>Feature sequence001 1280 42 gene locus_tag LOCUS_00010 gene gluD 1280 42 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_00010 2682 1474 gene locus_tag LOCUS_00020 2682 1474 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_00020 3594 2701 gene locus_tag LOCUS_00030 gene queG 3594 2701 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_00030 4915 3641 gene locus_tag LOCUS_00040 4915 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6537 5089 gene locus_tag LOCUS_00050 gene gatB 6537 5089 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_00050 8003 6537 gene locus_tag LOCUS_00060 gene gatA 8003 6537 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_00060 8305 8018 gene locus_tag LOCUS_00070 gene gatC 8305 8018 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_00070 8540 9679 gene locus_tag LOCUS_00080 8540 9679 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393485.1 protein_id gnl|my_center|LOCUS_00080 10791 9721 gene locus_tag LOCUS_00090 10791 9721 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234436.1 protein_id gnl|my_center|LOCUS_00090 10950 11849 gene locus_tag LOCUS_00100 10950 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15391 13325 gene locus_tag LOCUS_00110 gene glyS 15391 13325 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_00110 16263 15391 gene locus_tag LOCUS_00120 gene glyQ 16263 15391 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_00120 16560 16486 gene locus_tag LOCUS_t00010 16560 16486 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18368 16599 gene locus_tag LOCUS_00130 18368 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20231 18420 gene locus_tag LOCUS_00140 gene dnaG 20231 18420 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_00140 21091 20330 gene locus_tag LOCUS_00150 21091 20330 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_00150 21809 21144 gene locus_tag LOCUS_00160 21809 21144 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_00160 24305 21915 gene locus_tag LOCUS_00170 gene ppsA 24305 21915 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 protein_id gnl|my_center|LOCUS_00170 25156 24590 gene locus_tag LOCUS_00180 25156 24590 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_00180 26160 25195 gene locus_tag LOCUS_00190 26160 25195 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_00190 26357 26283 gene locus_tag LOCUS_t00020 26357 26283 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 26443 26370 gene locus_tag LOCUS_t00030 26443 26370 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26628 26555 gene locus_tag LOCUS_t00040 26628 26555 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27481 26735 gene locus_tag LOCUS_00200 27481 26735 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_00200 28822 27512 gene locus_tag LOCUS_00210 28822 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 32901 28819 gene locus_tag LOCUS_00220 32901 28819 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_00220 34076 32898 gene locus_tag LOCUS_00230 34076 32898 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_00230 35569 34088 gene locus_tag LOCUS_00240 35569 34088 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_00240 36752 35625 gene locus_tag LOCUS_00250 36752 35625 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_00250 37284 36802 gene locus_tag LOCUS_00260 gene rlmH 37284 36802 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053094.1 protein_id gnl|my_center|LOCUS_00260 38411 37281 gene locus_tag LOCUS_00270 38411 37281 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_00270 39211 38426 gene locus_tag LOCUS_00280 39211 38426 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_00280 39779 39345 gene locus_tag LOCUS_00290 39779 39345 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965922.1 protein_id gnl|my_center|LOCUS_00290 40792 40067 gene locus_tag LOCUS_00300 40792 40067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 41193 41891 gene locus_tag LOCUS_00310 gene cysE 41193 41891 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_00310 42098 43039 gene locus_tag LOCUS_00320 gene cysK 42098 43039 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_00320 44045 43137 gene locus_tag LOCUS_00330 44045 43137 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890699.1 protein_id gnl|my_center|LOCUS_00330 44888 44121 gene locus_tag LOCUS_00340 44888 44121 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_00340 45044 45463 gene locus_tag LOCUS_00350 45044 45463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45542 47017 gene locus_tag LOCUS_00360 45542 47017 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_00360 47147 48628 gene locus_tag LOCUS_00370 47147 48628 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_00370 49496 48726 gene locus_tag LOCUS_00380 49496 48726 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_00380 49901 49515 gene locus_tag LOCUS_00390 49901 49515 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 protein_id gnl|my_center|LOCUS_00390 50491 49898 gene locus_tag LOCUS_00400 50491 49898 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436558.1 protein_id gnl|my_center|LOCUS_00400 51713 50505 gene locus_tag LOCUS_00410 51713 50505 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_00410 52570 52037 gene locus_tag LOCUS_00420 gene nrdG 52570 52037 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 protein_id gnl|my_center|LOCUS_00420 54711 52585 gene locus_tag LOCUS_00430 gene nrdD 54711 52585 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187820.1 protein_id gnl|my_center|LOCUS_00430 56271 55081 gene locus_tag LOCUS_00440 56271 55081 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 protein_id gnl|my_center|LOCUS_00440 57778 56360 gene locus_tag LOCUS_00450 57778 56360 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_00450 57961 58884 gene locus_tag LOCUS_00460 57961 58884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58897 60231 gene locus_tag LOCUS_00470 58897 60231 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_00470 61490 60351 gene locus_tag LOCUS_00480 61490 60351 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_00480 62926 61493 gene locus_tag LOCUS_00490 62926 61493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 63741 62959 gene locus_tag LOCUS_00500 63741 62959 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_00500 65527 63764 gene locus_tag LOCUS_00510 65527 63764 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_00510 66351 65551 gene locus_tag LOCUS_00520 gene gctB 66351 65551 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_00520 67316 66354 gene locus_tag LOCUS_00530 gene gctA 67316 66354 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_00530 69085 67640 gene locus_tag LOCUS_00540 69085 67640 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_00540 70512 69082 gene locus_tag LOCUS_00550 70512 69082 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_00550 71215 70523 gene locus_tag LOCUS_00560 71215 70523 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_00560 73074 71212 gene locus_tag LOCUS_00570 73074 71212 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419074.1 protein_id gnl|my_center|LOCUS_00570 74205 73084 gene locus_tag LOCUS_00580 gene rodA 74205 73084 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_00580 76011 74215 gene locus_tag LOCUS_00590 gene mrdA 76011 74215 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_00590 76533 76021 gene locus_tag LOCUS_00600 76533 76021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 77417 76533 gene locus_tag LOCUS_00610 gene mreC 77417 76533 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945174.1 protein_id gnl|my_center|LOCUS_00610 78467 77436 gene locus_tag LOCUS_00620 78467 77436 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_00620 79169 78483 gene locus_tag LOCUS_00630 gene radC 79169 78483 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_00630 79731 79096 gene locus_tag LOCUS_00640 79731 79096 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249905.1 protein_id gnl|my_center|LOCUS_00640 80004 79741 gene locus_tag LOCUS_00650 80004 79741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 80445 80008 gene locus_tag LOCUS_00660 80445 80008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80958 80461 gene locus_tag LOCUS_00670 80958 80461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 82222 81095 gene locus_tag LOCUS_00680 82222 81095 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_00680 82695 82258 gene locus_tag LOCUS_00690 82695 82258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 83089 82766 gene locus_tag LOCUS_00700 83089 82766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 84662 83136 gene locus_tag LOCUS_00710 84662 83136 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_00710 86301 84778 gene locus_tag LOCUS_00720 86301 84778 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_00720 87779 86478 gene locus_tag LOCUS_00730 87779 86478 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_00730 88225 87809 gene locus_tag LOCUS_00740 88225 87809 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_00740 88594 88232 gene locus_tag LOCUS_00750 88594 88232 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_00750 91653 88615 gene locus_tag LOCUS_00760 91653 88615 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017124.1 protein_id gnl|my_center|LOCUS_00760 93052 91811 gene locus_tag LOCUS_00770 gene hutI 93052 91811 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_00770 95188 93137 gene locus_tag LOCUS_00780 95188 93137 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836512.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 1432 56 gene locus_tag LOCUS_00790 gene fumC 1432 56 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_00790 3552 1534 gene locus_tag LOCUS_00800 3552 1534 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_00800 4036 3485 gene locus_tag LOCUS_00810 4036 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 5044 4046 gene locus_tag LOCUS_00820 5044 4046 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_00820 5571 5496 gene locus_tag LOCUS_t00050 5571 5496 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6843 5617 gene locus_tag LOCUS_00830 6843 5617 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_00830 8671 7343 gene locus_tag LOCUS_00840 8671 7343 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289416.1 protein_id gnl|my_center|LOCUS_00840 9126 8815 gene locus_tag LOCUS_00850 9126 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9502 10503 gene locus_tag LOCUS_00860 9502 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 12025 10688 gene locus_tag LOCUS_00870 gene rpoN 12025 10688 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_00870 13321 12137 gene locus_tag LOCUS_00880 13321 12137 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_00880 14750 13500 gene locus_tag LOCUS_00890 14750 13500 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_00890 15074 16069 gene locus_tag LOCUS_00900 gene rbsR 15074 16069 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 protein_id gnl|my_center|LOCUS_00900 17428 16166 gene locus_tag LOCUS_00910 17428 16166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 18529 17555 gene locus_tag LOCUS_00920 18529 17555 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_00920 18842 19813 gene locus_tag LOCUS_00930 18842 19813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 20608 20027 gene locus_tag LOCUS_00940 20608 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21171 21095 gene locus_tag LOCUS_t00060 21171 21095 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21921 21217 gene locus_tag LOCUS_00950 21921 21217 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_00950 22949 21930 gene locus_tag LOCUS_00960 gene spo0J 22949 21930 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_00960 23703 22939 gene locus_tag LOCUS_00970 gene soj 23703 22939 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_00970 25192 23951 gene locus_tag LOCUS_00980 gene pepT 25192 23951 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_00980 25827 25396 gene locus_tag LOCUS_00990 25827 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925185.1 protein_id gnl|my_center|LOCUS_00990 26665 25952 gene locus_tag LOCUS_01000 gene rsmG 26665 25952 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_01000 28542 26662 gene locus_tag LOCUS_01010 gene mnmG 28542 26662 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_01010 29933 28560 gene locus_tag LOCUS_01020 gene mnmE 29933 28560 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641622.1 protein_id gnl|my_center|LOCUS_01020 30915 30154 gene locus_tag LOCUS_01030 30915 30154 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 protein_id gnl|my_center|LOCUS_01030 31582 30959 gene locus_tag LOCUS_01040 31582 30959 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_01040 31818 31609 gene locus_tag LOCUS_01050 gene yidD 31818 31609 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_01050 32172 31834 gene locus_tag LOCUS_01060 gene rnpA 32172 31834 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739250.1 protein_id gnl|my_center|LOCUS_01060 33002 32526 gene locus_tag LOCUS_01070 33002 32526 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_01070 34493 33081 gene locus_tag LOCUS_01080 34493 33081 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705258.1 protein_id gnl|my_center|LOCUS_01080 35613 34555 gene locus_tag LOCUS_01090 35613 34555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 36668 35610 gene locus_tag LOCUS_01100 36668 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 37626 36682 gene locus_tag LOCUS_01110 37626 36682 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_01110 37810 38982 gene locus_tag LOCUS_01120 37810 38982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 40559 39231 gene locus_tag LOCUS_01130 40559 39231 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_01130 41153 40569 gene locus_tag LOCUS_01140 41153 40569 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_01140 41621 41548 gene locus_tag LOCUS_t00070 41621 41548 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41818 45438 gene locus_tag LOCUS_01150 41818 45438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 45451 46551 gene locus_tag LOCUS_01160 45451 46551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 47422 46691 gene locus_tag LOCUS_01170 47422 46691 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475489.1 protein_id gnl|my_center|LOCUS_01170 47753 48913 gene locus_tag LOCUS_01180 gene dnaA 47753 48913 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_01180 49635 50258 gene locus_tag LOCUS_01190 49635 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 50470 51858 gene locus_tag LOCUS_01200 gene dnaA 50470 51858 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_01200 52106 53233 gene locus_tag LOCUS_01210 gene dnaN 52106 53233 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475453.1 protein_id gnl|my_center|LOCUS_01210 53233 54369 gene locus_tag LOCUS_01220 gene recF 53233 54369 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_01220 54366 55097 gene locus_tag LOCUS_01230 54366 55097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 55075 55302 gene locus_tag LOCUS_01240 55075 55302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 55318 57258 gene locus_tag LOCUS_01250 gene gyrB 55318 57258 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_01250 57269 57964 gene locus_tag LOCUS_01260 57269 57964 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_01260 57970 58734 gene locus_tag LOCUS_01270 57970 58734 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391974.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence003 2 139 gene locus_tag LOCUS_01280 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 320 631 gene locus_tag LOCUS_01290 gene rpsJ 320 631 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_01290 644 1303 gene locus_tag LOCUS_01300 gene rplC 644 1303 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_01300 1329 1958 gene locus_tag LOCUS_01310 gene rplD 1329 1958 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_01310 1958 2248 gene locus_tag LOCUS_01320 gene rplW 1958 2248 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_01320 2270 3100 gene locus_tag LOCUS_01330 gene rplB 2270 3100 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_01330 3129 3404 gene locus_tag LOCUS_01340 gene rpsS 3129 3404 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_01340 3429 3764 gene locus_tag LOCUS_01350 gene rplV 3429 3764 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_01350 3793 4470 gene locus_tag LOCUS_01360 gene rpsC 3793 4470 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_01360 4470 4928 gene locus_tag LOCUS_01370 gene rplP 4470 4928 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01370 4928 5122 gene locus_tag LOCUS_01380 gene rpmC 4928 5122 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_01380 5159 5419 gene locus_tag LOCUS_01390 gene rpsQ 5159 5419 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_01390 5459 5827 gene locus_tag LOCUS_01400 gene rplN 5459 5827 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_01400 5849 6178 gene locus_tag LOCUS_01410 gene rplX 5849 6178 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_01410 6202 6744 gene locus_tag LOCUS_01420 gene rplE 6202 6744 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01420 6757 6942 gene locus_tag LOCUS_01430 6757 6942 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_01430 6973 7371 gene locus_tag LOCUS_01440 gene rpsH 6973 7371 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_01440 7401 7949 gene locus_tag LOCUS_01450 gene rplF 7401 7949 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 protein_id gnl|my_center|LOCUS_01450 7975 8337 gene locus_tag LOCUS_01460 gene rplR 7975 8337 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_01460 8356 8856 gene locus_tag LOCUS_01470 gene rpsE 8356 8856 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_01470 8869 9054 gene locus_tag LOCUS_01480 8869 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 9070 9510 gene locus_tag LOCUS_01490 gene rplO 9070 9510 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 protein_id gnl|my_center|LOCUS_01490 9637 10767 gene locus_tag LOCUS_01500 gene secY 9637 10767 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_01500 10779 11423 gene locus_tag LOCUS_01510 10779 11423 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_01510 11436 11654 gene locus_tag LOCUS_01520 gene infA 11436 11654 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_01520 11811 12176 gene locus_tag LOCUS_01530 gene rpsM 11811 12176 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_01530 12202 12594 gene locus_tag LOCUS_01540 gene rpsK 12202 12594 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_01540 12613 13206 gene locus_tag LOCUS_01550 gene rpsD 12613 13206 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_01550 13271 14242 gene locus_tag LOCUS_01560 13271 14242 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_01560 14257 14595 gene locus_tag LOCUS_01570 gene rplQ 14257 14595 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_01570 14798 15571 gene locus_tag LOCUS_01580 14798 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 17650 15605 gene locus_tag LOCUS_01590 17650 15605 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040580.1 protein_id gnl|my_center|LOCUS_01590 18182 17664 gene locus_tag LOCUS_01600 gene yfcE 18182 17664 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706165.1 protein_id gnl|my_center|LOCUS_01600 19318 18341 gene locus_tag LOCUS_01610 gene asrC 19318 18341 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964823.1 protein_id gnl|my_center|LOCUS_01610 20144 19329 gene locus_tag LOCUS_01620 gene asrB 20144 19329 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964822.1 protein_id gnl|my_center|LOCUS_01620 21153 20134 gene locus_tag LOCUS_01630 gene asrA 21153 20134 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964821.1 protein_id gnl|my_center|LOCUS_01630 21437 22993 gene locus_tag LOCUS_01640 21437 22993 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_01640 23122 24378 gene locus_tag LOCUS_01650 23122 24378 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184189.1 protein_id gnl|my_center|LOCUS_01650 25431 24427 gene locus_tag LOCUS_01660 25431 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 25907 27364 gene locus_tag LOCUS_01670 25907 27364 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_01670 27381 28262 gene locus_tag LOCUS_01680 gene speE 27381 28262 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_01680 28249 29103 gene locus_tag LOCUS_01690 gene speB 28249 29103 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_01690 29325 30584 gene locus_tag LOCUS_01700 29325 30584 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_01700 30584 31798 gene locus_tag LOCUS_01710 gene nspC 30584 31798 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_01710 32216 33118 gene locus_tag LOCUS_01720 32216 33118 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_01720 33111 34040 gene locus_tag LOCUS_01730 gene pstC 33111 34040 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394571.1 protein_id gnl|my_center|LOCUS_01730 34044 34916 gene locus_tag LOCUS_01740 gene pstA 34044 34916 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994147.1 protein_id gnl|my_center|LOCUS_01740 34909 35694 gene locus_tag LOCUS_01750 gene pstB 34909 35694 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_01750 35708 36376 gene locus_tag LOCUS_01760 gene phoU 35708 36376 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946330.1 protein_id gnl|my_center|LOCUS_01760 36598 38463 gene locus_tag LOCUS_01770 36598 38463 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_01770 38465 38896 gene locus_tag LOCUS_01780 38465 38896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 protein_id gnl|my_center|LOCUS_01780 38965 39621 gene locus_tag LOCUS_01790 38965 39621 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_01790 39621 40814 gene locus_tag LOCUS_01800 39621 40814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 40876 41847 gene locus_tag LOCUS_01810 40876 41847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_01810 42140 43072 gene locus_tag LOCUS_01820 42140 43072 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_01820 43456 43977 gene locus_tag LOCUS_01830 43456 43977 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900176.1 protein_id gnl|my_center|LOCUS_01830 44340 46871 gene locus_tag LOCUS_01840 44340 46871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47352 48527 gene locus_tag LOCUS_01850 47352 48527 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_01850 48675 49442 gene locus_tag LOCUS_01860 gene pxpA 48675 49442 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_01860 49594 50784 gene locus_tag LOCUS_01870 49594 50784 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_01870 50801 51571 gene locus_tag LOCUS_01880 gene pxpB 50801 51571 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_01880 51568 52554 gene locus_tag LOCUS_01890 gene pxpC 51568 52554 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_01890 52658 53779 gene locus_tag LOCUS_01900 52658 53779 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705381.1 protein_id gnl|my_center|LOCUS_01900 53794 54261 gene locus_tag LOCUS_01910 53794 54261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 54248 55306 gene locus_tag LOCUS_01920 gene mutY 54248 55306 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_01920 >Feature sequence004 <1 558 gene locus_tag LOCUS_01930 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964856.1:NAD(P)/FAD-dependent oxidoreductase 555 1550 gene locus_tag LOCUS_01940 555 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1782 2249 gene locus_tag LOCUS_01950 1782 2249 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_01950 2246 2515 gene locus_tag LOCUS_01960 2246 2515 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_01960 2672 2869 gene locus_tag LOCUS_01970 2672 2869 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_01970 2979 3734 gene locus_tag LOCUS_01980 2979 3734 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_01980 3745 5088 gene locus_tag LOCUS_01990 gene brnQ 3745 5088 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361550.1 protein_id gnl|my_center|LOCUS_01990 5166 5774 gene locus_tag LOCUS_02000 5166 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5978 7648 gene locus_tag LOCUS_02010 5978 7648 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_02010 7661 25651 gene locus_tag LOCUS_02020 7661 25651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 25737 26168 gene locus_tag LOCUS_02030 25737 26168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 26363 26439 gene locus_tag LOCUS_t00080 26363 26439 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28077 26674 gene locus_tag LOCUS_02040 28077 26674 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_02040 28341 28709 gene locus_tag LOCUS_02050 28341 28709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 28702 29385 gene locus_tag LOCUS_02060 28702 29385 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_02060 29539 30693 gene locus_tag LOCUS_02070 29539 30693 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_02070 30716 32155 gene locus_tag LOCUS_02080 30716 32155 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_02080 32377 32589 gene locus_tag LOCUS_02090 32377 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 32586 33569 gene locus_tag LOCUS_02100 32586 33569 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_02100 33653 34408 gene locus_tag LOCUS_02110 33653 34408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 34500 35375 gene locus_tag LOCUS_02120 34500 35375 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_02120 35505 36548 gene locus_tag LOCUS_02130 35505 36548 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_02130 36659 38344 gene locus_tag LOCUS_02140 36659 38344 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_02140 38359 39429 gene locus_tag LOCUS_02150 38359 39429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_02150 39600 39980 gene locus_tag LOCUS_02160 39600 39980 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_02160 40853 40101 gene locus_tag LOCUS_02170 40853 40101 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 protein_id gnl|my_center|LOCUS_02170 41044 42012 gene locus_tag LOCUS_02180 gene speB 41044 42012 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055970141.1 protein_id gnl|my_center|LOCUS_02180 42016 42534 gene locus_tag LOCUS_02190 42016 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 42997 42674 gene locus_tag LOCUS_02200 42997 42674 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861511.1 protein_id gnl|my_center|LOCUS_02200 43749 