>Feature sequence001 2266 401 gene locus_tag LOCUS_00010 2266 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2863 2474 gene locus_tag LOCUS_00020 2863 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3179 2871 gene locus_tag LOCUS_00030 3179 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3999 3184 gene locus_tag LOCUS_00040 3999 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5880 4096 gene locus_tag LOCUS_00050 gene ftsH 5880 4096 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_00050 6872 5994 gene locus_tag LOCUS_00060 6872 5994 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_00060 7375 8781 gene locus_tag LOCUS_00070 7375 8781 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_00070 8798 10183 gene locus_tag LOCUS_00080 8798 10183 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_00080 10398 10856 gene locus_tag LOCUS_00090 gene mscL 10398 10856 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_00090 12092 10935 gene locus_tag LOCUS_00100 12092 10935 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_00100 15492 12085 gene locus_tag LOCUS_00110 15492 12085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_00110 16051 15461 gene locus_tag LOCUS_00120 16051 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17511 16048 gene locus_tag LOCUS_00130 17511 16048 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_00130 17897 18529 gene locus_tag LOCUS_00140 gene catA 17897 18529 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_00140 18617 19237 gene locus_tag LOCUS_00150 18617 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20182 19370 gene locus_tag LOCUS_00160 20182 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 21383 20925 gene locus_tag LOCUS_00170 21383 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21644 21438 gene locus_tag LOCUS_00180 21644 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 22033 21677 gene locus_tag LOCUS_00190 22033 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22784 22098 gene locus_tag LOCUS_00200 22784 22098 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989414.1 protein_id gnl|my_center|LOCUS_00200 24118 22781 gene locus_tag LOCUS_00210 24118 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974284.1 protein_id gnl|my_center|LOCUS_00210 24935 24108 gene locus_tag LOCUS_00220 24935 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26812 24938 gene locus_tag LOCUS_00230 26812 24938 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884100.1 protein_id gnl|my_center|LOCUS_00230 26904 27107 gene locus_tag LOCUS_00240 26904 27107 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108573.1 protein_id gnl|my_center|LOCUS_00240 27109 30339 gene locus_tag LOCUS_00250 27109 30339 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922226.1 protein_id gnl|my_center|LOCUS_00250 30345 32006 gene locus_tag LOCUS_00260 30345 32006 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_00260 31999 33000 gene locus_tag LOCUS_00270 31999 33000 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_00270 33045 33599 gene locus_tag LOCUS_00280 33045 33599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34710 33523 gene locus_tag LOCUS_00290 34710 33523 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_00290 35761 34769 gene locus_tag LOCUS_00300 35761 34769 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_00300 35824 36522 gene locus_tag LOCUS_00310 35824 36522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 36525 37295 gene locus_tag LOCUS_00320 36525 37295 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172680449.1 protein_id gnl|my_center|LOCUS_00320 37700 37374 gene locus_tag LOCUS_00330 37700 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38749 37808 gene locus_tag LOCUS_00340 38749 37808 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005944378.1 protein_id gnl|my_center|LOCUS_00340 39047 38739 gene locus_tag LOCUS_00350 39047 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40265 39186 gene locus_tag LOCUS_00360 40265 39186 CDS product DUF6371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461658.1 protein_id gnl|my_center|LOCUS_00360 41720 40344 gene locus_tag LOCUS_00370 41720 40344 CDS product DUF3987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203629.1 protein_id gnl|my_center|LOCUS_00370 42097 41732 gene locus_tag LOCUS_00380 42097 41732 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202325.1 protein_id gnl|my_center|LOCUS_00380 42282 43208 gene locus_tag LOCUS_00390 42282 43208 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546249.1 protein_id gnl|my_center|LOCUS_00390 43855 43220 gene locus_tag LOCUS_00400 43855 43220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44705 44340 gene locus_tag LOCUS_00410 44705 44340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45821 44715 gene locus_tag LOCUS_00420 45821 44715 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_00420 46817 45906 gene locus_tag LOCUS_00430 46817 45906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48499 47084 gene locus_tag LOCUS_00440 gene mnmE 48499 47084 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_00440 49893 48748 gene locus_tag LOCUS_00450 49893 48748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50501 49995 gene locus_tag LOCUS_00460 50501 49995 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202236.1 protein_id gnl|my_center|LOCUS_00460 51574 50660 gene locus_tag LOCUS_00470 51574 50660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_00470 53020 51590 gene locus_tag LOCUS_00480 53020 51590 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759989.1 protein_id gnl|my_center|LOCUS_00480 55900 53087 gene locus_tag LOCUS_00490 55900 53087 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_00490 56901 55954 gene locus_tag LOCUS_00500 gene trxB 56901 55954 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_00500 57074 58216 gene locus_tag LOCUS_00510 57074 58216 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202960.1 protein_id gnl|my_center|LOCUS_00510 58446 59660 gene locus_tag LOCUS_00520 58446 59660 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_00520 59653 60006 gene locus_tag LOCUS_00530 59653 60006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence002 2240 891 gene locus_tag LOCUS_00540 2240 891 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_00540 3384 2260 gene locus_tag LOCUS_00550 3384 2260 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_00550 4660 3398 gene locus_tag LOCUS_00560 4660 3398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_00560 5937 4675 gene locus_tag LOCUS_00570 5937 4675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_00570 6613 5930 gene locus_tag LOCUS_00580 6613 5930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_00580 8905 7112 gene locus_tag LOCUS_00590 gene argS 8905 7112 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_00590 9908 9636 gene locus_tag LOCUS_00600 9908 9636 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_00600 10121 10843 gene locus_tag LOCUS_00610 10121 10843 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_00610 10824 11702 gene locus_tag LOCUS_00620 10824 11702 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_00620 11709 12809 gene locus_tag LOCUS_00630 11709 12809 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_00630 13401 12826 gene locus_tag LOCUS_00640 13401 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 14396 13389 gene locus_tag LOCUS_00650 14396 13389 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_00650 14564 17578 gene locus_tag LOCUS_00660 gene secDF 14564 17578 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_00660 17690 19792 gene locus_tag LOCUS_00670 gene recG 17690 19792 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_00670 20053 21222 gene locus_tag LOCUS_00680 20053 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 21437 21979 gene locus_tag LOCUS_00690 21437 21979 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_00690 21995 23278 gene locus_tag LOCUS_00700 21995 23278 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_00700 23314 24075 gene locus_tag LOCUS_00710 gene tpiA 23314 24075 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_00710 24307 24702 gene locus_tag LOCUS_00720 24307 24702 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_00720 24705 25298 gene locus_tag LOCUS_00730 gene folE 24705 25298 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_00730 25453 26196 gene locus_tag LOCUS_00740 25453 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_00740 27464 26280 gene locus_tag LOCUS_00750 27464 26280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_00750 28082 27666 gene locus_tag LOCUS_00760 28082 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 28618 29406 gene locus_tag LOCUS_00770 28618 29406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 29604 33404 gene locus_tag LOCUS_00780 gene dnaE 29604 33404 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_00780 33483 33797 gene locus_tag LOCUS_00790 gene trxA 33483 33797 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_00790 35950 33893 gene locus_tag LOCUS_00800 35950 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 37217 36540 gene locus_tag LOCUS_00810 gene mnmD 37217 36540 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence003 1023 3059 gene locus_tag LOCUS_00820 1023 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 4778 3219 gene locus_tag LOCUS_00830 4778 3219 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767799.1 protein_id gnl|my_center|LOCUS_00830 6620 4902 gene locus_tag LOCUS_00840 gene sppA 6620 4902 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_00840 7409 6696 gene locus_tag LOCUS_00850 7409 6696 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_00850 7833 8747 gene locus_tag LOCUS_00860 7833 8747 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_00860 8911 10155 gene locus_tag LOCUS_00870 8911 10155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_00870 11616 10255 gene locus_tag LOCUS_00880 11616 10255 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_00880 11752 12981 gene locus_tag LOCUS_00890 11752 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_00890 13048 14262 gene locus_tag LOCUS_00900 13048 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_00900 14267 15154 gene locus_tag LOCUS_00910 14267 15154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_00910 17172 15670 gene locus_tag LOCUS_00920 17172 15670 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_00920 17337 19961 gene locus_tag LOCUS_00930 17337 19961 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_00930 20131 20721 gene locus_tag LOCUS_00940 20131 20721 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_00940 20718 23021 gene locus_tag LOCUS_00950 20718 23021 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_00950 23784 23107 gene locus_tag LOCUS_00960 23784 23107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 24859 23876 gene locus_tag LOCUS_00970 gene nadA 24859 23876 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_00970 25307 26095 gene locus_tag LOCUS_00980 25307 26095 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_00980 26102 27355 gene locus_tag LOCUS_00990 26102 27355 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202530.1 protein_id gnl|my_center|LOCUS_00990 28011 27586 gene locus_tag LOCUS_01000 gene tsaE 28011 27586 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_01000 29626 28079 gene locus_tag LOCUS_01010 29626 28079 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_01010 30479 29700 gene locus_tag LOCUS_01020 30479 29700 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_01020 32634 30616 gene locus_tag LOCUS_01030 32634 30616 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_01030 33451 32645 gene locus_tag LOCUS_01040 33451 32645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 33590 34204 gene locus_tag LOCUS_01050 33590 34204 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_01050 34741 34211 gene locus_tag LOCUS_01060 34741 34211 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence004 <1 830 gene locus_tag LOCUS_01070 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963816.1:proline dehydrogenase family protein 1036 1212 gene locus_tag LOCUS_01080 1036 1212 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_01080 1359 2693 gene locus_tag LOCUS_01090 gene gdhA 1359 2693 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_01090 3330 2767 gene locus_tag LOCUS_01100 gene ruvC 3330 2767 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_01100 3641 3330 gene locus_tag LOCUS_01110 3641 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3737 3663 gene locus_tag LOCUS_t00010 3737 3663 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6429 3868 gene locus_tag LOCUS_01120 6429 3868 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_01120 8197 6533 gene locus_tag LOCUS_01130 8197 6533 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_01130 8325 8609 gene locus_tag LOCUS_01140 8325 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8612 9157 gene locus_tag LOCUS_01150 8612 9157 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_01150 9310 10095 gene locus_tag LOCUS_01160 9310 10095 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_01160 10127 11380 gene locus_tag LOCUS_01170 10127 11380 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_01170 12001 11396 gene locus_tag LOCUS_01180 12001 11396 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_01180 13325 12057 gene locus_tag LOCUS_01190 13325 12057 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_01190 13759 13322 gene locus_tag LOCUS_01200 gene umuD 13759 13322 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_01200 14327 13779 gene locus_tag LOCUS_01210 14327 13779 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_01210 14937 14335 gene locus_tag LOCUS_01220 14937 14335 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_01220 15135 15815 gene locus_tag LOCUS_01230 15135 15815 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_01230 15821 16588 gene locus_tag LOCUS_01240 15821 16588 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_01240 16598 17914 gene locus_tag LOCUS_01250 16598 17914 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_01250 18487 18002 gene locus_tag LOCUS_01260 18487 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 18606 20252 gene locus_tag LOCUS_01270 18606 20252 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_01270 20511 20951 gene locus_tag LOCUS_01280 20511 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 20948 21430 gene locus_tag LOCUS_01290 20948 21430 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761066.1 protein_id gnl|my_center|LOCUS_01290 21427 21831 gene locus_tag LOCUS_01300 21427 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 21992 21918 gene locus_tag LOCUS_t00020 21992 21918 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22717 22103 gene locus_tag LOCUS_01310 22717 22103 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_01310 23361 22714 gene locus_tag LOCUS_01320 23361 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760131.1 protein_id gnl|my_center|LOCUS_01320 24226 23396 gene locus_tag LOCUS_01330 gene murQ 24226 23396 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_01330 25071 24223 gene locus_tag LOCUS_01340 25071 24223 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_01340 26517 25078 gene locus_tag LOCUS_01350 gene nhaD 26517 25078 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_01350 28202 26682 gene locus_tag LOCUS_01360 28202 26682 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_01360 28365 30578 gene locus_tag LOCUS_01370 28365 30578 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence005 3021 853 gene locus_tag LOCUS_01380 3021 853 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_01380 3383 3024 gene locus_tag LOCUS_01390 3383 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4310 3393 gene locus_tag LOCUS_01400 gene rsmH 4310 3393 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_01400 5303 4551 gene locus_tag LOCUS_01410 5303 4551 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_01410 6907 5447 gene locus_tag LOCUS_01420 6907 5447 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_01420 10151 6927 gene locus_tag LOCUS_01430 10151 6927 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839626.1 protein_id gnl|my_center|LOCUS_01430 11070 10246 gene locus_tag LOCUS_01440 11070 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 11913 12878 gene locus_tag LOCUS_01450 11913 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109301.1 protein_id gnl|my_center|LOCUS_01450 12923 13870 gene locus_tag LOCUS_01460 12923 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109301.1 protein_id gnl|my_center|LOCUS_01460 14251 13940 gene locus_tag LOCUS_01470 14251 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14372 15358 gene locus_tag LOCUS_01480 14372 15358 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_01480 15362 17833 gene locus_tag LOCUS_01490 15362 17833 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_01490 18662 17931 gene locus_tag LOCUS_01500 18662 17931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_01500 20170 18665 gene locus_tag LOCUS_01510 20170 18665 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_01510 21752 20418 gene locus_tag LOCUS_01520 21752 20418 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_01520 21831 24470 gene locus_tag LOCUS_01530 21831 24470 CDS product beta galactosidase jelly roll domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108903.1 protein_id gnl|my_center|LOCUS_01530 