUS_06530 9671 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15056 11589 gene locus_tag LOCUS_06540 15056 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 17934 15253 gene locus_tag LOCUS_06550 17934 15253 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_06550 18341 18084 gene locus_tag LOCUS_06560 18341 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 19002 18361 gene locus_tag LOCUS_06570 19002 18361 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_06570 20027 19053 gene locus_tag LOCUS_06580 20027 19053 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_06580 21350 20100 gene locus_tag LOCUS_06590 21350 20100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 22734 21394 gene locus_tag LOCUS_06600 22734 21394 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_06600 24254 22794 gene locus_tag LOCUS_06610 24254 22794 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_06610 25472 24303 gene locus_tag LOCUS_06620 25472 24303 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_06620 26681 25551 gene locus_tag LOCUS_06630 gene tgt 26681 25551 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_06630 29124 26725 gene locus_tag LOCUS_06640 gene lon 29124 26725 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_06640 30536 29781 gene locus_tag LOCUS_06650 30536 29781 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_06650 32252 30621 gene locus_tag LOCUS_06660 32252 30621 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_06660 34118 32448 gene locus_tag LOCUS_06670 gene recN 34118 32448 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_06670 35084 34230 gene locus_tag LOCUS_06680 35084 34230 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_06680 36364 35114 gene locus_tag LOCUS_06690 gene coaBC 36364 35114 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_06690 37142 36372 gene locus_tag LOCUS_06700 37142 36372 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_06700 38454 37264 gene locus_tag LOCUS_06710 gene dnaN 38454 37264 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_06710 41151 38593 gene locus_tag LOCUS_06720 41151 38593 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence016 1364 516 gene locus_tag LOCUS_06730 1364 516 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_06730 2260 1451 gene locus_tag LOCUS_06740 2260 1451 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_06740 4670 2421 gene locus_tag LOCUS_06750 4670 2421 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_06750 5605 4745 gene locus_tag LOCUS_06760 5605 4745 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_06760 6197 5649 gene locus_tag LOCUS_06770 6197 5649 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_06770 7854 6223 gene locus_tag LOCUS_06780 7854 6223 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_06780 8371 7898 gene locus_tag LOCUS_06790 8371 7898 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_06790 10472 8424 gene locus_tag LOCUS_06800 10472 8424 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_06800 11791 10574 gene locus_tag LOCUS_06810 11791 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 13301 12045 gene locus_tag LOCUS_06820 13301 12045 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765728.1 protein_id gnl|my_center|LOCUS_06820 15905 13344 gene locus_tag LOCUS_06830 gene gyrA 15905 13344 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_06830 17090 16704 gene locus_tag LOCUS_06840 17090 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 17337 17825 gene locus_tag LOCUS_06850 17337 17825 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_06850 17822 18925 gene locus_tag LOCUS_06860 17822 18925 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_06860 18993 21041 gene locus_tag LOCUS_06870 gene dnaG 18993 21041 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_06870 21149 22009 gene locus_tag LOCUS_06880 21149 22009 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_06880 22084 25128 gene locus_tag LOCUS_06890 22084 25128 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_06890 25149 25442 gene locus_tag LOCUS_06900 25149 25442 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764453.1 protein_id gnl|my_center|LOCUS_06900 25973 26950 gene locus_tag LOCUS_06910 25973 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 27057 36548 gene locus_tag LOCUS_06920 27057 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36545 37603 gene locus_tag LOCUS_06930 36545 37603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 38532 38924 gene locus_tag LOCUS_06940 38532 38924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence017 3128 480 gene locus_tag LOCUS_06950 3128 480 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108155.1 protein_id gnl|my_center|LOCUS_06950 4493 4879 gene locus_tag LOCUS_06960 4493 4879 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_06960 4941 6686 gene locus_tag LOCUS_06970 4941 6686 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_06970 6858 7619 gene locus_tag LOCUS_06980 gene nudC 6858 7619 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202441.1 protein_id gnl|my_center|LOCUS_06980 7700 9907 gene locus_tag LOCUS_06990 7700 9907 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_06990 9977 10807 gene locus_tag LOCUS_07000 9977 10807 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_07000 10826 11347 gene locus_tag LOCUS_07010 10826 11347 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_07010 11482 12063 gene locus_tag LOCUS_07020 11482 12063 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_07020 12138 12656 gene locus_tag LOCUS_07030 12138 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 13700 12786 gene locus_tag LOCUS_07040 13700 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 13874 14863 gene locus_tag LOCUS_07050 13874 14863 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760615.1 protein_id gnl|my_center|LOCUS_07050 14963 16174 gene locus_tag LOCUS_07060 14963 16174 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_07060 16196 16840 gene locus_tag LOCUS_07070 gene nth 16196 16840 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_07070 16910 18121 gene locus_tag LOCUS_07080 16910 18121 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_07080 19673 18582 gene locus_tag LOCUS_07090 19673 18582 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_07090 20914 19889 gene locus_tag LOCUS_07100 gene pheS 20914 19889 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_07100 21605 20967 gene locus_tag LOCUS_07110 21605 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 23320 21665 gene locus_tag LOCUS_07120 23320 21665 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_07120 24215 23367 gene locus_tag LOCUS_07130 gene nadC 24215 23367 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_07130 25180 24359 gene locus_tag LOCUS_07140 gene pyrF 25180 24359 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_07140 28043 25389 gene locus_tag LOCUS_07150 28043 25389 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202510.1 protein_id gnl|my_center|LOCUS_07150 31585 28214 gene locus_tag LOCUS_07160 gene secA 31585 28214 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_07160 33317 31698 gene locus_tag LOCUS_07170 33317 31698 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_07170 34560 33352 gene locus_tag LOCUS_07180 34560 33352 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_07180 35348 37063 gene locus_tag LOCUS_07190 gene asnB 35348 37063 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_07190 <38487 37717 gene locus_tag LOCUS_07200 <38487 37717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938772.1:DUF1848 domain-containing protein >Feature sequence018 419 979 gene locus_tag LOCUS_07210 gene frr 419 979 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_07210 984 1982 gene locus_tag LOCUS_07220 gene rsgA 984 1982 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_07220 2038 2499 gene locus_tag LOCUS_07230 2038 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2565 2987 gene locus_tag LOCUS_07240 gene mscL 2565 2987 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_07240 3099 3491 gene locus_tag LOCUS_07250 3099 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3481 3666 gene locus_tag LOCUS_07260 3481 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3875 4498 gene locus_tag LOCUS_07270 3875 4498 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_07270 5860 5285 gene locus_tag LOCUS_07280 5860 5285 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_07280 6285 6872 gene locus_tag LOCUS_07290 gene rplC 6285 6872 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_07290 6872 7501 gene locus_tag LOCUS_07300 gene rplD 6872 7501 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_07300 7519 7809 gene locus_tag LOCUS_07310 gene rplW 7519 7809 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_07310 7817 8641 gene locus_tag LOCUS_07320 gene rplB 7817 8641 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_07320 8668 8937 gene locus_tag LOCUS_07330 gene rpsS 8668 8937 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_07330 8978 9370 gene locus_tag LOCUS_07340 gene rplV 8978 9370 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_07340 9388 10119 gene locus_tag LOCUS_07350 gene rpsC 9388 10119 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_07350 10141 10566 gene locus_tag LOCUS_07360 gene rplP 10141 10566 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_07360 10569 10763 gene locus_tag LOCUS_07370 gene rpmC 10569 10763 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_07370 10830 11033 gene locus_tag LOCUS_07380 gene rpsQ 10830 11033 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_07380 11037 11402 gene locus_tag LOCUS_07390 gene rplN 11037 11402 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_07390 11428 11748 gene locus_tag LOCUS_07400 gene rplX 11428 11748 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_07400 11748 12305 gene locus_tag LOCUS_07410 gene rplE 11748 12305 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_07410 12327 12614 gene locus_tag LOCUS_07420 gene rpsN 12327 12614 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_07420 12696 13091 gene locus_tag LOCUS_07430 gene rpsH 12696 13091 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_07430 13109 13678 gene locus_tag LOCUS_07440 gene rplF 13109 13678 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_07440 13697 14041 gene locus_tag LOCUS_07450 gene rplR 13697 14041 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_07450 14047 14553 gene locus_tag LOCUS_07460 gene rpsE 14047 14553 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_07460 14560 14736 gene locus_tag LOCUS_07470 gene rpmD 14560 14736 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_07470 14762 15208 gene locus_tag LOCUS_07480 gene rplO 14762 15208 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_07480 15307 16560 gene locus_tag LOCUS_07490 gene secY 15307 16560 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_07490 16576 17370 gene locus_tag LOCUS_07500 gene map 16576 17370 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_07500 17376 17594 gene locus_tag LOCUS_07510 gene infA 17376 17594 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_07510 17767 18147 gene locus_tag LOCUS_07520 gene rpsM 17767 18147 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_07520 18157 18546 gene locus_tag LOCUS_07530 gene rpsK 18157 18546 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_07530 18590 19198 gene locus_tag LOCUS_07540 gene rpsD 18590 19198 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_07540 19219 20211 gene locus_tag LOCUS_07550 19219 20211 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_07550 20218 20697 gene locus_tag LOCUS_07560 20218 20697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 22033 21275 gene locus_tag LOCUS_07570 22033 21275 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_07570 24032 22065 gene locus_tag LOCUS_07580 24032 22065 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_07580 24739 24068 gene locus_tag LOCUS_07590 24739 24068 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_07590 26634 25939 gene locus_tag LOCUS_07600 26634 25939 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_07600 28545 26683 gene locus_tag LOCUS_07610 28545 26683 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_07610 28708 29997 gene locus_tag LOCUS_07620 28708 29997 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_07620 30043 30450 gene locus_tag LOCUS_07630 30043 30450 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_07630 30450 31544 gene locus_tag LOCUS_07640 gene dprA 30450 31544 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_07640 31673 33523 gene locus_tag LOCUS_07650 gene mnmG 31673 33523 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762875.1 protein_id gnl|my_center|LOCUS_07650 33866 35743 gene locus_tag LOCUS_07660 gene uvrC 33866 35743 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_07660 35800 36252 gene locus_tag LOCUS_07670 gene dtd 35800 36252 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_07670 36252 36644 gene locus_tag LOCUS_07680 36252 36644 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_07680 36637 37581 gene locus_tag LOCUS_07690 gene deoC 36637 37581 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence019 746 2182 gene locus_tag LOCUS_07700 746 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2769 3800 gene locus_tag LOCUS_07710 2769 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3836 5350 gene locus_tag LOCUS_07720 3836 5350 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176627.1 protein_id gnl|my_center|LOCUS_07720 7295 8020 gene locus_tag LOCUS_07730 7295 8020 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924814.1 protein_id gnl|my_center|LOCUS_07730 8013 9308 gene locus_tag LOCUS_07740 8013 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 9718 10356 gene locus_tag LOCUS_07750 9718 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10400 10927 gene locus_tag LOCUS_07760 10400 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 11038 12120 gene locus_tag LOCUS_07770 11038 12120 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_07770 12404 13102 gene locus_tag LOCUS_07780 12404 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 13192 14196 gene locus_tag LOCUS_07790 13192 14196 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_07790 14795 14256 gene locus_tag LOCUS_07800 14795 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 15122 14820 gene locus_tag LOCUS_07810 15122 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292646.1 protein_id gnl|my_center|LOCUS_07810 15307 15119 gene locus_tag LOCUS_07820 15307 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 15478 16071 gene locus_tag LOCUS_07830 15478 16071 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_07830 16390 17601 gene locus_tag LOCUS_07840 16390 17601 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_07840 17702 18781 gene locus_tag LOCUS_07850 17702 18781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 19333 21627 gene locus_tag LOCUS_07860 19333 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21998 21804 gene locus_tag LOCUS_07870 21998 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22320 23681 gene locus_tag LOCUS_07880 gene mtaB 22320 23681 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_07880 23735 24754 gene locus_tag LOCUS_07890 23735 24754 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_07890 24789 25493 gene locus_tag LOCUS_07900 24789 25493 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_07900 25683 