42994 gene locus_tag LOCUS_02210 43749 42994 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454563.1 protein_id gnl|my_center|LOCUS_02210 43932 45197 gene locus_tag LOCUS_02220 43932 45197 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_02220 45217 46266 gene locus_tag LOCUS_02230 gene serC 45217 46266 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_02230 46279 47535 gene locus_tag LOCUS_02240 gene gltS 46279 47535 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015836.1 protein_id gnl|my_center|LOCUS_02240 47769 48323 gene locus_tag LOCUS_02250 47769 48323 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_02250 48354 49133 gene locus_tag LOCUS_02260 48354 49133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence005 1011 433 gene locus_tag LOCUS_02270 1011 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2477 1008 gene locus_tag LOCUS_02280 gene cobA 2477 1008 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_02280 3330 2470 gene locus_tag LOCUS_02290 gene hemC 3330 2470 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703979.1 protein_id gnl|my_center|LOCUS_02290 3892 3332 gene locus_tag LOCUS_02300 3892 3332 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868997.1 protein_id gnl|my_center|LOCUS_02300 4165 5046 gene locus_tag LOCUS_02310 4165 5046 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_02310 5661 5571 gene locus_tag LOCUS_t00090 5661 5571 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7374 5734 gene locus_tag LOCUS_02320 7374 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8054 7485 gene locus_tag LOCUS_02330 8054 7485 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_02330 9505 8066 gene locus_tag LOCUS_02340 9505 8066 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_02340 11112 9556 gene locus_tag LOCUS_02350 11112 9556 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290168.1 protein_id gnl|my_center|LOCUS_02350 11360 12112 gene locus_tag LOCUS_02360 gene aroD 11360 12112 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704389.1 protein_id gnl|my_center|LOCUS_02360 13301 12234 gene locus_tag LOCUS_02370 13301 12234 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_02370 14627 13332 gene locus_tag LOCUS_02380 14627 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 15250 14630 gene locus_tag LOCUS_02390 15250 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 16145 15279 gene locus_tag LOCUS_02400 16145 15279 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02400 16431 16252 gene locus_tag LOCUS_02410 16431 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 18087 16711 gene locus_tag LOCUS_02420 18087 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 19254 18472 gene locus_tag LOCUS_02430 gene trpA 19254 18472 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_02430 20431 19247 gene locus_tag LOCUS_02440 gene trpB 20431 19247 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_02440 21054 20428 gene locus_tag LOCUS_02450 21054 20428 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_02450 21836 21051 gene locus_tag LOCUS_02460 gene trpC 21836 21051 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_02460 22875 21853 gene locus_tag LOCUS_02470 gene trpD 22875 21853 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_02470 23475 22897 gene locus_tag LOCUS_02480 23475 22897 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404410.1 protein_id gnl|my_center|LOCUS_02480 24940 23477 gene locus_tag LOCUS_02490 gene trpE 24940 23477 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_02490 25707 25417 gene locus_tag LOCUS_02500 25707 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 26367 25750 gene locus_tag LOCUS_02510 26367 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 26982 26392 gene locus_tag LOCUS_02520 26982 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 27778 27002 gene locus_tag LOCUS_02530 27778 27002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 29072 27957 gene locus_tag LOCUS_02540 29072 27957 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_02540 30349 29234 gene locus_tag LOCUS_02550 30349 29234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_02550 31459 30350 gene locus_tag LOCUS_02560 31459 30350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_02560 33204 31456 gene locus_tag LOCUS_02570 33204 31456 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_02570 34237 33197 gene locus_tag LOCUS_02580 34237 33197 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_02580 35763 34234 gene locus_tag LOCUS_02590 35763 34234 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_02590 36006 36569 gene locus_tag LOCUS_02600 36006 36569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 36617 37039 gene locus_tag LOCUS_02610 36617 37039 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_02610 37633 37178 gene locus_tag LOCUS_02620 37633 37178 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476058.1 protein_id gnl|my_center|LOCUS_02620 38884 37709 gene locus_tag LOCUS_02630 38884 37709 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_02630 39801 38950 gene locus_tag LOCUS_02640 39801 38950 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 protein_id gnl|my_center|LOCUS_02640 40488 39823 gene locus_tag LOCUS_02650 40488 39823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084191.1 protein_id gnl|my_center|LOCUS_02650 41510 40485 gene locus_tag LOCUS_02660 41510 40485 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817462.1 protein_id gnl|my_center|LOCUS_02660 42261 41896 gene locus_tag LOCUS_02670 gene rplL 42261 41896 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_02670 42869 42336 gene locus_tag LOCUS_02680 gene rplJ 42869 42336 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_02680 43731 43030 gene locus_tag LOCUS_02690 gene rplA 43731 43030 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989382.1 protein_id gnl|my_center|LOCUS_02690 44211 43786 gene locus_tag LOCUS_02700 gene rplK 44211 43786 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_02700 44804 44229 gene locus_tag LOCUS_02710 gene nusG 44804 44229 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_02710 45031 44807 gene locus_tag LOCUS_02720 45031 44807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 45204 45043 gene locus_tag LOCUS_02730 gene rpmG 45204 45043 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_02730 45480 45343 gene locus_tag LOCUS_02740 45480 45343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence006 477 133 gene locus_tag LOCUS_02750 477 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 611 1426 gene locus_tag LOCUS_02760 611 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1639 2082 gene locus_tag LOCUS_02770 1639 2082 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_02770 2360 3082 gene locus_tag LOCUS_02780 2360 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3220 3789 gene locus_tag LOCUS_02790 3220 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3782 4645 gene locus_tag LOCUS_02800 3782 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4642 5451 gene locus_tag LOCUS_02810 4642 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5448 6116 gene locus_tag LOCUS_02820 5448 6116 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_02820 6208 8382 gene locus_tag LOCUS_02830 6208 8382 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_02830 8647 9915 gene locus_tag LOCUS_02840 gene pepT 8647 9915 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 protein_id gnl|my_center|LOCUS_02840 10022 11341 gene locus_tag LOCUS_02850 10022 11341 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_02850 11360 12967 gene locus_tag LOCUS_02860 11360 12967 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_02860 13052 13330 gene locus_tag LOCUS_02870 13052 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13782 22886 gene locus_tag LOCUS_02880 13782 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 23177 23031 gene locus_tag LOCUS_02890 23177 23031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 23268 23561 gene locus_tag LOCUS_02900 23268 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 23594 24124 gene locus_tag LOCUS_02910 23594 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02910 24124 25707 gene locus_tag LOCUS_02920 24124 25707 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02920 26351 25743 gene locus_tag LOCUS_02930 26351 25743 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940850.1 protein_id gnl|my_center|LOCUS_02930 26499 27482 gene locus_tag LOCUS_02940 26499 27482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 27798 29387 gene locus_tag LOCUS_02950 gene serA 27798 29387 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878316.1 protein_id gnl|my_center|LOCUS_02950 29604 30494 gene locus_tag LOCUS_02960 29604 30494 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085067.1 protein_id gnl|my_center|LOCUS_02960 31597 30632 gene locus_tag LOCUS_02970 31597 30632 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807997.1 protein_id gnl|my_center|LOCUS_02970 31786 32487 gene locus_tag LOCUS_02980 31786 32487 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930236.1 protein_id gnl|my_center|LOCUS_02980 32660 33940 gene locus_tag LOCUS_02990 32660 33940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 34079 35107 gene locus_tag LOCUS_03000 34079 35107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 35412 36683 gene locus_tag LOCUS_03010 35412 36683 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_03010 36695 37846 gene locus_tag LOCUS_03020 36695 37846 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_03020 38131 38271 gene locus_tag LOCUS_03030 38131 38271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 38271 38456 gene locus_tag LOCUS_03040 38271 38456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 >Feature sequence007 371 482 gene locus_tag LOCUS_r00010 371 482 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1773 748 gene locus_tag LOCUS_03050 gene arsB 1773 748 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_03050 2162 1842 gene locus_tag LOCUS_03060 2162 1842 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_03060 2371 3708 gene locus_tag LOCUS_03070 2371 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3736 4056 gene locus_tag LOCUS_03080 3736 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4551 4096 gene locus_tag LOCUS_03090 4551 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4698 5588 gene locus_tag LOCUS_03100 gene dapF 4698 5588 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077385.1 protein_id gnl|my_center|LOCUS_03100 5671 6870 gene locus_tag LOCUS_03110 5671 6870 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_03110 6894 7334 gene locus_tag LOCUS_03120 6894 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8437 7376 gene locus_tag LOCUS_03130 gene potD 8437 7376 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772485.1 protein_id gnl|my_center|LOCUS_03130 9241 8444 gene locus_tag LOCUS_03140 gene potC 9241 8444 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714199.1 protein_id gnl|my_center|LOCUS_03140 10067 9222 gene locus_tag LOCUS_03150 gene potB 10067 9222 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_03150 11083 10079 gene locus_tag LOCUS_03160 gene potA 11083 10079 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720321.1 protein_id gnl|my_center|LOCUS_03160 11341 11652 gene locus_tag LOCUS_03170 gene rplU 11341 11652 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_03170 11656 11985 gene locus_tag LOCUS_03180 11656 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11991 12281 gene locus_tag LOCUS_03190 gene rpmA 11991 12281 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_03190 12342 12728 gene locus_tag LOCUS_03200 12342 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 13020 16754 gene locus_tag LOCUS_03210 gene rpoB 13020 16754 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_03210 16771 20826 gene locus_tag LOCUS_03220 16771 20826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 21523 20894 gene locus_tag LOCUS_03230 21523 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 21761 23305 gene locus_tag LOCUS_03240 21761 23305 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_03240 23477 23683 gene locus_tag LOCUS_03250 23477 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 23873 25417 gene locus_tag LOCUS_03260 23873 25417 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957212.1 protein_id gnl|my_center|LOCUS_03260 25669 26505 gene locus_tag LOCUS_03270 25669 26505 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_03270 26490 27353 gene locus_tag LOCUS_03280 26490 27353 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_03280 27347 28153 gene locus_tag LOCUS_03290 27347 28153 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03290 28150 28887 gene locus_tag LOCUS_03300 gene truA 28150 28887 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_03300 29128 31071 gene locus_tag LOCUS_03310 29128 31071 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928901.1 protein_id gnl|my_center|LOCUS_03310 31511 32608 gene locus_tag LOCUS_03320 gene ribD 31511 32608 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_03320 32613 33251 gene locus_tag LOCUS_03330 32613 33251 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence008 281 1543 gene locus_tag LOCUS_03340 281 1543 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_03340 2937 1696 gene locus_tag LOCUS_03350 2937 1696 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_03350 3116 4372 gene locus_tag LOCUS_03360 3116 4372 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_03360 4388 5428 gene locus_tag LOCUS_03370 4388 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6368 5511 gene locus_tag LOCUS_03380 6368 5511 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398819.1 protein_id gnl|my_center|LOCUS_03380 6503 7627 gene locus_tag LOCUS_03390 6503 7627 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_03390 7741 10023 gene locus_tag LOCUS_03400 7741 10023 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_03400 10034 11455 gene locus_tag LOCUS_03410 10034 11455 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040323.1 protein_id gnl|my_center|LOCUS_03410 11611 11414 gene locus_tag LOCUS_03420 11611 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 11753 12955 gene locus_tag LOCUS_03430 11753 12955 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_03430 13925 12999 gene locus_tag LOCUS_03440 13925 12999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_03440 15084 14164 gene locus_tag LOCUS_03450 15084 14164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_03450 15214 16104 gene locus_tag LOCUS_03460 15214 16104 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_03460 16126 17439 gene locus_tag LOCUS_03470 16126 17439 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891864.1 protein_id gnl|my_center|LOCUS_03470 18080 17661 gene locus_tag LOCUS_03480 gene perR 18080 17661 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110007.1 protein_id gnl|my_center|LOCUS_03480 18288 19793 gene locus_tag LOCUS_03490 18288 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 19963 22506 gene locus_tag LOCUS_03500 gene clpB 19963 22506 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723824.1 protein_id gnl|my_center|LOCUS_03500 23010 22552 gene locus_tag LOCUS_03510 23010 22552 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061029547.1 protein_id gnl|my_center|LOCUS_03510 23219 23764 gene locus_tag LOCUS_03520 23219 23764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 23889 24797 gene locus_tag LOCUS_03530 23889 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 25972 24974 gene locus_tag LOCUS_03540 25972 24974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03540 26388 25984 gene locus_tag LOCUS_03550 26388 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 26718 27839 gene locus_tag LOCUS_03560 26718 27839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 27826 28902 gene locus_tag LOCUS_03570 27826 28902 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_03570 29068 30054 gene locus_tag LOCUS_03580 29068 30054 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_03580 30073 31065 gene locus_tag LOCUS_03590 30073 31065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_03590 31069 31953 gene locus_tag LOCUS_03600 31069 31953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 protein_id gnl|my_center|LOCUS_03600 31953 32747 gene locus_tag LOCUS_03610 31953 32747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence009 10588 9887 gene locus_tag LOCUS_03620 gene tsaA 10588 9887 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03620 11226 10585 gene locus_tag LOCUS_03630 11226 10585 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_03630 12787 11387 gene locus_tag LOCUS_03640 12787 11387 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 protein_id gnl|my_center|LOCUS_03640 14196 12880 gene locus_tag LOCUS_03650 14196 12880 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861764.1 protein_id gnl|my_center|LOCUS_03650 15421 14213 gene locus_tag LOCUS_03660 15421 14213 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861765.1 protein_id gnl|my_center|LOCUS_03660 16001 15423 gene locus_tag LOCUS_03670 16001 15423 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_03670 16809 17762 gene locus_tag LOCUS_03680 16809 17762 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814323.1 protein_id gnl|my_center|LOCUS_03680 18520 17723 gene locus_tag LOCUS_03690 18520 17723 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103734.1 protein_id gnl|my_center|LOCUS_03690 18748 20037 gene locus_tag LOCUS_03700 18748 20037 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_03700 20027 20863 gene locus_tag LOCUS_03710 20027 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 21264 20893 gene locus_tag LOCUS_03720 21264 20893 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329230.1 protein_id gnl|my_center|LOCUS_03720 21444 21283 gene locus_tag LOCUS_03730 21444 21283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 23083 21446 gene locus_tag LOCUS_03740 gene hcp 23083 21446 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_03740 24027 23242 gene locus_tag LOCUS_03750 24027 23242 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_03750 24673 24062 gene locus_tag LOCUS_03760 24673 24062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 25895 24675 gene locus_tag LOCUS_03770 gene deoB 25895 24675 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816482.1 protein_id gnl|my_center|LOCUS_03770 26692 25892 gene locus_tag LOCUS_03780 gene udp 26692 25892 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073831.1 protein_id gnl|my_center|LOCUS_03780 27373 26783 gene locus_tag LOCUS_03790 27373 26783 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_03790 27542 28102 gene locus_tag LOCUS_03800 27542 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 29770 28223 gene locus_tag LOCUS_03810 gene rny 29770 28223 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_03810 30490 29993 gene locus_tag LOCUS_03820 gene recX 30490 29993 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098437.1 protein_id gnl|my_center|LOCUS_03820 31568 30480 gene locus_tag LOCUS_03830 gene recA 31568 30480 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_03830 32488 31628 gene locus_tag LOCUS_03840 gene hslO 32488 31628 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656372.1 protein_id gnl|my_center|LOCUS_03840 32959 32498 gene locus_tag LOCUS_03850 gene ribE 32959 32498 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence010 308 1162 gene locus_tag LOCUS_03860 308 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1278 3266 gene locus_tag LOCUS_03870 gene tkt 1278 3266 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_03870 3328 4152 gene locus_tag LOCUS_03880 gene thiD 3328 4152 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816645.1 protein_id gnl|my_center|LOCUS_03880 4149 4781 gene locus_tag LOCUS_03890 gene thiE 4149 4781 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_03890 4794 5195 gene locus_tag LOCUS_03900 4794 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 5270 5635 gene locus_tag LOCUS_03910 5270 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5638 6984 gene locus_tag LOCUS_03920 gene ffh 5638 6984 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_03920 7012 7284 gene locus_tag LOCUS_03930 gene rpsP 7012 7284 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 protein_id gnl|my_center|LOCUS_03930 7296 7523 gene locus_tag LOCUS_03940 7296 7523 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_03940 7535 7942 gene locus_tag LOCUS_03950 7535 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 7947 8441 gene locus_tag LOCUS_03960 gene rimM 7947 8441 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_03960 8443 9204 gene locus_tag LOCUS_03970 gene trmD 8443 9204 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272440.1 protein_id gnl|my_center|LOCUS_03970 9335 9676 gene locus_tag LOCUS_03980 gene rplS 9335 9676 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_03980 9738 10277 gene locus_tag LOCUS_03990 gene lepB 9738 10277 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_03990 10491 11378 gene locus_tag LOCUS_04000 gene ylqF 10491 11378 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_04000 11381 12193 gene locus_tag LOCUS_04010 11381 12193 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_04010 12296 12652 gene locus_tag LOCUS_04020 12296 12652 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_04020 12831 14354 gene locus_tag LOCUS_04030 12831 14354 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392536.1 protein_id gnl|my_center|LOCUS_04030 14371 16683 gene locus_tag LOCUS_04040 14371 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 16676 17239 gene locus_tag LOCUS_04050 16676 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 17331 18587 gene locus_tag LOCUS_04060 17331 18587 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_04060 18612 20273 gene locus_tag LOCUS_04070 18612 20273 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_04070 20289 21479 gene locus_tag LOCUS_04080 20289 21479 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_04080 21654 22907 gene locus_tag LOCUS_04090 21654 22907 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195506.1 protein_id gnl|my_center|LOCUS_04090 22936 24402 gene locus_tag LOCUS_04100 gene gltX 22936 24402 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_04100 24407 25306 gene locus_tag LOCUS_04110 24407 25306 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433828.1 protein_id gnl|my_center|LOCUS_04110 25434 25871 gene locus_tag LOCUS_04120 gene rplM 25434 25871 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727703.1 protein_id gnl|my_center|LOCUS_04120 25892 26284 gene locus_tag LOCUS_04130 gene rpsI 25892 26284 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_04130 27761 26454 gene locus_tag LOCUS_04140 gene thiC 27761 26454 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_04140 29306 28146 gene locus_tag LOCUS_04150 29306 28146 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047210621.1 protein_id gnl|my_center|LOCUS_04150 30071 29391 gene locus_tag LOCUS_04160 30071 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 30258 30458 gene locus_tag LOCUS_04170 30258 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 30529 30729 gene locus_tag LOCUS_04180 30529 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30735 31007 gene locus_tag LOCUS_04190 30735 31007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 31495 31785 gene locus_tag LOCUS_04200 31495 31785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 31854 32369 gene locus_tag LOCUS_04210 31854 32369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence011 220 1980 gene locus_tag LOCUS_04220 220 1980 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101957.1 protein_id gnl|my_center|LOCUS_04220 1970 3610 gene locus_tag LOCUS_04230 1970 3610 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706258.1 protein_id gnl|my_center|LOCUS_04230 4702 3686 gene locus_tag LOCUS_04240 4702 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5026 6048 gene locus_tag LOCUS_04250 gene pheS 5026 6048 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_04250 6066 8504 gene locus_tag LOCUS_04260 gene pheT 6066 8504 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_04260 8641 8717 gene locus_tag LOCUS_t00100 8641 8717 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8720 8794 gene locus_tag LOCUS_t00110 8720 8794 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8796 8869 gene locus_tag LOCUS_t00120 8796 8869 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8982 9281 gene locus_tag LOCUS_04270 8982 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 9589 10644 gene locus_tag LOCUS_04280 9589 10644 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_04280 10712 11692 gene locus_tag LOCUS_04290 10712 11692 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_04290 12021 11704 gene locus_tag LOCUS_04300 12021 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 12216 12368 gene locus_tag LOCUS_04310 12216 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 12416 12697 gene locus_tag LOCUS_04320 12416 12697 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 protein_id gnl|my_center|LOCUS_04320 12838 13272 gene locus_tag LOCUS_04330 gene ctsR 12838 13272 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_04330 13273 14646 gene locus_tag LOCUS_04340 gene radA 13273 14646 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_04340 14794 17421 gene locus_tag LOCUS_04350 gene alaS 14794 17421 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_04350 17459 17989 gene locus_tag LOCUS_04360 17459 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18301 18564 gene locus_tag LOCUS_04370 18301 18564 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_04370 18561 18980 gene locus_tag LOCUS_04380 gene ruvX 18561 18980 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229795.1 protein_id gnl|my_center|LOCUS_04380 18983 19297 gene locus_tag LOCUS_04390 18983 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 19313 20341 gene locus_tag LOCUS_04400 gene mltG 19313 20341 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_04400 20338 21558 gene locus_tag LOCUS_04410 20338 21558 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_04410 21670 22719 gene locus_tag LOCUS_04420 gene pepQ 21670 22719 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_04420 22757 23314 gene locus_tag LOCUS_04430 gene efp 22757 23314 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_04430 23407 24015 gene locus_tag LOCUS_04440 gene cobC 23407 24015 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_04440 24257 24084 gene locus_tag LOCUS_04450 24257 24084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 