24492 25247 gene locus_tag LOCUS_01540 24492 25247 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_01540 25609 26232 gene locus_tag LOCUS_01550 gene udk 25609 26232 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_01550 26287 26994 gene locus_tag LOCUS_01560 26287 26994 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_01560 26996 27610 gene locus_tag LOCUS_01570 26996 27610 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_01570 27807 31070 gene locus_tag LOCUS_01580 gene porU 27807 31070 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_01580 31127 32320 gene locus_tag LOCUS_01590 gene porV 31127 32320 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_01590 32415 32891 gene locus_tag LOCUS_01600 gene ispF 32415 32891 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence006 355 1446 gene locus_tag LOCUS_01610 gene mnmA 355 1446 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_01610 1512 2870 gene locus_tag LOCUS_01620 gene hisS 1512 2870 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_01620 3140 3688 gene locus_tag LOCUS_01630 3140 3688 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_01630 3756 4886 gene locus_tag LOCUS_01640 3756 4886 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203444.1 protein_id gnl|my_center|LOCUS_01640 5009 8437 gene locus_tag LOCUS_01650 5009 8437 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798155.1 protein_id gnl|my_center|LOCUS_01650 8458 10335 gene locus_tag LOCUS_01660 8458 10335 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108525.1 protein_id gnl|my_center|LOCUS_01660 11206 10430 gene locus_tag LOCUS_01670 11206 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 13027 13428 gene locus_tag LOCUS_01680 13027 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 13698 14807 gene locus_tag LOCUS_01690 13698 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 14812 15435 gene locus_tag LOCUS_01700 14812 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 15555 16370 gene locus_tag LOCUS_01710 15555 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 16411 17448 gene locus_tag LOCUS_01720 16411 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 17508 17969 gene locus_tag LOCUS_01730 17508 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 18006 18079 gene locus_tag LOCUS_t00030 18006 18079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19314 18169 gene locus_tag LOCUS_01740 19314 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 19780 20367 gene locus_tag LOCUS_01750 19780 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 20468 21046 gene locus_tag LOCUS_01760 20468 21046 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_01760 21174 22340 gene locus_tag LOCUS_01770 21174 22340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 22423 24891 gene locus_tag LOCUS_01780 gene priA 22423 24891 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_01780 25204 25620 gene locus_tag LOCUS_01790 25204 25620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 25650 26165 gene locus_tag LOCUS_01800 25650 26165 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_01800 28170 26137 gene locus_tag LOCUS_01810 28170 26137 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_01810 28384 29901 gene locus_tag LOCUS_01820 gene gltX 28384 29901 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_01820 29938 31185 gene locus_tag LOCUS_01830 29938 31185 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_01830 31827 31246 gene locus_tag LOCUS_01840 31827 31246 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_01840 32533 31829 gene locus_tag LOCUS_01850 32533 31829 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence007 1474 2595 gene locus_tag LOCUS_01860 1474 2595 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_01860 2732 4228 gene locus_tag LOCUS_01870 2732 4228 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_01870 4240 5487 gene locus_tag LOCUS_01880 4240 5487 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_01880 5523 7892 gene locus_tag LOCUS_01890 5523 7892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202843.1 protein_id gnl|my_center|LOCUS_01890 7973 10306 gene locus_tag LOCUS_01900 7973 10306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202844.1 protein_id gnl|my_center|LOCUS_01900 10550 12934 gene locus_tag LOCUS_01910 10550 12934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107560.1 protein_id gnl|my_center|LOCUS_01910 13318 15645 gene locus_tag LOCUS_01920 13318 15645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787751.1 protein_id gnl|my_center|LOCUS_01920 15867 18155 gene locus_tag LOCUS_01930 15867 18155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203351.1 protein_id gnl|my_center|LOCUS_01930 18175 20532 gene locus_tag LOCUS_01940 18175 20532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107500.1 protein_id gnl|my_center|LOCUS_01940 20582 21256 gene locus_tag LOCUS_01950 20582 21256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_01950 21360 22103 gene locus_tag LOCUS_01960 21360 22103 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_01960 22654 23736 gene locus_tag LOCUS_01970 22654 23736 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_01970 23876 24361 gene locus_tag LOCUS_01980 23876 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 24345 24857 gene locus_tag LOCUS_01990 24345 24857 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_01990 24854 25261 gene locus_tag LOCUS_02000 24854 25261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 25258 25731 gene locus_tag LOCUS_02010 25258 25731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 25803 27680 gene locus_tag LOCUS_02020 gene mnmG 25803 27680 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_02020 27762 29585 gene locus_tag LOCUS_02030 gene uvrC 27762 29585 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_02030 29595 30047 gene locus_tag LOCUS_02040 gene dtd 29595 30047 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_02040 30050 30385 gene locus_tag LOCUS_02050 30050 30385 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_02050 >Feature sequence008 898 3786 gene locus_tag LOCUS_02060 898 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4215 3928 gene locus_tag LOCUS_02070 4215 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 4448 4248 gene locus_tag LOCUS_02080 4448 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4593 7271 gene locus_tag LOCUS_02090 4593 7271 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_02090 7321 8892 gene locus_tag LOCUS_02100 7321 8892 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201965.1 protein_id gnl|my_center|LOCUS_02100 9258 9824 gene locus_tag LOCUS_02110 9258 9824 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785427.1 protein_id gnl|my_center|LOCUS_02110 9943 13548 gene locus_tag LOCUS_02120 9943 13548 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170848661.1 protein_id gnl|my_center|LOCUS_02120 13858 15786 gene locus_tag LOCUS_02130 13858 15786 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658523.1 protein_id gnl|my_center|LOCUS_02130 15912 16772 gene locus_tag LOCUS_02140 15912 16772 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_02140 16838 17626 gene locus_tag LOCUS_02150 16838 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 18665 17739 gene locus_tag LOCUS_02160 18665 17739 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108346.1 protein_id gnl|my_center|LOCUS_02160 22102 18662 gene locus_tag LOCUS_02170 22102 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 23053 22250 gene locus_tag LOCUS_02180 23053 22250 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_02180 23488 23069 gene locus_tag LOCUS_02190 23488 23069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_02190 24738 23503 gene locus_tag LOCUS_02200 gene aroA 24738 23503 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_02200 25781 24834 gene locus_tag LOCUS_02210 25781 24834 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108591.1 protein_id gnl|my_center|LOCUS_02210 25970 26770 gene locus_tag LOCUS_02220 25970 26770 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015775.1 protein_id gnl|my_center|LOCUS_02220 28002 27019 gene locus_tag LOCUS_02230 gene dusB 28002 27019 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_02230 28240 28079 gene locus_tag LOCUS_02240 28240 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 28437 29120 gene locus_tag LOCUS_02250 28437 29120 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_02250 <30253 29360 gene locus_tag LOCUS_02260 <30253 29360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762581.1:aspartate-semialdehyde dehydrogenase >Feature sequence009 2668 1628 gene locus_tag LOCUS_02270 gene mltG 2668 1628 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_02270 2816 2905 gene locus_tag LOCUS_t00040 2816 2905 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3193 3417 gene locus_tag LOCUS_02280 3193 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4013 3507 gene locus_tag LOCUS_02290 4013 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5155 4367 gene locus_tag LOCUS_02300 5155 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 7112 5484 gene locus_tag LOCUS_02310 7112 5484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_02310 8413 7124 gene locus_tag LOCUS_02320 8413 7124 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107701.1 protein_id gnl|my_center|LOCUS_02320 8744 8580 gene locus_tag LOCUS_02330 8744 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8911 8823 gene locus_tag LOCUS_t00050 8911 8823 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10568 9201 gene locus_tag LOCUS_02340 10568 9201 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767229.1 protein_id gnl|my_center|LOCUS_02340 13768 10577 gene locus_tag LOCUS_02350 13768 10577 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108542.1 protein_id gnl|my_center|LOCUS_02350 14884 13781 gene locus_tag LOCUS_02360 14884 13781 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761836.1 protein_id gnl|my_center|LOCUS_02360 15082 15993 gene locus_tag LOCUS_02370 15082 15993 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_02370 18410 16119 gene locus_tag LOCUS_02380 18410 16119 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_02380 18889 18506 gene locus_tag LOCUS_02390 18889 18506 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_02390 19595 19029 gene locus_tag LOCUS_02400 19595 19029 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_02400 20694 19672 gene locus_tag LOCUS_02410 20694 19672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_02410 21728 20697 gene locus_tag LOCUS_02420 21728 20697 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_02420 23757 21742 gene locus_tag LOCUS_02430 23757 21742 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763412.1 protein_id gnl|my_center|LOCUS_02430 24790 23831 gene locus_tag LOCUS_02440 24790 23831 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_02440 26912 24897 gene locus_tag LOCUS_02450 26912 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 27191 26928 gene locus_tag LOCUS_02460 27191 26928 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_02460 27359 29704 gene locus_tag LOCUS_02470 gene topA 27359 29704 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence010 2198 561 gene locus_tag LOCUS_02480 2198 561 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761073.1 protein_id gnl|my_center|LOCUS_02480 2773 3312 gene locus_tag LOCUS_02490 2773 3312 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107605.1 protein_id gnl|my_center|LOCUS_02490 3326 4759 gene locus_tag LOCUS_02500 3326 4759 CDS product DUF3868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103878196.1 protein_id gnl|my_center|LOCUS_02500 4763 6301 gene locus_tag LOCUS_02510 4763 6301 CDS product Mfa1 family fimbria major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203095.1 protein_id gnl|my_center|LOCUS_02510 6323 7330 gene locus_tag LOCUS_02520 6323 7330 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763526.1 protein_id gnl|my_center|LOCUS_02520 7332 8612 gene locus_tag LOCUS_02530 7332 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 8899 9729 gene locus_tag LOCUS_02540 8899 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9852 15452 gene locus_tag LOCUS_02550 9852 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15841 17181 gene locus_tag LOCUS_02560 gene ffh 15841 17181 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_02560 17197 18084 gene locus_tag LOCUS_02570 gene folD 17197 18084 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_02570 18284 19573 gene locus_tag LOCUS_02580 18284 19573 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_02580 19589 20758 gene locus_tag LOCUS_02590 19589 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20845 20920 gene locus_tag LOCUS_t00060 20845 20920 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 20953 21028 gene locus_tag LOCUS_t00070 20953 21028 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21236 22456 gene locus_tag LOCUS_02600 gene pepT 21236 22456 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_02600 22505 23590 gene locus_tag LOCUS_02610 gene gcvT 22505 23590 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_02610 23712 24740 gene locus_tag LOCUS_02620 gene iolU 23712 24740 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_02620 25865 24741 gene locus_tag LOCUS_02630 25865 24741 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_02630 26920 26195 gene locus_tag LOCUS_02640 26920 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 27868 26936 gene locus_tag LOCUS_02650 27868 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 28749 27892 gene locus_tag LOCUS_02660 28749 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 29463 28765 gene locus_tag LOCUS_02670 29463 28765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence011 4 75 gene locus_tag LOCUS_t00080 4 75 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 478 1056 gene locus_tag LOCUS_02680 478 1056 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_02680 1488 4412 gene locus_tag LOCUS_02690 1488 4412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_02690 4428 6020 gene locus_tag LOCUS_02700 4428 6020 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_02700 6042 6443 gene locus_tag LOCUS_02710 6042 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 6782 8740 gene locus_tag LOCUS_02720 gene pulA 6782 8740 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_02720 8765 10141 gene locus_tag LOCUS_02730 8765 10141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_02730 10143 12818 gene locus_tag LOCUS_02740 10143 12818 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108155.1 protein_id gnl|my_center|LOCUS_02740 13681 12923 gene locus_tag LOCUS_02750 13681 12923 CDS product DUF6261 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006270108.1 protein_id gnl|my_center|LOCUS_02750 13873 13706 gene locus_tag LOCUS_02760 13873 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 15982 14069 gene locus_tag LOCUS_02770 15982 14069 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786951.1 protein_id gnl|my_center|LOCUS_02770 19424 15999 gene locus_tag LOCUS_02780 19424 15999 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786949.1 protein_id gnl|my_center|LOCUS_02780 20075 22258 gene locus_tag LOCUS_02790 20075 22258 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_02790 22817 22266 gene locus_tag LOCUS_02800 22817 22266 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 protein_id gnl|my_center|LOCUS_02800 23400 22864 gene locus_tag LOCUS_02810 23400 22864 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108481.1 protein_id gnl|my_center|LOCUS_02810 24995 23400 gene locus_tag LOCUS_02820 24995 23400 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_02820 25493 25032 gene locus_tag LOCUS_02830 gene coaD 25493 25032 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_02830 27365 25497 gene locus_tag LOCUS_02840 27365 25497 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_02840 28514 27381 gene locus_tag LOCUS_02850 28514 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence012 483 1529 gene locus_tag LOCUS_02860 gene ribD 483 1529 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_02860 1625 2995 gene locus_tag LOCUS_02870 1625 2995 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108950.1 protein_id gnl|my_center|LOCUS_02870 3074 3790 gene locus_tag LOCUS_02880 3074 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 3803 4546 gene locus_tag LOCUS_02890 3803 4546 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_02890 4562 7255 gene locus_tag LOCUS_02900 4562 7255 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_02900 7420 7887 gene locus_tag LOCUS_02910 7420 7887 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_02910 7960 8463 gene locus_tag LOCUS_02920 7960 8463 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_02920 8533 9375 gene locus_tag LOCUS_02930 gene murI 8533 9375 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_02930 9959 9591 gene locus_tag LOCUS_02940 9959 9591 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_02940 11308 9956 gene locus_tag LOCUS_02950 11308 9956 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_02950 11525 15400 gene locus_tag LOCUS_02960 11525 15400 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108752.1 protein_id gnl|my_center|LOCUS_02960 15543 17564 gene locus_tag LOCUS_02970 15543 17564 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_02970 17580 17882 gene locus_tag LOCUS_02980 17580 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02980 17922 18719 gene locus_tag LOCUS_02990 17922 18719 CDS product basic secretory family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764203.1 protein_id gnl|my_center|LOCUS_02990 19030 20433 gene locus_tag LOCUS_03000 19030 20433 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_03000 20515 20775 gene locus_tag LOCUS_03010 20515 20775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 20721 21131 gene locus_tag LOCUS_03020 20721 21131 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_03020 21250 21672 gene locus_tag LOCUS_03030 21250 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 22927 21749 gene locus_tag LOCUS_03040 22927 21749 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_03040 23280 23837 gene locus_tag LOCUS_03050 23280 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 24011 24970 gene locus_tag LOCUS_03060 24011 24970 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681496.