25759 gene locus_tag LOCUS_t00180 25683 25759 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26095 26021 gene locus_tag LOCUS_t00190 26095 26021 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 26410 28029 gene locus_tag LOCUS_07910 26410 28029 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_07910 28168 28788 gene locus_tag LOCUS_07920 28168 28788 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_07920 28903 30069 gene locus_tag LOCUS_07930 gene dnaJ 28903 30069 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_07930 30245 31546 gene locus_tag LOCUS_07940 30245 31546 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_07940 31834 33993 gene locus_tag LOCUS_07950 31834 33993 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence020 629 850 gene locus_tag LOCUS_07960 629 850 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_07960 1885 1007 gene locus_tag LOCUS_07970 1885 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2848 1916 gene locus_tag LOCUS_07980 2848 1916 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_07980 3735 3577 gene locus_tag LOCUS_07990 3735 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4589 3831 gene locus_tag LOCUS_08000 4589 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7457 4668 gene locus_tag LOCUS_08010 7457 4668 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_08010 8015 7524 gene locus_tag LOCUS_08020 8015 7524 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_08020 8673 8029 gene locus_tag LOCUS_08030 8673 8029 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_08030 10087 8702 gene locus_tag LOCUS_08040 10087 8702 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_08040 10312 11244 gene locus_tag LOCUS_08050 10312 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 11289 12380 gene locus_tag LOCUS_08060 11289 12380 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_08060 12409 13416 gene locus_tag LOCUS_08070 12409 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13609 14586 gene locus_tag LOCUS_08080 13609 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 16133 14682 gene locus_tag LOCUS_08090 16133 14682 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061735.1 protein_id gnl|my_center|LOCUS_08090 17544 16192 gene locus_tag LOCUS_08100 17544 16192 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_08100 17803 18234 gene locus_tag LOCUS_08110 gene dut 17803 18234 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_08110 18486 20165 gene locus_tag LOCUS_08120 18486 20165 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_08120 20199 21062 gene locus_tag LOCUS_08130 20199 21062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 21193 22590 gene locus_tag LOCUS_08140 21193 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 22813 24150 gene locus_tag LOCUS_08150 22813 24150 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_08150 25272 24946 gene locus_tag LOCUS_08160 25272 24946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 26264 29212 gene locus_tag LOCUS_08170 gene uvrA 26264 29212 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_08170 29249 30451 gene locus_tag LOCUS_08180 gene ilvA 29249 30451 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_08180 30507 31397 gene locus_tag LOCUS_08190 30507 31397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_08190 31536 32522 gene locus_tag LOCUS_08200 31536 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 32641 32716 gene locus_tag LOCUS_t00200 32641 32716 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <34157 32759 gene locus_tag LOCUS_08210 <34157 32759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764222.1:AAA family ATPase >Feature sequence021 378 148 gene locus_tag LOCUS_08220 378 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08220 2018 1257 gene locus_tag LOCUS_08230 2018 1257 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_08230 2940 2116 gene locus_tag LOCUS_08240 gene tsf 2940 2116 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_08240 3921 3106 gene locus_tag LOCUS_08250 gene rpsB 3921 3106 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_08250 4552 4166 gene locus_tag LOCUS_08260 gene rpsI 4552 4166 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_08260 5023 4562 gene locus_tag LOCUS_08270 gene rplM 5023 4562 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_08270 5843 5259 gene locus_tag LOCUS_08280 5843 5259 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_08280 7097 5883 gene locus_tag LOCUS_08290 gene nspC 7097 5883 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_08290 8418 7180 gene locus_tag LOCUS_08300 8418 7180 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_08300 9421 8501 gene locus_tag LOCUS_08310 9421 8501 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_08310 10590 9571 gene locus_tag LOCUS_08320 gene serC 10590 9571 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_08320 11247 11173 gene locus_tag LOCUS_t00210 11247 11173 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11374 11301 gene locus_tag LOCUS_t00220 11374 11301 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12547 11609 gene locus_tag LOCUS_08330 12547 11609 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_08330 14696 12657 gene locus_tag LOCUS_08340 gene uvrB 14696 12657 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_08340 15411 14728 gene locus_tag LOCUS_08350 15411 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 16377 15469 gene locus_tag LOCUS_08360 gene metA 16377 15469 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_08360 18422 16470 gene locus_tag LOCUS_08370 18422 16470 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_08370 20058 18574 gene locus_tag LOCUS_08380 gene proS 20058 18574 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_08380 21230 20223 gene locus_tag LOCUS_08390 21230 20223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_08390 21523 21762 gene locus_tag LOCUS_08400 21523 21762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 22808 21918 gene locus_tag LOCUS_08410 22808 21918 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_08410 24134 22857 gene locus_tag LOCUS_08420 24134 22857 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_08420 24360 25826 gene locus_tag LOCUS_08430 24360 25826 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202945.1 protein_id gnl|my_center|LOCUS_08430 25902 26609 gene locus_tag LOCUS_08440 25902 26609 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_08440 28296 27013 gene locus_tag LOCUS_08450 28296 27013 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_08450 28544 29011 gene locus_tag LOCUS_08460 28544 29011 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_08460 29091 29759 gene locus_tag LOCUS_08470 29091 29759 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_08470 29900 31663 gene locus_tag LOCUS_08480 gene aspS 29900 31663 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_08480 31752 33692 gene locus_tag LOCUS_08490 31752 33692 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence022 <1 503 gene locus_tag LOCUS_08500 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791024.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 524 1324 gene locus_tag LOCUS_08510 524 1324 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_08510 2058 2504 gene locus_tag LOCUS_08520 2058 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2722 4080 gene locus_tag LOCUS_08530 2722 4080 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_08530 4732 4310 gene locus_tag LOCUS_08540 4732 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5650 4823 gene locus_tag LOCUS_08550 5650 4823 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_08550 7472 5832 gene locus_tag LOCUS_08560 7472 5832 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760603.1 protein_id gnl|my_center|LOCUS_08560 8488 10674 gene locus_tag LOCUS_08570 gene recQ 8488 10674 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_08570 10721 12415 gene locus_tag LOCUS_08580 10721 12415 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_08580 12546 13805 gene locus_tag LOCUS_08590 12546 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 16768 13853 gene locus_tag LOCUS_08600 16768 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 17978 16884 gene locus_tag LOCUS_08610 17978 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18709 17975 gene locus_tag LOCUS_08620 18709 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 19285 18743 gene locus_tag LOCUS_08630 gene rpoE 19285 18743 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_08630 21183 19900 gene locus_tag LOCUS_08640 21183 19900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_08640 25066 21212 gene locus_tag LOCUS_08650 25066 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 26345 25101 gene locus_tag LOCUS_08660 26345 25101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 27570 26338 gene locus_tag LOCUS_08670 gene cls 27570 26338 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_08670 28772 27819 gene locus_tag LOCUS_08680 28772 27819 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_08680 29565 28801 gene locus_tag LOCUS_08690 gene kdsA 29565 28801 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_08690 29808 30212 gene locus_tag LOCUS_08700 29808 30212 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_08700 30253 30675 gene locus_tag LOCUS_08710 30253 30675 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_08710 31962 30943 gene locus_tag LOCUS_08720 31962 30943 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_08720 32684 31983 gene locus_tag LOCUS_08730 32684 31983 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_08730 <33844 32864 gene locus_tag LOCUS_08740 <33844 32864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786511.1:class I mannose-6-phosphate isomerase >Feature sequence023 1095 532 gene locus_tag LOCUS_08750 1095 532 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_08750 1631 1227 gene locus_tag LOCUS_08760 1631 1227 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_08760 2163 1693 gene locus_tag LOCUS_08770 2163 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2387 2172 gene locus_tag LOCUS_08780 2387 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3868 2756 gene locus_tag LOCUS_08790 gene recF 3868 2756 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759932.1 protein_id gnl|my_center|LOCUS_08790 4148 5011 gene locus_tag LOCUS_08800 4148 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5145 5636 gene locus_tag LOCUS_08810 gene ribH 5145 5636 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_08810 5668 5751 gene locus_tag LOCUS_t00230 5668 5751 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5834 6640 gene locus_tag LOCUS_08820 gene thiD 5834 6640 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972916.1 protein_id gnl|my_center|LOCUS_08820 6722 7624 gene locus_tag LOCUS_08830 gene fabD 6722 7624 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_08830 7739 9412 gene locus_tag LOCUS_08840 7739 9412 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_08840 9547 10509 gene locus_tag LOCUS_08850 gene ftsY 9547 10509 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_08850 10634 11917 gene locus_tag LOCUS_08860 gene rimO 10634 11917 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_08860 11978 12256 gene locus_tag LOCUS_08870 11978 12256 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_08870 12304 13791 gene locus_tag LOCUS_08880 12304 13791 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202863.1 protein_id gnl|my_center|LOCUS_08880 14003 15181 gene locus_tag LOCUS_08890 14003 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 15198 17528 gene locus_tag LOCUS_08900 15198 17528 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_08900 17585 19525 gene locus_tag LOCUS_08910 17585 19525 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_08910 19649 20794 gene locus_tag LOCUS_08920 19649 20794 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_08920 20952 25376 gene locus_tag LOCUS_08930 20952 25376 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_08930 25539 25853 gene locus_tag LOCUS_08940 gene trxA 25539 25853 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_08940 25887 26222 gene locus_tag LOCUS_08950 25887 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 26336 26566 gene locus_tag LOCUS_08960 26336 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 26581 26883 gene locus_tag LOCUS_08970 26581 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 27081 28328 gene locus_tag LOCUS_08980 27081 28328 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_08980 28416 29288 gene locus_tag LOCUS_08990 28416 29288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 29288 31396 gene locus_tag LOCUS_09000 29288 31396 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence024 2239 4125 gene locus_tag LOCUS_09010 gene rho 2239 4125 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107884.1 protein_id gnl|my_center|LOCUS_09010 4306 5418 gene locus_tag LOCUS_09020 4306 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5437 5616 gene locus_tag LOCUS_09030 5437 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5755 6879 gene locus_tag LOCUS_09040 5755 6879 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_09040 7039 7563 gene locus_tag LOCUS_09050 7039 7563 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_09050 7588 8112 gene locus_tag LOCUS_09060 7588 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8379 8906 gene locus_tag LOCUS_09070 8379 8906 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_09070 8993 11491 gene locus_tag LOCUS_09080 8993 11491 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_09080 11569 12591 gene locus_tag LOCUS_09090 11569 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 12853 15141 gene locus_tag LOCUS_09100 12853 15141 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_09100 15174 15935 gene locus_tag LOCUS_09110 gene kdsB 15174 15935 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_09110 16122 17120 gene locus_tag LOCUS_09120 16122 17120 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765612.1 protein_id gnl|my_center|LOCUS_09120 17245 19296 gene locus_tag LOCUS_09130 17245 19296 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_09130 19897 21948 gene locus_tag LOCUS_09140 19897 21948 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_09140 21953 25282 gene locus_tag LOCUS_09150 21953 25282 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_09150 25348 28035 gene locus_tag LOCUS_09160 25348 28035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29090 28155 gene locus_tag LOCUS_09170 29090 28155 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_09170 29801 29196 gene locus_tag LOCUS_09180 29801 29196 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_09180 30170 30009 gene locus_tag LOCUS_09190 30170 30009 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763586.