24270 24968 gene locus_tag LOCUS_04460 24270 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 24981 26162 gene locus_tag LOCUS_04470 24981 26162 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_04470 26174 29950 gene locus_tag LOCUS_04480 26174 29950 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence012 1761 619 gene locus_tag LOCUS_04490 gene prpF 1761 619 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 protein_id gnl|my_center|LOCUS_04490 2103 3011 gene locus_tag LOCUS_04500 2103 3011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_04500 3822 3046 gene locus_tag LOCUS_04510 3822 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4586 3834 gene locus_tag LOCUS_04520 4586 3834 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_04520 5349 4639 gene locus_tag LOCUS_04530 5349 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6088 5342 gene locus_tag LOCUS_04540 gene recO 6088 5342 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_04540 6932 6078 gene locus_tag LOCUS_04550 6932 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8003 7077 gene locus_tag LOCUS_04560 gene era 8003 7077 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_04560 8405 8019 gene locus_tag LOCUS_04570 8405 8019 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187960.1 protein_id gnl|my_center|LOCUS_04570 8877 8395 gene locus_tag LOCUS_04580 gene ybeY 8877 8395 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_04580 9887 8874 gene locus_tag LOCUS_04590 9887 8874 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04590 10022 10098 gene locus_tag LOCUS_t00130 10022 10098 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11038 10178 gene locus_tag LOCUS_04600 11038 10178 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860969.1 protein_id gnl|my_center|LOCUS_04600 11203 11388 gene locus_tag LOCUS_04610 11203 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 11666 13339 gene locus_tag LOCUS_04620 11666 13339 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_04620 15535 13508 gene locus_tag LOCUS_04630 gene ligA 15535 13508 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_04630 17801 15549 gene locus_tag LOCUS_04640 gene pcrA 17801 15549 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_04640 17911 19296 gene locus_tag LOCUS_04650 17911 19296 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_04650 20670 19354 gene locus_tag LOCUS_04660 20670 19354 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_04660 21428 20691 gene locus_tag LOCUS_04670 21428 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 21642 21475 gene locus_tag LOCUS_04680 21642 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 21666 21866 gene locus_tag LOCUS_04690 21666 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22011 21928 gene locus_tag LOCUS_t00140 22011 21928 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22103 22028 gene locus_tag LOCUS_t00150 22103 22028 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22182 22107 gene locus_tag LOCUS_t00160 22182 22107 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22276 22201 gene locus_tag LOCUS_t00170 22276 22201 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22802 22374 gene locus_tag LOCUS_04700 22802 22374 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392857.1 protein_id gnl|my_center|LOCUS_04700 22915 23145 gene locus_tag LOCUS_04710 22915 23145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 24388 23180 gene locus_tag LOCUS_04720 24388 23180 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_04720 25635 24706 gene locus_tag LOCUS_04730 25635 24706 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965437.1 protein_id gnl|my_center|LOCUS_04730 27367 25766 gene locus_tag LOCUS_04740 27367 25766 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943055.1 protein_id gnl|my_center|LOCUS_04740 28316 27348 gene locus_tag LOCUS_04750 28316 27348 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393730.1 protein_id gnl|my_center|LOCUS_04750 29172 28303 gene locus_tag LOCUS_04760 gene cdaA 29172 28303 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_04760 29326 30582 gene locus_tag LOCUS_04770 29326 30582 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 protein_id gnl|my_center|LOCUS_04770 <31230 30680 gene locus_tag LOCUS_04780 <31230 30680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393767.1:argininosuccinate lyase >Feature sequence013 117 422 gene locus_tag LOCUS_04790 117 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 507 2273 gene locus_tag LOCUS_04800 507 2273 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_04800 2433 3215 gene locus_tag LOCUS_04810 2433 3215 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_04810 3217 3969 gene locus_tag LOCUS_04820 3217 3969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_04820 3974 5227 gene locus_tag LOCUS_04830 3974 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5325 6665 gene locus_tag LOCUS_04840 5325 6665 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_04840 6977 11302 gene locus_tag LOCUS_04850 6977 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11461 13674 gene locus_tag LOCUS_04860 11461 13674 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_04860 13712 14191 gene locus_tag LOCUS_04870 13712 14191 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869434.1 protein_id gnl|my_center|LOCUS_04870 14222 15154 gene locus_tag LOCUS_04880 14222 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 15171 15575 gene locus_tag LOCUS_04890 15171 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15644 16684 gene locus_tag LOCUS_04900 gene lpxD 15644 16684 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_04900 16681 17289 gene locus_tag LOCUS_04910 16681 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 17302 18201 gene locus_tag LOCUS_04920 17302 18201 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_04920 18205 19542 gene locus_tag LOCUS_04930 18205 19542 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_04930 19558 20367 gene locus_tag LOCUS_04940 gene lpxA 19558 20367 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_04940 20372 21193 gene locus_tag LOCUS_04950 gene lpxI 20372 21193 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_04950 22450 21374 gene locus_tag LOCUS_04960 22450 21374 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_04960 23127 22507 gene locus_tag LOCUS_04970 23127 22507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 23750 23142 gene locus_tag LOCUS_04980 23750 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 23909 24094 gene locus_tag LOCUS_04990 23909 24094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24126 24344 gene locus_tag LOCUS_05000 24126 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 24360 24704 gene locus_tag LOCUS_05010 24360 24704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 24688 24969 gene locus_tag LOCUS_05020 24688 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 25050 25367 gene locus_tag LOCUS_05030 25050 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 25364 25849 gene locus_tag LOCUS_05040 25364 25849 CDS product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731904.1 protein_id gnl|my_center|LOCUS_05040 25862 26518 gene locus_tag LOCUS_05050 25862 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 26515 27024 gene locus_tag LOCUS_05060 26515 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 27287 27468 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agaaaggaaaaaaatgtaccttct 28151 28594 gene locus_tag LOCUS_05070 28151 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 28713 28985 gene locus_tag LOCUS_05080 28713 28985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 28948 29307 gene locus_tag LOCUS_05090 28948 29307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 29285 29590 gene locus_tag LOCUS_05100 29285 29590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 29592 29792 gene locus_tag LOCUS_05110 29592 29792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 29789 30046 gene locus_tag LOCUS_05120 29789 30046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 30099 30644 gene locus_tag LOCUS_05130 30099 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 30637 31038 gene locus_tag LOCUS_05140 gene ssb 30637 31038 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence014 350 988 gene locus_tag LOCUS_05150 350 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1086 1436 gene locus_tag LOCUS_05160 1086 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1497 1940 gene locus_tag LOCUS_05170 1497 1940 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_05170 1955 2398 gene locus_tag LOCUS_05180 1955 2398 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_05180 2412 2849 gene locus_tag LOCUS_05190 2412 2849 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_05190 2989 3426 gene locus_tag LOCUS_05200 2989 3426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_05200 3461 3895 gene locus_tag LOCUS_05210 3461 3895 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815877.1 protein_id gnl|my_center|LOCUS_05210 5519 3981 gene locus_tag LOCUS_05220 5519 3981 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046719.1 protein_id gnl|my_center|LOCUS_05220 5679 7205 gene locus_tag LOCUS_05230 5679 7205 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 protein_id gnl|my_center|LOCUS_05230 8452 7259 gene locus_tag LOCUS_05240 8452 7259 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_05240 8749 11367 gene locus_tag LOCUS_05250 gene polA 8749 11367 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_05250 11378 12199 gene locus_tag LOCUS_05260 gene mutM 11378 12199 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_05260 12210 12797 gene locus_tag LOCUS_05270 gene coaE 12210 12797 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_05270 12977 13534 gene locus_tag LOCUS_05280 12977 13534 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_05280 13589 13675 gene locus_tag LOCUS_t00180 13589 13675 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13706 13791 gene locus_tag LOCUS_t00190 13706 13791 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13844 13930 gene locus_tag LOCUS_t00200 13844 13930 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15191 14199 gene locus_tag LOCUS_05290 15191 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 15371 16771 gene locus_tag LOCUS_05300 15371 16771 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_05300 17154 17891 gene locus_tag LOCUS_05310 gene sufC 17154 17891 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_05310 17908 19374 gene locus_tag LOCUS_05320 gene sufB 17908 19374 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_05320 19391 20515 gene locus_tag LOCUS_05330 gene sufD 19391 20515 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_05330 20508 21698 gene locus_tag LOCUS_05340 20508 21698 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_05340 21722 22162 gene locus_tag LOCUS_05350 21722 22162 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_05350 22513 24585 gene locus_tag LOCUS_05360 22513 24585 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_05360 24756 25202 gene locus_tag LOCUS_05370 24756 25202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 25219 25650 gene locus_tag LOCUS_05380 25219 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 25896 25705 gene locus_tag LOCUS_05390 gene rpmB 25896 25705 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_05390 26016 28079 gene locus_tag LOCUS_05400 gene recG 26016 28079 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_05400 28291 30363 gene locus_tag LOCUS_05410 gene fusA 28291 30363 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence015 1071 91 gene locus_tag LOCUS_05420 1071 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1114 1410 gene locus_tag LOCUS_05430 1114 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1407 1796 gene locus_tag LOCUS_05440 1407 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1711 2199 gene locus_tag LOCUS_05450 1711 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2199 2783 gene locus_tag LOCUS_05460 2199 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2944 3465 gene locus_tag LOCUS_05470 2944 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3548 3775 gene locus_tag LOCUS_05480 3548 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3791 3985 gene locus_tag LOCUS_05490 3791 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4132 5268 gene locus_tag LOCUS_05500 gene lpxB 4132 5268 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_05500 5265 7061 gene locus_tag LOCUS_05510 5265 7061 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_05510 7109 9640 gene locus_tag LOCUS_05520 7109 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 9637 10383 gene locus_tag LOCUS_05530 gene kdsB 9637 10383 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_05530 10387 11211 gene locus_tag LOCUS_05540 gene kdsA 10387 11211 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_05540 11216 12181 gene locus_tag LOCUS_05550 11216 12181 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_05550 12182 12724 gene locus_tag LOCUS_05560 12182 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12724 13593 gene locus_tag LOCUS_05570 12724 13593 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021787.1 protein_id gnl|my_center|LOCUS_05570 13609 14157 gene locus_tag LOCUS_05580 13609 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14157 15014 gene locus_tag LOCUS_05590 14157 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 15027 15746 gene locus_tag LOCUS_05600 gene lptB 15027 15746 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_05600 15755 16846 gene locus_tag LOCUS_05610 gene lptG 15755 16846 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_05610 17066 17473 gene locus_tag LOCUS_05620 17066 17473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17470 18210 gene locus_tag LOCUS_05630 17470 18210 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_05630 18447 19670 gene locus_tag LOCUS_05640 18447 19670 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925128.1 protein_id gnl|my_center|LOCUS_05640 19663 20079 gene locus_tag LOCUS_05650 19663 20079 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_05650 20358 21656 gene locus_tag LOCUS_05660 20358 21656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 22037 23365 gene locus_tag LOCUS_05670 22037 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 23669 24940 gene locus_tag LOCUS_05680 23669 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 25249 26517 gene locus_tag LOCUS_05690 25249 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 27916 26639 gene locus_tag LOCUS_05700 27916 26639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence016 939 490 gene locus_tag LOCUS_05710 gene dtd 939 490 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_05710 3169 947 gene locus_tag LOCUS_05720 3169 947 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_05720 5522 3174 gene locus_tag LOCUS_05730 gene recJ 5522 3174 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941223.1 protein_id gnl|my_center|LOCUS_05730 5927 5532 gene locus_tag LOCUS_05740 5927 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7000 6053 gene locus_tag LOCUS_05750 7000 6053 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_05750 8180 7299 gene locus_tag LOCUS_05760 gene secF 8180 7299 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_05760 9430 8177 gene locus_tag LOCUS_05770 gene secD 9430 8177 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_05770 10018 9443 gene locus_tag LOCUS_05780 10018 9443 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_05780 10386 10018 gene locus_tag LOCUS_05790 10386 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11514 10393 gene locus_tag LOCUS_05800 gene tgt 11514 10393 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_05800 12541 11525 gene locus_tag LOCUS_05810 gene queA 12541 11525 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700557.1 protein_id gnl|my_center|LOCUS_05810 13860 12553 gene locus_tag LOCUS_05820 13860 12553 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039699.1 protein_id gnl|my_center|LOCUS_05820 14873 13857 gene locus_tag LOCUS_05830 gene ruvB 14873 13857 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_05830 15488 14874 gene locus_tag LOCUS_05840 gene ruvA 15488 14874 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052857.1 protein_id gnl|my_center|LOCUS_05840 15982 15485 gene locus_tag LOCUS_05850 gene ruvC 15982 15485 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_05850 16817 16086 gene locus_tag LOCUS_05860 16817 16086 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_05860 18421 16907 gene locus_tag LOCUS_05870 18421 16907 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_05870 20102 18633 gene locus_tag LOCUS_05880 gene thrC 20102 18633 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_05880 20334 22241 gene locus_tag LOCUS_05890 20334 22241 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396632.1 protein_id gnl|my_center|LOCUS_05890 22238 22723 gene locus_tag LOCUS_05900 22238 22723 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 protein_id gnl|my_center|LOCUS_05900 23037 22762 gene locus_tag LOCUS_05910 23037 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 23158 24129 gene locus_tag LOCUS_05920 gene bioB 23158 24129 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_05920 24708 24166 gene locus_tag LOCUS_05930 24708 24166 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_05930 26012 24858 gene locus_tag LOCUS_05940 26012 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 26235 27050 gene locus_tag LOCUS_05950 26235 27050 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_05950 27127 27212 gene locus_tag LOCUS_t00210 27127 27212 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 2859 904 gene locus_tag LOCUS_05960 2859 904 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_05960 3024 3938 gene locus_tag LOCUS_05970 3024 3938 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_05970 6243 3958 gene locus_tag LOCUS_05980 6243 3958 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_05980 7398 6271 gene locus_tag LOCUS_05990 7398 6271 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_05990 8743 7436 gene locus_tag LOCUS_06000 gene citS 8743 7436 CDS product citrate/sodium symporter CitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183602.1 protein_id gnl|my_center|LOCUS_06000 9641 8748 gene locus_tag LOCUS_06010 9641 8748 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 protein_id gnl|my_center|LOCUS_06010 10292 10891 gene locus_tag LOCUS_06020 10292 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 11487 10948 gene locus_tag LOCUS_06030 11487 10948 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461633.1 protein_id gnl|my_center|LOCUS_06030 12697 11555 gene locus_tag LOCUS_06040 12697 11555 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_06040 15090 12754 gene locus_tag LOCUS_06050 15090 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15617 15087 gene locus_tag LOCUS_06060 15617 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 15763 16734 gene locus_tag LOCUS_06070 15763 16734 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_06070 17144 16770 gene locus_tag LOCUS_06080 17144 16770 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_06080 18405 17137 gene locus_tag LOCUS_06090 18405 17137 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_06090 19935 18409 gene locus_tag LOCUS_06100 19935 18409 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_06100 21273 19951 gene locus_tag LOCUS_06110 21273 19951 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_06110 21514 22320 gene locus_tag LOCUS_06120 21514 22320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 23622 22354 gene locus_tag LOCUS_06130 23622 22354 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_06130 24181 23795 gene locus_tag LOCUS_06140 24181 23795 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 protein_id gnl|my_center|LOCUS_06140 25785 24178 gene locus_tag LOCUS_06150 25785 24178 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_06150 <27033 25802 gene locus_tag LOCUS_06160 <27033 25802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000879805.1:sodium:solute symporter family protein >Feature sequence018 2528 1560 gene locus_tag LOCUS_06170 2528 1560 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927183.1 protein_id gnl|my_center|LOCUS_06170 2765 3952 gene locus_tag LOCUS_06180 2765 3952 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860897.1 protein_id gnl|my_center|LOCUS_06180 3977 5077 gene locus_tag LOCUS_06190 3977 5077 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 protein_id gnl|my_center|LOCUS_06190 6519 5176 gene locus_tag LOCUS_06200 6519 5176 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_06200 7970 6675 gene locus_tag LOCUS_06210 7970 6675 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_06210 8962 8084 gene locus_tag LOCUS_06220 8962 8084 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 protein_id gnl|my_center|LOCUS_06220 10180 9032 gene locus_tag LOCUS_06230 gene dinB 10180 9032 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_06230 10814 10233 gene locus_tag LOCUS_06240 10814 10233 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_06240 11119 10811 gene locus_tag LOCUS_06250 11119 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12450 11215 gene locus_tag LOCUS_06260 12450 11215 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_06260 14009 12672 gene locus_tag LOCUS_06270 gene bioA 14009 12672 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_06270 14706 14020 gene locus_tag LOCUS_06280 gene bioD 14706 14020 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_06280 15429 14887 gene locus_tag LOCUS_06290 15429 14887 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868997.1 protein_id gnl|my_center|LOCUS_06290 15874 15608 gene locus_tag LOCUS_06300 15874 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 16873 16007 gene locus_tag LOCUS_06310 16873 16007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_06310 18158 16986 gene locus_tag LOCUS_06320 18158 16986 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_06320 18856 18233 gene locus_tag LOCUS_06330 18856 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 19015 19968 gene locus_tag LOCUS_06340 19015 19968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922313.1 protein_id gnl|my_center|LOCUS_06340 20069 21475 gene locus_tag LOCUS_06350 20069 21475 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852570.1 protein_id gnl|my_center|LOCUS_06350 21494 22435 gene locus_tag LOCUS_06360 gene glsA 21494 22435 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417962.1 protein_id gnl|my_center|LOCUS_06360 24154 22736 gene locus_tag LOCUS_06370 24154 22736 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797259.1 protein_id gnl|my_center|LOCUS_06370 24453 25688 gene locus_tag LOCUS_06380 gene gltS 24453 25688 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015836.1 protein_id gnl|my_center|LOCUS_06380 26063 25952 gene locus_tag LOCUS_r00020 26063 25952 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence019 1143 1445 gene locus_tag LOCUS_06390 1143 1445 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891186.1 protein_id gnl|my_center|LOCUS_06390 1458 2618 gene locus_tag LOCUS_06400 1458 2618 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_06400 2649 3857 gene locus_tag LOCUS_06410 2649 3857 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_06410 4846 3947 gene locus_tag LOCUS_06420 4846 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5017 5547 gene locus_tag LOCUS_06430 5017 5547 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_06430 6450 5620 gene locus_tag LOCUS_06440 6450 5620 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_06440 6643 7218 gene locus_tag LOCUS_06450 6643 7218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_06450 7234 8064 gene locus_tag LOCUS_06460 7234 8064 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_06460 8077 8997 gene locus_tag LOCUS_06470 8077 8997 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_06470 9987 9046 gene locus_tag LOCUS_06480 9987 9046 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948021.1 protein_id gnl|my_center|LOCUS_06480 11800 10238 gene locus_tag LOCUS_06490 11800 10238 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890637.1 protein_id gnl|my_center|LOCUS_06490 13544 12168 gene locus_tag LOCUS_06500 gene rlmD 13544 12168 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_06500 13811 14203 gene locus_tag LOCUS_06510 13811 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 14330 15310 gene locus_tag LOCUS_06520 14330 15310 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_06520 16107 15448 gene locus_tag LOCUS_06530 16107 15448 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 protein_id gnl|my_center|LOCUS_06530 16845 16183 gene locus_tag LOCUS_06540 16845 16183 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_06540 17251 18174 gene locus_tag LOCUS_06550 gene metA 17251 18174 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 protein_id gnl|my_center|LOCUS_06550 18299 18778 gene locus_tag LOCUS_06560 gene tadA 18299 18778 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_06560 18802 18889 gene locus_tag LOCUS_t00220 18802 18889 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19026 20426 gene locus_tag LOCUS_06570 19026 20426 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_06570 20783 20693 gene locus_tag LOCUS_t00230 20783 20693 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20966 22981 gene locus_tag LOCUS_06580 20966 22981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 23018 23350 gene locus_tag LOCUS_06590 23018 23350 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_06590 23366 23962 gene locus_tag LOCUS_06600 gene recR 23366 23962 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_06600 24023 24268 gene locus_tag LOCUS_06610 24023 24268 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359493.1 protein_id gnl|my_center|LOCUS_06610 24270 24668 gene locus_tag LOCUS_06620 24270 24668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 24697 25641 gene locus_tag LOCUS_06630 24697 25641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence020 <1 992 gene locus_tag LOCUS_06640 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393179.1:histidine--tRNA ligase 1014 2810 gene locus_tag LOCUS_06650 gene aspS 1014 2810 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_06650 2851 3072 gene locus_tag LOCUS_06660 2851 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3745 3191 gene locus_tag LOCUS_06670 3745 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4122 4772 gene locus_tag LOCUS_06680 4122 4772 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_06680 5049 5528 gene locus_tag LOCUS_06690 gene lspA 5049 5528 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_06690 5450 6442 gene locus_tag LOCUS_06700 5450 6442 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_06700 6458 7009 gene locus_tag LOCUS_06710 gene pyrR 6458 7009 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_06710 7022 10585 gene locus_tag LOCUS_06720 gene smc 7022 10585 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989816.1 protein_id gnl|my_center|LOCUS_06720 10582 11499 gene locus_tag LOCUS_06730 gene ftsY 10582 11499 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_06730 12294 11533 gene locus_tag LOCUS_06740 12294 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 13129 13773 gene locus_tag LOCUS_06750 13129 13773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 13996 22746 gene locus_tag LOCUS_06760 13996 22746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06760 23213 24340 gene locus_tag LOCUS_06770 23213 24340 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_06770 24350 25687 gene locus_tag LOCUS_06780 24350 25687 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243743.