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence013 1405 509 gene locus_tag LOCUS_03070 1405 509 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_03070 2166 4490 gene locus_tag LOCUS_03080 2166 4490 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_03080 4513 5229 gene locus_tag LOCUS_03090 4513 5229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_03090 5416 6381 gene locus_tag LOCUS_03100 5416 6381 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_03100 6464 6991 gene locus_tag LOCUS_03110 6464 6991 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791198.1 protein_id gnl|my_center|LOCUS_03110 7147 10158 gene locus_tag LOCUS_03120 7147 10158 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_03120 10172 11950 gene locus_tag LOCUS_03130 10172 11950 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_03130 12754 12002 gene locus_tag LOCUS_03140 12754 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 13244 13038 gene locus_tag LOCUS_03150 13244 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 13357 14643 gene locus_tag LOCUS_03160 13357 14643 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_03160 14624 15808 gene locus_tag LOCUS_03170 14624 15808 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_03170 16983 15901 gene locus_tag LOCUS_03180 16983 15901 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_03180 21734 17484 gene locus_tag LOCUS_03190 21734 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 25809 22594 gene locus_tag LOCUS_03200 25809 22594 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence014 <1 1937 gene locus_tag LOCUS_03210 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817018.1:TonB-dependent receptor 1967 3421 gene locus_tag LOCUS_03220 1967 3421 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_03220 3488 4588 gene locus_tag LOCUS_03230 3488 4588 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_03230 4608 6227 gene locus_tag LOCUS_03240 4608 6227 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_03240 6319 7905 gene locus_tag LOCUS_03250 6319 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 8752 7988 gene locus_tag LOCUS_03260 8752 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9214 10521 gene locus_tag LOCUS_03270 9214 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10534 11244 gene locus_tag LOCUS_03280 10534 11244 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_03280 11231 12115 gene locus_tag LOCUS_03290 11231 12115 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_03290 12121 13674 gene locus_tag LOCUS_03300 12121 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 13676 13867 gene locus_tag LOCUS_03310 13676 13867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13877 15280 gene locus_tag LOCUS_03320 13877 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 15942 15457 gene locus_tag LOCUS_03330 15942 15457 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783533.1 protein_id gnl|my_center|LOCUS_03330 17536 15953 gene locus_tag LOCUS_03340 17536 15953 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_03340 18906 17539 gene locus_tag LOCUS_03350 18906 17539 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_03350 20394 18934 gene locus_tag LOCUS_03360 20394 18934 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_03360 21968 20466 gene locus_tag LOCUS_03370 21968 20466 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_03370 25103 21981 gene locus_tag LOCUS_03380 25103 21981 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_03380 26471 25482 gene locus_tag LOCUS_03390 26471 25482 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802446.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence015 <1 1163 gene locus_tag LOCUS_03400 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764238.1:lipid-A-disaccharide synthase 1251 1988 gene locus_tag LOCUS_03410 1251 1988 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_03410 3084 2068 gene locus_tag LOCUS_03420 3084 2068 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_03420 3293 3081 gene locus_tag LOCUS_03430 3293 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4064 3297 gene locus_tag LOCUS_03440 4064 3297 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_03440 4920 4048 gene locus_tag LOCUS_03450 4920 4048 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797001.1 protein_id gnl|my_center|LOCUS_03450 5710 5213 gene locus_tag LOCUS_03460 5710 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6403 5714 gene locus_tag LOCUS_03470 6403 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7022 7804 gene locus_tag LOCUS_03480 7022 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7867 9135 gene locus_tag LOCUS_03490 7867 9135 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_03490 9132 9557 gene locus_tag LOCUS_03500 9132 9557 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761720.1 protein_id gnl|my_center|LOCUS_03500 9550 10662 gene locus_tag LOCUS_03510 gene dprA 9550 10662 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_03510 11139 10684 gene locus_tag LOCUS_03520 11139 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 11824 11177 gene locus_tag LOCUS_03530 11824 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12769 11930 gene locus_tag LOCUS_03540 12769 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 14058 12736 gene locus_tag LOCUS_03550 14058 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 15304 14252 gene locus_tag LOCUS_03560 15304 14252 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_03560 16391 15360 gene locus_tag LOCUS_03570 16391 15360 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_03570 17084 16482 gene locus_tag LOCUS_03580 17084 16482 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_03580 18016 17078 gene locus_tag LOCUS_03590 18016 17078 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765632.1 protein_id gnl|my_center|LOCUS_03590 18144 18716 gene locus_tag LOCUS_03600 18144 18716 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_03600 18830 20383 gene locus_tag LOCUS_03610 18830 20383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_03610 21122 20412 gene locus_tag LOCUS_03620 21122 20412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 21263 24052 gene locus_tag LOCUS_03630 21263 24052 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_03630 24178 26415 gene locus_tag LOCUS_03640 24178 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence016 1131 154 gene locus_tag LOCUS_03650 1131 154 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_03650 2246 1128 gene locus_tag LOCUS_03660 2246 1128 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_03660 2866 2237 gene locus_tag LOCUS_03670 2866 2237 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_03670 3132 2980 gene locus_tag LOCUS_03680 gene rpmH 3132 2980 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_03680 4259 3297 gene locus_tag LOCUS_03690 4259 3297 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203527.1 protein_id gnl|my_center|LOCUS_03690 4764 5039 gene locus_tag LOCUS_03700 4764 5039 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763353.1 protein_id gnl|my_center|LOCUS_03700 5026 6954 gene locus_tag LOCUS_03710 5026 6954 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_03710 6954 8189 gene locus_tag LOCUS_03720 6954 8189 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_03720 10135 8489 gene locus_tag LOCUS_03730 10135 8489 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_03730 10397 12238 gene locus_tag LOCUS_03740 10397 12238 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_03740 12337 13551 gene locus_tag LOCUS_03750 12337 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107960.1 protein_id gnl|my_center|LOCUS_03750 13564 14760 gene locus_tag LOCUS_03760 13564 14760 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_03760 16717 14831 gene locus_tag LOCUS_03770 16717 14831 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_03770 17621 16902 gene locus_tag LOCUS_03780 17621 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 18363 17722 gene locus_tag LOCUS_03790 18363 17722 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_03790 19023 18376 gene locus_tag LOCUS_03800 19023 18376 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_03800 20765 19185 gene locus_tag LOCUS_03810 20765 19185 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_03810 21177 22322 gene locus_tag LOCUS_03820 21177 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 22319 23077 gene locus_tag LOCUS_03830 22319 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence017 982 332 gene locus_tag LOCUS_03840 982 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1510 2199 gene locus_tag LOCUS_03850 1510 2199 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_03850 2230 3738 gene locus_tag LOCUS_03860 gene araA 2230 3738 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_03860 3855 5531 gene locus_tag LOCUS_03870 3855 5531 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298170.1 protein_id gnl|my_center|LOCUS_03870 5547 7985 gene locus_tag LOCUS_03880 5547 7985 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_03880 9301 10131 gene locus_tag LOCUS_03890 9301 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 10295 13735 gene locus_tag LOCUS_03900 10295 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 15025 13967 gene locus_tag LOCUS_03910 15025 13967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_03910 16139 15039 gene locus_tag LOCUS_03920 16139 15039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_03920 17627 16143 gene locus_tag LOCUS_03930 17627 16143 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107325.1 protein_id gnl|my_center|LOCUS_03930 18501 17569 gene locus_tag LOCUS_03940 18501 17569 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_03940 19732 18515 gene locus_tag LOCUS_03950 19732 18515 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_03950 20701 20171 gene locus_tag LOCUS_03960 gene cobC 20701 20171 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_03960 21509 20760 gene locus_tag LOCUS_03970 21509 20760 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_03970 22549 21512 gene locus_tag LOCUS_03980 gene cobT 22549 21512 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_03980 23070 22546 gene locus_tag LOCUS_03990 gene cobU 23070 22546 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_03990 23675 23070 gene locus_tag LOCUS_04000 23675 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 24637 23690 gene locus_tag LOCUS_04010 gene cbiB 24637 23690 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_04010 24724 25794 gene locus_tag LOCUS_04020 24724 25794 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence018 2166 724 gene locus_tag LOCUS_04030 2166 724 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_04030 3687 2344 gene locus_tag LOCUS_04040 gene purB 3687 2344 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_04040 3867 3942 gene locus_tag LOCUS_t00090 3867 3942 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3970 4045 gene locus_tag LOCUS_t00100 3970 4045 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4608 4120 gene locus_tag LOCUS_04050 4608 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5220 7292 gene locus_tag LOCUS_04060 5220 7292 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_04060 8172 7360 gene locus_tag LOCUS_04070 8172 7360 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_04070 8621 8211 gene locus_tag LOCUS_04080 8621 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8829 9944 gene locus_tag LOCUS_04090 8829 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9949 10938 gene locus_tag LOCUS_04100 9949 10938 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_04100 11035 12699 gene locus_tag LOCUS_04110 11035 12699 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_04110 12881 13096 gene locus_tag LOCUS_04120 12881 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 13231 15327 gene locus_tag LOCUS_04130 13231 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15964 15404 gene locus_tag LOCUS_04140 15964 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 18596 16056 gene locus_tag LOCUS_04150 18596 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 19142 20347 gene locus_tag LOCUS_04160 19142 20347 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_04160 20371 21546 gene locus_tag LOCUS_04170 20371 21546 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766061.1 protein_id gnl|my_center|LOCUS_04170 21618 22946 gene locus_tag LOCUS_04180 21618 22946 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763445.1 protein_id gnl|my_center|LOCUS_04180 24691 23222 gene locus_tag LOCUS_04190 24691 23222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence019 <1 507 gene locus_tag LOCUS_04200 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107253.1:HU family DNA-binding protein 3082 734 gene locus_tag LOCUS_04210 3082 734 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203126.1 protein_id gnl|my_center|LOCUS_04210 5026 3104 gene locus_tag LOCUS_04220 5026 3104 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761956.1 protein_id gnl|my_center|LOCUS_04220 8382 5119 gene locus_tag LOCUS_04230 8382 5119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801316.1 protein_id gnl|my_center|LOCUS_04230 9920 8922 gene locus_tag LOCUS_04240 9920 8922 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764521.1 protein_id gnl|my_center|LOCUS_04240 10860 10210 gene locus_tag LOCUS_04250 gene sodB 10860 10210 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_04250 13711 10925 gene locus_tag LOCUS_04260 gene uvrA 13711 10925 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_04260 16967 13791 gene locus_tag LOCUS_04270 16967 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 18213 17134 gene locus_tag LOCUS_04280 18213 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 19829 18261 gene locus_tag LOCUS_04290 gene gldM 19829 18261 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_04290 20915 19884 gene locus_tag LOCUS_04300 20915 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 22389 20950 gene locus_tag LOCUS_04310 gene gldK 22389 20950 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_04310 23338 22394 gene locus_tag LOCUS_04320 23338 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence020 1653 532 gene locus_tag LOCUS_04330 gene wecB 1653 532 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_04330 2596 1676 gene locus_tag LOCUS_04340 gene rfbD 2596 1676 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_04340 4902 3838 gene locus_tag LOCUS_04350 gene rfbB 4902 3838 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_04350 5495 4920 gene locus_tag LOCUS_04360 gene rfbC 5495 4920 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286442.1 protein_id gnl|my_center|LOCUS_04360 6391 5495 gene locus_tag LOCUS_04370 gene rfbA 6391 5495 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_04370 6987 6406 gene locus_tag LOCUS_04380 6987 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 8444 6984 gene locus_tag LOCUS_04390 8444 6984 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_04390 9311 8448 gene locus_tag LOCUS_04400 9311 8448 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592816.1 protein_id gnl|my_center|LOCUS_04400 10031 9333 gene locus_tag LOCUS_04410 10031 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 11223 10024 gene locus_tag LOCUS_04420 11223 10024 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_04420 12352 11228 gene locus_tag LOCUS_04430 12352 11228 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_04430 13121 12345 gene locus_tag LOCUS_04440 13121 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 13381 13647 gene locus_tag LOCUS_04450 13381 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 14577 13630 gene locus_tag LOCUS_04460 14577 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15673 14600 gene locus_tag LOCUS_04470 15673 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 16481 15663 gene locus_tag LOCUS_04480 16481 15663 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_04480 17786 16587 gene locus_tag LOCUS_04490 gene alr 17786 16587 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_04490 18555 17770 gene locus_tag LOCUS_04500 18555 17770 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_04500 19635 18571 gene locus_tag LOCUS_04510 19635 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 21054 19822 gene locus_tag LOCUS_04520 21054 19822 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_04520 21448 21266 gene locus_tag LOCUS_04530 21448 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 22557 21994 gene locus_tag LOCUS_04540 22557 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 