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence025 490 2253 gene locus_tag LOCUS_09200 490 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2603 2400 gene locus_tag LOCUS_09210 2603 2400 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_09210 2876 3814 gene locus_tag LOCUS_09220 2876 3814 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_09220 3849 4535 gene locus_tag LOCUS_09230 3849 4535 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794216.1 protein_id gnl|my_center|LOCUS_09230 4618 5436 gene locus_tag LOCUS_09240 gene panB 4618 5436 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_09240 5455 6153 gene locus_tag LOCUS_09250 5455 6153 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_09250 8851 6251 gene locus_tag LOCUS_09260 gene clpB 8851 6251 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_09260 9714 10823 gene locus_tag LOCUS_09270 9714 10823 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_09270 10890 12164 gene locus_tag LOCUS_09280 10890 12164 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_09280 12244 13404 gene locus_tag LOCUS_09290 gene galK 12244 13404 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_09290 13601 14161 gene locus_tag LOCUS_09300 13601 14161 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_09300 14145 15383 gene locus_tag LOCUS_09310 14145 15383 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_09310 15451 16176 gene locus_tag LOCUS_09320 gene tpiA 15451 16176 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_09320 16319 16885 gene locus_tag LOCUS_09330 16319 16885 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_09330 16943 17518 gene locus_tag LOCUS_09340 gene folE 16943 17518 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_09340 17605 19053 gene locus_tag LOCUS_09350 17605 19053 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_09350 19074 20981 gene locus_tag LOCUS_09360 19074 20981 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_09360 21031 22023 gene locus_tag LOCUS_09370 21031 22023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 22224 23015 gene locus_tag LOCUS_09380 gene nagB 22224 23015 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_09380 23175 24398 gene locus_tag LOCUS_09390 23175 24398 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_09390 25187 24486 gene locus_tag LOCUS_09400 25187 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 25929 25423 gene locus_tag LOCUS_09410 25929 25423 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_09410 26687 26055 gene locus_tag LOCUS_09420 26687 26055 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_09420 28486 26801 gene locus_tag LOCUS_09430 gene ettA 28486 26801 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_09430 30304 28712 gene locus_tag LOCUS_09440 30304 28712 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence026 1403 522 gene locus_tag LOCUS_09450 1403 522 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_09450 2237 1470 gene locus_tag LOCUS_09460 2237 1470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791872.1 protein_id gnl|my_center|LOCUS_09460 2980 2234 gene locus_tag LOCUS_09470 2980 2234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_09470 3171 3085 gene locus_tag LOCUS_t00240 3171 3085 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4837 3299 gene locus_tag LOCUS_09480 4837 3299 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_09480 5538 4948 gene locus_tag LOCUS_09490 gene leuD 5538 4948 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_09490 6956 5580 gene locus_tag LOCUS_09500 gene leuC 6956 5580 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_09500 7321 7034 gene locus_tag LOCUS_09510 7321 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8857 7337 gene locus_tag LOCUS_09520 8857 7337 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_09520 10689 9865 gene locus_tag LOCUS_09530 10689 9865 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_09530 11618 10686 gene locus_tag LOCUS_09540 11618 10686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_09540 12675 11635 gene locus_tag LOCUS_09550 12675 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 13883 12741 gene locus_tag LOCUS_09560 13883 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 14620 13979 gene locus_tag LOCUS_09570 14620 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 16181 14685 gene locus_tag LOCUS_09580 16181 14685 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_09580 18135 16426 gene locus_tag LOCUS_09590 18135 16426 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_09590 19221 18199 gene locus_tag LOCUS_09600 19221 18199 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_09600 20120 19245 gene locus_tag LOCUS_09610 20120 19245 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_09610 20743 21612 gene locus_tag LOCUS_09620 20743 21612 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_09620 21636 22244 gene locus_tag LOCUS_09630 21636 22244 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763544.1 protein_id gnl|my_center|LOCUS_09630 22257 22871 gene locus_tag LOCUS_09640 22257 22871 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_09640 22898 23746 gene locus_tag LOCUS_09650 22898 23746 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_09650 23907 24710 gene locus_tag LOCUS_09660 23907 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 25133 26599 gene locus_tag LOCUS_09670 25133 26599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 27059 29056 gene locus_tag LOCUS_09680 27059 29056 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence027 324 1700 gene locus_tag LOCUS_09690 324 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1816 2472 gene locus_tag LOCUS_09700 1816 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2506 3252 gene locus_tag LOCUS_09710 2506 3252 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_09710 3252 6002 gene locus_tag LOCUS_09720 3252 6002 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_09720 6021 6539 gene locus_tag LOCUS_09730 6021 6539 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_09730 6729 7295 gene locus_tag LOCUS_09740 6729 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7542 8822 gene locus_tag LOCUS_09750 7542 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8897 9625 gene locus_tag LOCUS_09760 8897 9625 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_09760 9872 9798 gene locus_tag LOCUS_t00250 9872 9798 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9984 9910 gene locus_tag LOCUS_t00260 9984 9910 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10098 11057 gene locus_tag LOCUS_09770 10098 11057 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_09770 11099 12799 gene locus_tag LOCUS_09780 11099 12799 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_09780 12830 13828 gene locus_tag LOCUS_09790 gene queG 12830 13828 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_09790 15314 14817 gene locus_tag LOCUS_09800 15314 14817 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_09800 15457 15314 gene locus_tag LOCUS_09810 15457 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 16639 15518 gene locus_tag LOCUS_09820 gene prfB 16639 15518 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_09820 18547 16694 gene locus_tag LOCUS_09830 18547 16694 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_09830 18711 19787 gene locus_tag LOCUS_09840 18711 19787 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_09840 21162 19957 gene locus_tag LOCUS_09850 21162 19957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_09850 21925 21338 gene locus_tag LOCUS_09860 21925 21338 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_09860 23147 21942 gene locus_tag LOCUS_09870 23147 21942 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_09870 24549 23194 gene locus_tag LOCUS_09880 gene sufD 24549 23194 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_09880 25329 24556 gene locus_tag LOCUS_09890 gene sufC 25329 24556 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_09890 25764 26264 gene locus_tag LOCUS_09900 25764 26264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 26311 28992 gene locus_tag LOCUS_09910 26311 28992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 29038 29226 gene locus_tag LOCUS_09920 29038 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence028 136 741 gene locus_tag LOCUS_09930 136 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 954 1139 gene locus_tag LOCUS_09940 954 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2477 4357 gene locus_tag LOCUS_09950 2477 4357 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_09950 4602 5678 gene locus_tag LOCUS_09960 gene carA 4602 5678 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_09960 5848 9039 gene locus_tag LOCUS_09970 gene carB 5848 9039 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_09970 9261 9830 gene locus_tag LOCUS_09980 9261 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9905 10870 gene locus_tag LOCUS_09990 9905 10870 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_09990 10922 11404 gene locus_tag LOCUS_10000 10922 11404 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109333.1 protein_id gnl|my_center|LOCUS_10000 11406 12128 gene locus_tag LOCUS_10010 11406 12128 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_10010 12230 13237 gene locus_tag LOCUS_10020 12230 13237 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_10020 13284 13955 gene locus_tag LOCUS_10030 13284 13955 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_10030 14918 16975 gene locus_tag LOCUS_10040 gene htpG 14918 16975 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_10040 17252 18094 gene locus_tag LOCUS_10050 17252 18094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 18273 18348 gene locus_tag LOCUS_t00270 18273 18348 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18696 19799 gene locus_tag LOCUS_10060 gene nhaD 18696 19799 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_10060 19910 20833 gene locus_tag LOCUS_10070 gene pfkA 19910 20833 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_10070 20918 22456 gene locus_tag LOCUS_10080 gene atpD 20918 22456 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_10080 22483 22740 gene locus_tag LOCUS_10090 22483 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 22737 23156 gene locus_tag LOCUS_10100 22737 23156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 23149 24219 gene locus_tag LOCUS_10110 gene atpB 23149 24219 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_10110 24277 24579 gene locus_tag LOCUS_10120 24277 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 24776 25273 gene locus_tag LOCUS_10130 gene atpF 24776 25273 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_10130 25350 25889 gene locus_tag LOCUS_10140 25350 25889 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768717.1 protein_id gnl|my_center|LOCUS_10140 25968 27554 gene locus_tag LOCUS_10150 gene atpA 25968 27554 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_10150 27591 28454 gene locus_tag LOCUS_10160 27591 28454 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence029 2342 2824 gene locus_tag LOCUS_10170 2342 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2969 3160 gene locus_tag LOCUS_10180 gene rpmF 2969 3160 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_10180 3327 4409 gene locus_tag LOCUS_10190 3327 4409 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_10190 4534 5421 gene locus_tag LOCUS_10200 gene era 4534 5421 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_10200 5480 6796 gene locus_tag LOCUS_10210 gene der 5480 6796 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_10210 6793 7263 gene locus_tag LOCUS_10220 6793 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7296 8651 gene locus_tag LOCUS_10230 7296 8651 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_10230 8761 9927 gene locus_tag LOCUS_10240 8761 9927 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_10240 9936 10640 gene locus_tag LOCUS_10250 9936 10640 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_10250 10637 11251 gene locus_tag LOCUS_10260 10637 11251 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_10260 11291 11917 gene locus_tag LOCUS_10270 gene nqrE 11291 11917 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_10270 11949 13223 gene locus_tag LOCUS_10280 gene nqrF 11949 13223 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_10280 13478 14053 gene locus_tag LOCUS_10290 13478 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14151 14705 gene locus_tag LOCUS_10300 14151 14705 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_10300 14710 15090 gene locus_tag LOCUS_10310 14710 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 15152 15619 gene locus_tag LOCUS_10320 15152 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 16515 15793 gene locus_tag LOCUS_10330 16515 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 17018 16662 gene locus_tag LOCUS_10340 17018 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 17674 18417 gene locus_tag LOCUS_10350 17674 18417 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_10350 18510 20036 gene locus_tag LOCUS_10360 18510 20036 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_10360 20073 22466 gene locus_tag LOCUS_10370 20073 22466 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_10370 22540 24642 gene locus_tag LOCUS_10380 22540 24642 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_10380 24709 25488 gene locus_tag LOCUS_10390 24709 25488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 25637 27724 gene locus_tag LOCUS_10400 25637 27724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 27802 28101 gene locus_tag LOCUS_10410 27802 28101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence030 777 1070 gene locus_tag LOCUS_10420 777 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4015 1541 gene locus_tag LOCUS_10430 4015 1541 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_10430 4466 4296 gene locus_tag LOCUS_10440 4466 4296 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_10440 6291 4675 gene locus_tag LOCUS_10450 6291 4675 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_10450 7010 6351 gene locus_tag LOCUS_10460 7010 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7683 7024 gene locus_tag LOCUS_10470 7683 7024 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_10470 9217 7760 gene locus_tag LOCUS_10480 9217 7760 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_10480 10605 9262 gene locus_tag LOCUS_10490 gene trkA 10605 9262 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_10490 12634 10664 gene locus_tag LOCUS_10500 gene dxs 12634 10664 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_10500 13338 13646 gene locus_tag LOCUS_10510 13338 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13639 14748 gene locus_tag LOCUS_10520 13639 14748 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_10520 15655 14816 gene locus_tag LOCUS_10530 15655 14816 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_10530 16415 15657 gene locus_tag LOCUS_10540 16415 15657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_10540 16516 18597 gene locus_tag LOCUS_10550 16516 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 18804 19271 gene locus_tag LOCUS_10560 gene rimP 18804 19271 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767604.1 protein_id gnl|my_center|LOCUS_10560 19293 20573 gene locus_tag LOCUS_10570 gene nusA 19293 20573 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_10570 20738 23731 gene locus_tag LOCUS_10580 gene infB 20738 23731 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_10580 23888 24448 gene locus_tag LOCUS_10590 23888 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 24432 25901 gene locus_tag LOCUS_10600 gene sufB 24432 25901 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_10600 25948 26913 gene locus_tag LOCUS_10610 25948 26913 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_10610 27518 26997 gene locus_tag LOCUS_10620 27518 26997 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_10620 27697 27609 gene locus_tag LOCUS_t00280 27697 27609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 908 231 gene locus_tag LOCUS_10630 gene