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence021 1917 1126 gene locus_tag LOCUS_06790 1917 1126 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_06790 2795 1938 gene locus_tag LOCUS_06800 2795 1938 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_06800 4088 2937 gene locus_tag LOCUS_06810 4088 2937 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965998.1 protein_id gnl|my_center|LOCUS_06810 5357 4170 gene locus_tag LOCUS_06820 5357 4170 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_06820 5948 5547 gene locus_tag LOCUS_06830 5948 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 7485 5959 gene locus_tag LOCUS_06840 7485 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 8171 7542 gene locus_tag LOCUS_06850 gene nth 8171 7542 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_06850 9532 8171 gene locus_tag LOCUS_06860 9532 8171 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_06860 9814 9545 gene locus_tag LOCUS_06870 9814 9545 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_06870 10196 11071 gene locus_tag LOCUS_06880 10196 11071 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_06880 12039 11284 gene locus_tag LOCUS_06890 12039 11284 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419950.1 protein_id gnl|my_center|LOCUS_06890 12766 12044 gene locus_tag LOCUS_06900 12766 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13342 12833 gene locus_tag LOCUS_06910 13342 12833 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052318.1 protein_id gnl|my_center|LOCUS_06910 14311 13394 gene locus_tag LOCUS_06920 gene trxB 14311 13394 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_06920 14634 14308 gene locus_tag LOCUS_06930 14634 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16102 14795 gene locus_tag LOCUS_06940 16102 14795 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626527.1 protein_id gnl|my_center|LOCUS_06940 16594 16160 gene locus_tag LOCUS_06950 16594 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 16935 16735 gene locus_tag LOCUS_06960 16935 16735 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198960.1 protein_id gnl|my_center|LOCUS_06960 17269 16979 gene locus_tag LOCUS_06970 17269 16979 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461875.1 protein_id gnl|my_center|LOCUS_06970 20182 17378 gene locus_tag LOCUS_06980 gene ileS 20182 17378 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_06980 21257 20475 gene locus_tag LOCUS_06990 21257 20475 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435374.1 protein_id gnl|my_center|LOCUS_06990 21913 21254 gene locus_tag LOCUS_07000 21913 21254 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_07000 23258 21930 gene locus_tag LOCUS_07010 23258 21930 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_07010 24283 23270 gene locus_tag LOCUS_07020 24283 23270 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_07020 24522 25673 gene locus_tag LOCUS_07030 24522 25673 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_07030 25687 25809 gene locus_tag LOCUS_07040 25687 25809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 26085 25918 gene locus_tag LOCUS_07050 26085 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence022 2867 588 gene locus_tag LOCUS_07060 gene pflB 2867 588 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_07060 3710 2979 gene locus_tag LOCUS_07070 gene pflA 3710 2979 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_07070 4590 3898 gene locus_tag LOCUS_07080 4590 3898 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_07080 5975 4587 gene locus_tag LOCUS_07090 5975 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7015 6089 gene locus_tag LOCUS_07100 gene argC 7015 6089 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_07100 7334 7131 gene locus_tag LOCUS_07110 7334 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8812 7331 gene locus_tag LOCUS_07120 8812 7331 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_07120 9447 9007 gene locus_tag LOCUS_07130 9447 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 10276 9464 gene locus_tag LOCUS_07140 10276 9464 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966216.1 protein_id gnl|my_center|LOCUS_07140 10453 10379 gene locus_tag LOCUS_t00240 10453 10379 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11303 10512 gene locus_tag LOCUS_07150 11303 10512 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_07150 12012 11317 gene locus_tag LOCUS_07160 12012 11317 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853332.1 protein_id gnl|my_center|LOCUS_07160 12988 12110 gene locus_tag LOCUS_07170 12988 12110 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461725.1 protein_id gnl|my_center|LOCUS_07170 13770 13045 gene locus_tag LOCUS_07180 13770 13045 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_07180 14321 15172 gene locus_tag LOCUS_07190 gene panC 14321 15172 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_07190 15177 16151 gene locus_tag LOCUS_07200 15177 16151 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_07200 17610 16366 gene locus_tag LOCUS_07210 17610 16366 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105913.1 protein_id gnl|my_center|LOCUS_07210 17835 17710 gene locus_tag LOCUS_07220 17835 17710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 20697 17938 gene locus_tag LOCUS_07230 gene mgtA 20697 17938 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_07230 20961 20737 gene locus_tag LOCUS_07240 20961 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 22666 21380 gene locus_tag LOCUS_07250 22666 21380 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_07250 23377 22688 gene locus_tag LOCUS_07260 gene pssA 23377 22688 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444818.1 protein_id gnl|my_center|LOCUS_07260 24021 23374 gene locus_tag LOCUS_07270 24021 23374 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_07270 24855 24112 gene locus_tag LOCUS_07280 24855 24112 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_07280 25862 24984 gene locus_tag LOCUS_07290 25862 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence023 16 1578 gene locus_tag LOCUS_07300 16 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2333 1608 gene locus_tag LOCUS_07310 gene lgt 2333 1608 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_07310 3275 2571 gene locus_tag LOCUS_07320 3275 2571 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_07320 3431 5920 gene locus_tag LOCUS_07330 gene leuS 3431 5920 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07330 6045 7490 gene locus_tag LOCUS_07340 6045 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7487 8107 gene locus_tag LOCUS_07350 gene tmk 7487 8107 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_07350 8133 9170 gene locus_tag LOCUS_07360 gene holB 8133 9170 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583155.1 protein_id gnl|my_center|LOCUS_07360 9186 10028 gene locus_tag LOCUS_07370 9186 10028 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_07370 10028 10762 gene locus_tag LOCUS_07380 10028 10762 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_07380 10752 11582 gene locus_tag LOCUS_07390 gene rsmI 10752 11582 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_07390 12580 11705 gene locus_tag LOCUS_07400 12580 11705 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_07400 12692 13711 gene locus_tag LOCUS_07410 12692 13711 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_07410 14148 15488 gene locus_tag LOCUS_07420 14148 15488 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_07420 15535 16128 gene locus_tag LOCUS_07430 15535 16128 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_07430 16192 16647 gene locus_tag LOCUS_07440 gene bcp 16192 16647 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_07440 16644 17402 gene locus_tag LOCUS_07450 gene yaaA 16644 17402 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 protein_id gnl|my_center|LOCUS_07450 17433 18518 gene locus_tag LOCUS_07460 17433 18518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 18616 19401 gene locus_tag LOCUS_07470 18616 19401 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_07470 19517 20296 gene locus_tag LOCUS_07480 19517 20296 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_07480 20324 20980 gene locus_tag LOCUS_07490 20324 20980 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462201.1 protein_id gnl|my_center|LOCUS_07490 20970 21701 gene locus_tag LOCUS_07500 20970 21701 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_07500 21849 22394 gene locus_tag LOCUS_07510 gene raiA 21849 22394 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815573.1 protein_id gnl|my_center|LOCUS_07510 22566 25043 gene locus_tag LOCUS_07520 gene secA 22566 25043 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence024 1525 38 gene locus_tag LOCUS_07530 gene putP 1525 38 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_07530 1794 2273 gene locus_tag LOCUS_07540 1794 2273 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295125.1 protein_id gnl|my_center|LOCUS_07540 2215 3873 gene locus_tag LOCUS_07550 gene argS 2215 3873 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_07550 3908 5527 gene locus_tag LOCUS_07560 3908 5527 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462257.1 protein_id gnl|my_center|LOCUS_07560 5598 6560 gene locus_tag LOCUS_07570 gene glpX 5598 6560 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_07570 6658 9936 gene locus_tag LOCUS_07580 6658 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 10024 11571 gene locus_tag LOCUS_07590 10024 11571 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_07590 11582 12394 gene locus_tag LOCUS_07600 gene mazG 11582 12394 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_07600 12556 12831 gene locus_tag LOCUS_07610 12556 12831 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_07610 12923 13204 gene locus_tag LOCUS_07620 12923 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 14472 13624 gene locus_tag LOCUS_07630 14472 13624 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942056.1 protein_id gnl|my_center|LOCUS_07630 14750 15352 gene locus_tag LOCUS_07640 14750 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 15751 16764 gene locus_tag LOCUS_07650 gene aroF 15751 16764 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_07650 16789 17661 gene locus_tag LOCUS_07660 16789 17661 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_07660 17642 18706 gene locus_tag LOCUS_07670 gene aroB 17642 18706 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_07670 18711 20003 gene locus_tag LOCUS_07680 gene aroA 18711 20003 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_07680 19984 21072 gene locus_tag LOCUS_07690 gene aroC 19984 21072 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_07690 21077 21928 gene locus_tag LOCUS_07700 21077 21928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 21925 22749 gene locus_tag LOCUS_07710 21925 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 22742 23242 gene locus_tag LOCUS_07720 22742 23242 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439413.1 protein_id gnl|my_center|LOCUS_07720 24366 23317 gene locus_tag LOCUS_07730 24366 23317 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_07730 24478 25707 gene locus_tag LOCUS_07740 24478 25707 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence025 236 880 gene locus_tag LOCUS_07750 236 880 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_07750 967 2799 gene locus_tag LOCUS_07760 967 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2872 3396 gene locus_tag LOCUS_07770 2872 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3461 4099 gene locus_tag LOCUS_07780 3461 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4336 5244 gene locus_tag LOCUS_07790 4336 5244 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 protein_id gnl|my_center|LOCUS_07790 5302 6630 gene locus_tag LOCUS_07800 5302 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6787 8400 gene locus_tag LOCUS_07810 6787 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8381 8971 gene locus_tag LOCUS_07820 gene gmhA 8381 8971 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_07820 8964 10442 gene locus_tag LOCUS_07830 gene rfaE2 8964 10442 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870427.1 protein_id gnl|my_center|LOCUS_07830 10439 11407 gene locus_tag LOCUS_07840 gene rfaD 10439 11407 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_07840 11404 11931 gene locus_tag LOCUS_07850 11404 11931 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923322.1 protein_id gnl|my_center|LOCUS_07850 11928 12980 gene locus_tag LOCUS_07860 gene waaC 11928 12980 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_07860 12973 14007 gene locus_tag LOCUS_07870 gene waaF 12973 14007 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_07870 14091 14166 gene locus_tag LOCUS_t00250 14091 14166 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14175 14249 gene locus_tag LOCUS_t00260 14175 14249 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14256 14331 gene locus_tag LOCUS_t00270 14256 14331 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14348 14500 gene locus_tag LOCUS_07880 14348 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 14736 15206 gene locus_tag LOCUS_07890 14736 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15203 16201 gene locus_tag LOCUS_07900 gene floA 15203 16201 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_07900 16214 16615 gene locus_tag LOCUS_07910 16214 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 16831 18372 gene locus_tag LOCUS_07920 gene abgT 16831 18372 CDS product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062979.1 protein_id gnl|my_center|LOCUS_07920 18457 18855 gene locus_tag LOCUS_07930 18457 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 19122 19586 gene locus_tag LOCUS_07940 gene queF 19122 19586 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_07940 19579 20277 gene locus_tag LOCUS_07950 gene queC 19579 20277 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_07950 20280 20606 gene locus_tag LOCUS_07960 20280 20606 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_07960 20596 21252 gene locus_tag LOCUS_07970 gene queE 20596 21252 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949101.1 protein_id gnl|my_center|LOCUS_07970 23664 21391 gene locus_tag LOCUS_07980 23664 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 <24571 23664 gene locus_tag LOCUS_07990 <24571 23664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072763.1:exonuclease SbcCD subunit D >Feature sequence026 2127 565 gene locus_tag LOCUS_08000 gene citF 2127 565 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_08000 3040 2129 gene locus_tag LOCUS_08010 gene citE 3040 2129 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_08010 3341 3042 gene locus_tag LOCUS_08020 gene citD 3341 3042 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641303.1 protein_id gnl|my_center|LOCUS_08020 3583 4494 gene locus_tag LOCUS_08030 3583 4494 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_08030 4503 5891 gene locus_tag LOCUS_08040 gene citG 4503 5891 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_08040 6347 7825 gene locus_tag LOCUS_08050 6347 7825 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_08050 7872 8093 gene locus_tag LOCUS_08060 7872 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9016 8132 gene locus_tag LOCUS_08070 gene sdaAA 9016 8132 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671221.1 protein_id gnl|my_center|LOCUS_08070 9693 9028 gene locus_tag LOCUS_08080 gene sdaAB 9693 9028 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_08080 11094 9904 gene locus_tag LOCUS_08090 11094 9904 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_08090 11261 12220 gene locus_tag LOCUS_08100 11261 12220 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_08100 12279 12485 gene locus_tag LOCUS_08110 gene rpmE 12279 12485 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_08110 12558 13442 gene locus_tag LOCUS_08120 12558 13442 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_08120 13455 14531 gene locus_tag LOCUS_08130 gene prfA 13455 14531 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_08130 14533 15441 gene locus_tag LOCUS_08140 gene prmC 14533 15441 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_08140 15407 16513 gene locus_tag LOCUS_08150 15407 16513 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_08150 16581 17018 gene locus_tag LOCUS_08160 gene rpiB 16581 17018 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430700.1 protein_id gnl|my_center|LOCUS_08160 17028 17570 gene locus_tag LOCUS_08170 17028 17570 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 protein_id gnl|my_center|LOCUS_08170 17624 18871 gene locus_tag LOCUS_08180 17624 18871 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_08180 18894 19520 gene locus_tag LOCUS_08190 gene upp 18894 19520 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_08190 19524 19976 gene locus_tag LOCUS_08200 19524 19976 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_08200 20900 20028 gene locus_tag LOCUS_08210 20900 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 21059 22039 gene locus_tag LOCUS_08220 21059 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 22123 22689 gene locus_tag LOCUS_08230 22123 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 22699 24156 gene locus_tag LOCUS_08240 22699 24156 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306203.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence027 3 218 gene locus_tag LOCUS_08250 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 1832 285 gene locus_tag LOCUS_08260 1832 285 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957212.1 protein_id gnl|my_center|LOCUS_08260 2093 4000 gene locus_tag LOCUS_08270 gene ftsH 2093 4000 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428619.1 protein_id gnl|my_center|LOCUS_08270 4191 5786 gene locus_tag LOCUS_08280 4191 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7585 6056 gene locus_tag LOCUS_08290 gene ppx 7585 6056 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 protein_id gnl|my_center|LOCUS_08290 7740 9299 gene locus_tag LOCUS_08300 7740 9299 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_08300 9299 11407 gene locus_tag LOCUS_08310 9299 11407 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_08310 11457 11774 gene locus_tag LOCUS_08320 11457 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11921 12472 gene locus_tag LOCUS_08330 11921 12472 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_08330 13003 12671 gene locus_tag LOCUS_08340 gene azlD 13003 12671 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_08340 13761 13000 gene locus_tag LOCUS_08350 gene azlC 13761 13000 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_08350 13660 13857 gene locus_tag LOCUS_08360 13660 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13989 15395 gene locus_tag LOCUS_08370 13989 15395 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986562.1 protein_id gnl|my_center|LOCUS_08370 15490 16353 gene locus_tag LOCUS_08380 gene metF 15490 16353 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_08380 16367 17068 gene locus_tag LOCUS_08390 16367 17068 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_08390 17065 19482 gene locus_tag LOCUS_08400 17065 19482 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_08400 19547 20248 gene locus_tag LOCUS_08410 19547 20248 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_08410 20250 21554 gene locus_tag LOCUS_08420 20250 21554 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_08420 21601 22977 gene locus_tag LOCUS_08430 gene emmdR 21601 22977 CDS product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 protein_id gnl|my_center|LOCUS_08430 22991 24100 gene locus_tag LOCUS_08440 gene hydE 22991 24100 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence028 217 1815 gene locus_tag LOCUS_08450 217 1815 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868946.1 protein_id gnl|my_center|LOCUS_08450 1868 3349 gene locus_tag LOCUS_08460 gene hutH 1868 3349 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_08460 3608 4912 gene locus_tag LOCUS_08470 3608 4912 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869229.1 protein_id gnl|my_center|LOCUS_08470 4984 6543 gene locus_tag LOCUS_08480 gene hutH 4984 6543 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_08480 8062 6647 gene locus_tag LOCUS_08490 8062 6647 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_08490 8277 9908 gene locus_tag LOCUS_08500 8277 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10016 11167 gene locus_tag LOCUS_08510 gene eefA 10016 11167 CDS product multidrug efflux RND transporter periplasmic adaptor subunit EefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703858.1 protein_id gnl|my_center|LOCUS_08510 11181 14330 gene locus_tag LOCUS_08520 11181 14330 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_08520 14450 16207 gene locus_tag LOCUS_08530 14450 16207 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105053.1 protein_id gnl|my_center|LOCUS_08530 16230 17582 gene locus_tag LOCUS_08540 16230 17582 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_08540 17869 19050 gene locus_tag LOCUS_08550 17869 19050 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_08550 19160 19912 gene locus_tag LOCUS_08560 gene rlmB 19160 19912 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_08560 19930 20664 gene locus_tag LOCUS_08570 gene sigH 19930 20664 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_08570 20785 21246 gene locus_tag LOCUS_08580 20785 21246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 21269 22387 gene locus_tag LOCUS_08590 21269 22387 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_08590 22529 23341 gene locus_tag LOCUS_08600 gene uppP 22529 23341 CDS product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796238.1 protein_id gnl|my_center|LOCUS_08600 23473 23548 gene locus_tag LOCUS_t00280 23473 23548 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23571 23655 gene locus_tag LOCUS_t00290 23571 23655 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 23661 23736 gene locus_tag LOCUS_t00300 23661 23736 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23740 23815 gene locus_tag LOCUS_t00310 23740 23815 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23822 23898 gene locus_tag LOCUS_t00320 23822 23898 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 818 243 gene locus_tag LOCUS_08610 818 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1391 834 gene locus_tag LOCUS_08620 1391 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2836 1484 gene locus_tag LOCUS_08630 2836 1484 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245209.1 protein_id gnl|my_center|LOCUS_08630 3584 2949 gene locus_tag LOCUS_08640 3584 2949 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_08640 4979 3588 gene locus_tag LOCUS_08650 4979 3588 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_08650 6744 4972 gene locus_tag LOCUS_08660 6744 4972 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_08660 7080 6754 gene locus_tag LOCUS_08670 7080 6754 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_08670 8102 7107 gene locus_tag LOCUS_08680 8102 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8712 8104 gene locus_tag LOCUS_08690 8712 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 9205 8729 gene locus_tag LOCUS_08700 9205 8729 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_08700 11076 9220 gene locus_tag LOCUS_08710 11076 9220 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_08710 11381 11070 gene locus_tag LOCUS_08720 11381 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11704 12945 gene locus_tag LOCUS_08730 11704 12945 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_08730 14383 12989 gene locus_tag LOCUS_08740 14383 12989 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323650.1 protein_id gnl|my_center|LOCUS_08740 15289 14501 gene locus_tag LOCUS_08750 gene ygiD 15289 14501 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_08750 15439 15786 gene locus_tag LOCUS_08760 15439 15786 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814177.1 protein_id gnl|my_center|LOCUS_08760 17485 15827 gene locus_tag LOCUS_08770 17485 15827 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_08770 18603 17620 gene locus_tag LOCUS_08780 18603 17620 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_08780 18797 19336 gene locus_tag LOCUS_08790 18797 19336 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641608.1 protein_id gnl|my_center|LOCUS_08790 19662 20618 gene locus_tag LOCUS_08800 19662 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 21715 20816 gene locus_tag LOCUS_08810 21715 20816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 22077 23291 gene locus_tag LOCUS_08820 22077 23291 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016518.