22868 22686 gene locus_tag LOCUS_04550 22868 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 23445 23134 gene locus_tag LOCUS_04560 23445 23134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence021 <1 293 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactcttcgtgagtgcgtggattgaaac 482 2365 gene locus_tag LOCUS_04570 482 2365 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_04570 2382 3479 gene locus_tag LOCUS_04580 gene carA 2382 3479 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_04580 3518 6739 gene locus_tag LOCUS_04590 gene carB 3518 6739 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_04590 7527 6817 gene locus_tag LOCUS_04600 7527 6817 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787514.1 protein_id gnl|my_center|LOCUS_04600 7839 9044 gene locus_tag LOCUS_04610 7839 9044 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_04610 9049 10086 gene locus_tag LOCUS_04620 9049 10086 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_04620 10070 11092 gene locus_tag LOCUS_04630 10070 11092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_04630 11152 11922 gene locus_tag LOCUS_04640 gene mtgA 11152 11922 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786953.1 protein_id gnl|my_center|LOCUS_04640 11886 12557 gene locus_tag LOCUS_04650 gene lipB 11886 12557 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_04650 13238 13717 gene locus_tag LOCUS_04660 13238 13717 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_04660 13849 16428 gene locus_tag LOCUS_04670 13849 16428 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_04670 16441 17754 gene locus_tag LOCUS_04680 16441 17754 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_04680 17766 18947 gene locus_tag LOCUS_04690 gene purT 17766 18947 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_04690 20153 19245 gene locus_tag LOCUS_04700 20153 19245 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_04700 <22635 20157 gene locus_tag LOCUS_04710 <22635 20157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870178.1:glycyl radical protein >Feature sequence022 1503 247 gene locus_tag LOCUS_04720 1503 247 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764774.1 protein_id gnl|my_center|LOCUS_04720 2818 1517 gene locus_tag LOCUS_04730 2818 1517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_04730 4114 2837 gene locus_tag LOCUS_04740 4114 2837 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202450.1 protein_id gnl|my_center|LOCUS_04740 5387 4119 gene locus_tag LOCUS_04750 5387 4119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_04750 6161 5493 gene locus_tag LOCUS_04760 6161 5493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_04760 7439 6180 gene locus_tag LOCUS_04770 7439 6180 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800756.1 protein_id gnl|my_center|LOCUS_04770 8953 7673 gene locus_tag LOCUS_04780 8953 7673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202444.1 protein_id gnl|my_center|LOCUS_04780 10313 9066 gene locus_tag LOCUS_04790 10313 9066 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_04790 11485 10907 gene locus_tag LOCUS_04800 11485 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 13034 11487 gene locus_tag LOCUS_04810 13034 11487 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_04810 13215 14651 gene locus_tag LOCUS_04820 13215 14651 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_04820 15512 14736 gene locus_tag LOCUS_04830 15512 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 16678 15611 gene locus_tag LOCUS_04840 16678 15611 CDS product HaeII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686885.1 protein_id gnl|my_center|LOCUS_04840 17660 16644 gene locus_tag LOCUS_04850 17660 16644 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_04850 18907 17987 gene locus_tag LOCUS_04860 18907 17987 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108643.1 protein_id gnl|my_center|LOCUS_04860 20412 18928 gene locus_tag LOCUS_04870 20412 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 21041 20373 gene locus_tag LOCUS_04880 21041 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 21126 21782 gene locus_tag LOCUS_04890 21126 21782 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_04890 22022 22351 gene locus_tag LOCUS_04900 22022 22351 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence023 6695 6099 gene locus_tag LOCUS_04910 gene ruvA 6695 6099 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_04910 8437 6983 gene locus_tag LOCUS_04920 8437 6983 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_04920 9793 8456 gene locus_tag LOCUS_04930 gene trkA 9793 8456 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_04930 11740 9830 gene locus_tag LOCUS_04940 gene dxs 11740 9830 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_04940 12913 12077 gene locus_tag LOCUS_04950 12913 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 14437 13502 gene locus_tag LOCUS_04960 14437 13502 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108601.1 protein_id gnl|my_center|LOCUS_04960 14958 14434 gene locus_tag LOCUS_04970 14958 14434 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761748.1 protein_id gnl|my_center|LOCUS_04970 17607 15022 gene locus_tag LOCUS_04980 17607 15022 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_04980 18598 17708 gene locus_tag LOCUS_04990 18598 17708 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_04990 18993 19673 gene locus_tag LOCUS_05000 18993 19673 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813226.1 protein_id gnl|my_center|LOCUS_05000 19637 20944 gene locus_tag LOCUS_05010 19637 20944 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_05010 20949 21587 gene locus_tag LOCUS_05020 20949 21587 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence024 614 306 gene locus_tag LOCUS_05030 614 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791850.1 protein_id gnl|my_center|LOCUS_05030 2328 808 gene locus_tag LOCUS_05040 2328 808 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_05040 3746 2385 gene locus_tag LOCUS_05050 3746 2385 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_05050 4633 3773 gene locus_tag LOCUS_05060 4633 3773 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760774.1 protein_id gnl|my_center|LOCUS_05060 6214 4640 gene locus_tag LOCUS_05070 6214 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8511 6331 gene locus_tag LOCUS_05080 gene recQ 8511 6331 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_05080 9779 8541 gene locus_tag LOCUS_05090 gene clpX 9779 8541 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_05090 10535 9834 gene locus_tag LOCUS_05100 gene clpP 10535 9834 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_05100 12039 10687 gene locus_tag LOCUS_05110 gene tig 12039 10687 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_05110 13625 12435 gene locus_tag LOCUS_05120 13625 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 14111 13632 gene locus_tag LOCUS_05130 14111 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 17329 14126 gene locus_tag LOCUS_05140 17329 14126 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_05140 17250 17429 gene locus_tag LOCUS_05150 17250 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 18721 17507 gene locus_tag LOCUS_05160 18721 17507 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_05160 19358 18873 gene locus_tag LOCUS_05170 19358 18873 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_05170 19996 20538 gene locus_tag LOCUS_05180 19996 20538 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence025 477 1628 gene locus_tag LOCUS_05190 477 1628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_05190 2713 1787 gene locus_tag LOCUS_05200 2713 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2849 3118 gene locus_tag LOCUS_05210 2849 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4372 3335 gene locus_tag LOCUS_05220 4372 3335 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_05220 5603 4425 gene locus_tag LOCUS_05230 5603 4425 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_05230 5932 6732 gene locus_tag LOCUS_05240 5932 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7530 6748 gene locus_tag LOCUS_05250 7530 6748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_05250 8243 7533 gene locus_tag LOCUS_05260 8243 7533 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_05260 8391 9143 gene locus_tag LOCUS_05270 gene lptB 8391 9143 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_05270 10169 9327 gene locus_tag LOCUS_05280 10169 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10349 10729 gene locus_tag LOCUS_05290 10349 10729 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_05290 10740 11765 gene locus_tag LOCUS_05300 gene rhaT 10740 11765 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_05300 11820 13070 gene locus_tag LOCUS_05310 11820 13070 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_05310 13278 15497 gene locus_tag LOCUS_05320 13278 15497 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_05320 15499 16002 gene locus_tag LOCUS_05330 gene nrdG 15499 16002 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867062.1 protein_id gnl|my_center|LOCUS_05330 16359 16165 gene locus_tag LOCUS_05340 16359 16165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 16377 17231 gene locus_tag LOCUS_05350 16377 17231 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_05350 18635 17397 gene locus_tag LOCUS_05360 18635 17397 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803746.1 protein_id gnl|my_center|LOCUS_05360 19638 18718 gene locus_tag LOCUS_05370 19638 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 20027 19647 gene locus_tag LOCUS_05380 20027 19647 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_05380 <21767 20242 gene locus_tag LOCUS_05390 <21767 20242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993641.1:DNA mismatch repair endonuclease MutL >Feature sequence026 <1 706 gene locus_tag LOCUS_05400 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763364.1:acyl-CoA carboxylase subunit beta 726 1625 gene locus_tag LOCUS_05410 726 1625 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_05410 1652 2083 gene locus_tag LOCUS_05420 1652 2083 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_05420 2088 3284 gene locus_tag LOCUS_05430 2088 3284 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_05430 3781 5511 gene locus_tag LOCUS_05440 gene lysS 3781 5511 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_05440 5527 6522 gene locus_tag LOCUS_05450 5527 6522 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_05450 6535 7881 gene locus_tag LOCUS_05460 6535 7881 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_05460 7988 8728 gene locus_tag LOCUS_05470 7988 8728 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108143.1 protein_id gnl|my_center|LOCUS_05470 9682 8783 gene locus_tag LOCUS_05480 9682 8783 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_05480 10272 11303 gene locus_tag LOCUS_05490 10272 11303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11306 12358 gene locus_tag LOCUS_05500 11306 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 12367 12975 gene locus_tag LOCUS_05510 12367 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13869 13108 gene locus_tag LOCUS_05520 13869 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 14243 15166 gene locus_tag LOCUS_05530 14243 15166 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_05530 16172 15192 gene locus_tag LOCUS_05540 16172 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 16292 18976 gene locus_tag LOCUS_05550 16292 18976 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_05550 19042 19755 gene locus_tag LOCUS_05560 gene tsaB 19042 19755 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_05560 19765 20802 gene locus_tag LOCUS_05570 19765 20802 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109216.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence027 1502 855 gene locus_tag LOCUS_05580 1502 855 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_05580 1889 1506 gene locus_tag LOCUS_05590 1889 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2065 2586 gene locus_tag LOCUS_05600 2065 2586 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_05600 2598 3812 gene locus_tag LOCUS_05610 2598 3812 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_05610 3869 5734 gene locus_tag LOCUS_05620 3869 5734 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791976.1 protein_id gnl|my_center|LOCUS_05620 5739 6755 gene locus_tag LOCUS_05630 5739 6755 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_05630 6980 7387 gene locus_tag LOCUS_05640 6980 7387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8517 7471 gene locus_tag LOCUS_05650 8517 7471 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764710.1 protein_id gnl|my_center|LOCUS_05650 10104 8524 gene locus_tag LOCUS_05660 10104 8524 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_05660 11007 10120 gene locus_tag LOCUS_05670 gene rfbD 11007 10120 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_05670 11551 11000 gene locus_tag LOCUS_05680 11551 11000 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_05680 12474 11548 gene locus_tag LOCUS_05690 12474 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13612 16611 gene locus_tag LOCUS_05700 13612 16611 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_05700 16624 18564 gene locus_tag LOCUS_05710 16624 18564 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791678.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence028 1498 86 gene locus_tag LOCUS_05720 1498 86 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431494.1 protein_id gnl|my_center|LOCUS_05720 2131 1643 gene locus_tag LOCUS_05730 2131 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3115 2219 gene locus_tag LOCUS_05740 3115 2219 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_05740 3804 3112 gene locus_tag LOCUS_05750 3804 3112 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_05750 4238 3801 gene locus_tag LOCUS_05760 4238 3801 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_05760 6498 4864 gene locus_tag LOCUS_05770 6498 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6883 6485 gene locus_tag LOCUS_05780 6883 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 7256 6933 gene locus_tag LOCUS_05790 7256 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7639 7250 gene locus_tag LOCUS_05800 7639 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 7830 9608 gene locus_tag LOCUS_05810 7830 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 9981 10754 gene locus_tag LOCUS_05820 9981 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 10783 11448 gene locus_tag LOCUS_05830 10783 11448 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_05830 11546 11857 gene locus_tag LOCUS_05840 gene trxA 11546 11857 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_05840 11854 12177 gene locus_tag LOCUS_05850 11854 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 12174 13865 gene locus_tag LOCUS_05860 gene cdr 12174 13865 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_05860 13877 14287 gene locus_tag LOCUS_05870 13877 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 14322 14957 gene locus_tag LOCUS_05880 14322 14957 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_05880 14960 16141 gene locus_tag LOCUS_05890 14960 16141 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943945.1 protein_id gnl|my_center|LOCUS_05890 16154 16522 gene locus_tag LOCUS_05900 16154 16522 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_05900 16968 16717 gene locus_tag LOCUS_05910 16968 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 17802 17038 gene locus_tag LOCUS_05920 gene rhuM 17802 17038 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_05920 18816 18190 gene locus_tag LOCUS_05930 18816 18190 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_05930 18916 19851 gene locus_tag LOCUS_05940 18916 19851 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence029 3304 1124 gene locus_tag LOCUS_05950 3304 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05950 4327 3383 gene locus_tag LOCUS_05960 4327 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05960 5426 7549 gene locus_tag LOCUS_05970 5426 7549 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_05970 7559 8533 gene locus_tag LOCUS_05980 7559 8533 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_05980 8613 9176 gene locus_tag LOCUS_05990 8613 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 9301 10935 gene locus_tag LOCUS_06000 9301 10935 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763411.1 protein_id gnl|my_center|LOCUS_06000 10981 11262 gene locus_tag LOCUS_06010 10981 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 11250 11567 gene locus_tag LOCUS_06020 11250 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 11654 12394 gene locus_tag LOCUS_06030 11654 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 12606 13388 gene locus_tag LOCUS_06040 12606 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 14822 13590 gene locus_tag LOCUS_06050 14822 13590 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_06050 16088 14892 gene locus_tag LOCUS_06060 16088 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_06060 17420 16095 gene locus_tag LOCUS_06070 gene rseP 17420 16095 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_06070 18601 17453 gene locus_tag LOCUS_06080 18601 17453 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_06080 19492 18614 gene locus_tag LOCUS_06090 19492 18614 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence030 <1 827 gene locus_tag LOCUS_06100 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584070.