trmD 908 231 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_10630 982 3084 gene locus_tag LOCUS_10640 gene ligA 982 3084 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_10640 3651 4829 gene locus_tag LOCUS_10650 3651 4829 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_10650 4901 6010 gene locus_tag LOCUS_10660 gene prfA 4901 6010 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_10660 6081 6968 gene locus_tag LOCUS_10670 gene dapA 6081 6968 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_10670 6986 7615 gene locus_tag LOCUS_10680 6986 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8060 7761 gene locus_tag LOCUS_10690 8060 7761 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789142.1 protein_id gnl|my_center|LOCUS_10690 8191 9294 gene locus_tag LOCUS_10700 8191 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10191 9493 gene locus_tag LOCUS_10710 10191 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 11810 10323 gene locus_tag LOCUS_10720 gene rny 11810 10323 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_10720 12305 11988 gene locus_tag LOCUS_10730 12305 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12685 12392 gene locus_tag LOCUS_10740 12685 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_10740 13437 12793 gene locus_tag LOCUS_10750 13437 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_10750 13822 15051 gene locus_tag LOCUS_10760 13822 15051 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_10760 15346 15419 gene locus_tag LOCUS_t00290 15346 15419 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15479 15552 gene locus_tag LOCUS_t00300 15479 15552 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16065 15694 gene locus_tag LOCUS_10770 16065 15694 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316392.1 protein_id gnl|my_center|LOCUS_10770 16563 16180 gene locus_tag LOCUS_10780 16563 16180 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_10780 17997 16912 gene locus_tag LOCUS_10790 17997 16912 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_10790 19533 18004 gene locus_tag LOCUS_10800 19533 18004 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_10800 20023 19607 gene locus_tag LOCUS_10810 20023 19607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_10810 22062 20098 gene locus_tag LOCUS_10820 22062 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 22970 22098 gene locus_tag LOCUS_10830 gene rfbA 22970 22098 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_10830 24379 23030 gene locus_tag LOCUS_10840 24379 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067457.1 protein_id gnl|my_center|LOCUS_10840 25000 26442 gene locus_tag LOCUS_10850 25000 26442 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_10850 26504 26962 gene locus_tag LOCUS_10860 gene bcp 26504 26962 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence032 252 821 gene locus_tag LOCUS_10870 252 821 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_10870 867 1643 gene locus_tag LOCUS_10880 867 1643 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922437.1 protein_id gnl|my_center|LOCUS_10880 2595 1750 gene locus_tag LOCUS_10890 2595 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3900 2602 gene locus_tag LOCUS_10900 3900 2602 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_10900 4720 3977 gene locus_tag LOCUS_10910 4720 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4937 6535 gene locus_tag LOCUS_10920 4937 6535 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_10920 6567 9935 gene locus_tag LOCUS_10930 6567 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10221 10589 gene locus_tag LOCUS_10940 10221 10589 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791717.1 protein_id gnl|my_center|LOCUS_10940 10611 11810 gene locus_tag LOCUS_10950 10611 11810 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_10950 12099 12461 gene locus_tag LOCUS_10960 12099 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 12461 12709 gene locus_tag LOCUS_10970 12461 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963931.1 protein_id gnl|my_center|LOCUS_10970 13628 13170 gene locus_tag LOCUS_10980 13628 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 14018 13650 gene locus_tag LOCUS_10990 14018 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 15355 14789 gene locus_tag LOCUS_11000 15355 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 15699 15502 gene locus_tag LOCUS_11010 15699 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 17033 15822 gene locus_tag LOCUS_11020 17033 15822 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_11020 17811 17305 gene locus_tag LOCUS_11030 17811 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 17886 20801 gene locus_tag LOCUS_11040 17886 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 21206 22744 gene locus_tag LOCUS_11050 21206 22744 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785070.1 protein_id gnl|my_center|LOCUS_11050 23244 24503 gene locus_tag LOCUS_11060 23244 24503 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_11060 24993 25553 gene locus_tag LOCUS_11070 24993 25553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence033 318 698 gene locus_tag LOCUS_11080 318 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2768 1701 gene locus_tag LOCUS_11090 2768 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3230 3421 gene locus_tag LOCUS_11100 gene rpsU 3230 3421 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_11100 3543 4502 gene locus_tag LOCUS_11110 gene xerC 3543 4502 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_11110 4759 5055 gene locus_tag LOCUS_11120 gene raiA 4759 5055 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_11120 5168 5253 gene locus_tag LOCUS_t00310 5168 5253 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5274 5347 gene locus_tag LOCUS_t00320 5274 5347 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5367 5439 gene locus_tag LOCUS_t00330 5367 5439 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5484 6671 gene locus_tag LOCUS_11130 gene tuf 5484 6671 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_11130 6740 6813 gene locus_tag LOCUS_t00340 6740 6813 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6828 7019 gene locus_tag LOCUS_11140 6828 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7038 7580 gene locus_tag LOCUS_11150 gene nusG 7038 7580 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_11150 7743 8075 gene locus_tag LOCUS_11160 7743 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 8103 8801 gene locus_tag LOCUS_11170 gene rplA 8103 8801 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_11170 8814 9332 gene locus_tag LOCUS_11180 gene rplJ 8814 9332 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_11180 9386 9760 gene locus_tag LOCUS_11190 gene rplL 9386 9760 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_11190 10033 13845 gene locus_tag LOCUS_11200 gene rpoB 10033 13845 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_11200 13886 18154 gene locus_tag LOCUS_11210 gene rpoC 13886 18154 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_11210 19183 22533 gene locus_tag LOCUS_11220 19183 22533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 22649 22858 gene locus_tag LOCUS_11230 22649 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence034 1923 667 gene locus_tag LOCUS_11240 gene clpX 1923 667 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_11240 2610 1936 gene locus_tag LOCUS_11250 gene clpP 2610 1936 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_11250 4097 2739 gene locus_tag LOCUS_11260 gene tig 4097 2739 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_11260 5012 4293 gene locus_tag LOCUS_11270 5012 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5702 5025 gene locus_tag LOCUS_11280 5702 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6359 5889 gene locus_tag LOCUS_11290 gene cdd 6359 5889 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_11290 7607 6453 gene locus_tag LOCUS_11300 gene nagA 7607 6453 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_11300 8684 7767 gene locus_tag LOCUS_11310 8684 7767 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025876514.1 protein_id gnl|my_center|LOCUS_11310 9792 8746 gene locus_tag LOCUS_11320 9792 8746 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_11320 10772 10044 gene locus_tag LOCUS_11330 10772 10044 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_11330 13293 10831 gene locus_tag LOCUS_11340 gene pheT 13293 10831 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_11340 14150 15841 gene locus_tag LOCUS_11350 14150 15841 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_11350 15945 18578 gene locus_tag LOCUS_11360 15945 18578 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_11360 19189 18980 gene locus_tag LOCUS_11370 19189 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 19776 19348 gene locus_tag LOCUS_11380 19776 19348 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_11380 20046 21944 gene locus_tag LOCUS_11390 20046 21944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence035 377 970 gene locus_tag LOCUS_11400 377 970 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_11400 1241 1408 gene locus_tag LOCUS_11410 1241 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3501 1687 gene locus_tag LOCUS_11420 3501 1687 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_11420 5117 3507 gene locus_tag LOCUS_11430 5117 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5364 6389 gene locus_tag LOCUS_11440 gene tdh 5364 6389 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_11440 6594 7676 gene locus_tag LOCUS_11450 6594 7676 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_11450 7821 8834 gene locus_tag LOCUS_11460 gene pta 7821 8834 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_11460 8916 10112 gene locus_tag LOCUS_11470 8916 10112 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_11470 10291 11640 gene locus_tag LOCUS_11480 10291 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 12143 15514 gene locus_tag LOCUS_11490 12143 15514 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_11490 15551 17227 gene locus_tag LOCUS_11500 15551 17227 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_11500 17286 18347 gene locus_tag LOCUS_11510 17286 18347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 18445 19542 gene locus_tag LOCUS_11520 18445 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 19627 21114 gene locus_tag LOCUS_11530 19627 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 21272 21345 gene locus_tag LOCUS_t00350 21272 21345 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22155 21835 gene locus_tag LOCUS_11540 22155 21835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 22555 22172 gene locus_tag LOCUS_11550 22555 22172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 >Feature sequence036 372 740 gene locus_tag LOCUS_11560 gene rplS 372 740 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_11560 874 1971 gene locus_tag LOCUS_11570 gene trpS 874 1971 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_11570 2143 2301 gene locus_tag LOCUS_11580 gene rpmH 2143 2301 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_11580 3268 2495 gene locus_tag LOCUS_11590 3268 2495 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_11590 4434 3364 gene locus_tag LOCUS_11600 4434 3364 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_11600 5706 4525 gene locus_tag LOCUS_11610 5706 4525 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_11610 6520 5693 gene locus_tag LOCUS_11620 6520 5693 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_11620 8037 6775 gene locus_tag LOCUS_11630 8037 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9138 8089 gene locus_tag LOCUS_11640 gene aroB 9138 8089 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_11640 9720 9247 gene locus_tag LOCUS_11650 9720 9247 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_11650 10106 9717 gene locus_tag LOCUS_11660 10106 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11004 10126 gene locus_tag LOCUS_11670 11004 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_11670 12250 11228 gene locus_tag LOCUS_11680 12250 11228 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_11680 13479 12541 gene locus_tag LOCUS_11690 13479 12541 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_11690 14536 13532 gene locus_tag LOCUS_11700 14536 13532 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_11700 14768 15568 gene locus_tag LOCUS_11710 14768 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 17559 16444 gene locus_tag LOCUS_11720 17559 16444 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_11720 18590 17694 gene locus_tag LOCUS_11730 18590 17694 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_11730 18730 19668 gene locus_tag LOCUS_11740 18730 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 19871 21424 gene locus_tag LOCUS_11750 19871 21424 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_11750 21439 21708 gene locus_tag LOCUS_11760 21439 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence037 1911 1525 gene locus_tag LOCUS_11770 gene tnpA 1911 1525 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_11770 2809 5592 gene locus_tag LOCUS_11780 2809 5592 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_11780 5626 7197 gene locus_tag LOCUS_11790 5626 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8144 7311 gene locus_tag LOCUS_11800 8144 7311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_11800 9190 8150 gene locus_tag LOCUS_11810 9190 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9871 9206 gene locus_tag LOCUS_11820 9871 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 10913 9939 gene locus_tag LOCUS_11830 gene miaA 10913 9939 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_11830 12057 11047 gene locus_tag LOCUS_11840 gene gap 12057 11047 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_11840 12899 12285 gene locus_tag LOCUS_11850 12899 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 13180 12977 gene locus_tag LOCUS_11860 13180 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 13191 14744 gene locus_tag LOCUS_11870 gene guaA 13191 14744 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_11870 14872 15240 gene locus_tag LOCUS_11880 14872 15240 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_11880 15237 16019 gene locus_tag LOCUS_11890 15237 16019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_11890 16228 18579 gene locus_tag LOCUS_11900 16228 18579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 19103 19930 gene locus_tag LOCUS_11910 19103 19930 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_11910 19975 20955 gene locus_tag LOCUS_11920 19975 20955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_11920 20964 21347 gene locus_tag LOCUS_11930 20964 21347 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence038 7616 231 gene locus_tag LOCUS_11940 gene sprA 7616 231 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_11940 8336 7731 gene locus_tag LOCUS_11950 gene ruvA 8336 7731 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_11950 10028 8466 gene locus_tag LOCUS_11960 gene dnaB 10028 8466 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_11960 11583 10099 gene locus_tag LOCUS_11970 11583 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_11970 13035 11659 gene locus_tag LOCUS_11980 gene rseP 13035 11659 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_11980 14280 13126 gene locus_tag LOCUS_11990 14280 13126 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_11990 