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence030 148 1707 gene locus_tag LOCUS_08830 gene pckA 148 1707 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_08830 2011 2490 gene locus_tag LOCUS_08840 gene tsaE 2011 2490 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_08840 2495 3196 gene locus_tag LOCUS_08850 gene tsaB 2495 3196 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_08850 3166 3621 gene locus_tag LOCUS_08860 gene rimI 3166 3621 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_08860 3634 4653 gene locus_tag LOCUS_08870 gene tsaD 3634 4653 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_08870 5944 4733 gene locus_tag LOCUS_08880 5944 4733 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_08880 7868 5961 gene locus_tag LOCUS_08890 7868 5961 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_08890 8900 8004 gene locus_tag LOCUS_08900 8900 8004 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_08900 9011 9430 gene locus_tag LOCUS_08910 9011 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9696 10700 gene locus_tag LOCUS_08920 9696 10700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 10865 12619 gene locus_tag LOCUS_08930 10865 12619 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_08930 12854 13171 gene locus_tag LOCUS_08940 12854 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13164 13409 gene locus_tag LOCUS_08950 13164 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13431 14063 gene locus_tag LOCUS_08960 13431 14063 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_08960 14245 14105 gene locus_tag LOCUS_08970 14245 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 16530 14365 gene locus_tag LOCUS_08980 gene feoB 16530 14365 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_08980 16831 16604 gene locus_tag LOCUS_08990 16831 16604 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08990 17061 16849 gene locus_tag LOCUS_09000 17061 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18175 17279 gene locus_tag LOCUS_09010 18175 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 18404 19222 gene locus_tag LOCUS_09020 gene map 18404 19222 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761263.1 protein_id gnl|my_center|LOCUS_09020 19371 19877 gene locus_tag LOCUS_09030 19371 19877 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_09030 20446 19916 gene locus_tag LOCUS_09040 20446 19916 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_09040 21847 20549 gene locus_tag LOCUS_09050 21847 20549 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_09050 22458 21964 gene locus_tag LOCUS_09060 22458 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence031 1438 179 gene locus_tag LOCUS_09070 1438 179 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_09070 2322 1435 gene locus_tag LOCUS_09080 2322 1435 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_09080 3108 2338 gene locus_tag LOCUS_09090 3108 2338 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_09090 4499 3102 gene locus_tag LOCUS_09100 4499 3102 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_09100 5319 4597 gene locus_tag LOCUS_09110 5319 4597 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_09110 6755 5307 gene locus_tag LOCUS_09120 6755 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7423 6770 gene locus_tag LOCUS_09130 gene uppC 7423 6770 CDS product polysaccharide export protein UppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971492.1 protein_id gnl|my_center|LOCUS_09130 8649 7855 gene locus_tag LOCUS_09140 8649 7855 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_09140 10138 8696 gene locus_tag LOCUS_09150 10138 8696 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_09150 11509 10154 gene locus_tag LOCUS_09160 gene trkA 11509 10154 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09160 12258 11710 gene locus_tag LOCUS_09170 12258 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 13396 12314 gene locus_tag LOCUS_09180 13396 12314 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_09180 15469 13721 gene locus_tag LOCUS_09190 gene pyk 15469 13721 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_09190 16606 15584 gene locus_tag LOCUS_09200 16606 15584 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_09200 17410 16619 gene locus_tag LOCUS_09210 17410 16619 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_09210 21133 17717 gene locus_tag LOCUS_09220 21133 17717 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_09220 21608 21285 gene locus_tag LOCUS_09230 21608 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 <22822 21813 gene locus_tag LOCUS_09240 <22822 21813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964991.1:translational GTPase TypA >Feature sequence032 1209 211 gene locus_tag LOCUS_09250 1209 211 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_09250 1420 2445 gene locus_tag LOCUS_09260 1420 2445 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_09260 2802 4475 gene locus_tag LOCUS_09270 2802 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 4738 6405 gene locus_tag LOCUS_09280 4738 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7168 6464 gene locus_tag LOCUS_09290 gene rncS 7168 6464 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_09290 8428 7181 gene locus_tag LOCUS_09300 gene fabF 8428 7181 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_09300 9393 8440 gene locus_tag LOCUS_09310 9393 8440 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_09310 9723 9481 gene locus_tag LOCUS_09320 gene acpP 9723 9481 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_09320 10507 9764 gene locus_tag LOCUS_09330 gene fabG 10507 9764 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_09330 11456 10509 gene locus_tag LOCUS_09340 gene fabD 11456 10509 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_09340 12463 11453 gene locus_tag LOCUS_09350 12463 11453 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_09350 13480 12464 gene locus_tag LOCUS_09360 gene plsX 13480 12464 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_09360 14054 13464 gene locus_tag LOCUS_09370 gene fapR 14054 13464 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774378.1 protein_id gnl|my_center|LOCUS_09370 14827 14171 gene locus_tag LOCUS_09380 gene fsa 14827 14171 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722103.1 protein_id gnl|my_center|LOCUS_09380 15157 14975 gene locus_tag LOCUS_09390 gene rpmF 15157 14975 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_09390 15685 15182 gene locus_tag LOCUS_09400 15685 15182 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_09400 16944 15748 gene locus_tag LOCUS_09410 16944 15748 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_09410 17060 18283 gene locus_tag LOCUS_09420 17060 18283 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869853.1 protein_id gnl|my_center|LOCUS_09420 18881 18315 gene locus_tag LOCUS_09430 18881 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 19402 18908 gene locus_tag LOCUS_09440 gene coaD 19402 18908 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_09440 20010 19456 gene locus_tag LOCUS_09450 gene rsmD 20010 19456 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_09450 20071 21726 gene locus_tag LOCUS_09460 20071 21726 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_09460 21751 21827 gene locus_tag LOCUS_t00330 21751 21827 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 2062 323 gene locus_tag LOCUS_09470 2062 323 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 protein_id gnl|my_center|LOCUS_09470 2166 2789 gene locus_tag LOCUS_09480 2166 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2803 3699 gene locus_tag LOCUS_09490 2803 3699 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_09490 3720 4010 gene locus_tag LOCUS_09500 3720 4010 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_09500 4003 4647 gene locus_tag LOCUS_09510 gene gmk 4003 4647 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_09510 4663 4884 gene locus_tag LOCUS_09520 4663 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4898 6097 gene locus_tag LOCUS_09530 gene coaBC 4898 6097 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_09530 6187 6663 gene locus_tag LOCUS_09540 6187 6663 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847065.1 protein_id gnl|my_center|LOCUS_09540 6727 8142 gene locus_tag LOCUS_09550 6727 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8156 9154 gene locus_tag LOCUS_09560 8156 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259165.1 protein_id gnl|my_center|LOCUS_09560 9138 9398 gene locus_tag LOCUS_09570 9138 9398 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 protein_id gnl|my_center|LOCUS_09570 10187 9675 gene locus_tag LOCUS_09580 10187 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 10671 10759 gene locus_tag LOCUS_t00340 10671 10759 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10820 11344 gene locus_tag LOCUS_09590 10820 11344 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_09590 11376 12485 gene locus_tag LOCUS_09600 gene hydE 11376 12485 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_09600 12613 12822 gene locus_tag LOCUS_09610 12613 12822 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_09610 12837 13445 gene locus_tag LOCUS_09620 12837 13445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 protein_id gnl|my_center|LOCUS_09620 13458 14018 gene locus_tag LOCUS_09630 13458 14018 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_09630 14118 15551 gene locus_tag LOCUS_09640 14118 15551 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972982.1 protein_id gnl|my_center|LOCUS_09640 15877 15647 gene locus_tag LOCUS_09650 15877 15647 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_09650 17490 16027 gene locus_tag LOCUS_09660 17490 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 17805 21626 gene locus_tag LOCUS_09670 17805 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence034 14 298 gene locus_tag LOCUS_09680 14 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 633 3818 gene locus_tag LOCUS_09690 633 3818 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_09690 5348 4044 gene locus_tag LOCUS_09700 gene abgA 5348 4044 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444925.1 protein_id gnl|my_center|LOCUS_09700 7005 5401 gene locus_tag LOCUS_09710 7005 5401 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_09710 8194 7073 gene locus_tag LOCUS_09720 8194 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 8837 8316 gene locus_tag LOCUS_09730 8837 8316 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_09730 10037 8982 gene locus_tag LOCUS_09740 10037 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11409 10243 gene locus_tag LOCUS_09750 11409 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12794 11418 gene locus_tag LOCUS_09760 gene gltA 12794 11418 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_09760 13645 12803 gene locus_tag LOCUS_09770 13645 12803 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_09770 15172 13889 gene locus_tag LOCUS_09780 15172 13889 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_09780 16009 15182 gene locus_tag LOCUS_09790 gene mtnP 16009 15182 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583293.1 protein_id gnl|my_center|LOCUS_09790 16686 16015 gene locus_tag LOCUS_09800 16686 16015 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_09800 20144 16794 gene locus_tag LOCUS_09810 20144 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 21576 20149 gene locus_tag LOCUS_09820 21576 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence035 1554 472 gene locus_tag LOCUS_09830 1554 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2424 1681 gene locus_tag LOCUS_09840 2424 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3277 2507 gene locus_tag LOCUS_09850 3277 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3686 3270 gene locus_tag LOCUS_09860 3686 3270 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_09860 4321 3683 gene locus_tag LOCUS_09870 4321 3683 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_09870 5153 4326 gene locus_tag LOCUS_09880 5153 4326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_09880 6111 5155 gene locus_tag LOCUS_09890 6111 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7485 6166 gene locus_tag LOCUS_09900 7485 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8131 7490 gene locus_tag LOCUS_09910 gene rpe 8131 7490 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_09910 9015 8128 gene locus_tag LOCUS_09920 gene rsgA 9015 8128 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_09920 10985 9012 gene locus_tag LOCUS_09930 gene pknB 10985 9012 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_09930 11701 10970 gene locus_tag LOCUS_09940 11701 10970 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_09940 12759 11698 gene locus_tag LOCUS_09950 gene rlmN 12759 11698 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_09950 14108 12768 gene locus_tag LOCUS_09960 gene rsmB 14108 12768 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_09960 14878 14105 gene locus_tag LOCUS_09970 14878 14105 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_09970 15821 14883 gene locus_tag LOCUS_09980 gene fmt 15821 14883 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_09980 16294 15818 gene locus_tag LOCUS_09990 gene def 16294 15818 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_09990 18847 16454 gene locus_tag LOCUS_10000 gene priA 18847 16454 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_10000 20027 18849 gene locus_tag LOCUS_10010 gene metK 20027 18849 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_10010 21293 20247 gene locus_tag LOCUS_10020 gene citC 21293 20247 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263235.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence036 1267 569 gene locus_tag LOCUS_10030 1267 569 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_10030 2395 1487 gene locus_tag LOCUS_10040 2395 1487 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_10040 2719 4062 gene locus_tag LOCUS_10050 gene rsxC 2719 4062 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_10050 4089 5123 gene locus_tag LOCUS_10060 4089 5123 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_10060 5120 5689 gene locus_tag LOCUS_10070 5120 5689 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_10070 5695 6291 gene locus_tag LOCUS_10080 5695 6291 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_10080 6284 6859 gene locus_tag LOCUS_10090 6284 6859 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_10090 6877 7794 gene locus_tag LOCUS_10100 6877 7794 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_10100 7900 8808 gene locus_tag LOCUS_10110 7900 8808 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_10110 8818 9195 gene locus_tag LOCUS_10120 8818 9195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9179 9703 gene locus_tag LOCUS_10130 9179 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9987 10634 gene locus_tag LOCUS_10140 9987 10634 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_10140 10697 12094 gene locus_tag LOCUS_10150 gene amrA 10697 12094 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_10150 12091 12933 gene locus_tag LOCUS_10160 gene amrS 12091 12933 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_10160 13296 12973 gene locus_tag LOCUS_10170 13296 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 14009 13311 gene locus_tag LOCUS_10180 14009 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15545 14136 gene locus_tag LOCUS_10190 15545 14136 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 protein_id gnl|my_center|LOCUS_10190 16221 15547 gene locus_tag LOCUS_10200 16221 15547 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_10200 18172 16850 gene locus_tag LOCUS_10210 18172 16850 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 protein_id gnl|my_center|LOCUS_10210 20543 18255 gene locus_tag LOCUS_10220 20543 18255 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence037 440 1354 gene locus_tag LOCUS_10230 440 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1351 2700 gene locus_tag LOCUS_10240 1351 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3456 2728 gene locus_tag LOCUS_10250 3456 2728 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813911.1 protein_id gnl|my_center|LOCUS_10250 4020 9380 gene locus_tag LOCUS_10260 4020 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10552 9482 gene locus_tag LOCUS_10270 gene mnmA 10552 9482 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_10270 11715 10564 gene locus_tag LOCUS_10280 11715 10564 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_10280 11960 12244 gene locus_tag LOCUS_10290 gene rpsF 11960 12244 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_10290 12258 12701 gene locus_tag LOCUS_10300 gene ssb 12258 12701 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_10300 12723 12959 gene locus_tag LOCUS_10310 gene rpsR 12723 12959 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10310 13109 14065 gene locus_tag LOCUS_10320 13109 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14077 16125 gene locus_tag LOCUS_10330 14077 16125 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470520.1 protein_id gnl|my_center|LOCUS_10330 16085 16537 gene locus_tag LOCUS_10340 gene rplI 16085 16537 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_10340 16679 18010 gene locus_tag LOCUS_10350 gene dnaB 16679 18010 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_10350 18207 19499 gene locus_tag LOCUS_10360 gene purB 18207 19499 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_10360 19520 20809 gene locus_tag LOCUS_10370 19520 20809 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence038 <1 1218 gene locus_tag LOCUS_10380 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704465.1:LTA synthase family protein 1273 2637 gene locus_tag LOCUS_10390 1273 2637 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812207.1 protein_id gnl|my_center|LOCUS_10390 3572 2664 gene locus_tag LOCUS_10400 3572 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3705 4583 gene locus_tag LOCUS_10410 3705 4583 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_10410 5352 4780 gene locus_tag LOCUS_10420 5352 4780 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_10420 5891 5352 gene locus_tag LOCUS_10430 5891 5352 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_10430 6126 7139 gene locus_tag LOCUS_10440 6126 7139 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_10440 7157 8323 gene locus_tag LOCUS_10450 gene wecB 7157 8323 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_10450 8330 8746 gene locus_tag LOCUS_10460 8330 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 8799 9509 gene locus_tag LOCUS_10470 gene atpB 8799 9509 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_10470 9535 9792 gene locus_tag LOCUS_10480 gene atpE 9535 9792 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_10480 9846 10337 gene locus_tag LOCUS_10490 9846 10337 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966153.1 protein_id gnl|my_center|LOCUS_10490 10376 12232 gene locus_tag LOCUS_10500 gene atpA 10376 12232 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_10500 12248 13156 gene locus_tag LOCUS_10510 12248 13156 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_10510 13171 14646 gene locus_tag LOCUS_10520 gene atpD 13171 14646 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_10520 14643 15092 gene locus_tag LOCUS_10530 14643 15092 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_10530 15135 15326 gene locus_tag LOCUS_10540 15135 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 15471 15896 gene locus_tag LOCUS_10550 15471 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 15904 17226 gene locus_tag LOCUS_10560 gene murA 15904 17226 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_10560 17233 18264 gene locus_tag LOCUS_10570 17233 18264 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_10570 18347 19756 gene locus_tag LOCUS_10580 18347 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence039 2230 857 gene locus_tag LOCUS_10590 gene murD 2230 857 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_10590 3456 2494 gene locus_tag LOCUS_10600 gene mraY 3456 2494 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_10600 4832 3450 gene locus_tag LOCUS_10610 4832 3450 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611464.1 protein_id gnl|my_center|LOCUS_10610 6318 4825 gene locus_tag LOCUS_10620 6318 4825 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_10620 6851 6441 gene locus_tag LOCUS_10630 6851 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7823 6894 gene locus_tag LOCUS_10640 gene rsmH 7823 6894 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_10640 8353 7928 gene locus_tag LOCUS_10650 gene mraZ 8353 7928 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_10650 8684 8914 gene locus_tag LOCUS_10660 8684 8914 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_10660 9658 9086 gene locus_tag LOCUS_10670 gene pyrE 9658 9086 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_10670 10380 9661 gene locus_tag LOCUS_10680 gene pyrF 10380 9661 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_10680 11332 10394 gene locus_tag LOCUS_10690 11332 10394 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_10690 12093 11326 gene locus_tag LOCUS_10700 12093 11326 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_10700 15303 12097 gene locus_tag LOCUS_10710 gene carB 15303 12097 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 protein_id gnl|my_center|LOCUS_10710 16381 15305 gene locus_tag LOCUS_10720 16381 15305 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_10720 17661 16369 gene locus_tag LOCUS_10730 17661 16369 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_10730 18667 17645 gene locus_tag LOCUS_10740 18667 17645 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence040 828 145 gene locus_tag LOCUS_10750 828 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1539 835 gene locus_tag LOCUS_10760 gene thyX 1539 835 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_10760 2012 1539 gene locus_tag LOCUS_10770 2012 1539 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 protein_id gnl|my_center|LOCUS_10770 3454 2009 gene locus_tag LOCUS_10780 gene cysS 3454 2009 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869759.1 protein_id gnl|my_center|LOCUS_10780 4942 3470 gene locus_tag LOCUS_10790 gene gltX 4942 3470 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_10790 6152 4965 gene locus_tag LOCUS_10800 gene ispD 6152 4965 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938747.1 protein_id gnl|my_center|LOCUS_10800 7278 6169 gene locus_tag LOCUS_10810 7278 6169 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_10810 7882 7403 gene locus_tag LOCUS_10820 7882 7403 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810219.1 protein_id gnl|my_center|LOCUS_10820 8986 8117 gene locus_tag LOCUS_10830 8986 8117 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223903.1 protein_id gnl|my_center|LOCUS_10830 10297 9113 gene locus_tag LOCUS_10840 10297 9113 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_10840 10835 10386 gene locus_tag LOCUS_10850 10835 10386 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 protein_id gnl|my_center|LOCUS_10850 11043 10867 gene locus_tag LOCUS_10860 11043 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11487 11152 gene locus_tag LOCUS_10870 11487 11152 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_10870 12828 11515 gene locus_tag LOCUS_10880 gene mtaB 12828 11515 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_10880 13575 12841 gene locus_tag LOCUS_10890 13575 12841 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_10890 14518 13577 gene locus_tag LOCUS_10900 gene prmA 14518 13577 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_10900 18759 14626 gene locus_tag LOCUS_10910 18759 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence041 480 49 gene locus_tag LOCUS_10920 480 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 838 1041 gene locus_tag LOCUS_10930 838 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1093 1335 gene locus_tag LOCUS_10940 1093 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1332 1736 gene locus_tag LOCUS_10950 1332 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2256 1702 gene locus_tag LOCUS_10960 2256 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2322 2618 gene locus_tag LOCUS_10970 2322 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2618 3079 gene locus_tag LOCUS_10980 2618 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3069 3380 gene locus_tag LOCUS_10990 3069 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3370 3495 gene locus_tag LOCUS_11000 3370 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3598 4863 gene locus_tag LOCUS_11010 3598 4863 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_11010 4876 5910 gene locus_tag LOCUS_11020 4876 5910 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_11020 5926 6444 gene locus_tag LOCUS_11030 5926 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6445 8049 gene locus_tag LOCUS_11040 6445 8049 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_11040 8046 10127 gene locus_tag LOCUS_11050 8046 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 10347 10844 gene locus_tag LOCUS_11060 gene dut 10347 10844 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_11060 10861 11040 gene locus_tag LOCUS_11070 10861 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 11053 11403 gene locus_tag LOCUS_11080 11053 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 11331 11513 gene locus_tag LOCUS_11090 11331 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 11527 11751 gene locus_tag LOCUS_11100 11527 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 11748 11933 gene locus_tag LOCUS_11110 11748 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 11930 12328 gene locus_tag LOCUS_11120 11930 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12345 12878 gene locus_tag LOCUS_11130 12345 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 13101 13562 gene locus_tag LOCUS_11140 13101 13562 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 protein_id gnl|my_center|LOCUS_11140 13555 14808 gene locus_tag LOCUS_11150 13555 14808 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047809.1 protein_id gnl|my_center|LOCUS_11150 14814 16241 gene locus_tag LOCUS_11160 14814 16241 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_11160 16234 16401 gene locus_tag LOCUS_11170 16234 16401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 16458 17078 gene locus_tag LOCUS_11180 16458 17078 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047806.