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1356 931 gene locus_tag LOCUS_06110 1356 931 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_06110 1553 2731 gene locus_tag LOCUS_06120 1553 2731 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_06120 3802 2795 gene locus_tag LOCUS_06130 3802 2795 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_06130 5553 3826 gene locus_tag LOCUS_06140 5553 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7663 5708 gene locus_tag LOCUS_06150 gene gyrB 7663 5708 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_06150 7893 7821 gene locus_tag LOCUS_t00110 7893 7821 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8194 7937 gene locus_tag LOCUS_06160 gene rpsT 8194 7937 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_06160 8307 8235 gene locus_tag LOCUS_t00120 8307 8235 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8829 8425 gene locus_tag LOCUS_06170 8829 8425 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_06170 8906 9631 gene locus_tag LOCUS_06180 gene recO 8906 9631 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_06180 9901 14235 gene locus_tag LOCUS_06190 9901 14235 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_06190 14261 15163 gene locus_tag LOCUS_06200 14261 15163 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109045.1 protein_id gnl|my_center|LOCUS_06200 15173 16213 gene locus_tag LOCUS_06210 15173 16213 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 protein_id gnl|my_center|LOCUS_06210 16210 16980 gene locus_tag LOCUS_06220 16210 16980 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 protein_id gnl|my_center|LOCUS_06220 17370 16993 gene locus_tag LOCUS_06230 gene crcB 17370 16993 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_06230 17630 17558 gene locus_tag LOCUS_t00130 17630 17558 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17987 18148 gene locus_tag LOCUS_06240 17987 18148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence031 2063 1071 gene locus_tag LOCUS_06250 2063 1071 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_06250 3230 2094 gene locus_tag LOCUS_06260 3230 2094 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_06260 3591 4799 gene locus_tag LOCUS_06270 3591 4799 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_06270 4859 6490 gene locus_tag LOCUS_06280 4859 6490 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_06280 6590 9970 gene locus_tag LOCUS_06290 gene secA 6590 9970 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_06290 10073 11248 gene locus_tag LOCUS_06300 10073 11248 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_06300 11358 12089 gene locus_tag LOCUS_06310 11358 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787597.1 protein_id gnl|my_center|LOCUS_06310 12336 14219 gene locus_tag LOCUS_06320 12336 14219 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_06320 14303 15409 gene locus_tag LOCUS_06330 14303 15409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_06330 15680 16057 gene locus_tag LOCUS_06340 15680 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763961.1 protein_id gnl|my_center|LOCUS_06340 17395 16148 gene locus_tag LOCUS_06350 17395 16148 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803746.1 protein_id gnl|my_center|LOCUS_06350 19085 17502 gene locus_tag LOCUS_06360 19085 17502 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence032 <1 2480 gene locus_tag LOCUS_06370 <1 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790618.1:efflux RND transporter permease subunit 2474 3676 gene locus_tag LOCUS_06380 2474 3676 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_06380 4064 4612 gene locus_tag LOCUS_06390 4064 4612 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_06390 4612 5793 gene locus_tag LOCUS_06400 4612 5793 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_06400 5849 6829 gene locus_tag LOCUS_06410 5849 6829 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_06410 7677 6976 gene locus_tag LOCUS_06420 7677 6976 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_06420 9118 7916 gene locus_tag LOCUS_06430 9118 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 10142 9267 gene locus_tag LOCUS_06440 10142 9267 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_06440 11738 10152 gene locus_tag LOCUS_06450 gene atpA 11738 10152 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_06450 12289 11747 gene locus_tag LOCUS_06460 12289 11747 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_06460 12793 12293 gene locus_tag LOCUS_06470 gene atpF 12793 12293 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_06470 13061 12810 gene locus_tag LOCUS_06480 gene atpE 13061 12810 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_06480 14195 13149 gene locus_tag LOCUS_06490 gene atpB 14195 13149 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_06490 14604 14176 gene locus_tag LOCUS_06500 14604 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 14849 14613 gene locus_tag LOCUS_06510 14849 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 16372 14855 gene locus_tag LOCUS_06520 gene atpD 16372 14855 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_06520 16766 17605 gene locus_tag LOCUS_06530 gene coaW 16766 17605 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 protein_id gnl|my_center|LOCUS_06530 18330 17680 gene locus_tag LOCUS_06540 18330 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 <19476 18535 gene locus_tag LOCUS_06550 <19476 18535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764442.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence033 <1 2117 gene locus_tag LOCUS_06560 <1 2117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108712.1:DUF2723 domain-containing protein 2125 2736 gene locus_tag LOCUS_06570 2125 2736 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_06570 2824 3252 gene locus_tag LOCUS_06580 2824 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3249 3716 gene locus_tag LOCUS_06590 3249 3716 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_06590 3713 3931 gene locus_tag LOCUS_06600 3713 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3994 4905 gene locus_tag LOCUS_06610 gene queG 3994 4905 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_06610 4920 6197 gene locus_tag LOCUS_06620 4920 6197 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_06620 7061 6204 gene locus_tag LOCUS_06630 7061 6204 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_06630 7207 7061 gene locus_tag LOCUS_06640 7207 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 8136 7204 gene locus_tag LOCUS_06650 8136 7204 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_06650 9185 8157 gene locus_tag LOCUS_06660 9185 8157 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769190.1 protein_id gnl|my_center|LOCUS_06660 10323 9217 gene locus_tag LOCUS_06670 10323 9217 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_06670 11141 10320 gene locus_tag LOCUS_06680 11141 10320 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_06680 12636 11143 gene locus_tag LOCUS_06690 12636 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13359 12643 gene locus_tag LOCUS_06700 13359 12643 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201895.1 protein_id gnl|my_center|LOCUS_06700 14059 13562 gene locus_tag LOCUS_06710 14059 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 15222 14056 gene locus_tag LOCUS_06720 15222 14056 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_06720 17276 15453 gene locus_tag LOCUS_06730 17276 15453 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_06730 19245 17437 gene locus_tag LOCUS_06740 19245 17437 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence034 3406 191 gene locus_tag LOCUS_06750 3406 191 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_06750 3612 4190 gene locus_tag LOCUS_06760 3612 4190 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_06760 4213 4953 gene locus_tag LOCUS_06770 4213 4953 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_06770 4950 6317 gene locus_tag LOCUS_06780 4950 6317 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790403.1 protein_id gnl|my_center|LOCUS_06780 6314 6892 gene locus_tag LOCUS_06790 6314 6892 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_06790 7733 6957 gene locus_tag LOCUS_06800 7733 6957 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107682.1 protein_id gnl|my_center|LOCUS_06800 8775 7726 gene locus_tag LOCUS_06810 8775 7726 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107610.1 protein_id gnl|my_center|LOCUS_06810 10091 8796 gene locus_tag LOCUS_06820 10091 8796 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555881.1 protein_id gnl|my_center|LOCUS_06820 13434 10390 gene locus_tag LOCUS_06830 13434 10390 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764996.1 protein_id gnl|my_center|LOCUS_06830 14466 13447 gene locus_tag LOCUS_06840 14466 13447 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764995.1 protein_id gnl|my_center|LOCUS_06840 16539 14647 gene locus_tag LOCUS_06850 gene speA 16539 14647 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_06850 16856 17653 gene locus_tag LOCUS_06860 16856 17653 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082558.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence035 <1 1116 gene locus_tag LOCUS_06870 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767538.1:ATP-binding protein 1952 5296 gene locus_tag LOCUS_06880 1952 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6100 5375 gene locus_tag LOCUS_06890 6100 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6628 7134 gene locus_tag LOCUS_06900 6628 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 7242 8771 gene locus_tag LOCUS_06910 7242 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 10019 8856 gene locus_tag LOCUS_06920 10019 8856 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858523.1 protein_id gnl|my_center|LOCUS_06920 10475 14296 gene locus_tag LOCUS_06930 10475 14296 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_06930 17377 14480 gene locus_tag LOCUS_06940 17377 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18026 17625 gene locus_tag LOCUS_06950 18026 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence036 <1 605 gene locus_tag LOCUS_06960 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005799108.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit 690 2768 gene locus_tag LOCUS_06970 690 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2980 4362 gene locus_tag LOCUS_06980 2980 4362 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390060.1 protein_id gnl|my_center|LOCUS_06980 5588 4461 gene locus_tag LOCUS_06990 5588 4461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_06990 6694 5588 gene locus_tag LOCUS_07000 6694 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8897 6888 gene locus_tag LOCUS_07010 8897 6888 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_07010 9828 10595 gene locus_tag LOCUS_07020 9828 10595 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787997.1 protein_id gnl|my_center|LOCUS_07020 10592 11095 gene locus_tag LOCUS_07030 10592 11095 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787995.1 protein_id gnl|my_center|LOCUS_07030 11099 11830 gene locus_tag LOCUS_07040 11099 11830 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765763.1 protein_id gnl|my_center|LOCUS_07040 12290 11910 gene locus_tag LOCUS_07050 12290 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07050 13949 12294 gene locus_tag LOCUS_07060 13949 12294 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07060 15825 13966 gene locus_tag LOCUS_07070 15825 13966 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_07070 16961 15906 gene locus_tag LOCUS_07080 16961 15906 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767358.1 protein_id gnl|my_center|LOCUS_07080 <18387 17140 gene locus_tag LOCUS_07090 <18387 17140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767669.1:arylsulfatase >Feature sequence037 1996 641 gene locus_tag LOCUS_07100 1996 641 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_07100 2057 2359 gene locus_tag LOCUS_07110 2057 2359 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760150.1 protein_id gnl|my_center|LOCUS_07110 2371 3129 gene locus_tag LOCUS_07120 2371 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4331 3132 gene locus_tag LOCUS_07130 4331 3132 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_07130 7221 4426 gene locus_tag LOCUS_07140 7221 4426 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_07140 7917 10142 gene locus_tag LOCUS_07150 7917 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11809 10232 gene locus_tag LOCUS_07160 11809 10232 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_07160 14635 11870 gene locus_tag LOCUS_07170 14635 11870 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_07170 15238 14696 gene locus_tag LOCUS_07180 15238 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 16901 15495 gene locus_tag LOCUS_07190 16901 15495 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence038 3045 7 gene locus_tag LOCUS_07200 3045 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4373 4759 gene locus_tag LOCUS_07210 4373 4759 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460531.1 protein_id gnl|my_center|LOCUS_07210 4738 5034 gene locus_tag LOCUS_07220 4738 5034 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_07220 5481 7088 gene locus_tag LOCUS_07230 gene pckA 5481 7088 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_07230 7244 8350 gene locus_tag LOCUS_07240 7244 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8406 9944 gene locus_tag LOCUS_07250 8406 9944 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_07250 10679 9954 gene locus_tag LOCUS_07260 10679 9954 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_07260 13073 10683 gene locus_tag LOCUS_07270 13073 10683 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_07270 13872 13105 gene locus_tag LOCUS_07280 13872 13105 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_07280 15300 14089 gene locus_tag LOCUS_07290 15300 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 16780 15569 gene locus_tag LOCUS_07300 16780 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788655.1 protein_id gnl|my_center|LOCUS_07300 17464 16814 gene locus_tag LOCUS_07310 17464 16814 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769761.1 protein_id gnl|my_center|LOCUS_07310 <18328 17678 gene locus_tag LOCUS_07320 <18328 17678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108789.1:4-phosphoerythronate dehydrogenase PdxB >Feature sequence039 3241 1016 gene locus_tag LOCUS_07330 gene pnp 3241 1016 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_07330 3441 4592 gene locus_tag LOCUS_07340 3441 4592 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_07340 4814 5284 gene locus_tag LOCUS_07350 gene greA 4814 5284 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_07350 5296 5691 gene locus_tag LOCUS_07360 5296 5691 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_07360 7091 5991 gene locus_tag LOCUS_07370 7091 5991 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_07370 7424 7098 gene locus_tag LOCUS_07380 7424 7098 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_07380 7977 9788 gene locus_tag LOCUS_07390 7977 9788 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784128.1 protein_id gnl|my_center|LOCUS_07390 9961 10443 gene locus_tag LOCUS_07400 9961 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 10699 11196 gene locus_tag LOCUS_07410 10699 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12182 11298 gene locus_tag LOCUS_07420 12182 11298 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_07420 13134 12214 gene locus_tag LOCUS_07430 13134 12214 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_07430 15154 13136 gene locus_tag LOCUS_07440 15154 13136 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107315.1 protein_id gnl|my_center|LOCUS_07440 16534 15422 gene locus_tag LOCUS_07450 16534 15422 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_07450 17343 16531 gene locus_tag LOCUS_07460 17343 16531 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence040 <1 1250 gene locus_tag LOCUS_07470 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080566.1:DUF262 domain-containing protein 1266 3008 gene locus_tag LOCUS_07480 1266 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3177 4538 gene locus_tag LOCUS_07490 3177 4538 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_07490 4550 6652 gene locus_tag LOCUS_07500 4550 6652 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202386.1 protein_id gnl|my_center|LOCUS_07500 6665 12847 gene locus_tag LOCUS_07510 6665 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 12994 13788 gene locus_tag LOCUS_07520 12994 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 14854 14273 gene locus_tag LOCUS_07530 14854 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15239 14967 gene locus_tag LOCUS_07540 15239 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 17296 15236 gene locus_tag LOCUS_07550 17296 15236 CDS product bifunctional DNA primase/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108230.1 protein_id gnl|my_center|LOCUS_07550 17669 17262 gene locus_tag LOCUS_07560 17669 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence041 3656 1320 gene locus_tag LOCUS_07570 3656 1320 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202761.1 protein_id gnl|my_center|LOCUS_07570 4349 3669 gene