14832 14305 gene locus_tag LOCUS_12000 gene rimM 14832 14305 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_12000 16139 14829 gene locus_tag LOCUS_12010 gene murA 16139 14829 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_12010 16811 16209 gene locus_tag LOCUS_12020 16811 16209 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_12020 17529 16879 gene locus_tag LOCUS_12030 gene tsaB 17529 16879 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_12030 18463 17786 gene locus_tag LOCUS_12040 gene mtgA 18463 17786 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_12040 18977 18552 gene locus_tag LOCUS_12050 18977 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 19234 20364 gene locus_tag LOCUS_12060 gene hemW 19234 20364 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence039 183 3023 gene locus_tag LOCUS_12070 gene leuS 183 3023 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203753.1 protein_id gnl|my_center|LOCUS_12070 3045 4043 gene locus_tag LOCUS_12080 3045 4043 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_12080 4196 6910 gene locus_tag LOCUS_12090 gene mutS 4196 6910 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_12090 8045 7035 gene locus_tag LOCUS_12100 8045 7035 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_12100 8373 8455 gene locus_tag LOCUS_t00360 8373 8455 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8652 10010 gene locus_tag LOCUS_12110 8652 10010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_12110 10145 10219 gene locus_tag LOCUS_t00370 10145 10219 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12303 10849 gene locus_tag LOCUS_12120 12303 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 12659 12267 gene locus_tag LOCUS_12130 12659 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14377 12800 gene locus_tag LOCUS_12140 14377 12800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_12140 15498 16766 gene locus_tag LOCUS_12150 15498 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 16763 17167 gene locus_tag LOCUS_12160 gene mutT 16763 17167 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_12160 20354 17961 gene locus_tag LOCUS_12170 20354 17961 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence040 879 160 gene locus_tag LOCUS_12180 gene truB 879 160 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_12180 1731 892 gene locus_tag LOCUS_12190 1731 892 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_12190 2105 1776 gene locus_tag LOCUS_12200 2105 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3038 2163 gene locus_tag LOCUS_12210 3038 2163 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_12210 3324 4424 gene locus_tag LOCUS_12220 3324 4424 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202097.1 protein_id gnl|my_center|LOCUS_12220 5305 4508 gene locus_tag LOCUS_12230 gene trmB 5305 4508 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_12230 5483 5292 gene locus_tag LOCUS_12240 5483 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6794 5505 gene locus_tag LOCUS_12250 gene xseA 6794 5505 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_12250 8319 6844 gene locus_tag LOCUS_12260 8319 6844 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_12260 8482 11409 gene locus_tag LOCUS_12270 8482 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 12729 12397 gene locus_tag LOCUS_12280 12729 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13076 12735 gene locus_tag LOCUS_12290 13076 12735 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_12290 13481 17554 gene locus_tag LOCUS_12300 13481 17554 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_12300 17649 19157 gene locus_tag LOCUS_12310 17649 19157 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence041 1904 492 gene locus_tag LOCUS_12320 gene mnmE 1904 492 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_12320 3573 2047 gene locus_tag LOCUS_12330 3573 2047 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_12330 4392 3745 gene locus_tag LOCUS_12340 4392 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5981 4578 gene locus_tag LOCUS_12350 gene uxaC 5981 4578 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_12350 7478 6054 gene locus_tag LOCUS_12360 7478 6054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_12360 8146 7475 gene locus_tag LOCUS_12370 8146 7475 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_12370 9233 8208 gene locus_tag LOCUS_12380 9233 8208 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_12380 10450 9275 gene locus_tag LOCUS_12390 gene uxuA 10450 9275 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_12390 11339 10530 gene locus_tag LOCUS_12400 11339 10530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_12400 12368 11607 gene locus_tag LOCUS_12410 12368 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 13159 12401 gene locus_tag LOCUS_12420 13159 12401 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_12420 15813 13378 gene locus_tag LOCUS_12430 15813 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 16140 17312 gene locus_tag LOCUS_12440 16140 17312 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_12440 19393 18137 gene locus_tag LOCUS_12450 19393 18137 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761527.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence042 543 181 gene locus_tag LOCUS_12460 543 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707215.1 protein_id gnl|my_center|LOCUS_12460 1968 697 gene locus_tag LOCUS_12470 1968 697 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_12470 3413 1965 gene locus_tag LOCUS_12480 3413 1965 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_12480 4700 3468 gene locus_tag LOCUS_12490 4700 3468 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_12490 5750 4710 gene locus_tag LOCUS_12500 5750 4710 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_12500 7308 5794 gene locus_tag LOCUS_12510 7308 5794 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_12510 9960 7441 gene locus_tag LOCUS_12520 9960 7441 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_12520 10503 10111 gene locus_tag LOCUS_12530 10503 10111 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_12530 11037 10570 gene locus_tag LOCUS_12540 gene greA 11037 10570 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_12540 12579 11392 gene locus_tag LOCUS_12550 gene kbl 12579 11392 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_12550 14559 13957 gene locus_tag LOCUS_12560 14559 13957 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_12560 14855 14613 gene locus_tag LOCUS_12570 gene yidD 14855 14613 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_12570 15346 14852 gene locus_tag LOCUS_12580 15346 14852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 16258 15512 gene locus_tag LOCUS_12590 16258 15512 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_12590 17204 16266 gene locus_tag LOCUS_12600 17204 16266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 17871 17296 gene locus_tag LOCUS_12610 17871 17296 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_12610 19218 17929 gene locus_tag LOCUS_12620 gene metK 19218 17929 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence043 64 249 gene locus_tag LOCUS_12630 64 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 937 386 gene locus_tag LOCUS_12640 gene yfcE 937 386 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977007.1 protein_id gnl|my_center|LOCUS_12640 2107 944 gene locus_tag LOCUS_12650 gene lysA 2107 944 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_12650 3605 2331 gene locus_tag LOCUS_12660 3605 2331 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_12660 4457 3702 gene locus_tag LOCUS_12670 4457 3702 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_12670 6312 4531 gene locus_tag LOCUS_12680 gene lepA 6312 4531 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_12680 6981 6427 gene locus_tag LOCUS_12690 gene rfbC 6981 6427 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_12690 9593 7080 gene locus_tag LOCUS_12700 9593 7080 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_12700 11520 9673 gene locus_tag LOCUS_12710 11520 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 14155 11597 gene locus_tag LOCUS_12720 14155 11597 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_12720 15113 14253 gene locus_tag LOCUS_12730 15113 14253 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_12730 15456 15716 gene locus_tag LOCUS_12740 15456 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 18088 15812 gene locus_tag LOCUS_12750 18088 15812 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence044 1184 660 gene locus_tag LOCUS_12760 1184 660 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_12760 3017 1269 gene locus_tag LOCUS_12770 3017 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3980 3081 gene locus_tag LOCUS_12780 3980 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4907 4026 gene locus_tag LOCUS_12790 4907 4026 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_12790 5830 4949 gene locus_tag LOCUS_12800 5830 4949 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767582.1 protein_id gnl|my_center|LOCUS_12800 6443 5940 gene locus_tag LOCUS_12810 6443 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 6522 6713 gene locus_tag LOCUS_12820 6522 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 7306 6662 gene locus_tag LOCUS_12830 7306 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7672 11094 gene locus_tag LOCUS_12840 gene mfd 7672 11094 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_12840 11190 11654 gene locus_tag LOCUS_12850 11190 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_12850 11785 12978 gene locus_tag LOCUS_12860 11785 12978 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_12860 13014 13754 gene locus_tag LOCUS_12870 13014 13754 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_12870 13872 16427 gene locus_tag LOCUS_12880 13872 16427 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_12880 16625 17092 gene locus_tag LOCUS_12890 gene ndk 16625 17092 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760845.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence045 3972 424 gene locus_tag LOCUS_12900 gene nifJ 3972 424 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_12900 4748 4443 gene locus_tag LOCUS_12910 gene rpsJ 4748 4443 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_12910 6962 4842 gene locus_tag LOCUS_12920 gene fusA 6962 4842 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_12920 7473 6997 gene locus_tag LOCUS_12930 gene rpsG 7473 6997 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762032.1 protein_id gnl|my_center|LOCUS_12930 7822 7583 gene locus_tag LOCUS_12940 7822 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8863 8450 gene locus_tag LOCUS_12950 8863 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9507 8860 gene locus_tag LOCUS_12960 9507 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10349 9504 gene locus_tag LOCUS_12970 10349 9504 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_12970 10902 10447 gene locus_tag LOCUS_12980 10902 10447 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108716.1 protein_id gnl|my_center|LOCUS_12980 11824 10886 gene locus_tag LOCUS_12990 11824 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 13227 11962 gene locus_tag LOCUS_13000 gene purD 13227 11962 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796998.1 protein_id gnl|my_center|LOCUS_13000 16923 13393 gene locus_tag LOCUS_13010 16923 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence046 2104 563 gene locus_tag LOCUS_13020 2104 563 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_13020 2232 2411 gene locus_tag LOCUS_13030 2232 2411 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_13030 2473 2907 gene locus_tag LOCUS_13040 2473 2907 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202006.1 protein_id gnl|my_center|LOCUS_13040 2974 3813 gene locus_tag LOCUS_13050 2974 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3858 4409 gene locus_tag LOCUS_13060 3858 4409 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_13060 4520 5371 gene locus_tag LOCUS_13070 gene hisG 4520 5371 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_13070 5390 6664 gene locus_tag LOCUS_13080 gene hisD 5390 6664 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_13080 6733 7782 gene locus_tag LOCUS_13090 gene hisC 6733 7782 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_13090 7818 8996 gene locus_tag LOCUS_13100 gene hisB 7818 8996 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_13100 9056 9640 gene locus_tag LOCUS_13110 gene hisH 9056 9640 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_13110 9662 10402 gene locus_tag LOCUS_13120 gene hisA 9662 10402 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_13120 10435 11193 gene locus_tag LOCUS_13130 gene hisF 10435 11193 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_13130 11243 11842 gene locus_tag LOCUS_13140 gene hisIE 11243 11842 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_13140 13411 11954 gene locus_tag LOCUS_13150 13411 11954 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_13150 14563 13469 gene locus_tag LOCUS_13160 14563 13469 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_13160 14691 15506 gene locus_tag LOCUS_13170 gene rsmA 14691 15506 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_13170 15562 17004 gene locus_tag LOCUS_13180 15562 17004 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203233.