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence042 165 389 gene locus_tag LOCUS_11190 165 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 474 1208 gene locus_tag LOCUS_11200 474 1208 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_11200 1214 1615 gene locus_tag LOCUS_11210 1214 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1612 4083 gene locus_tag LOCUS_11220 gene rnr 1612 4083 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_11220 4034 4498 gene locus_tag LOCUS_11230 gene smpB 4034 4498 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_11230 4647 5642 gene locus_tag LOCUS_11240 4647 5642 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016424.1 protein_id gnl|my_center|LOCUS_11240 5739 7211 gene locus_tag LOCUS_11250 gene pap 5739 7211 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_11250 7315 8118 gene locus_tag LOCUS_11260 gene pgeF 7315 8118 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460686.1 protein_id gnl|my_center|LOCUS_11260 8137 8841 gene locus_tag LOCUS_11270 8137 8841 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_11270 8860 9453 gene locus_tag LOCUS_11280 8860 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 9441 10262 gene locus_tag LOCUS_11290 gene proC 9441 10262 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_11290 10264 11061 gene locus_tag LOCUS_11300 10264 11061 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_11300 11076 11735 gene locus_tag LOCUS_11310 11076 11735 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285503.1 protein_id gnl|my_center|LOCUS_11310 13005 11782 gene locus_tag LOCUS_11320 13005 11782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_11320 13589 14371 gene locus_tag LOCUS_11330 13589 14371 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_11330 14384 15379 gene locus_tag LOCUS_11340 14384 15379 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986692.1 protein_id gnl|my_center|LOCUS_11340 15386 16057 gene locus_tag LOCUS_11350 15386 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16081 16236 gene locus_tag LOCUS_11360 16081 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence043 40 201 gene locus_tag LOCUS_11370 40 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 598 281 gene locus_tag LOCUS_11380 598 281 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367287.1 protein_id gnl|my_center|LOCUS_11380 1915 734 gene locus_tag LOCUS_11390 1915 734 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015685.1 protein_id gnl|my_center|LOCUS_11390 3045 1951 gene locus_tag LOCUS_11400 3045 1951 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_11400 4512 3133 gene locus_tag LOCUS_11410 gene pepV 4512 3133 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_11410 4859 6256 gene locus_tag LOCUS_11420 4859 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7305 6310 gene locus_tag LOCUS_11430 gene dusB 7305 6310 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_11430 7617 7438 gene locus_tag LOCUS_11440 7617 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 8439 7669 gene locus_tag LOCUS_11450 8439 7669 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_11450 9177 8617 gene locus_tag LOCUS_11460 9177 8617 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_11460 10169 9174 gene locus_tag LOCUS_11470 10169 9174 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_11470 12377 10440 gene locus_tag LOCUS_11480 gene ftsH 12377 10440 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_11480 12971 12432 gene locus_tag LOCUS_11490 gene hpt 12971 12432 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_11490 14007 12955 gene locus_tag LOCUS_11500 14007 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 14550 14062 gene locus_tag LOCUS_11510 14550 14062 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 protein_id gnl|my_center|LOCUS_11510 17549 14739 gene locus_tag LOCUS_11520 17549 14739 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence044 1073 180 gene locus_tag LOCUS_11530 1073 180 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214046.1 protein_id gnl|my_center|LOCUS_11530 1423 1070 gene locus_tag LOCUS_11540 gene rsfS 1423 1070 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_11540 2462 1485 gene locus_tag LOCUS_11550 2462 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3053 2466 gene locus_tag LOCUS_11560 gene yqeK 3053 2466 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_11560 3701 3090 gene locus_tag LOCUS_11570 gene nadD 3701 3090 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_11570 4640 3867 gene locus_tag LOCUS_11580 4640 3867 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986889.1 protein_id gnl|my_center|LOCUS_11580 5784 4675 gene locus_tag LOCUS_11590 gene ychF 5784 4675 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_11590 6893 5823 gene locus_tag LOCUS_11600 6893 5823 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_11600 8293 6890 gene locus_tag LOCUS_11610 8293 6890 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_11610 9119 8283 gene locus_tag LOCUS_11620 gene murQ 9119 8283 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477459.1 protein_id gnl|my_center|LOCUS_11620 9217 10350 gene locus_tag LOCUS_11630 gene nagA 9217 10350 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_11630 11567 10398 gene locus_tag LOCUS_11640 11567 10398 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_11640 13190 11910 gene locus_tag LOCUS_11650 gene serS 13190 11910 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_11650 14043 13270 gene locus_tag LOCUS_11660 14043 13270 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_11660 15351 14071 gene locus_tag LOCUS_11670 15351 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 16896 15469 gene locus_tag LOCUS_11680 16896 15469 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence045 1469 324 gene locus_tag LOCUS_11690 1469 324 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_11690 1774 1505 gene locus_tag LOCUS_11700 1774 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1664 2308 gene locus_tag LOCUS_11710 gene pcp 1664 2308 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869192.1 protein_id gnl|my_center|LOCUS_11710 4254 2524 gene locus_tag LOCUS_11720 4254 2524 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_11720 6083 4248 gene locus_tag LOCUS_11730 6083 4248 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_11730 6308 6730 gene locus_tag LOCUS_11740 6308 6730 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_11740 7105 7030 gene locus_tag LOCUS_t00350 7105 7030 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7750 7196 gene locus_tag LOCUS_11750 7750 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 7908 8903 gene locus_tag LOCUS_11760 7908 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 8922 10286 gene locus_tag LOCUS_11770 8922 10286 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_11770 10300 11289 gene locus_tag LOCUS_11780 gene galE 10300 11289 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924988.1 protein_id gnl|my_center|LOCUS_11780 11295 13238 gene locus_tag LOCUS_11790 11295 13238 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_11790 13235 13924 gene locus_tag LOCUS_11800 13235 13924 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 protein_id gnl|my_center|LOCUS_11800 13935 14705 gene locus_tag LOCUS_11810 13935 14705 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_11810 14715 15026 gene locus_tag LOCUS_11820 14715 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 14960 15190 gene locus_tag LOCUS_11830 14960 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15247 15600 gene locus_tag LOCUS_11840 15247 15600 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440244.1 protein_id gnl|my_center|LOCUS_11840 15961 16215 gene locus_tag LOCUS_11850 15961 16215 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459096.1 protein_id gnl|my_center|LOCUS_11850 16281 16664 gene locus_tag LOCUS_11860 gene rpsL 16281 16664 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_11860 16711 17181 gene locus_tag LOCUS_11870 gene rpsG 16711 17181 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722012.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence046 1243 620 gene locus_tag LOCUS_11880 1243 620 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548123.1 protein_id gnl|my_center|LOCUS_11880 2086 1307 gene locus_tag LOCUS_11890 2086 1307 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_11890 3471 2188 gene locus_tag LOCUS_11900 gene eno 3471 2188 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_11900 5110 3599 gene locus_tag LOCUS_11910 gene gpmI 5110 3599 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_11910 7073 5136 gene locus_tag LOCUS_11920 7073 5136 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_11920 8088 7084 gene locus_tag LOCUS_11930 gene gap 8088 7084 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_11930 9171 8110 gene locus_tag LOCUS_11940 9171 8110 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399034.1 protein_id gnl|my_center|LOCUS_11940 10150 9311 gene locus_tag LOCUS_11950 gene nadC 10150 9311 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942603.1 protein_id gnl|my_center|LOCUS_11950 11747 10128 gene locus_tag LOCUS_11960 gene nadB 11747 10128 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_11960 12805 11900 gene locus_tag LOCUS_11970 gene nadA 12805 11900 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_11970 14865 13036 gene locus_tag LOCUS_11980 gene glmS 14865 13036 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_11980 16551 15208 gene locus_tag LOCUS_11990 gene glmM 16551 15208 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence047 1249 311 gene locus_tag LOCUS_12000 gene cynR 1249 311 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237346.1 protein_id gnl|my_center|LOCUS_12000 1464 2792 gene locus_tag LOCUS_12010 gene gudD 1464 2792 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_12010 2824 4236 gene locus_tag LOCUS_12020 2824 4236 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_12020 4367 5326 gene locus_tag LOCUS_12030 4367 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5374 5571 gene locus_tag LOCUS_12040 5374 5571 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869714.1 protein_id gnl|my_center|LOCUS_12040 5571 6716 gene locus_tag LOCUS_12050 5571 6716 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080717.1 protein_id gnl|my_center|LOCUS_12050 6716 7531 gene locus_tag LOCUS_12060 6716 7531 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_12060 7534 8064 gene locus_tag LOCUS_12070 7534 8064 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867630.1 protein_id gnl|my_center|LOCUS_12070 8100 9785 gene locus_tag LOCUS_12080 gene ilvD 8100 9785 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584102.1 protein_id gnl|my_center|LOCUS_12080 9844 10197 gene locus_tag LOCUS_12090 9844 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10370 11689 gene locus_tag LOCUS_12100 10370 11689 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_12100 12094 13407 gene locus_tag LOCUS_12110 12094 13407 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_12110 13425 14945 gene locus_tag LOCUS_12120 gene garD 13425 14945 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence048 737 525 gene locus_tag LOCUS_12130 737 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2076 2645 gene locus_tag LOCUS_12140 2076 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4033 3245 gene locus_tag LOCUS_12150 4033 3245 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_12150 4267 4914 gene locus_tag LOCUS_12160 4267 4914 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_12160 6305 6093 gene locus_tag LOCUS_12170 6305 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6305 7273 gene locus_tag LOCUS_12180 6305 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7467 8348 gene locus_tag LOCUS_12190 gene holA 7467 8348 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_12190 8371 9570 gene locus_tag LOCUS_12200 gene gltS 8371 9570 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_12200 10648 9776 gene locus_tag LOCUS_12210 10648 9776 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_12210 10928 11785 gene locus_tag LOCUS_12220 gene ispE 10928 11785 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_12220 11793 12509 gene locus_tag LOCUS_12230 11793 12509 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_12230 12509 13321 gene locus_tag LOCUS_12240 gene purR 12509 13321 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_12240 13359 14570 gene locus_tag LOCUS_12250 gene ilvA 13359 14570 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_12250 14592 15965 gene locus_tag LOCUS_12260 gene glmU 14592 15965 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence049 109 480 gene locus_tag LOCUS_12270 109 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 573 1100 gene locus_tag LOCUS_12280 573 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1100 1786 gene locus_tag LOCUS_12290 1100 1786 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086292.1 protein_id gnl|my_center|LOCUS_12290 2012 3235 gene locus_tag LOCUS_12300 2012 3235 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_12300 3706 4353 gene locus_tag LOCUS_12310 gene lexA 3706 4353 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_12310 5738 4497 gene locus_tag LOCUS_12320 5738 4497 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 protein_id gnl|my_center|LOCUS_12320 7607 5793 gene locus_tag LOCUS_12330 gene hflX 7607 5793 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 protein_id gnl|my_center|LOCUS_12330 9261 7627 gene locus_tag LOCUS_12340 9261 7627 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_12340 10537 9293 gene locus_tag LOCUS_12350 10537 9293 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_12350 11871 10543 gene locus_tag LOCUS_12360 gene rimO 11871 10543 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_12360 13478 11967 gene locus_tag LOCUS_12370 13478 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 15845 13524 gene locus_tag LOCUS_12380 15845 13524 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272342.1 protein_id gnl|my_center|LOCUS_12380 16230 15880 gene locus_tag LOCUS_12390 16230 15880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence050 2549 1302 gene locus_tag LOCUS_12400 2549 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3238 2669 gene locus_tag LOCUS_12410 3238 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3632 3159 gene locus_tag LOCUS_12420 3632 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3807 3616 gene locus_tag LOCUS_12430 3807 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4339 4031 gene locus_tag LOCUS_12440 4339 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 4535 5212 gene locus_tag LOCUS_12450 4535 5212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_12450 5228 6958 gene locus_tag LOCUS_12460 5228 6958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_12460 7488 7012 gene locus_tag LOCUS_12470 7488 7012 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068320.1 protein_id gnl|my_center|LOCUS_12470 7984 7589 gene locus_tag LOCUS_12480 7984 7589 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224559.1 protein_id gnl|my_center|LOCUS_12480 8989 8231 gene locus_tag LOCUS_12490 8989 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 9128 9523 gene locus_tag LOCUS_12500 9128 9523 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_12500 10342 9524 gene locus_tag LOCUS_12510 gene folD 10342 9524 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475808.1 protein_id gnl|my_center|LOCUS_12510 12451 10358 gene locus_tag LOCUS_12520 12451 10358 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_12520 13653 12448 gene locus_tag LOCUS_12530 gene ftsW 13653 12448 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_12530 14313 13672 gene locus_tag LOCUS_12540 gene trmB 14313 13672 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 protein_id gnl|my_center|LOCUS_12540 15723 14404 gene locus_tag LOCUS_12550 15723 14404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence051 1554 133 gene locus_tag LOCUS_12560 gene hydG 1554 133 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_12560 2422 1895 gene locus_tag LOCUS_12570 2422 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2699 2623 gene locus_tag LOCUS_t00360 2699 2623 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2885 4162 gene locus_tag LOCUS_12580 gene obgE 2885 4162 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_12580 4201 5346 gene locus_tag LOCUS_12590 gene proB 4201 5346 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_12590 5360 6616 gene locus_tag LOCUS_12600 5360 6616 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_12600 6804 7874 gene locus_tag LOCUS_12610 6804 7874 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_12610 7894 8592 gene locus_tag LOCUS_12620 7894 8592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_12620 8585 9799 gene locus_tag LOCUS_12630 8585 9799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_12630 9840 9959 gene locus_tag LOCUS_12640 9840 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10578 10015 gene locus_tag LOCUS_12650 10578 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10780 11685 gene locus_tag LOCUS_12660 gene ftcD 10780 11685 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681237.1 protein_id gnl|my_center|LOCUS_12660 11713 13383 gene locus_tag LOCUS_12670 11713 13383 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_12670 13403 14023 gene locus_tag LOCUS_12680 13403 14023 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_12680 15504 14059 gene locus_tag LOCUS_12690 gene rocR 15504 14059 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110073.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence052 <1 582 gene locus_tag LOCUS_12700 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541498.1:type I DNA topoisomerase 596 1912 gene locus_tag LOCUS_12710 gene trmFO 596 1912 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320953.1 protein_id gnl|my_center|LOCUS_12710 1975 2910 gene locus_tag LOCUS_12720 gene xerC 1975 2910 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_12720 2923 3699 gene locus_tag LOCUS_12730 gene codY 2923 3699 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_12730 3896 4522 gene locus_tag LOCUS_12740 3896 4522 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_12740 4541 5269 gene locus_tag LOCUS_12750 4541 5269 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_12750 5247 5795 gene locus_tag LOCUS_12760 gene scpB 5247 5795 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_12760 5817 6551 gene locus_tag LOCUS_12770 5817 6551 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_12770 6548 7810 gene locus_tag LOCUS_12780 6548 7810 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_12780 7807 8472 gene locus_tag LOCUS_12790 gene cmk 7807 8472 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_12790 8474 9070 gene locus_tag LOCUS_12800 8474 9070 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_12800 9899 11116 gene locus_tag LOCUS_12810 9899 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11137 12186 gene locus_tag LOCUS_12820 gene fni 11137 12186 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392841.1 protein_id gnl|my_center|LOCUS_12820 12206 13537 gene locus_tag LOCUS_12830 gene der 12206 13537 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_12830 13553 14155 gene locus_tag LOCUS_12840 gene plsY 13553 14155 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence053 1333 62 gene locus_tag LOCUS_12850 1333 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2618 1338 gene locus_tag LOCUS_12860 2618 1338 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_12860 5291 2637 gene locus_tag LOCUS_12870 5291 2637 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_12870 7483 5759 gene locus_tag LOCUS_12880 7483 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8407 7490 gene locus_tag LOCUS_12890 8407 7490 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_12890 9145 8675 gene locus_tag LOCUS_12900 9145 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9816 9283 gene locus_tag LOCUS_12910 9816 9283 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_12910 10894 10664 gene locus_tag LOCUS_12920 10894 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 11232 10921 gene locus_tag LOCUS_12930 11232 10921 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948466.1 protein_id gnl|my_center|LOCUS_12930 12243 11245 gene locus_tag LOCUS_12940 12243 11245 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_12940 12465 12389 gene locus_tag LOCUS_t00370 12465 12389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12547 12474 gene locus_tag LOCUS_t00380 12547 12474 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12635 12559 gene locus_tag LOCUS_t00390 12635 12559 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12761 12686 gene locus_tag LOCUS_t00400 12761 12686 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12844 12770 gene locus_tag LOCUS_t00410 12844 12770 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12922 12848 gene locus_tag LOCUS_t00420 12922 12848 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13794 13189 gene locus_tag LOCUS_12950 13794 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14105 13791 gene locus_tag LOCUS_12960 14105 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 14443 14102 gene locus_tag LOCUS_12970 14443 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 14775 14500 gene locus_tag LOCUS_12980 14775 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence054 1600 131 gene locus_tag LOCUS_12990 1600 131 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_12990 2553 1804 gene locus_tag LOCUS_13000 2553 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3244 2555 gene locus_tag LOCUS_13010 3244 2555 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_13010 3771 3307 gene locus_tag LOCUS_13020 3771 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3916 6081 gene locus_tag LOCUS_13030 3916 6081 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_13030 6288 6962 gene locus_tag LOCUS_13040 6288 6962 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_13040 7050 8852 gene locus_tag LOCUS_13050 7050 8852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_13050 8845 10719 gene locus_tag LOCUS_13060 8845 10719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_13060 11425 10865 gene locus_tag LOCUS_13070 11425 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11568 12569 gene locus_tag LOCUS_13080 11568 12569 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267466.1 protein_id gnl|my_center|LOCUS_13080 12662 13831 gene locus_tag LOCUS_13090 gene alr 12662 13831 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence055 536 5470 gene locus_tag LOCUS_13100 536 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_13100 5499 6485 gene locus_tag LOCUS_13110 5499 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6513 7598 gene locus_tag LOCUS_13120 6513 7598 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_13120 7768 9180 gene locus_tag LOCUS_13130 7768 9180 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_13130 9256 10716 gene locus_tag LOCUS_13140 9256 10716 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_13140 10737 11870 gene locus_tag LOCUS_13150 gene hemW 10737 11870 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_13150 11980 13020 gene locus_tag LOCUS_13160 gene hrcA 11980 13020 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence056 1375 422 gene locus_tag LOCUS_13170 1375 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4094 1584 gene locus_tag LOCUS_13180 4094 1584 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_13180 6216 4567 gene locus_tag LOCUS_13190 6216 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 7128 6334 gene locus_tag LOCUS_13200 7128 6334 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_13200 7675 7379 gene locus_tag LOCUS_13210 7675 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7777 8922 gene locus_tag LOCUS_13220 7777 8922 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_13220 8927 10276 gene locus_tag LOCUS_13230 8927 10276 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_13230 10888 10325 gene locus_tag LOCUS_13240 10888 10325 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_13240 11469 10885 gene locus_tag LOCUS_13250 11469 10885 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902465.1 protein_id gnl|my_center|LOCUS_13250 11789 11466 gene locus_tag LOCUS_13260 11789 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 13191 12157 gene locus_tag LOCUS_13270 13191 12157 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390097.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence057 418 1929 gene locus_tag LOCUS_13280 418 1929 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_13280 1901 2587 gene locus_tag LOCUS_13290 1901 2587 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_13290 3048 4058 gene locus_tag LOCUS_13300 gene ilvC 3048 4058 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_13300 4180 5877 gene locus_tag LOCUS_13310 gene ilvB 4180 5877 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_13310 5874 6377 gene locus_tag LOCUS_13320 gene ilvN 5874 6377 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_13320 7228 6659 gene locus_tag LOCUS_13330 7228 6659 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_13330 8389 7316 gene locus_tag LOCUS_13340 gene leuB 8389 7316 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_13340 8871 8389 gene locus_tag LOCUS_13350 gene leuD 8871 8389 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_13350 10133 8868 gene locus_tag LOCUS_13360 gene leuC 10133 8868 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_13360 11863 10457 gene locus_tag LOCUS_13370 11863 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 12817 11888 gene locus_tag LOCUS_13380 12817 11888 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence058 <1 1154 gene locus_tag LOCUS_13390 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546145.1:TerB N-terminal domain-containing protein 1151 2470 gene locus_tag LOCUS_13400 1151 2470 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_13400 2483 4756 gene locus_tag LOCUS_13410 2483 4756 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_13410 4779 6155 gene locus_tag LOCUS_13420 4779 6155 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_13420 7115 6207 gene locus_tag LOCUS_13430 7115 6207 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943599.1 protein_id gnl|my_center|LOCUS_13430 7263 8189 gene locus_tag LOCUS_13440 7263 8189 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_13440 8664 8242 gene locus_tag LOCUS_13450 8664 8242 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_13450 <13050 8754 gene locus_tag LOCUS_13460 <13050 8754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439757.1:EAL domain-containing protein >Feature sequence059 <1 978 gene locus_tag LOCUS_13470 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_127133531.1:radical SAM protein 965 2728 gene locus_tag LOCUS_13480 965 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2728 4476 gene locus_tag LOCUS_13490 2728 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4581 5618 gene locus_tag LOCUS_13500 4581 5618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_13500 5817 6650 gene locus_tag LOCUS_13510 5817 6650 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_13510 6672 7568 gene locus_tag LOCUS_13520 6672 7568 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 protein_id gnl|my_center|LOCUS_13520 7565 8518 gene locus_tag LOCUS_13530 7565 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8642 9646 gene locus_tag LOCUS_13540 8642 9646 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_13540 9643 10560 gene locus_tag LOCUS_13550 9643 10560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_13550 10589 11566 gene locus_tag LOCUS_13560 10589 11566 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence060 <1 949 gene locus_tag LOCUS_13570 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434194.1:M18 family aminopeptidase 1949 981 gene locus_tag LOCUS_13580 1949 981 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016957.1 protein_id gnl|my_center|LOCUS_13580 2713 2108 gene locus_tag LOCUS_13590 2713 2108 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_13590 2907 3758 gene locus_tag LOCUS_13600 gene hpnK 2907 3758 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_13600 3830 4732 gene locus_tag LOCUS_13610 gene pfkB 3830 4732 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_13610 4734 6656 gene locus_tag LOCUS_13620 4734 6656 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_13620 6746 7381 gene locus_tag LOCUS_13630 6746 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7421 8812 gene locus_tag LOCUS_13640 7421 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 8879 9808 gene locus_tag LOCUS_13650 8879 9808 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964086.1 protein_id gnl|my_center|LOCUS_13650 9949 11160 gene locus_tag LOCUS_13660 9949 11160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723548.