locus_tag LOCUS_07580 4349 3669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660099.1 protein_id gnl|my_center|LOCUS_07580 6731 4389 gene locus_tag LOCUS_07590 6731 4389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_07590 8009 6750 gene locus_tag LOCUS_07600 8009 6750 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_07600 9357 8020 gene locus_tag LOCUS_07610 9357 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9857 14743 gene locus_tag LOCUS_07620 9857 14743 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_07620 15618 14884 gene locus_tag LOCUS_07630 15618 14884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07630 17656 15953 gene locus_tag LOCUS_07640 gene dnaK 17656 15953 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence042 958 464 gene locus_tag LOCUS_07650 958 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1707 985 gene locus_tag LOCUS_07660 1707 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2734 1898 gene locus_tag LOCUS_07670 2734 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3861 2743 gene locus_tag LOCUS_07680 3861 2743 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_07680 4968 3865 gene locus_tag LOCUS_07690 4968 3865 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_07690 5232 5017 gene locus_tag LOCUS_07700 5232 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7748 5646 gene locus_tag LOCUS_07710 7748 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8366 7761 gene locus_tag LOCUS_07720 8366 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 9520 8372 gene locus_tag LOCUS_07730 9520 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10980 10588 gene locus_tag LOCUS_07740 10980 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11817 11041 gene locus_tag LOCUS_07750 11817 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13058 11811 gene locus_tag LOCUS_07760 13058 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 14672 13383 gene locus_tag LOCUS_07770 14672 13383 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202265.1 protein_id gnl|my_center|LOCUS_07770 15317 14712 gene locus_tag LOCUS_07780 15317 14712 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_07780 15936 15331 gene locus_tag LOCUS_07790 15936 15331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801359.1 protein_id gnl|my_center|LOCUS_07790 16700 15933 gene locus_tag LOCUS_07800 16700 15933 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_07800 <17497 16697 gene locus_tag LOCUS_07810 <17497 16697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042001299.1:ketoacyl-ACP synthase III >Feature sequence043 676 1521 gene locus_tag LOCUS_07820 676 1521 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_07820 1496 2680 gene locus_tag LOCUS_07830 1496 2680 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_07830 2707 3798 gene locus_tag LOCUS_07840 2707 3798 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_07840 3808 4581 gene locus_tag LOCUS_07850 3808 4581 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_07850 5078 6211 gene locus_tag LOCUS_07860 5078 6211 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765296.1 protein_id gnl|my_center|LOCUS_07860 6223 7884 gene locus_tag LOCUS_07870 6223 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765297.1 protein_id gnl|my_center|LOCUS_07870 8357 9748 gene locus_tag LOCUS_07880 8357 9748 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_07880 9779 10789 gene locus_tag LOCUS_07890 9779 10789 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_07890 10852 11970 gene locus_tag LOCUS_07900 10852 11970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_07900 11978 13243 gene locus_tag LOCUS_07910 11978 13243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_07910 15206 13326 gene locus_tag LOCUS_07920 15206 13326 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_07920 16047 15217 gene locus_tag LOCUS_07930 16047 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence044 3 1424 gene locus_tag LOCUS_07940 3 1424 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_07940 1511 2875 gene locus_tag LOCUS_07950 1511 2875 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_07950 2880 5021 gene locus_tag LOCUS_07960 2880 5021 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_07960 6377 5250 gene locus_tag LOCUS_07970 6377 5250 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_07970 8218 6533 gene locus_tag LOCUS_07980 8218 6533 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_07980 8302 9969 gene locus_tag LOCUS_07990 8302 9969 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_07990 10929 10054 gene locus_tag LOCUS_08000 10929 10054 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_08000 13853 11016 gene locus_tag LOCUS_08010 gene leuS 13853 11016 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_08010 14245 15132 gene locus_tag LOCUS_08020 14245 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 16953 15781 gene locus_tag LOCUS_08030 16953 15781 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence045 4403 2193 gene locus_tag LOCUS_08040 4403 2193 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_08040 7432 4616 gene locus_tag LOCUS_08050 7432 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 9901 7436 gene locus_tag LOCUS_08060 9901 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 12818 9984 gene locus_tag LOCUS_08070 12818 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 15327 13192 gene locus_tag LOCUS_08080 15327 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 <17277 15560 gene locus_tag LOCUS_08090 <17277 15560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765815.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence046 <1 856 gene locus_tag LOCUS_08100 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966754.1:GIY-YIG nuclease family protein 923 2350 gene locus_tag LOCUS_08110 923 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2761 3189 gene locus_tag LOCUS_08120 2761 3189 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107253.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08120 6233 3246 gene locus_tag LOCUS_08130 6233 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7132 6272 gene locus_tag LOCUS_08140 7132 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 8197 7199 gene locus_tag LOCUS_08150 8197 7199 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_08150 8875 8207 gene locus_tag LOCUS_08160 8875 8207 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_08160 10446 8878 gene locus_tag LOCUS_08170 10446 8878 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403056.1 protein_id gnl|my_center|LOCUS_08170 11573 10482 gene locus_tag LOCUS_08180 11573 10482 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_08180 11695 12585 gene locus_tag LOCUS_08190 11695 12585 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551739.1 protein_id gnl|my_center|LOCUS_08190 12724 13758 gene locus_tag LOCUS_08200 12724 13758 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_08200 13925 14974 gene locus_tag LOCUS_08210 13925 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15283 15846 gene locus_tag LOCUS_08220 15283 15846 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_08220 15984 16205 gene locus_tag LOCUS_08230 15984 16205 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence047 1243 1031 gene locus_tag LOCUS_08240 1243 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 1622 1329 gene locus_tag LOCUS_08250 1622 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_08250 1981 1775 gene locus_tag LOCUS_08260 1981 1775 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_08260 2747 2055 gene locus_tag LOCUS_08270 2747 2055 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_08270 3584 2760 gene locus_tag LOCUS_08280 gene pgeF 3584 2760 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_08280 4743 3562 gene locus_tag LOCUS_08290 gene obgE 4743 3562 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_08290 5399 4827 gene locus_tag LOCUS_08300 5399 4827 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_08300 6040 5495 gene locus_tag LOCUS_08310 gene hpt 6040 5495 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_08310 6665 6165 gene locus_tag LOCUS_08320 6665 6165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7758 6982 gene locus_tag LOCUS_08330 7758 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8174 10996 gene locus_tag LOCUS_08340 8174 10996 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_08340 11935 10970 gene locus_tag LOCUS_08350 11935 10970 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_08350 12784 11999 gene locus_tag LOCUS_08360 12784 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203400.1 protein_id gnl|my_center|LOCUS_08360 13153 12938 gene locus_tag LOCUS_08370 13153 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13845 13261 gene locus_tag LOCUS_08380 13845 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 14813 16324 gene locus_tag LOCUS_08390 14813 16324 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence048 81 482 gene locus_tag LOCUS_08400 81 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 839 1468 gene locus_tag LOCUS_08410 839 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1906 2172 gene locus_tag LOCUS_08420 1906 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2190 2495 gene locus_tag LOCUS_08430 2190 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2782 3186 gene locus_tag LOCUS_08440 2782 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3198 3437 gene locus_tag LOCUS_08450 3198 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3593 3880 gene locus_tag LOCUS_08460 3593 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3908 4450 gene locus_tag LOCUS_08470 3908 4450 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_08470 4447 5199 gene locus_tag LOCUS_08480 4447 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5815 5889 gene locus_tag LOCUS_t00140 5815 5889 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6645 6715 gene locus_tag LOCUS_t00150 6645 6715 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6823 7122 gene locus_tag LOCUS_08490 6823 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7128 7200 gene locus_tag LOCUS_t00160 7128 7200 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7301 8218 gene locus_tag LOCUS_08500 7301 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8231 8446 gene locus_tag LOCUS_08510 8231 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 8430 8735 gene locus_tag LOCUS_08520 8430 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8754 9053 gene locus_tag LOCUS_08530 8754 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9213 9488 gene locus_tag LOCUS_08540 9213 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9680 10276 gene locus_tag LOCUS_08550 9680 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10289 10537 gene locus_tag LOCUS_08560 10289 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 10527 10829 gene locus_tag LOCUS_08570 10527 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 10826 11026 gene locus_tag LOCUS_08580 10826 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11023 11268 gene locus_tag LOCUS_08590 11023 11268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11283 11729 gene locus_tag LOCUS_08600 11283 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11811 13517 gene locus_tag LOCUS_08610 gene terL 11811 13517 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819485.1 protein_id gnl|my_center|LOCUS_08610 13537 13992 gene locus_tag LOCUS_08620 13537 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13967 14245 gene locus_tag LOCUS_08630 13967 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 14713 16161 gene locus_tag LOCUS_08640 14713 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence049 5073 4576 gene locus_tag LOCUS_08650 5073 4576 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_08650 5901 5107 gene locus_tag LOCUS_08660 5901 5107 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_08660 6268 9015 gene locus_tag LOCUS_08670 6268 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9049 10269 gene locus_tag LOCUS_08680 9049 10269 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_08680 10586 13699 gene locus_tag LOCUS_08690 10586 13699 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785421.1 protein_id gnl|my_center|LOCUS_08690 13710 15224 gene locus_tag LOCUS_08700 13710 15224 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence050 332 571 gene locus_tag LOCUS_08710 332 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1730 771 gene locus_tag LOCUS_08720 1730 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3312 2452 gene locus_tag LOCUS_08730 3312 2452 CDS product CepA family extended-spectrum class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202336.1 protein_id gnl|my_center|LOCUS_08730 3510 3428 gene locus_tag LOCUS_t00170 3510 3428 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4580 3579 gene locus_tag LOCUS_08740 4580 3579 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_08740 5458 4601 gene locus_tag LOCUS_08750 5458 4601 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_08750 8180 5445 gene locus_tag LOCUS_08760 8180 5445 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_08760 8290 8832 gene locus_tag LOCUS_08770 8290 8832 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783757.1 protein_id gnl|my_center|LOCUS_08770 9098 8877 gene locus_tag LOCUS_08780 gene yidD 9098 8877 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_08780 9484 9095 gene locus_tag LOCUS_08790 gene rnpA 9484 9095 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_08790 10245 9487 gene locus_tag LOCUS_08800 10245 9487 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_08800 12015 11002 gene locus_tag LOCUS_08810 12015 11002 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_08810 12099 13622 gene locus_tag LOCUS_08820 12099 13622 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_08820 15233 13794 gene locus_tag LOCUS_08830 15233 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 <16093 15489 gene locus_tag LOCUS_08840 <16093 15489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202548.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence051 656 1111 gene locus_tag LOCUS_08850 656 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1122 3656 gene locus_tag LOCUS_08860 1122 3656 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_08860 3668 4975 gene locus_tag LOCUS_08870 3668 4975 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_08870 4977 6239 gene locus_tag LOCUS_08880 4977 6239 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_08880 6252 7073 gene locus_tag LOCUS_08890 6252 7073 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_08890 7259 12793 gene locus_tag LOCUS_08900 7259 12793 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100240.1 protein_id gnl|my_center|LOCUS_08900 12933 13289 gene locus_tag LOCUS_08910 12933 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107299.1 protein_id gnl|my_center|LOCUS_08910 13363 15693 gene locus_tag LOCUS_08920 13363 15693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence052 1228 1917 gene locus_tag LOCUS_08930 1228 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_08930 1932 2759 gene locus_tag LOCUS_08940 1932 2759 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764221.1 protein_id gnl|my_center|LOCUS_08940 2747 3292 gene locus_tag LOCUS_08950 2747 3292 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_08950 4829 3393 gene locus_tag LOCUS_08960 gene cls 4829 3393 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_08960 7703 4917 gene locus_tag LOCUS_08970 7703 4917 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_08970 9183 7912 gene locus_tag LOCUS_08980 9183 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9879 9268 gene locus_tag LOCUS_08990 9879 9268 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765039.1 protein_id gnl|my_center|LOCUS_08990 10646 9891 gene locus_tag LOCUS_09000 10646 9891 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_09000 11916 10762 gene locus_tag LOCUS_09010 11916 10762 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_09010 12639 11932 gene locus_tag LOCUS_09020 12639 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680413.1 protein_id gnl|my_center|LOCUS_09020 13882 12656 gene locus_tag LOCUS_09030 13882 12656 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_09030 15329 13896 gene locus_tag LOCUS_09040 15329 13896 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_09040 <16030 15460 gene locus_tag LOCUS_09050 <16030 15460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680409.1:imelysin family protein >Feature sequence053 <1 862 gene locus_tag LOCUS_09060 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203376.1:DUF4493 domain-containing protein 1055 1780 gene locus_tag LOCUS_09070 1055 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_09070 1787 3448 gene locus_tag LOCUS_09080 1787 3448 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_09080 3466 5232 gene locus_tag LOCUS_09090 3466 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5244 6026 gene locus_tag LOCUS_09100 5244 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6760 6263 gene locus_tag LOCUS_09110 6760 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787699.1 protein_id gnl|my_center|LOCUS_09110 9155 6963 gene locus_tag LOCUS_09120 9155 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 11028 9187 gene locus_tag LOCUS_09130 11028 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762677.1 protein_id gnl|my_center|LOCUS_09130 13392 11152 gene locus_tag LOCUS_09140 13392 