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence047 4590 526 gene locus_tag LOCUS_13190 4590 526 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143257291.1 protein_id gnl|my_center|LOCUS_13190 8868 4834 gene locus_tag LOCUS_13200 8868 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 9953 9063 gene locus_tag LOCUS_13210 9953 9063 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_13210 10615 9950 gene locus_tag LOCUS_13220 10615 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 11565 10645 gene locus_tag LOCUS_13230 gene prmA 11565 10645 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766150.1 protein_id gnl|my_center|LOCUS_13230 13050 11635 gene locus_tag LOCUS_13240 13050 11635 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_13240 13300 15054 gene locus_tag LOCUS_13250 13300 15054 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_13250 15173 16627 gene locus_tag LOCUS_13260 15173 16627 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence048 927 1784 gene locus_tag LOCUS_13270 gene folP 927 1784 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_13270 1806 2576 gene locus_tag LOCUS_13280 gene cdaA 1806 2576 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_13280 2830 2756 gene locus_tag LOCUS_t00380 2830 2756 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2926 2838 gene locus_tag LOCUS_t00390 2926 2838 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4069 3047 gene locus_tag LOCUS_13290 4069 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5205 4165 gene locus_tag LOCUS_13300 5205 4165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202020.1 protein_id gnl|my_center|LOCUS_13300 6145 5222 gene locus_tag LOCUS_13310 6145 5222 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_13310 6840 6187 gene locus_tag LOCUS_13320 6840 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8032 6878 gene locus_tag LOCUS_13330 8032 6878 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_13330 9121 8132 gene locus_tag LOCUS_13340 9121 8132 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_13340 10508 9342 gene locus_tag LOCUS_13350 10508 9342 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_13350 11152 10508 gene locus_tag LOCUS_13360 11152 10508 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_13360 11508 11909 gene locus_tag LOCUS_13370 11508 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 11884 12294 gene locus_tag LOCUS_13380 11884 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 12330 14471 gene locus_tag LOCUS_13390 12330 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 14578 16701 gene locus_tag LOCUS_13400 14578 16701 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence049 553 654 gene locus_tag LOCUS_r00010 553 654 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 938 660 gene locus_tag LOCUS_13410 938 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2754 1117 gene locus_tag LOCUS_13420 2754 1117 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_13420 3426 2794 gene locus_tag LOCUS_13430 gene pyrE 3426 2794 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_13430 4226 3675 gene locus_tag LOCUS_13440 4226 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5696 4317 gene locus_tag LOCUS_13450 gene argH 5696 4317 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_13450 6205 5735 gene locus_tag LOCUS_13460 6205 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 8702 6381 gene locus_tag LOCUS_13470 8702 6381 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_13470 10106 8817 gene locus_tag LOCUS_13480 10106 8817 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_13480 11106 10225 gene locus_tag LOCUS_13490 11106 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 11999 11103 gene locus_tag LOCUS_13500 11999 11103 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_13500 12822 12034 gene locus_tag LOCUS_13510 12822 12034 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_13510 13145 14398 gene locus_tag LOCUS_13520 13145 14398 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_13520 15244 15861 gene locus_tag LOCUS_13530 15244 15861 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence050 1263 529 gene locus_tag LOCUS_13540 1263 529 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_13540 2205 1306 gene locus_tag LOCUS_13550 2205 1306 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_13550 6619 2357 gene locus_tag LOCUS_13560 6619 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 7725 6757 gene locus_tag LOCUS_13570 7725 6757 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_13570 8786 7998 gene locus_tag LOCUS_13580 8786 7998 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_13580 9986 9081 gene locus_tag LOCUS_13590 9986 9081 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_13590 10668 10153 gene locus_tag LOCUS_13600 10668 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11733 10696 gene locus_tag LOCUS_13610 gene tsaD 11733 10696 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_13610 12664 11807 gene locus_tag LOCUS_13620 gene map 12664 11807 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_13620 13461 12790 gene locus_tag LOCUS_13630 13461 12790 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_13630 14011 13529 gene locus_tag LOCUS_13640 14011 13529 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_13640 15223 14099 gene locus_tag LOCUS_13650 15223 14099 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_13650 16608 15280 gene locus_tag LOCUS_13660 gene lpdA 16608 15280 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence051 <1 959 gene locus_tag LOCUS_13670 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766920.1:methylenetetrahydrofolate reductase [NAD(P)H] 989 2125 gene locus_tag LOCUS_13680 989 2125 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_13680 2213 3355 gene locus_tag LOCUS_13690 gene ricT 2213 3355 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_13690 3397 3933 gene locus_tag LOCUS_13700 3397 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3973 4620 gene locus_tag LOCUS_13710 3973 4620 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_13710 4656 5492 gene locus_tag LOCUS_13720 4656 5492 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_13720 5585 6616 gene locus_tag LOCUS_13730 5585 6616 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_13730 6754 7521 gene locus_tag LOCUS_13740 6754 7521 CDS product DpnI domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678771.1 protein_id gnl|my_center|LOCUS_13740 7599 7892 gene locus_tag LOCUS_13750 7599 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7927 8325 gene locus_tag LOCUS_13760 7927 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 8496 10832 gene locus_tag LOCUS_13770 gene topA 8496 10832 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_13770 10897 11424 gene locus_tag LOCUS_13780 10897 11424 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_13780 11526 13418 gene locus_tag LOCUS_13790 gene speA 11526 13418 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_13790 13563 14975 gene locus_tag LOCUS_13800 13563 14975 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_13800 16315 16133 gene locus_tag LOCUS_13810 16315 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence052 555 136 gene locus_tag LOCUS_13820 555 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2110 611 gene locus_tag LOCUS_13830 2110 611 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_13830 3417 2245 gene locus_tag LOCUS_13840 gene rfbB 3417 2245 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_13840 5032 3683 gene locus_tag LOCUS_13850 5032 3683 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_13850 5674 5252 gene locus_tag LOCUS_13860 5674 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5966 7039 gene locus_tag LOCUS_13870 gene nusB 5966 7039 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_13870 7160 7486 gene locus_tag LOCUS_13880 gene yajC 7160 7486 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_13880 7733 7497 gene locus_tag LOCUS_13890 7733 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 7617 8573 gene locus_tag LOCUS_13900 7617 8573 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_13900 8608 9234 gene locus_tag LOCUS_13910 gene coaE 8608 9234 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_13910 9231 9701 gene locus_tag LOCUS_13920 9231 9701 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_13920 9698 10306 gene locus_tag LOCUS_13930 9698 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 10353 11462 gene locus_tag LOCUS_13940 10353 11462 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_13940 11720 16117 gene locus_tag LOCUS_13950 11720 16117 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143257291.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence053 2502 421 gene locus_tag LOCUS_13960 2502 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2830 3414 gene locus_tag LOCUS_13970 2830 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3428 3997 gene locus_tag LOCUS_13980 3428 3997 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_13980 4005 5552 gene locus_tag LOCUS_13990 4005 5552 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_13990 6491 5673 gene locus_tag LOCUS_14000 6491 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7220 7451 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgtctcttatcaaacttctacatcaaaccacaac 11198 7716 gene locus_tag LOCUS_14010 11198 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 11867 14788 gene locus_tag LOCUS_14020 11867 14788 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_14020 16021 14954 gene locus_tag LOCUS_14030 16021 14954 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765031.1 protein_id gnl|my_center|LOCUS_14030 16371 16039 gene locus_tag LOCUS_14040 16371 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 16306 16515 gene locus_tag LOCUS_14050 16306 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence054 1071 178 gene locus_tag LOCUS_14060 1071 178 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_14060 1475 1098 gene locus_tag LOCUS_14070 1475 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4027 1559 gene locus_tag LOCUS_14080 4027 1559 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_14080 4780 4148 gene locus_tag LOCUS_14090 4780 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4850 5041 gene locus_tag LOCUS_14100 4850 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5862 6485 gene locus_tag LOCUS_14110 5862 6485 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_14110 7172 6624 gene locus_tag LOCUS_14120 7172 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7814 7206 gene locus_tag LOCUS_14130 7814 7206 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_14130 9297 7900 gene locus_tag LOCUS_14140 9297 7900 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_14140 10142 9351 gene locus_tag LOCUS_14150 10142 9351 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_14150 10969 10139 gene locus_tag LOCUS_14160 gene ispE 10969 10139 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_14160 12241 11051 gene locus_tag LOCUS_14170 12241 11051 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_14170 12912 12238 gene locus_tag LOCUS_14180 12912 12238 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_14180 13403 12909 gene locus_tag LOCUS_14190 13403 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14795 13524 gene locus_tag LOCUS_14200 14795 13524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_14200 15991 14792 gene locus_tag LOCUS_14210 15991 14792 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence055 <1 1839 gene locus_tag LOCUS_14220 <1 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783855.1:ABC transporter ATP-binding protein 2017 3435 gene locus_tag LOCUS_14230 gene ahcY 2017 3435 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229256.1 protein_id gnl|my_center|LOCUS_14230 3432 6170 gene locus_tag LOCUS_14240 3432 6170 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_14240 6714 7817 gene locus_tag LOCUS_14250 gene ychF 6714 7817 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_14250 8727 9611 gene locus_tag LOCUS_14260 gene lgt 8727 9611 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_14260 9657 10436 gene locus_tag LOCUS_14270 gene argB 9657 10436 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_14270 10465 11709 gene locus_tag LOCUS_14280 10465 11709 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_14280 11775 13901 gene locus_tag LOCUS_14290 11775 13901 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence056 70 255 gene locus_tag LOCUS_14300 70 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 531 950 gene locus_tag LOCUS_14310 gene tsaE 531 950 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_14310 999 3206 gene locus_tag LOCUS_14320 999 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3271 3981 gene locus_tag LOCUS_14330 3271 3981 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_14330 3992 4774 gene locus_tag LOCUS_14340 3992 4774 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783846.1 protein_id gnl|my_center|LOCUS_14340 4843 5745 gene locus_tag LOCUS_14350 4843 5745 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 protein_id gnl|my_center|LOCUS_14350 5793 7370 gene locus_tag LOCUS_14360 5793 7370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_14360 7428 7649 gene locus_tag LOCUS_14370 7428 7649 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763429.1 protein_id gnl|my_center|LOCUS_14370 7768 9273 gene locus_tag LOCUS_14380 7768 9273 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_14380 9308 10471 gene locus_tag LOCUS_14390 gene cydB 9308 10471 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_14390 10574 11710 gene locus_tag LOCUS_14400 10574 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_14400 11874 13952 gene locus_tag LOCUS_14410 11874 13952 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_14410 14033 14482 gene locus_tag LOCUS_14420 gene coaD 14033 14482 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_14420 14546 16147 gene locus_tag LOCUS_14430 14546 16147 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence057 327 707 gene locus_tag LOCUS_14440 327 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 920 2419 gene locus_tag LOCUS_14450 920 2419 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_14450 2498 3256 gene locus_tag LOCUS_14460 gene fabG 2498 3256 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_14460 3407 4594 gene locus_tag LOCUS_14470 3407 4594 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_14470 4634 5734 gene locus_tag LOCUS_14480 4634 5734 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_14480 5793 6035 gene locus_tag LOCUS_14490 5793 6035 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_14490 6147 7037 gene locus_tag LOCUS_14500 6147 7037 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_14500 7034 7537 gene locus_tag LOCUS_14510 7034 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_14510 7534 7965 gene locus_tag LOCUS_14520 7534 7965 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_14520 7935 9746 gene locus_tag LOCUS_14530 7935 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 9776 10033 gene locus_tag LOCUS_14540 9776 10033 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_14540 10083 11279 gene locus_tag LOCUS_14550 10083 11279 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_14550 11326 12438 gene locus_tag LOCUS_14560 11326 12438 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_14560 12435 12842 gene locus_tag LOCUS_14570 12435 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 12880 14364 gene locus_tag LOCUS_14580 12880 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 14398 15915 gene locus_tag LOCUS_14590 14398 15915 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence058 859 443 gene locus_tag LOCUS_14600 859 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2474 1269 gene locus_tag LOCUS_14610 2474 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5050 2537 gene locus_tag LOCUS_14620 5050 2537 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_14620 9788 5136 gene locus_tag LOCUS_14630 9788 5136 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_14630 10399 11688 gene locus_tag LOCUS_14640 10399 11688 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766205.1 protein_id gnl|my_center|LOCUS_14640 11701 15456 gene locus_tag LOCUS_14650 11701 15456 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018648595.