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence061 703 101 gene locus_tag LOCUS_13670 703 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1937 1374 gene locus_tag LOCUS_13680 1937 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2897 1953 gene locus_tag LOCUS_13690 2897 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3605 3042 gene locus_tag LOCUS_13700 3605 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3848 4030 gene locus_tag LOCUS_13710 3848 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4295 4846 gene locus_tag LOCUS_13720 4295 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4960 5187 gene locus_tag LOCUS_13730 4960 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 5203 5451 gene locus_tag LOCUS_13740 5203 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 5454 5603 gene locus_tag LOCUS_13750 5454 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6038 5700 gene locus_tag LOCUS_13760 6038 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7472 6261 gene locus_tag LOCUS_13770 7472 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 8208 7483 gene locus_tag LOCUS_13780 8208 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 8691 8212 gene locus_tag LOCUS_13790 gene folK 8691 8212 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_13790 9878 8682 gene locus_tag LOCUS_13800 gene folP 9878 8682 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_13800 10647 9880 gene locus_tag LOCUS_13810 gene folE2 10647 9880 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082504.1 protein_id gnl|my_center|LOCUS_13810 11003 10641 gene locus_tag LOCUS_13820 gene queD 11003 10641 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582987.1 protein_id gnl|my_center|LOCUS_13820 11470 11000 gene locus_tag LOCUS_13830 gene trmL 11470 11000 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_13830 <12468 11467 gene locus_tag LOCUS_13840 <12468 11467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681594.1:glucosaminidase domain-containing protein >Feature sequence062 257 475 gene locus_tag LOCUS_13850 257 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 493 792 gene locus_tag LOCUS_13860 493 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 777 1091 gene locus_tag LOCUS_13870 777 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1088 1642 gene locus_tag LOCUS_13880 1088 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1758 2192 gene locus_tag LOCUS_13890 1758 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2308 2511 gene locus_tag LOCUS_13900 2308 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2576 3871 gene locus_tag LOCUS_13910 2576 3871 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_13910 3990 4274 gene locus_tag LOCUS_13920 3990 4274 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813972.1 protein_id gnl|my_center|LOCUS_13920 4264 4539 gene locus_tag LOCUS_13930 4264 4539 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_13930 4831 5265 gene locus_tag LOCUS_13940 4831 5265 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972836.1 protein_id gnl|my_center|LOCUS_13940 6555 7046 gene locus_tag LOCUS_13950 6555 7046 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_13950 7972 7118 gene locus_tag LOCUS_13960 7972 7118 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965690.1 protein_id gnl|my_center|LOCUS_13960 8081 9838 gene locus_tag LOCUS_13970 8081 9838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_13970 9838 11580 gene locus_tag LOCUS_13980 9838 11580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_13980 11697 11939 gene locus_tag LOCUS_13990 11697 11939 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381076.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence063 3407 171 gene locus_tag LOCUS_14000 3407 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5207 3576 gene locus_tag LOCUS_14010 gene glgA 5207 3576 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_14010 7173 5182 gene locus_tag LOCUS_14020 gene glgB 7173 5182 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_14020 9537 7222 gene locus_tag LOCUS_14030 gene glgP 9537 7222 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_14030 10785 9673 gene locus_tag LOCUS_14040 gene glgD 10785 9673 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_14040 12004 10778 gene locus_tag LOCUS_14050 gene glgC 12004 10778 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057619.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence064 1211 189 gene locus_tag LOCUS_14060 1211 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2826 1204 gene locus_tag LOCUS_14070 2826 1204 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172635924.1 protein_id gnl|my_center|LOCUS_14070 3548 2850 gene locus_tag LOCUS_14080 3548 2850 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_14080 4094 3711 gene locus_tag LOCUS_14090 4094 3711 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_14090 5122 4424 gene locus_tag LOCUS_14100 5122 4424 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_14100 6250 5309 gene locus_tag LOCUS_14110 6250 5309 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_14110 6585 6268 gene locus_tag LOCUS_14120 gene trxA 6585 6268 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_14120 7928 7005 gene locus_tag LOCUS_14130 7928 7005 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_14130 8759 7941 gene locus_tag LOCUS_14140 8759 7941 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_14140 9444 8734 gene locus_tag LOCUS_14150 9444 8734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047989.1 protein_id gnl|my_center|LOCUS_14150 10180 9455 gene locus_tag LOCUS_14160 10180 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662421.1 protein_id gnl|my_center|LOCUS_14160 <11347 10200 gene locus_tag LOCUS_14170 <11347 10200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051542.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence065 <1 511 gene locus_tag LOCUS_14180 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392548.1:UMP kinase 512 1075 gene locus_tag LOCUS_14190 gene frr 512 1075 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_14190 1072 1374 gene locus_tag LOCUS_14200 1072 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1308 1481 gene locus_tag LOCUS_14210 1308 1481 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_14210 1548 2339 gene locus_tag LOCUS_14220 1548 2339 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_14220 2352 3182 gene locus_tag LOCUS_14230 2352 3182 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460414.1 protein_id gnl|my_center|LOCUS_14230 3194 4348 gene locus_tag LOCUS_14240 3194 4348 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_14240 4361 5377 gene locus_tag LOCUS_14250 gene rseP 4361 5377 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_14250 5387 6454 gene locus_tag LOCUS_14260 gene ispG 5387 6454 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_14260 6457 8172 gene locus_tag LOCUS_14270 6457 8172 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_14270 8362 9039 gene locus_tag LOCUS_14280 8362 9039 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence066 105 2195 gene locus_tag LOCUS_14290 105 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2192 4048 gene locus_tag LOCUS_14300 gene uvrC 2192 4048 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_14300 4163 4324 gene locus_tag LOCUS_14310 4163 4324 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_14310 4392 5201 gene locus_tag LOCUS_14320 4392 5201 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_14320 5337 6143 gene locus_tag LOCUS_14330 gene rapZ 5337 6143 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_14330 6148 7527 gene locus_tag LOCUS_14340 6148 7527 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462178.1 protein_id gnl|my_center|LOCUS_14340 7530 8459 gene locus_tag LOCUS_14350 gene whiA 7530 8459 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006558.1 protein_id gnl|my_center|LOCUS_14350 8456 9307 gene locus_tag LOCUS_14360 8456 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9395 9538 gene locus_tag LOCUS_14370 gene scfA 9395 9538 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_14370 9616 11022 gene locus_tag LOCUS_14380 gene scfB 9616 11022 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence067 1939 3891 gene locus_tag LOCUS_14390 gene metG 1939 3891 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_14390 3893 4678 gene locus_tag LOCUS_14400 3893 4678 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_14400 4814 5800 gene locus_tag LOCUS_14410 4814 5800 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084663050.1 protein_id gnl|my_center|LOCUS_14410 5817 6362 gene locus_tag LOCUS_14420 gene rnmV 5817 6362 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_14420 6366 7220 gene locus_tag LOCUS_14430 gene rsmA 6366 7220 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_14430 7217 7477 gene locus_tag LOCUS_14440 7217 7477 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_14440 7603 7893 gene locus_tag LOCUS_14450 gene groES 7603 7893 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917311.1 protein_id gnl|my_center|LOCUS_14450 7967 9598 gene locus_tag LOCUS_14460 gene groL 7967 9598 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_14460 9753 10262 gene locus_tag LOCUS_14470 gene tpx 9753 10262 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence068 589 362 gene locus_tag LOCUS_14480 589 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1640 675 gene locus_tag LOCUS_14490 1640 675 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_14490 2815 1712 gene locus_tag LOCUS_14500 2815 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3647 2829 gene locus_tag LOCUS_14510 3647 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5464 3692 gene locus_tag LOCUS_14520 5464 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6447 5467 gene locus_tag LOCUS_14530 6447 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6703 8286 gene locus_tag LOCUS_14540 6703 8286 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_14540 9730 9957 gene locus_tag LOCUS_14550 9730 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 <10548 10045 gene locus_tag LOCUS_14560 <10548 10045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392582.1:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence069 950 87 gene locus_tag LOCUS_14570 950 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1443 940 gene locus_tag LOCUS_14580 1443 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1750 1430 gene locus_tag LOCUS_14590 1750 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2204 1737 gene locus_tag LOCUS_14600 2204 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2593 2201 gene locus_tag LOCUS_14610 2593 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3695 2643 gene locus_tag LOCUS_14620 3695 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4350 3892 gene locus_tag LOCUS_14630 gene nrdR 4350 3892 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 protein_id gnl|my_center|LOCUS_14630 5488 4370 gene locus_tag LOCUS_14640 gene ftsZ 5488 4370 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_14640 6029 5703 gene locus_tag LOCUS_14650 6029 5703 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_14650 6718 6026 gene locus_tag LOCUS_14660 6718 6026 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_14660 7945 6731 gene locus_tag LOCUS_14670 7945 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8879 7947 gene locus_tag LOCUS_14680 8879 7947 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_14680 10267 8882 gene locus_tag LOCUS_14690 gene murC 10267 8882 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence070 1071 91 gene locus_tag LOCUS_14700 1071 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1121 1417 gene locus_tag LOCUS_14710 1121 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1414 1764 gene locus_tag LOCUS_14720 1414 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1724 2341 gene locus_tag LOCUS_14730 1724 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2344 2805 gene locus_tag LOCUS_14740 2344 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2936 3139 gene locus_tag LOCUS_14750 2936 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3326 4045 gene locus_tag LOCUS_14760 3326 4045 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_14760 4042 5001 gene locus_tag LOCUS_14770 4042 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4998 6386 gene locus_tag LOCUS_14780 4998 6386 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_14780 6979 6467 gene locus_tag LOCUS_14790 6979 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6980 7204 gene locus_tag LOCUS_14800 6980 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7415 8266 gene locus_tag LOCUS_14810 7415 8266 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470596.1 protein_id gnl|my_center|LOCUS_14810 8277 9797 gene locus_tag LOCUS_14820 8277 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence071 304 777 gene locus_tag LOCUS_14830 304 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3258 886 gene locus_tag LOCUS_14840 3258 886 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_14840 3368 3216 gene locus_tag LOCUS_14850 3368 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5847 3382 gene locus_tag LOCUS_14860 5847 3382 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458989.1 protein_id gnl|my_center|LOCUS_14860 6066 7742 gene locus_tag LOCUS_14870 6066 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 8662 7802 gene locus_tag LOCUS_14880 8662 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9325 8909 gene locus_tag LOCUS_14890 9325 8909 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_14890 9529 9341 gene locus_tag LOCUS_14900 9529 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence072 437 799 gene locus_tag LOCUS_14910 437 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 978 3821 gene locus_tag LOCUS_14920 978 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3818 4531 gene locus_tag LOCUS_14930 3818 4531 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398548.1 protein_id gnl|my_center|LOCUS_14930 4528 5592 gene locus_tag LOCUS_14940 4528 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5595 5990 gene locus_tag LOCUS_14950 5595 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 6003 6428 gene locus_tag LOCUS_14960 6003 6428 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438449.1 protein_id gnl|my_center|LOCUS_14960 6421 7452 gene locus_tag LOCUS_14970 6421 7452 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438450.1 protein_id gnl|my_center|LOCUS_14970 7449 8900 gene locus_tag LOCUS_14980 7449 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence073 172 765 gene locus_tag LOCUS_14990 gene clpP 172 765 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_14990 807 2078 gene locus_tag LOCUS_15000 gene clpX 807 2078 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_15000 2147 4465 gene locus_tag LOCUS_15010 gene lon 2147 4465 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_15010 4467 5096 gene locus_tag LOCUS_15020 gene yihA 4467 5096 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_15020 5197 5865 gene locus_tag LOCUS_15030 5197 5865 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_15030 7000 5783 gene locus_tag LOCUS_15040 gene hofQ 7000 5783 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369385.1 protein_id gnl|my_center|LOCUS_15040 7509 7000 gene locus_tag LOCUS_15050 7509 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7721 8872 gene locus_tag LOCUS_15060 gene gspE 7721 8872 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138174.1 protein_id gnl|my_center|LOCUS_15060 8882 9550 gene locus_tag LOCUS_15070 8882 9550 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869323.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence074 2645 1770 gene locus_tag LOCUS_15080 2645 1770 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_15080 2890 2645 gene locus_tag LOCUS_15090 2890 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4104 2890 gene locus_tag LOCUS_15100 gene xseA 4104 2890 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_15100 5060 4101 gene locus_tag LOCUS_15110 5060 4101 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_15110 5469 5050 gene locus_tag LOCUS_15120 gene nusB 5469 5050 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_15120 5712 5488 gene locus_tag LOCUS_15130 5712 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6248 5727 gene locus_tag LOCUS_15140 6248 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 6838 6245 gene locus_tag LOCUS_15150 6838 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7095 8228 gene locus_tag LOCUS_15160 7095 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 8740 8225 gene locus_tag LOCUS_15170 8740 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9568 8768 gene locus_tag LOCUS_15180 9568 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence075 46 489 gene locus_tag LOCUS_15190 gene mscL 46 489 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_15190 564 1790 gene locus_tag LOCUS_15200 gene tyrS 564 1790 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_15200 3337 1880 gene locus_tag LOCUS_15210 3337 1880 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_15210 3657 5246 gene locus_tag LOCUS_15220 3657 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5240 6652 gene locus_tag LOCUS_15230 5240 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6627 7244 gene locus_tag LOCUS_15240 gene vraR 6627 7244 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_15240 7614 8714 gene locus_tag LOCUS_15250 7614 8714 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530292.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence076 717 175 gene locus_tag LOCUS_15260 717 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15260 2221 869 gene locus_tag LOCUS_15270 2221 869 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_15270 3397 2318 gene locus_tag LOCUS_15280 3397 2318 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703952.1 protein_id gnl|my_center|LOCUS_15280 3674 4669 gene locus_tag LOCUS_15290 3674 4669 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 protein_id gnl|my_center|LOCUS_15290 4735 5193 gene locus_tag LOCUS_15300 4735 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5213 6766 gene locus_tag LOCUS_15310 5213 6766 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_15310 6886 7161 gene locus_tag LOCUS_15320 6886 7161 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_15320 7151 7894 gene locus_tag LOCUS_15330 7151 7894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439810.1 protein_id gnl|my_center|LOCUS_15330 7882 8598 gene locus_tag LOCUS_15340 7882 8598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727032.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence077 827 6 gene locus_tag LOCUS_15350 827 6 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_15350 2197 947 gene locus_tag LOCUS_15360 gene maeB 2197 947 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_15360 2713 2213 gene locus_tag LOCUS_15370 2713 2213 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_15370 3285 2692 gene locus_tag LOCUS_15380 3285 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4327 3683 gene locus_tag LOCUS_15390 4327 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_15390 4859 4320 gene locus_tag LOCUS_15400 4859 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 5278 4856 gene locus_tag LOCUS_15410 5278 4856 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_15410 5512 5438 gene locus_tag LOCUS_t00430 5512 5438 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6020 5586 gene locus_tag LOCUS_15420 6020 5586 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166786.1 protein_id gnl|my_center|LOCUS_15420 8636 6138 gene locus_tag LOCUS_15430 8636 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 9046 8642 gene locus_tag LOCUS_15440 9046 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence078 <1 1381 gene locus_tag LOCUS_15450 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003601491.1:NAD-dependent malic enzyme 1805 2926 gene locus_tag LOCUS_15460 1805 2926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_15460 2998 3894 gene locus_tag LOCUS_15470 2998 3894 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_15470 3895 4884 gene locus_tag LOCUS_15480 3895 4884 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_15480 4859 5629 gene locus_tag LOCUS_15490 4859 5629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837311.1 protein_id gnl|my_center|LOCUS_15490 5629 6333 gene locus_tag LOCUS_15500 5629 6333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_15500 6349 7017 gene locus_tag LOCUS_15510 6349 7017 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262680.1 protein_id gnl|my_center|LOCUS_15510 7007 7207 gene locus_tag LOCUS_15520 7007 7207 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_15520 7296 8024 gene locus_tag LOCUS_15530 7296 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8036 8695 gene locus_tag LOCUS_15540 8036 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence079 700 1125 gene locus_tag LOCUS_15550 700 1125 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016519.1 protein_id gnl|my_center|LOCUS_15550 2780 1167 gene locus_tag LOCUS_15560 2780 1167 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15560 3197 7483 gene locus_tag LOCUS_15570 3197 7483 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_15570 7631 8749 gene locus_tag LOCUS_15580 7631 8749 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence080 743 486 gene locus_tag LOCUS_15590 743 486 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_15590 1237 860 gene locus_tag LOCUS_15600 1237 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2943 1477 gene locus_tag LOCUS_15610 2943 1477 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994262.1 protein_id gnl|my_center|LOCUS_15610 3246 4256 gene locus_tag LOCUS_15620 3246 4256 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682144.1 protein_id gnl|my_center|LOCUS_15620 5401 4307 gene locus_tag LOCUS_15630 5401 4307 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_15630 7073 5481 gene locus_tag LOCUS_15640 7073 5481 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_15640 8105 7260 gene locus_tag LOCUS_15650 gene thiM 8105 7260 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986722.1 protein_id gnl|my_center|LOCUS_15650 8622 8035 gene locus_tag LOCUS_15660 gene thiW 8622 8035 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047762.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence081 231 1196 gene locus_tag LOCUS_15670 231 1196 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_15670 1265 1894 gene locus_tag LOCUS_15680 gene pth 1265 1894 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596228.1 protein_id gnl|my_center|LOCUS_15680 1891 2769 gene locus_tag LOCUS_15690 gene galU 1891 2769 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_15690 2995 3597 gene locus_tag LOCUS_15700 2995 3597 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966586.1 protein_id gnl|my_center|LOCUS_15700 3724 5115 gene locus_tag LOCUS_15710 3724 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5337 8525 gene locus_tag LOCUS_15720 5337 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence082 809 51 gene locus_tag LOCUS_15730 gene hisF 809 51 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_15730 1542 814 gene locus_tag LOCUS_15740 gene hisA 1542 814 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_15740 2153 1539 gene locus_tag LOCUS_15750 gene hisH 2153 1539 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_15750 2742 2155 gene locus_tag LOCUS_15760 gene hisB 2742 2155 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131113.1 protein_id gnl|my_center|LOCUS_15760 3913 2762 gene locus_tag LOCUS_15770 gene hisC 3913 2762 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017744.1 protein_id gnl|my_center|LOCUS_15770 5259 3913 gene locus_tag LOCUS_15780 gene hisD 5259 3913 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_15780 5906 5256 gene locus_tag LOCUS_15790 gene hisG 5906 5256 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_15790 7095 5920 gene locus_tag LOCUS_15800 gene hisZ 7095 5920 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_15800 7394 7092 gene locus_tag LOCUS_15810 7394 7092 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence083 <1 867 gene locus_tag LOCUS_15820 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245569.