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14342 13410 gene locus_tag LOCUS_09150 14342 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence054 306 220 gene locus_tag LOCUS_t00180 306 220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 489 1568 gene locus_tag LOCUS_09160 489 1568 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_09160 2551 5685 gene locus_tag LOCUS_09170 2551 5685 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_09170 5700 7385 gene locus_tag LOCUS_09180 5700 7385 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_09180 7501 8631 gene locus_tag LOCUS_09190 7501 8631 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_09190 9924 8698 gene locus_tag LOCUS_09200 9924 8698 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_09200 10290 9934 gene locus_tag LOCUS_09210 gene rbfA 10290 9934 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_09210 10987 10349 gene locus_tag LOCUS_09220 10987 10349 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_09220 12460 11003 gene locus_tag LOCUS_09230 gene pyk 12460 11003 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_09230 12921 12493 gene locus_tag LOCUS_09240 gene aroQ 12921 12493 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_09240 13123 14028 gene locus_tag LOCUS_09250 gene xerD 13123 14028 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_09250 <15278 14576 gene locus_tag LOCUS_09260 <15278 14576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421593.1:MBL fold metallo-hydrolase >Feature sequence055 17 1015 gene locus_tag LOCUS_09270 17 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1019 2965 gene locus_tag LOCUS_09280 gene dndD 1019 2965 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_09280 2968 3357 gene locus_tag LOCUS_09290 gene dndE 2968 3357 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_09290 3354 4505 gene locus_tag LOCUS_09300 gene dndA 3354 4505 CDS product cysteine desulfurase DndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109917.1 protein_id gnl|my_center|LOCUS_09300 4520 5707 gene locus_tag LOCUS_09310 4520 5707 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_09310 5708 6283 gene locus_tag LOCUS_09320 5708 6283 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_09320 6430 7383 gene locus_tag LOCUS_09330 6430 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7387 7938 gene locus_tag LOCUS_09340 7387 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 8120 8794 gene locus_tag LOCUS_09350 8120 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 8815 9015 gene locus_tag LOCUS_09360 8815 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9306 9506 gene locus_tag LOCUS_09370 9306 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 9713 10072 gene locus_tag LOCUS_09380 9713 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 10211 10771 gene locus_tag LOCUS_09390 10211 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 10777 10941 gene locus_tag LOCUS_09400 10777 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 11020 12714 gene locus_tag LOCUS_09410 11020 12714 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence056 3068 2793 gene locus_tag LOCUS_09420 3068 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 3365 4471 gene locus_tag LOCUS_09430 gene trpS 3365 4471 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_09430 4575 5069 gene locus_tag LOCUS_09440 4575 5069 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_09440 5225 6073 gene locus_tag LOCUS_09450 5225 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 6137 8446 gene locus_tag LOCUS_09460 6137 8446 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_09460 8446 9459 gene locus_tag LOCUS_09470 8446 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 10344 9475 gene locus_tag LOCUS_09480 10344 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 10699 11391 gene locus_tag LOCUS_09490 10699 11391 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_09490 11584 12558 gene locus_tag LOCUS_09500 11584 12558 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_09500 12560 13345 gene locus_tag LOCUS_09510 12560 13345 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_09510 13490 13578 gene locus_tag LOCUS_t00190 13490 13578 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 2398 1163 gene locus_tag LOCUS_09520 2398 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3152 2409 gene locus_tag LOCUS_09530 3152 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3841 3227 gene locus_tag LOCUS_09540 3841 3227 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_09540 3929 4480 gene locus_tag LOCUS_09550 3929 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4668 5060 gene locus_tag LOCUS_09560 4668 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 5060 5446 gene locus_tag LOCUS_09570 5060 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5446 5754 gene locus_tag LOCUS_09580 5446 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5751 8372 gene locus_tag LOCUS_09590 5751 8372 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291515.1 protein_id gnl|my_center|LOCUS_09590 8365 8580 gene locus_tag LOCUS_09600 8365 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8597 9193 gene locus_tag LOCUS_09610 8597 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9207 10256 gene locus_tag LOCUS_09620 9207 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10278 10913 gene locus_tag LOCUS_09630 10278 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 10906 12195 gene locus_tag LOCUS_09640 10906 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 12197 12370 gene locus_tag LOCUS_09650 12197 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 12367 13443 gene locus_tag LOCUS_09660 gene traN 12367 13443 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842179.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence058 1381 119 gene locus_tag LOCUS_09670 1381 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2486 1509 gene locus_tag LOCUS_09680 2486 1509 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_09680 3212 2550 gene locus_tag LOCUS_09690 3212 2550 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_09690 3727 3224 gene locus_tag LOCUS_09700 3727 3224 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_09700 3894 6728 gene locus_tag LOCUS_09710 3894 6728 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_09710 8829 7192 gene locus_tag LOCUS_09720 gene groL 8829 7192 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_09720 9219 8950 gene locus_tag LOCUS_09730 9219 8950 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_09730 9937 9413 gene locus_tag LOCUS_09740 9937 9413 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_09740 10774 10121 gene locus_tag LOCUS_09750 10774 10121 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_09750 10932 11696 gene locus_tag LOCUS_09760 10932 11696 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_09760 13043 12324 gene locus_tag LOCUS_09770 13043 12324 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence059 479 1831 gene locus_tag LOCUS_09780 479 1831 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201957.1 protein_id gnl|my_center|LOCUS_09780 1910 3235 gene locus_tag LOCUS_09790 gene mtaB 1910 3235 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_09790 3255 4163 gene locus_tag LOCUS_09800 3255 4163 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_09800 4150 5187 gene locus_tag LOCUS_09810 4150 5187 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_09810 5293 7221 gene locus_tag LOCUS_09820 5293 7221 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09820 7368 8639 gene locus_tag LOCUS_09830 7368 8639 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_09830 8816 9496 gene locus_tag LOCUS_09840 8816 9496 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_09840 10513 9572 gene locus_tag LOCUS_09850 10513 9572 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_09850 12308 10611 gene locus_tag LOCUS_09860 12308 10611 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_09860 13163 12333 gene locus_tag LOCUS_09870 13163 12333 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence060 66 560 gene locus_tag LOCUS_09880 66 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 789 2474 gene locus_tag LOCUS_09890 789 2474 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766031.1 protein_id gnl|my_center|LOCUS_09890 3618 2608 gene locus_tag LOCUS_09900 3618 2608 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203490.1 protein_id gnl|my_center|LOCUS_09900 6285 3622 gene locus_tag LOCUS_09910 6285 3622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_09910 7164 6289 gene locus_tag LOCUS_09920 7164 6289 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763955.1 protein_id gnl|my_center|LOCUS_09920 8596 7322 gene locus_tag LOCUS_09930 8596 7322 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_09930 8868 9887 gene locus_tag LOCUS_09940 gene pheS 8868 9887 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_09940 10104 10742 gene locus_tag LOCUS_09950 gene nth 10104 10742 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_09950 10856 11626 gene locus_tag LOCUS_09960 10856 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 12381 11623 gene locus_tag LOCUS_09970 12381 11623 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_09970 13391 12381 gene locus_tag LOCUS_09980 gene murB 13391 12381 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence061 1169 2152 gene locus_tag LOCUS_09990 1169 2152 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_09990 2169 2525 gene locus_tag LOCUS_10000 2169 2525 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_10000 2607 2996 gene locus_tag LOCUS_10010 2607 2996 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_10010 5377 3071 gene locus_tag LOCUS_10020 5377 3071 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_10020 6988 5471 gene locus_tag LOCUS_10030 6988 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7697 6993 gene locus_tag LOCUS_10040 7697 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8578 7694 gene locus_tag LOCUS_10050 8578 7694 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_10050 9375 8611 gene locus_tag LOCUS_10060 9375 8611 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_10060 9875 9501 gene locus_tag LOCUS_10070 9875 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 10441 9878 gene locus_tag LOCUS_10080 10441 9878 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_10080 10855 10445 gene locus_tag LOCUS_10090 10855 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 11849 10992 gene locus_tag LOCUS_10100 11849 10992 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763946.1 protein_id gnl|my_center|LOCUS_10100 13363 11879 gene locus_tag LOCUS_10110 13363 11879 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence062 3992 1476 gene locus_tag LOCUS_10120 3992 1476 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_10120 4855 4094 gene locus_tag LOCUS_10130 4855 4094 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_10130 5180 4905 gene locus_tag LOCUS_10140 5180 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6458 5184 gene locus_tag LOCUS_10150 6458 5184 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_10150 7441 6455 gene locus_tag LOCUS_10160 7441 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7930 7460 gene locus_tag LOCUS_10170 7930 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9256 8240 gene locus_tag LOCUS_10180 9256 8240 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_10180 10077 9268 gene locus_tag LOCUS_10190 10077 9268 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202934.1 protein_id gnl|my_center|LOCUS_10190 11544 10102 gene locus_tag LOCUS_10200 11544 10102 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_10200 12878 11565 gene locus_tag LOCUS_10210 12878 11565 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence063 749 126 gene locus_tag LOCUS_10220 749 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1743 742 gene locus_tag LOCUS_10230 1743 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3216 2347 gene locus_tag LOCUS_10240 3216 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4771 3326 gene locus_tag LOCUS_10250 4771 3326 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_10250 5547 4780 gene locus_tag LOCUS_10260 gene argB 5547 4780 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_10260 5623 5696 gene locus_tag LOCUS_t00200 5623 5696 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5825 6499 gene locus_tag LOCUS_10270 5825 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6569 8674 gene locus_tag LOCUS_10280 6569 8674 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109177.1 protein_id gnl|my_center|LOCUS_10280 8798 9232 gene locus_tag LOCUS_10290 8798 9232 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_10290 9245 10885 gene locus_tag LOCUS_10300 9245 10885 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_10300 10888 11442 gene locus_tag LOCUS_10310 10888 11442 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_10310 11725 11432 gene locus_tag LOCUS_10320 11725 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 12836 11727 gene locus_tag LOCUS_10330 gene recF 12836 11727 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence064 508 1854 gene locus_tag LOCUS_10340 gene mgtE 508 1854 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760927.1 protein_id gnl|my_center|LOCUS_10340 3616 1868 gene locus_tag LOCUS_10350 gene glaB 3616 1868 CDS product alpha-1,3-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202199.1 protein_id gnl|my_center|LOCUS_10350 4679 3873 gene locus_tag LOCUS_10360 4679 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6516 4684 gene locus_tag LOCUS_10370 6516 4684 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_10370 7946 6660 gene locus_tag LOCUS_10380 7946 6660 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_10380 8036 9436 gene locus_tag LOCUS_10390 8036 9436 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_10390 10661 9441 gene locus_tag LOCUS_10400 10661 9441 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence065 2519 972 gene locus_tag LOCUS_10410 2519 972 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_10410 3814 2582 gene locus_tag LOCUS_10420 3814 2582 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_10420 3959 4672 gene locus_tag LOCUS_10430 3959 4672 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_10430 4710 5492 gene locus_tag LOCUS_10440 4710 5492 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_10440 5885 5514 gene locus_tag LOCUS_10450 5885 5514 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_10450 6033 6446 gene locus_tag LOCUS_10460 6033 6446 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_10460 6545 7876 gene locus_tag LOCUS_10470 6545 7876 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_10470 8066 10048 gene locus_tag LOCUS_10480 8066 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12175 10058 gene locus_tag LOCUS_10490 12175 10058 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_10490 12934 12317 gene locus_tag LOCUS_10500 12934 12317 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766175.