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence059 2422 203 gene locus_tag LOCUS_14660 2422 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3405 5198 gene locus_tag LOCUS_14670 3405 5198 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_14670 5287 5469 gene locus_tag LOCUS_14680 5287 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5553 6347 gene locus_tag LOCUS_14690 5553 6347 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_14690 6347 6601 gene locus_tag LOCUS_14700 6347 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6610 7107 gene locus_tag LOCUS_14710 6610 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7162 8082 gene locus_tag LOCUS_14720 gene kduI 7162 8082 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_14720 8218 9129 gene locus_tag LOCUS_14730 8218 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9457 9732 gene locus_tag LOCUS_14740 9457 9732 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_14740 12624 9883 gene locus_tag LOCUS_14750 12624 9883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_14750 12827 14995 gene locus_tag LOCUS_14760 12827 14995 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_14760 15024 15266 gene locus_tag LOCUS_14770 15024 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence060 1010 513 gene locus_tag LOCUS_14780 1010 513 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_14780 2515 1031 gene locus_tag LOCUS_14790 gene cysS 2515 1031 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_14790 4646 2601 gene locus_tag LOCUS_14800 gene metG 4646 2601 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_14800 5550 4714 gene locus_tag LOCUS_14810 5550 4714 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_14810 6489 5677 gene locus_tag LOCUS_14820 6489 5677 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_14820 8463 6535 gene locus_tag LOCUS_14830 8463 6535 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_14830 10072 8564 gene locus_tag LOCUS_14840 10072 8564 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_14840 11245 10319 gene locus_tag LOCUS_14850 11245 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 11911 13875 gene locus_tag LOCUS_14860 11911 13875 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_14860 13961 15043 gene locus_tag LOCUS_14870 13961 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 15658 15583 gene locus_tag LOCUS_t00400 15658 15583 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 4412 5515 gene locus_tag LOCUS_14880 4412 5515 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_14880 5579 8986 gene locus_tag LOCUS_14890 5579 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 9087 10475 gene locus_tag LOCUS_14900 9087 10475 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767546.1 protein_id gnl|my_center|LOCUS_14900 10545 11330 gene locus_tag LOCUS_14910 gene lpxA 10545 11330 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_14910 12091 11696 gene locus_tag LOCUS_14920 12091 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 11975 12196 gene locus_tag LOCUS_14930 11975 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 12354 13253 gene locus_tag LOCUS_14940 12354 13253 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_14940 13882 15204 gene locus_tag LOCUS_14950 13882 15204 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_14950 15541 15614 gene locus_tag LOCUS_t00410 15541 15614 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15641 15725 gene locus_tag LOCUS_t00420 15641 15725 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15762 15846 gene locus_tag LOCUS_t00430 15762 15846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 1351 1013 gene locus_tag LOCUS_14960 1351 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1641 2114 gene locus_tag LOCUS_14970 gene smpB 1641 2114 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_14970 2221 4995 gene locus_tag LOCUS_14980 gene metH 2221 4995 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_14980 5013 6329 gene locus_tag LOCUS_14990 5013 6329 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_14990 6753 6583 gene locus_tag LOCUS_15000 6753 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7347 6790 gene locus_tag LOCUS_15010 7347 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8535 7624 gene locus_tag LOCUS_15020 8535 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 8812 11127 gene locus_tag LOCUS_15030 8812 11127 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_15030 11348 11217 gene locus_tag LOCUS_15040 11348 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 11728 12909 gene locus_tag LOCUS_15050 11728 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 13012 14775 gene locus_tag LOCUS_15060 13012 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 14796 15209 gene locus_tag LOCUS_15070 14796 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence063 547 2145 gene locus_tag LOCUS_15080 547 2145 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_15080 2251 4170 gene locus_tag LOCUS_15090 gene yidC 2251 4170 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_15090 4268 6433 gene locus_tag LOCUS_15100 4268 6433 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_15100 6512 7882 gene locus_tag LOCUS_15110 6512 7882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_15110 7901 9889 gene locus_tag LOCUS_15120 7901 9889 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_15120 9910 10710 gene locus_tag LOCUS_15130 gene mazG 9910 10710 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_15130 10784 11734 gene locus_tag LOCUS_15140 10784 11734 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_15140 11759 12520 gene locus_tag LOCUS_15150 gene lptB 11759 12520 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_15150 12608 15097 gene locus_tag LOCUS_15160 12608 15097 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence064 1074 169 gene locus_tag LOCUS_15170 1074 169 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_15170 2985 5186 gene locus_tag LOCUS_15180 2985 5186 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_15180 5434 6018 gene locus_tag LOCUS_15190 5434 6018 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_15190 6097 7020 gene locus_tag LOCUS_15200 6097 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7039 7944 gene locus_tag LOCUS_15210 7039 7944 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_15210 8152 8748 gene locus_tag LOCUS_15220 8152 8748 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108963.1 protein_id gnl|my_center|LOCUS_15220 8816 9562 gene locus_tag LOCUS_15230 gene fabG 8816 9562 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_15230 9734 13714 gene locus_tag LOCUS_15240 9734 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13739 13957 gene locus_tag LOCUS_15250 13739 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 14108 14359 gene locus_tag LOCUS_15260 14108 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 14708 14845 gene locus_tag LOCUS_15270 14708 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence065 1109 243 gene locus_tag LOCUS_15280 1109 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1562 3001 gene locus_tag LOCUS_15290 1562 3001 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_15290 3800 3078 gene locus_tag LOCUS_15300 gene recO 3800 3078 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_15300 4059 4131 gene locus_tag LOCUS_t00440 4059 4131 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4154 4408 gene locus_tag LOCUS_15310 gene rpsT 4154 4408 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_15310 7580 5262 gene locus_tag LOCUS_15320 7580 5262 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_15320 7832 8581 gene locus_tag LOCUS_15330 7832 8581 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_15330 8658 9920 gene locus_tag LOCUS_15340 8658 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 9987 12191 gene locus_tag LOCUS_15350 9987 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 12360 14486 gene locus_tag LOCUS_15360 12360 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence066 1555 437 gene locus_tag LOCUS_15370 1555 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3122 1788 gene locus_tag LOCUS_15380 3122 1788 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_15380 3873 3142 gene locus_tag LOCUS_15390 3873 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4820 3912 gene locus_tag LOCUS_15400 4820 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_15400 5726 4953 gene locus_tag LOCUS_15410 gene rsmI 5726 4953 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_15410 7224 5893 gene locus_tag LOCUS_15420 7224 5893 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_15420 10253 7221 gene locus_tag LOCUS_15430 10253 7221 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_15430 11358 10267 gene locus_tag LOCUS_15440 11358 10267 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_15440 13753 11447 gene locus_tag LOCUS_15450 13753 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence067 803 2212 gene locus_tag LOCUS_15460 803 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2275 4959 gene locus_tag LOCUS_15470 2275 4959 CDS product M60 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798674.1 protein_id gnl|my_center|LOCUS_15470 5173 8019 gene locus_tag LOCUS_15480 5173 8019 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_15480 9619 8372 gene locus_tag LOCUS_15490 9619 8372 CDS product fragipain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788546.1 protein_id gnl|my_center|LOCUS_15490 9915 10505 gene locus_tag LOCUS_15500 9915 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 10571 12796 gene locus_tag LOCUS_15510 10571 12796 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence068 700 1434 gene locus_tag LOCUS_15520 700 1434 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_15520 1523 2152 gene locus_tag LOCUS_15530 1523 2152 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_15530 2152 3132 gene locus_tag LOCUS_15540 2152 3132 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108346.1 protein_id gnl|my_center|LOCUS_15540 3158 3952 gene locus_tag LOCUS_15550 3158 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3949 4962 gene locus_tag LOCUS_15560 gene dusB 3949 4962 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_15560 5037 5867 gene locus_tag LOCUS_15570 5037 5867 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_15570 5876 6406 gene locus_tag LOCUS_15580 5876 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6458 7780 gene locus_tag LOCUS_15590 gene miaB 6458 7780 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_15590 7840 9516 gene locus_tag LOCUS_15600 7840 9516 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_15600 9536 10132 gene locus_tag LOCUS_15610 9536 10132 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_15610 10207 12570 gene locus_tag LOCUS_15620 10207 12570 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence069 734 3175 gene locus_tag LOCUS_15630 734 3175 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_15630 3291 3503 gene locus_tag LOCUS_15640 3291 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3599 4042 gene locus_tag LOCUS_15650 3599 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4846 4367 gene locus_tag LOCUS_15660 4846 4367 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_15660 5130 6803 gene locus_tag LOCUS_15670 gene ade 5130 6803 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829317.1 protein_id gnl|my_center|LOCUS_15670 7521 8225 gene locus_tag LOCUS_15680 7521 8225 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_15680 8273 8977 gene locus_tag LOCUS_15690 gene pssA 8273 8977 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_15690 9047 9325 gene locus_tag LOCUS_15700 9047 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 9476 10042 gene locus_tag LOCUS_15710 gene efp 9476 10042 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_15710 10255 11298 gene locus_tag LOCUS_15720 gene lpxD 10255 11298 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_15720 11338 12723 gene locus_tag LOCUS_15730 11338 12723 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence070 2098 359 gene locus_tag LOCUS_15740 2098 359 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_15740 2798 2127 gene locus_tag LOCUS_15750 2798 2127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_15750 3041 5449 gene locus_tag LOCUS_15760 3041 5449 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_15760 6228 5611 gene locus_tag LOCUS_15770 6228 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8717 6471 gene locus_tag LOCUS_15780 8717 6471 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_15780 9653 8922 gene locus_tag LOCUS_15790 gene lptC 9653 8922 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_15790 11053 9653 gene locus_tag LOCUS_15800 11053 9653 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_15800 11836 11054 gene locus_tag LOCUS_15810 11836 11054 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence071 468 1862 gene locus_tag LOCUS_15820 gene murC 468 1862 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_15820 1879 2676 gene locus_tag LOCUS_15830 1879 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2782 4236 gene locus_tag LOCUS_15840 gene ftsA 2782 4236 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_15840 4312 5604 gene locus_tag LOCUS_15850 gene ftsZ 4312 5604 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_15850 5830 7200 gene locus_tag LOCUS_15860 gene ftsZ 5830 7200 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763706.1 protein_id gnl|my_center|LOCUS_15860 7225 7677 gene locus_tag LOCUS_15870 7225 7677 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_15870 9435 7837 gene locus_tag LOCUS_15880 9435 7837 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_15880 12232 9503 gene locus_tag LOCUS_15890 12232 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767692.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence072 1 957 gene locus_tag LOCUS_15900 1 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1125 898 gene locus_tag LOCUS_15910 1125 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2217 1144 gene locus_tag LOCUS_15920 gene murB 2217 1144 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_15920 3060 2218 gene locus_tag LOCUS_15930 3060 2218 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_15930 5445 3655 gene locus_tag LOCUS_15940 gene rpsA 5445 3655 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_15940 5904 5578 gene locus_tag LOCUS_15950 5904 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5870 6253 gene locus_tag LOCUS_15960 5870 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6664 8607 gene locus_tag LOCUS_15970 gene thrS 6664 8607 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_15970 8662 9324 gene locus_tag LOCUS_15980 gene infC 8662 9324 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_15980 9423 9620 gene locus_tag LOCUS_15990 gene rpmI 9423 9620 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_15990 9739 10083 gene locus_tag LOCUS_16000 gene rplT 9739 10083 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_16000 10168 10377 gene locus_tag LOCUS_16010 10168 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 10618 11265 gene locus_tag LOCUS_16020 gene rpe 10618 11265 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_16020 11317 12351 gene locus_tag LOCUS_16030 11317 12351 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence073 70 261 gene locus_tag LOCUS_16040 70 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 651 1460 gene locus_tag LOCUS_16050 651 1460 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_16050 1642 2061 gene locus_tag LOCUS_16060 1642 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2105 3202 gene locus_tag LOCUS_16070 2105 3202 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679043.1 protein_id gnl|my_center|LOCUS_16070 3199 4005 gene locus_tag LOCUS_16080 3199 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4187 6055 gene locus_tag LOCUS_16090 4187 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6263 8737 gene locus_tag LOCUS_16100 6263 8737 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_16100 8987 10900 gene locus_tag LOCUS_16110 8987 10900 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_16110 10961 12226 gene locus_tag LOCUS_16120 10961 12226 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence074 2122 449 gene locus_tag LOCUS_16130 2122 449 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763411.1 protein_id gnl|my_center|LOCUS_16130 4022 2166 gene locus_tag LOCUS_16140 4022 2166 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107313.1 protein_id gnl|my_center|LOCUS_16140 5401 4409 gene locus_tag LOCUS_16150 5401 4409 