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 960 1229 gene locus_tag LOCUS_15830 960 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1213 2109 gene locus_tag LOCUS_15840 gene xerD 1213 2109 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_15840 2124 2984 gene locus_tag LOCUS_15850 gene htpX 2124 2984 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_15850 3294 4535 gene locus_tag LOCUS_15860 3294 4535 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902653.1 protein_id gnl|my_center|LOCUS_15860 4733 5443 gene locus_tag LOCUS_15870 4733 5443 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence084 349 2448 gene locus_tag LOCUS_15880 349 2448 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_15880 2441 3529 gene locus_tag LOCUS_15890 gene csaB 2441 3529 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241591.1 protein_id gnl|my_center|LOCUS_15890 3592 4278 gene locus_tag LOCUS_15900 gene ftsE 3592 4278 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_15900 4268 5155 gene locus_tag LOCUS_15910 gene ftsX 4268 5155 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_15910 5168 6301 gene locus_tag LOCUS_15920 5168 6301 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence085 <1 1451 gene locus_tag LOCUS_15930 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040347516.1:LTA synthase family protein 1548 2714 gene locus_tag LOCUS_15940 gene ugd 1548 2714 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704814.1 protein_id gnl|my_center|LOCUS_15940 2724 3722 gene locus_tag LOCUS_15950 2724 3722 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_15950 3868 4695 gene locus_tag LOCUS_15960 3868 4695 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877413.1 protein_id gnl|my_center|LOCUS_15960 4873 6258 gene locus_tag LOCUS_15970 4873 6258 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852570.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence086 339 2036 gene locus_tag LOCUS_15980 gene ilvB 339 2036 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_15980 2051 2590 gene locus_tag LOCUS_15990 gene ilvN 2051 2590 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_15990 2587 3840 gene locus_tag LOCUS_16000 2587 3840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_16000 3901 4458 gene locus_tag LOCUS_16010 3901 4458 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_16010 5988 4483 gene locus_tag LOCUS_16020 5988 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6269 7291 gene locus_tag LOCUS_16030 6269 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence087 585 250 gene locus_tag LOCUS_16040 585 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 584 781 gene locus_tag LOCUS_16050 584 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 866 1705 gene locus_tag LOCUS_16060 gene murI 866 1705 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_16060 1843 2355 gene locus_tag LOCUS_16070 1843 2355 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647216.1 protein_id gnl|my_center|LOCUS_16070 3225 2386 gene locus_tag LOCUS_16080 3225 2386 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_16080 3392 4102 gene locus_tag LOCUS_16090 3392 4102 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_16090 4178 5539 gene locus_tag LOCUS_16100 4178 5539 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_16100 5552 7033 gene locus_tag LOCUS_16110 5552 7033 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015837.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence088 1469 258 gene locus_tag LOCUS_16120 gene dapG 1469 258 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808827.1 protein_id gnl|my_center|LOCUS_16120 2542 1511 gene locus_tag LOCUS_16130 2542 1511 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_16130 3426 2653 gene locus_tag LOCUS_16140 gene dapB 3426 2653 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 protein_id gnl|my_center|LOCUS_16140 4223 3780 gene locus_tag LOCUS_16150 4223 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 4685 4233 gene locus_tag LOCUS_16160 4685 4233 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_16160 5157 4666 gene locus_tag LOCUS_16170 5157 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5788 5219 gene locus_tag LOCUS_16180 5788 5219 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_16180 6306 5932 gene locus_tag LOCUS_16190 6306 5932 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_16190 6481 6762 gene locus_tag LOCUS_16200 6481 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence089 1487 384 gene locus_tag LOCUS_16210 1487 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3127 1625 gene locus_tag LOCUS_16220 3127 1625 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_16220 3503 3129 gene locus_tag LOCUS_16230 3503 3129 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_16230 4906 3587 gene locus_tag LOCUS_16240 4906 3587 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_16240 6733 5153 gene locus_tag LOCUS_16250 6733 5153 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564276.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence090 146 1408 gene locus_tag LOCUS_16260 gene sstT 146 1408 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_16260 2469 1459 gene locus_tag LOCUS_16270 2469 1459 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 protein_id gnl|my_center|LOCUS_16270 4273 2870 gene locus_tag LOCUS_16280 gene mgtE 4273 2870 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934126.1 protein_id gnl|my_center|LOCUS_16280 4687 4355 gene locus_tag LOCUS_16290 4687 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 5941 4712 gene locus_tag LOCUS_16300 5941 4712 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_16300 6613 6284 gene locus_tag LOCUS_16310 6613 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence091 2066 846 gene locus_tag LOCUS_16320 2066 846 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_16320 3044 2103 gene locus_tag LOCUS_16330 gene argF 3044 2103 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_16330 4253 3063 gene locus_tag LOCUS_16340 4253 3063 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_16340 5156 4269 gene locus_tag LOCUS_16350 gene argB 5156 4269 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_16350 5523 6320 gene locus_tag LOCUS_16360 5523 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence092 2535 1423 gene locus_tag LOCUS_16370 2535 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2767 3984 gene locus_tag LOCUS_16380 gene hydF 2767 3984 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_16380 5249 4116 gene locus_tag LOCUS_16390 5249 4116 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_16390 5905 5405 gene locus_tag LOCUS_16400 5905 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 6335 5907 gene locus_tag LOCUS_16410 6335 5907 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence093 1468 302 gene locus_tag LOCUS_16420 1468 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2188 1472 gene locus_tag LOCUS_16430 2188 1472 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_16430 3926 3024 gene locus_tag LOCUS_16440 3926 3024 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964901.1 protein_id gnl|my_center|LOCUS_16440 4261 4935 gene locus_tag LOCUS_16450 4261 4935 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948966.1 protein_id gnl|my_center|LOCUS_16450 4928 5740 gene locus_tag LOCUS_16460 4928 5740 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948965.1 protein_id gnl|my_center|LOCUS_16460 5733 6176 gene locus_tag LOCUS_16470 5733 6176 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence094 <1 1047 gene locus_tag LOCUS_16480 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase 2465 1107 gene locus_tag LOCUS_16490 2465 1107 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_16490 4727 2733 gene locus_tag LOCUS_16500 4727 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5277 4759 gene locus_tag LOCUS_16510 gene greA 5277 4759 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_16510 <6410 5516 gene locus_tag LOCUS_16520 <6410 5516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053675.1:anion transporter >Feature sequence095 1147 155 gene locus_tag LOCUS_16530 1147 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2973 1168 gene locus_tag LOCUS_16540 gene lepA 2973 1168 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_16540 3537 3274 gene locus_tag LOCUS_16550 gene rpsT 3537 3274 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 protein_id gnl|my_center|LOCUS_16550 4553 3612 gene locus_tag LOCUS_16560 4553 3612 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_16560 5443 4550 gene locus_tag LOCUS_16570 gene truB 5443 4550 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_16570 <6154 5443 gene locus_tag LOCUS_16580 <6154 5443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053104374.1:bifunctional oligoribonuclease/PAP phosphatase NrnA >Feature sequence096 252 1910 gene locus_tag LOCUS_16590 252 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1985 2923 gene locus_tag LOCUS_16600 1985 2923 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_16600 2998 3681 gene locus_tag LOCUS_16610 2998 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 4735 3806 gene locus_tag LOCUS_16620 gene fba 4735 3806 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_16620 5616 4759 gene locus_tag LOCUS_16630 5616 4759 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640877.1 protein_id gnl|my_center|LOCUS_16630 5975 5616 gene locus_tag LOCUS_16640 gene crcB 5975 5616 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence097 1413 856 gene locus_tag LOCUS_16650 1413 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2460 1579 gene locus_tag LOCUS_16660 2460 1579 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_16660 3165 2545 gene locus_tag LOCUS_16670 gene ttdB 3165 2545 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 protein_id gnl|my_center|LOCUS_16670 4064 3165 gene locus_tag LOCUS_16680 gene ttdA 4064 3165 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_16680 4262 4125 gene locus_tag LOCUS_16690 4262 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5392 4247 gene locus_tag LOCUS_16700 5392 4247 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence098 500 1960 gene locus_tag LOCUS_16710 500 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1947 2840 gene locus_tag LOCUS_16720 1947 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2837 3301 gene locus_tag LOCUS_16730 2837 3301 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073873.1 protein_id gnl|my_center|LOCUS_16730 3303 5243 gene locus_tag LOCUS_16740 gene cirA 3303 5243 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488257.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence099 545 1243 gene locus_tag LOCUS_16750 545 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1462 1968 gene locus_tag LOCUS_16760 1462 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1987 2142 gene locus_tag LOCUS_16770 1987 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2126 2419 gene locus_tag LOCUS_16780 2126 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16780 2643 3506 gene locus_tag LOCUS_16790 2643 3506 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence100 1427 564 gene locus_tag LOCUS_16800 1427 564 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_16800 2603 1968 gene locus_tag LOCUS_16810 2603 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3607 2723 gene locus_tag LOCUS_16820 3607 2723 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_16820 4940 3609 gene locus_tag LOCUS_16830 4940 3609 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480751.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence101 51 503 gene locus_tag LOCUS_16840 51 503 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_16840 693 2000 gene locus_tag LOCUS_16850 693 2000 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_16850 2017 2943 gene locus_tag LOCUS_16860 gene thrB 2017 2943 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_16860 2957 3622 gene locus_tag LOCUS_16870 2957 3622 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_16870 3848 5281 gene locus_tag LOCUS_16880 3848 5281 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948144.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence102 1075 2448 gene locus_tag LOCUS_16890 1075 2448 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_16890 2527 3573 gene locus_tag LOCUS_16900 2527 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence103 <1 2499 gene locus_tag LOCUS_16910 <1 2499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541545.1:DNA mismatch repair protein MutS 2499 4487 gene locus_tag LOCUS_16920 gene mutL 2499 4487 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392628.1 protein_id gnl|my_center|LOCUS_16920 4506 5300 gene locus_tag LOCUS_16930 4506 5300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811585.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence104 238 822 gene locus_tag LOCUS_16940 238 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1118 1354 gene locus_tag LOCUS_16950 1118 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1347 3428 gene locus_tag LOCUS_16960 gene feoB 1347 3428 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861233.1 protein_id gnl|my_center|LOCUS_16960 3576 3794 gene locus_tag LOCUS_16970 3576 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence105 1 1137 gene locus_tag LOCUS_16980 1 1137 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922165.1 protein_id gnl|my_center|LOCUS_16980 1159 2196 gene locus_tag LOCUS_16990 1159 2196 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548798.1 protein_id gnl|my_center|LOCUS_16990 2724 2443 gene locus_tag LOCUS_17000 2724 2443 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_17000 3270 3440 gene locus_tag LOCUS_17010 3270 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3596 3447 gene locus_tag LOCUS_17020 3596 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3879 5051 gene locus_tag LOCUS_17030 3879 5051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895603.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence106 399 139 gene locus_tag LOCUS_17040 gene spoVS 399 139 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_17040 1132 575 gene locus_tag LOCUS_17050 1132 575 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723131.1 protein_id gnl|my_center|LOCUS_17050 2837 1113 gene locus_tag LOCUS_17060 gene recN 2837 1113 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_17060 3295 2840 gene locus_tag LOCUS_17070 gene argR 3295 2840 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810957.1 protein_id gnl|my_center|LOCUS_17070 4188 3310 gene locus_tag LOCUS_17080 4188 3310 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_17080 5020 4217 gene locus_tag LOCUS_17090 5020 4217 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence107 1201 440 gene locus_tag LOCUS_17100 1201 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2321 1212 gene locus_tag LOCUS_17110 2321 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_17110 3782 2340 gene locus_tag LOCUS_17120 3782 2340 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_17120 5001 3973 gene locus_tag LOCUS_17130 5001 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence108 688 398 gene locus_tag LOCUS_17140 688 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1205 852 gene locus_tag LOCUS_17150 gene rplT 1205 852 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_17150 1448 1251 gene locus_tag LOCUS_17160 gene rpmI 1448 1251 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_17160 2000 1467 gene locus_tag LOCUS_17170 gene infC 2000 1467 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_17170 2767 2165 gene locus_tag LOCUS_17180 gene thiT 2767 2165 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_17180 3609 2764 gene locus_tag LOCUS_17190 3609 2764 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_17190 4964 3630 gene locus_tag LOCUS_17200 4964 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence109 119 668 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgcaagggggcgtggattgaaat 950 2119 gene locus_tag LOCUS_17210 950 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427320.1 protein_id gnl|my_center|LOCUS_17210 2134 3294 gene locus_tag LOCUS_17220 2134 3294 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_17220 3305 3424 gene locus_tag LOCUS_17230 3305 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3518 4099 gene locus_tag LOCUS_17240 3518 4099 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_17240 4171 4247 gene locus_tag LOCUS_t00440 4171 4247 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 <1 1094 gene locus_tag LOCUS_17250 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791788.1:tryptophan--tRNA ligase 1109 2467 gene locus_tag LOCUS_17260 1109 2467 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_17260 2518 3126 gene locus_tag LOCUS_17270 2518 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3290 4102 gene locus_tag LOCUS_17280 3290 4102 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence111 2804 810 gene locus_tag LOCUS_17290 gene uvrB 2804 810 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_17290 2940 4496 gene locus_tag LOCUS_17300 2940 4496 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence112 1281 349 gene locus_tag LOCUS_17310 1281 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1433 1573 gene locus_tag LOCUS_17320 1433 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1653 2063 gene locus_tag LOCUS_17330 1653 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2085 2354 gene locus_tag LOCUS_17340 2085 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2637 3632 gene locus_tag LOCUS_17350 2637 3632 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_17350 3742 4572 gene locus_tag LOCUS_17360 3742 4572 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence113 1185 55 gene locus_tag LOCUS_17370 1185 55 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861188.1 protein_id gnl|my_center|LOCUS_17370 1678 1199 gene locus_tag LOCUS_17380 1678 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2043 1678 gene locus_tag LOCUS_17390 2043 1678 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861030.1 protein_id gnl|my_center|LOCUS_17390 2412 2044 gene locus_tag LOCUS_17400 2412 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2777 2409 gene locus_tag LOCUS_17410 2777 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 <4612 3077 gene locus_tag LOCUS_17420 <4612 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928179.1:minor capsid protein >Feature sequence114 268 879 gene locus_tag LOCUS_17430 gene purN 268 879 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_17430 892 1494 gene locus_tag LOCUS_17440 892 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1508 2791 gene locus_tag LOCUS_17450 gene purD 1508 2791 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_17450 2938 4449 gene locus_tag LOCUS_17460 2938 4449 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence115 <1 2380 gene locus_tag LOCUS_17470 <1 2380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963336.1:DNA gyrase subunit A 2664 3104 gene locus_tag LOCUS_17480 2664 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4019 3141 gene locus_tag LOCUS_17490 4019 3141 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945976.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence116 361 1188 gene locus_tag LOCUS_17500 gene larE 361 1188 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17500 1191 1943 gene locus_tag LOCUS_17510 gene larB 1191 1943 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_17510 1948 3333 gene locus_tag LOCUS_17520 gene larC 1948 3333 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence117 1536 22 gene locus_tag LOCUS_17530 1536 22 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948762.1 protein_id gnl|my_center|LOCUS_17530 2827 1646 gene locus_tag LOCUS_17540 2827 1646 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_17540 <4218 2947 gene locus_tag LOCUS_17550 <4218 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438301.1:PolC-type DNA polymerase III >Feature sequence118 2096 489 gene locus_tag LOCUS_17560 2096 489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_17560 2237 2728 gene locus_tag LOCUS_17570 2237 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3717 2929 gene locus_tag LOCUS_17580 3717 2929 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence119 1512 1051 gene locus_tag LOCUS_17590 gene rimP 1512 1051 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_17590 1734 3788 gene locus_tag LOCUS_17600 1734 3788 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence120 291 1466 gene locus_tag LOCUS_17610 291 1466 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788311.1 protein_id gnl|my_center|LOCUS_17610 1917 3605 gene locus_tag LOCUS_17620 gene leuA 1917 3605 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence121 672 2183 gene locus_tag LOCUS_17630 672 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2409 3848 gene locus_tag LOCUS_17640 2409 3848 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence122 3839 2790 gene locus_tag LOCUS_17650 3839 2790 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence123 78 353 gene locus_tag LOCUS_17660 78 353 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_17660 337 636 gene locus_tag LOCUS_17670 337 636 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_17670 653 3238 gene locus_tag LOCUS_17680 653 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3248 3604 gene locus_tag LOCUS_17690 gene rbfA 3248 3604 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931015.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence124 227 1972 gene locus_tag LOCUS_17700 227 1972 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence125 187 1140 gene locus_tag LOCUS_17710 gene mmuM 187 1140 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_17710 1191 1748 gene locus_tag LOCUS_17720 1191 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1745 2926 gene locus_tag LOCUS_17730 1745 2926 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence126 436 1746 gene locus_tag LOCUS_17740 436 1746 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101072.1 protein_id gnl|my_center|LOCUS_17740 3332 1887 gene locus_tag LOCUS_17750 3332 1887 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918514.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence127 2231 789 gene locus_tag LOCUS_17760 gene purF 2231 789 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_17760 2751 2248 gene locus_tag LOCUS_17770 gene purE 2751 2248 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_17770 3437 3018 gene locus_tag LOCUS_17780 3437 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence128 1169 156 gene locus_tag LOCUS_17790 gene pta 1169 156 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_17790 1860 1357 gene locus_tag LOCUS_17800 1860 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3409 2036 gene locus_tag LOCUS_17810 3409 2036 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence129 988 503 gene locus_tag LOCUS_17820 gene snaB 988 503 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_17820 1776 967 gene locus_tag LOCUS_17830 1776 967 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837550.1 protein_id gnl|my_center|LOCUS_17830 2492 1773 gene locus_tag LOCUS_17840 2492 1773 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243465.1 protein_id gnl|my_center|LOCUS_17840 3210 2485 gene locus_tag LOCUS_17850 3210 2485 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988904.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence130 806 579 gene locus_tag LOCUS_17860 806 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 1144 806 gene locus_tag LOCUS_17870 1144 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17870 1271 1600 gene locus_tag LOCUS_17880 1271 1600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964792.1 protein_id gnl|my_center|LOCUS_17880 1722 2546 gene locus_tag LOCUS_17890 1722 2546 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968037.1 protein_id gnl|my_center|LOCUS_17890 3092 2589 gene locus_tag LOCUS_17900 3092 2589 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389386.1 protein_id gnl|my_center|LOCUS_17900 3349 3227 gene locus_tag LOCUS_17910 3349 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence131 80 1933 gene locus_tag LOCUS_17920 gene dnaK 80 1933 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_17920 1956 3125 gene locus_tag LOCUS_17930 gene dnaJ 1956 3125 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence132 <3172 397 gene locus_tag LOCUS_17940 <3172 397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869283.1:YadA family autotransporter adhesin >Feature sequence133 <1 905 gene locus_tag LOCUS_17950 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258870.1:DHHA1 domain-containing protein 1162 1911 gene locus_tag LOCUS_17960 gene rpsB 1162 1911 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_17960 1954 2835 gene locus_tag LOCUS_17970 gene tsf 1954 2835 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018578.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence134 723 268 gene locus_tag LOCUS_17980 723 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_17980 1520 720 gene locus_tag LOCUS_17990 1520 720 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_17990 2805 1513 gene locus_tag LOCUS_18000 2805 1513 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence135 222 1259 gene locus_tag LOCUS_18010 222 1259 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_18010 1249 1911 gene locus_tag LOCUS_18020 1249 1911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_18020 2346 1996 gene locus_tag LOCUS_18030 2346 1996 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence136 1478 750 gene locus_tag LOCUS_18040 1478 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1619 2164 gene locus_tag LOCUS_18050 1619 2164 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence137 277 861 gene locus_tag LOCUS_18060 277 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 892 1341 gene locus_tag LOCUS_18070 gene paaI 892 1341 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_18070 >Feature sequence138 2080 233 gene locus_tag LOCUS_18080 gene recQ 2080 233 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence139 1227 187 gene locus_tag LOCUS_18090 1227 187 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_18090 <2289 1462 gene locus_tag LOCUS_18100 <2289 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:insulinase family protein >Feature sequence140 607 20 gene locus_tag LOCUS_18110 607 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1285 686 gene locus_tag LOCUS_18120 1285 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1865 1422 gene locus_tag LOCUS_18130 1865 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence141 2088 688 gene locus_tag LOCUS_18140 2088 688 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_18140 2268 2140 gene locus_tag LOCUS_18150 2268 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence142 511 1503 gene locus_tag LOCUS_18160 511 1503 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence143 1756 845 gene locus_tag LOCUS_18170 gene murB 1756 845 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_18170 2022 1756 gene locus_tag LOCUS_18180 2022 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence144 1004 357 gene locus_tag LOCUS_18190 gene cas4 1004 357 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_18190 1924 1028 gene locus_tag LOCUS_18200 gene cas7c 1924 1028 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_18200