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202049.1 protein_id gnl|my_center|LOCUS_16150 6569 5574 gene locus_tag LOCUS_16160 gene floA 6569 5574 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_16160 7474 6611 gene locus_tag LOCUS_16170 7474 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 8164 7571 gene locus_tag LOCUS_16180 8164 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 10102 8258 gene locus_tag LOCUS_16190 10102 8258 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_16190 11142 10168 gene locus_tag LOCUS_16200 gene ribD 11142 10168 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784375.1 protein_id gnl|my_center|LOCUS_16200 11212 12117 gene locus_tag LOCUS_16210 gene prmC 11212 12117 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence075 2267 276 gene locus_tag LOCUS_16220 2267 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2559 3716 gene locus_tag LOCUS_16230 2559 3716 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_16230 7760 3876 gene locus_tag LOCUS_16240 gene dnaE 7760 3876 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_16240 9551 7839 gene locus_tag LOCUS_16250 gene thiC 9551 7839 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_16250 10233 9616 gene locus_tag LOCUS_16260 10233 9616 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence076 483 4025 gene locus_tag LOCUS_16270 483 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7065 4174 gene locus_tag LOCUS_16280 7065 4174 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_16280 7310 8272 gene locus_tag LOCUS_16290 7310 8272 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_16290 8463 8374 gene locus_tag LOCUS_t00450 8463 8374 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8652 10187 gene locus_tag LOCUS_16300 gene gpmI 8652 10187 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence077 651 821 gene locus_tag LOCUS_16310 651 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1041 2339 gene locus_tag LOCUS_16320 1041 2339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_16320 2630 2232 gene locus_tag LOCUS_16330 2630 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3278 2736 gene locus_tag LOCUS_16340 3278 2736 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_16340 4355 3294 gene locus_tag LOCUS_16350 gene buk 4355 3294 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814251.1 protein_id gnl|my_center|LOCUS_16350 5344 4427 gene locus_tag LOCUS_16360 5344 4427 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763574.1 protein_id gnl|my_center|LOCUS_16360 5811 5389 gene locus_tag LOCUS_16370 5811 5389 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_16370 6942 5944 gene locus_tag LOCUS_16380 6942 5944 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_16380 8826 6997 gene locus_tag LOCUS_16390 8826 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 9310 8993 gene locus_tag LOCUS_16400 9310 8993 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_16400 10015 9419 gene locus_tag LOCUS_16410 10015 9419 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence078 14 2182 gene locus_tag LOCUS_16420 14 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2211 4103 gene locus_tag LOCUS_16430 2211 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4168 6021 gene locus_tag LOCUS_16440 4168 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6068 9145 gene locus_tag LOCUS_16450 6068 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence079 651 190 gene locus_tag LOCUS_16460 651 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2382 964 gene locus_tag LOCUS_16470 2382 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2599 3789 gene locus_tag LOCUS_16480 2599 3789 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_16480 4363 6393 gene locus_tag LOCUS_16490 4363 6393 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786503.1 protein_id gnl|my_center|LOCUS_16490 6427 6858 gene locus_tag LOCUS_16500 gene rpiB 6427 6858 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_16500 7248 7520 gene locus_tag LOCUS_16510 7248 7520 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_16510 7856 9442 gene locus_tag LOCUS_16520 7856 9442 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence080 919 20 gene locus_tag LOCUS_16530 gene xerD 919 20 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_16530 1123 1554 gene locus_tag LOCUS_16540 gene aroQ 1123 1554 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_16540 1571 2305 gene locus_tag LOCUS_16550 1571 2305 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_16550 2350 2685 gene locus_tag LOCUS_16560 gene rbfA 2350 2685 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_16560 2698 3924 gene locus_tag LOCUS_16570 2698 3924 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_16570 4436 6574 gene locus_tag LOCUS_16580 gene nrdD 4436 6574 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_16580 6568 7038 gene locus_tag LOCUS_16590 6568 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 7599 9653 gene locus_tag LOCUS_16600 7599 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence081 1212 2501 gene locus_tag LOCUS_16610 1212 2501 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_16610 2635 5112 gene locus_tag LOCUS_16620 2635 5112 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_16620 5147 5788 gene locus_tag LOCUS_16630 5147 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5869 6801 gene locus_tag LOCUS_16640 gene trxB 5869 6801 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_16640 <9196 6926 gene locus_tag LOCUS_16650 <9196 6926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence082 306 473 gene locus_tag LOCUS_16660 306 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 470 592 gene locus_tag LOCUS_16670 470 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 674 1384 gene locus_tag LOCUS_16680 674 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1456 2346 gene locus_tag LOCUS_16690 1456 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2404 2838 gene locus_tag LOCUS_16700 2404 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2893 3330 gene locus_tag LOCUS_16710 2893 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3609 4079 gene locus_tag LOCUS_16720 3609 4079 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_16720 4109 4891 gene locus_tag LOCUS_16730 4109 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4776 5381 gene locus_tag LOCUS_16740 4776 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 5395 5574 gene locus_tag LOCUS_16750 5395 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5580 5915 gene locus_tag LOCUS_16760 5580 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 6007 6447 gene locus_tag LOCUS_16770 6007 6447 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_16770 6620 6970 gene locus_tag LOCUS_16780 6620 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 7115 7639 gene locus_tag LOCUS_16790 7115 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence083 1565 303 gene locus_tag LOCUS_16800 1565 303 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_16800 1928 1686 gene locus_tag LOCUS_16810 1928 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1934 2722 gene locus_tag LOCUS_16820 gene surE 1934 2722 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_16820 2994 2761 gene locus_tag LOCUS_16830 2994 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2917 3945 gene locus_tag LOCUS_16840 gene lpxB 2917 3945 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_16840 4030 5055 gene locus_tag LOCUS_16850 4030 5055 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815431.1 protein_id gnl|my_center|LOCUS_16850 5121 6236 gene locus_tag LOCUS_16860 5121 6236 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_16860 6249 7268 gene locus_tag LOCUS_16870 6249 7268 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_16870 7297 8808 gene locus_tag LOCUS_16880 7297 8808 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109351.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence084 1867 587 gene locus_tag LOCUS_16890 1867 587 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_16890 2735 1953 gene locus_tag LOCUS_16900 2735 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4840 2732 gene locus_tag LOCUS_16910 4840 2732 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_16910 6559 4904 gene locus_tag LOCUS_16920 6559 4904 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_16920 7545 6622 gene locus_tag LOCUS_16930 7545 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 8631 7579 gene locus_tag LOCUS_16940 gene queA 8631 7579 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence085 385 2370 gene locus_tag LOCUS_16950 385 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2339 2845 gene locus_tag LOCUS_16960 2339 2845 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_16960 2885 3475 gene locus_tag LOCUS_16970 2885 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4703 4140 gene locus_tag LOCUS_16980 4703 4140 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_16980 5731 4700 gene locus_tag LOCUS_16990 gene mltG 5731 4700 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_16990 5872 7554 gene locus_tag LOCUS_17000 5872 7554 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_17000 7661 8584 gene locus_tag LOCUS_17010 7661 8584 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence086 2599 3711 gene locus_tag LOCUS_17020 2599 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3752 6085 gene locus_tag LOCUS_17030 3752 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 6610 6398 gene locus_tag LOCUS_17040 6610 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7688 6867 gene locus_tag LOCUS_17050 7688 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence087 1585 722 gene locus_tag LOCUS_17060 gene rfbD 1585 722 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721501.1 protein_id gnl|my_center|LOCUS_17060 3253 1634 gene locus_tag LOCUS_17070 3253 1634 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_17070 5965 3287 gene locus_tag LOCUS_17080 5965 3287 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_17080 6548 6826 gene locus_tag LOCUS_17090 6548 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence088 67 140 gene locus_tag LOCUS_t00460 67 140 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 331 909 gene locus_tag LOCUS_17100 331 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 973 1728 gene locus_tag LOCUS_17110 gene yaaA 973 1728 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109003.1 protein_id gnl|my_center|LOCUS_17110 2025 1867 gene locus_tag LOCUS_17120 2025 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2247 2056 gene locus_tag LOCUS_17130 gene rpmG 2247 2056 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_17130 2547 2287 gene locus_tag LOCUS_17140 gene rpmB 2547 2287 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_17140 3276 2707 gene locus_tag LOCUS_17150 3276 2707 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_17150 4443 3325 gene locus_tag LOCUS_17160 4443 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4904 4440 gene locus_tag LOCUS_17170 4904 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5555 4947 gene locus_tag LOCUS_17180 gene recR 5555 4947 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_17180 5866 6453 gene locus_tag LOCUS_17190 gene yihA 5866 6453 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence089 1730 294 gene locus_tag LOCUS_17200 1730 294 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_17200 3072 1798 gene locus_tag LOCUS_17210 3072 1798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_17210 5145 3169 gene locus_tag LOCUS_17220 5145 3169 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_17220 6072 5368 gene locus_tag LOCUS_17230 6072 5368 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence090 901 296 gene locus_tag LOCUS_17240 901 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1547 2788 gene locus_tag LOCUS_17250 1547 2788 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_17250 4315 4151 gene locus_tag LOCUS_17260 4315 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4484 6184 gene locus_tag LOCUS_17270 gene glaB 4484 6184 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence091 3745 476 gene locus_tag LOCUS_17280 3745 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 4956 4021 gene locus_tag LOCUS_17290 gene cysK 4956 4021 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_17290 5265 5966 gene locus_tag LOCUS_17300 5265 5966 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence092 46 1698 gene locus_tag LOCUS_17310 46 1698 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_17310 3750 2137 gene locus_tag LOCUS_17320 3750 2137 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_17320 4345 5304 gene locus_tag LOCUS_17330 4345 5304 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence093 1492 563 gene locus_tag LOCUS_17340 1492 563 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_17340 3875 1623 gene locus_tag LOCUS_17350 3875 1623 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_17350 4081 5697 gene locus_tag LOCUS_17360 4081 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence094 445 978 gene locus_tag LOCUS_17370 445 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1110 1535 gene locus_tag LOCUS_17380 1110 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1572 4139 gene locus_tag LOCUS_17390 1572 4139 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_17390 4195 4509 gene locus_tag LOCUS_17400 4195 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4709 5329 gene locus_tag LOCUS_17410 4709 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence095 698 246 gene locus_tag LOCUS_17420 698 246 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_17420 1959 763 gene locus_tag LOCUS_17430 1959 763 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_17430 2890 1973 gene locus_tag LOCUS_17440 2890 1973 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_17440 <5600 3009 gene locus_tag LOCUS_17450 <5600 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase >Feature sequence096 169 942 gene locus_tag LOCUS_17460 gene lpxA 169 942 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_17460 956 1519 gene locus_tag LOCUS_17470 956 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_17470 1534 2451 gene locus_tag LOCUS_17480 gene miaA 1534 2451 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_17480 2657 5140 gene locus_tag LOCUS_17490 2657 5140 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence097 1111 2148 gene locus_tag LOCUS_17500 1111 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2234 2992 gene locus_tag LOCUS_17510 2234 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 2989 4767 gene locus_tag LOCUS_17520 2989 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17520 >Feature sequence098 473 2203 gene locus_tag LOCUS_17530 473 2203 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202429.1 protein_id gnl|my_center|LOCUS_17530 3532 2477 gene locus_tag LOCUS_17540 3532 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence099 2224 176 gene locus_tag LOCUS_17550 2224 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3699 2284 gene locus_tag LOCUS_17560 3699 2284 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence100 501 1043 gene locus_tag LOCUS_17570 501 1043 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_17570 1516 3171 gene locus_tag LOCUS_17580 1516 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence101 2866 2192 gene locus_tag LOCUS_17590 2866 2192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence102 >Feature sequence103 >Feature sequence104