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence066 3088 719 gene locus_tag LOCUS_10510 3088 719 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_10510 3725 3516 gene locus_tag LOCUS_10520 3725 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4070 5134 gene locus_tag LOCUS_10530 4070 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5155 6156 gene locus_tag LOCUS_10540 5155 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6160 7614 gene locus_tag LOCUS_10550 6160 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7607 8173 gene locus_tag LOCUS_10560 7607 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8175 9401 gene locus_tag LOCUS_10570 8175 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9406 9768 gene locus_tag LOCUS_10580 9406 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 10549 11715 gene locus_tag LOCUS_10590 10549 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence067 2108 108 gene locus_tag LOCUS_10600 gene ligA 2108 108 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_10600 3561 2431 gene locus_tag LOCUS_10610 3561 2431 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201847.1 protein_id gnl|my_center|LOCUS_10610 4642 3659 gene locus_tag LOCUS_10620 4642 3659 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_10620 5763 4660 gene locus_tag LOCUS_10630 5763 4660 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_10630 7377 5908 gene locus_tag LOCUS_10640 gene cysN 7377 5908 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786535.1 protein_id gnl|my_center|LOCUS_10640 7709 7377 gene locus_tag LOCUS_10650 7709 7377 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_10650 8683 7775 gene locus_tag LOCUS_10660 gene cysD 8683 7775 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776455.1 protein_id gnl|my_center|LOCUS_10660 9327 8695 gene locus_tag LOCUS_10670 gene cysC 9327 8695 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_10670 10903 9353 gene locus_tag LOCUS_10680 10903 9353 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_10680 11833 11015 gene locus_tag LOCUS_10690 gene cysQ 11833 11015 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_10690 12883 12539 gene locus_tag LOCUS_10700 gene rplT 12883 12539 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence068 537 1142 gene locus_tag LOCUS_10710 537 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1585 1983 gene locus_tag LOCUS_10720 1585 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2164 2355 gene locus_tag LOCUS_10730 2164 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2836 3237 gene locus_tag LOCUS_10740 2836 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3330 4436 gene locus_tag LOCUS_10750 3330 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4455 7607 gene locus_tag LOCUS_10760 4455 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7768 9378 gene locus_tag LOCUS_10770 7768 9378 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764376.1 protein_id gnl|my_center|LOCUS_10770 9697 12504 gene locus_tag LOCUS_10780 9697 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence069 310 1260 gene locus_tag LOCUS_10790 310 1260 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759763.1 protein_id gnl|my_center|LOCUS_10790 2703 1306 gene locus_tag LOCUS_10800 2703 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2950 3561 gene locus_tag LOCUS_10810 2950 3561 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_10810 3742 4803 gene locus_tag LOCUS_10820 3742 4803 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_10820 4828 5634 gene locus_tag LOCUS_10830 4828 5634 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_10830 5727 5800 gene locus_tag LOCUS_t00210 5727 5800 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5952 6458 gene locus_tag LOCUS_10840 5952 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6497 7447 gene locus_tag LOCUS_10850 6497 7447 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_10850 7532 8095 gene locus_tag LOCUS_10860 7532 8095 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_10860 9060 8185 gene locus_tag LOCUS_10870 9060 8185 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_10870 9725 9057 gene locus_tag LOCUS_10880 9725 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9810 10526 gene locus_tag LOCUS_10890 9810 10526 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_10890 10553 11269 gene locus_tag LOCUS_10900 10553 11269 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_10900 11345 11713 gene locus_tag LOCUS_10910 11345 11713 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_10910 11726 12574 gene locus_tag LOCUS_10920 11726 12574 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence070 <1 1489 gene locus_tag LOCUS_10930 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:carboxypeptidase-like regulatory domain-containing protein 2187 1486 gene locus_tag LOCUS_10940 2187 1486 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790377.1 protein_id gnl|my_center|LOCUS_10940 2623 2441 gene locus_tag LOCUS_10950 2623 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2854 2657 gene locus_tag LOCUS_10960 2854 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3456 3052 gene locus_tag LOCUS_10970 3456 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3540 4433 gene locus_tag LOCUS_10980 3540 4433 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_10980 5009 4659 gene locus_tag LOCUS_10990 5009 4659 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360043.1 protein_id gnl|my_center|LOCUS_10990 5851 5021 gene locus_tag LOCUS_11000 5851 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6861 5917 gene locus_tag LOCUS_11010 6861 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7225 6878 gene locus_tag LOCUS_11020 7225 6878 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_11020 7407 8654 gene locus_tag LOCUS_11030 7407 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946837.1 protein_id gnl|my_center|LOCUS_11030 9180 8638 gene locus_tag LOCUS_11040 9180 8638 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_11040 10753 9203 gene locus_tag LOCUS_11050 10753 9203 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_11050 11447 10881 gene locus_tag LOCUS_11060 11447 10881 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_11060 12616 11855 gene locus_tag LOCUS_11070 12616 11855 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence071 239 715 gene locus_tag LOCUS_11080 239 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11080 788 1171 gene locus_tag LOCUS_11090 788 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1269 2531 gene locus_tag LOCUS_11100 1269 2531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_11100 2884 3294 gene locus_tag LOCUS_11110 2884 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 3591 4583 gene locus_tag LOCUS_11120 3591 4583 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_11120 4587 8927 gene locus_tag LOCUS_11130 4587 8927 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109062.1 protein_id gnl|my_center|LOCUS_11130 8975 10390 gene locus_tag LOCUS_11140 8975 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10460 11965 gene locus_tag LOCUS_11150 10460 11965 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_11150 12305 12218 gene locus_tag LOCUS_t00220 12305 12218 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 666 1238 gene locus_tag LOCUS_11160 666 1238 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_11160 1381 2286 gene locus_tag LOCUS_11170 1381 2286 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_11170 2475 5870 gene locus_tag LOCUS_11180 2475 5870 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785209.1 protein_id gnl|my_center|LOCUS_11180 5890 7653 gene locus_tag LOCUS_11190 5890 7653 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785207.1 protein_id gnl|my_center|LOCUS_11190 7735 8961 gene locus_tag LOCUS_11200 7735 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11200 8999 10729 gene locus_tag LOCUS_11210 8999 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11210 >Feature sequence073 195 821 gene locus_tag LOCUS_11220 195 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1144 1069 gene locus_tag LOCUS_t00230 1144 1069 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2468 1239 gene locus_tag LOCUS_11230 2468 1239 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_11230 2565 3917 gene locus_tag LOCUS_11240 gene dacB 2565 3917 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_11240 4649 3903 gene locus_tag LOCUS_11250 4649 3903 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_11250 5743 4646 gene locus_tag LOCUS_11260 5743 4646 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_11260 7310 6090 gene locus_tag LOCUS_11270 7310 6090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_11270 8072 7332 gene locus_tag LOCUS_11280 8072 7332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_11280 9341 8109 gene locus_tag LOCUS_11290 9341 8109 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_11290 10831 9515 gene locus_tag LOCUS_11300 10831 9515 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_11300 11026 12318 gene locus_tag LOCUS_11310 gene tyrS 11026 12318 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_11310 12386 12457 gene locus_tag LOCUS_t00240 12386 12457 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 1318 812 gene locus_tag LOCUS_11320 1318 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2300 1392 gene locus_tag LOCUS_11330 2300 1392 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_11330 2458 3525 gene locus_tag LOCUS_11340 gene vexC 2458 3525 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_11340 3542 6694 gene locus_tag LOCUS_11350 3542 6694 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766604.1 protein_id gnl|my_center|LOCUS_11350 6702 7988 gene locus_tag LOCUS_11360 6702 7988 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107684.1 protein_id gnl|my_center|LOCUS_11360 8282 8434 gene locus_tag LOCUS_11370 8282 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8644 10335 gene locus_tag LOCUS_11380 8644 10335 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_11380 10404 11348 gene locus_tag LOCUS_11390 10404 11348 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence075 2042 600 gene locus_tag LOCUS_11400 2042 600 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_11400 3391 2093 gene locus_tag LOCUS_11410 3391 2093 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_11410 3990 3388 gene locus_tag LOCUS_11420 3990 3388 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_11420 5605 4025 gene locus_tag LOCUS_11430 5605 4025 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_11430 7020 5644 gene locus_tag LOCUS_11440 gene radA 7020 5644 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_11440 8640 7102 gene locus_tag LOCUS_11450 8640 7102 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_11450 11040 8740 gene locus_tag LOCUS_11460 11040 8740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_11460 11199 12104 gene locus_tag LOCUS_11470 11199 12104 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence076 168 1079 gene locus_tag LOCUS_11480 168 1079 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_11480 3539 1275 gene locus_tag LOCUS_11490 3539 1275 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_11490 4821 3571 gene locus_tag LOCUS_11500 4821 3571 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_11500 5370 4906 gene locus_tag LOCUS_11510 5370 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_11510 7532 5481 gene locus_tag LOCUS_11520 gene htpG 7532 5481 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_11520 9195 7978 gene locus_tag LOCUS_11530 9195 7978 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765728.1 protein_id gnl|my_center|LOCUS_11530 11819 9252 gene locus_tag LOCUS_11540 gene gyrA 11819 9252 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence077 929 39 gene locus_tag LOCUS_11550 929 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1782 1000 gene locus_tag LOCUS_11560 1782 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1976 1782 gene locus_tag LOCUS_11570 1976 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4033 1949 gene locus_tag LOCUS_11580 4033 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4451 4047 gene locus_tag LOCUS_11590 4451 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4818 5075 gene locus_tag LOCUS_11600 4818 5075 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_11600 5068 7089 gene locus_tag LOCUS_11610 5068 7089 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_11610 7083 8564 gene locus_tag LOCUS_11620 7083 8564 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_11620 9932 8796 gene locus_tag LOCUS_11630 9932 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10321 9992 gene locus_tag LOCUS_11640 10321 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11129 10434 gene locus_tag LOCUS_11650 11129 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence078 <1 1038 gene locus_tag LOCUS_11660 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107079.1:nucleotidyltransferase family protein 1038 1934 gene locus_tag LOCUS_11670 1038 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_11670 2030 2824 gene locus_tag LOCUS_11680 2030 2824 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_11680 2848 5193 gene locus_tag LOCUS_11690 2848 5193 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_11690 5241 5423 gene locus_tag LOCUS_11700 5241 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5446 7986 gene locus_tag LOCUS_11710 5446 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8089 10647 gene locus_tag LOCUS_11720 8089 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10681 11349 gene locus_tag LOCUS_11730 10681 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12162 11680 gene locus_tag LOCUS_11740 12162 11680 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence079 <1 923 gene locus_tag LOCUS_11750 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201861.1:histidine kinase note possible pseudo, frameshifted 1240 2010 gene locus_tag LOCUS_11760 1240 2010 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796993.1 protein_id gnl|my_center|LOCUS_11760 2164 2517 gene locus_tag LOCUS_11770 gene rpsF 2164 2517 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_11770 2520 2789 gene locus_tag LOCUS_11780 gene rpsR 2520 2789 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_11780 2811 3254 gene locus_tag LOCUS_11790 gene rplI 2811 3254 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769978.1 protein_id gnl|my_center|LOCUS_11790 3486 4793 gene locus_tag LOCUS_11800 3486 4793 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_11800 4991 7594 gene locus_tag LOCUS_11810 4991 7594 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203735.1 protein_id gnl|my_center|LOCUS_11810 7733 9595 gene locus_tag LOCUS_11820 7733 9595 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203243.1 protein_id gnl|my_center|LOCUS_11820 9634 10500 gene locus_tag LOCUS_11830 9634 10500 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 protein_id gnl|my_center|LOCUS_11830 10509 11669 gene locus_tag LOCUS_11840 10509 11669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence080 270 1190 gene locus_tag LOCUS_11850 270 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1193 2665 gene locus_tag LOCUS_11860 1193 2665 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_11860 2807 3394 gene locus_tag LOCUS_11870 2807 3394 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_11870 3421 4119 gene locus_tag LOCUS_11880 3421 4119 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_11880 4319 4789 gene locus_tag LOCUS_11890 4319 4789 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_11890 4920 6290 gene locus_tag LOCUS_11900 4920 6290 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_11900 6271 7608 gene locus_tag LOCUS_11910 gene xseA 6271 7608 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_11910 7631 7831 gene locus_tag LOCUS_11920 7631 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7828 8517 gene locus_tag LOCUS_11930 7828 8517 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_11930 10101 8638 gene locus_tag LOCUS_11940 10101 8638 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109097.1 protein_id gnl|my_center|LOCUS_11940 10335 10261 gene locus_tag LOCUS_t00250 10335 10261 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11420 10452 gene locus_tag LOCUS_11950 gene prfB 11420 10452 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_11950 <12327 11643 gene locus_tag LOCUS_11960 <12327 11643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074572.1:AraC family transcriptional regulator >Feature sequence081 1872 535 gene locus_tag LOCUS_11970 gene secY 1872 535 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_11970 2322 1876 gene locus_tag LOCUS_11980 gene rplO 2322 1876 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_11980 2525 2349 gene locus_tag LOCUS_11990 gene rpmD 2525 2349 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_11990 3066 2542 gene locus_tag LOCUS_12000 gene rpsE 3066 2542 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791564.1 protein_id gnl|my_center|LOCUS_12000 3410 3066 gene locus_tag LOCUS_12010 gene rplR 3410 3066 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791562.1 protein_id gnl|my_center|LOCUS_12010 3983 3432 gene locus_tag LOCUS_12020 gene rplF 3983 3432 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_12020 4394 3999 gene locus_tag LOCUS_12030 gene rpsH 4394 3999 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_12030 4721 4452 gene locus_tag LOCUS_12040 gene rpsN 4721 4452 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_12040 5285 4728 gene locus_tag LOCUS_12050 gene rplE 5285 4728 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_12050 5605 5285 gene locus_tag LOCUS_12060 gene rplX 5605 5285 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_12060 5991 5626 gene locus_tag LOCUS_12070 gene rplN 5991 5626 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_12070 6250 5993 gene locus_tag LOCUS_12080 gene rpsQ 6250 5993 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_12080 6457 6260 gene locus_tag LOCUS_12090 gene rpmC 6457 6260 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_12090 6898 6464 gene locus_tag LOCUS_12100 gene rplP 6898 6464 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_12100 7653 6919 gene locus_tag LOCUS_12110 gene rpsC 7653 6919 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_12110 8071 7661 gene locus_tag LOCUS_12120 gene rplV 8071 7661 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_12120 8384 8115 gene locus_tag LOCUS_12130 gene rpsS 8384 8115 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_12130 9229 8405 gene locus_tag LOCUS_12140 gene rplB 9229 8405 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_12140 9531 9238 gene locus_tag LOCUS_12150 gene rplW 9531 9238 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_12150 10173 9544 gene locus_tag LOCUS_12160 gene rplD 10173 9544 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_12160 10790 10173 gene locus_tag LOCUS_12170 gene rplC 10790 10173 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_12170 11116 10811 gene locus_tag LOCUS_12180 gene rpsJ 11116 10811 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_12180 <12268 11141 gene locus_tag LOCUS_12190 <12268 11141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762033.1:elongation factor G >Feature sequence082 482 1741 gene locus_tag LOCUS_12200 gene mraY 482 1741 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_12200 1744 3081 gene locus_tag LOCUS_12210 gene murD 1744 3081 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_12210 3101 4414 gene locus_tag LOCUS_12220 3101 4414 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_12220 4420 5529 gene locus_tag LOCUS_12230 gene murG 4420 5529 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_12230 5560 6942 gene locus_tag LOCUS_12240 gene murC 5560 6942 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_12240 6939 7667 gene locus_tag LOCUS_12250 6939 7667 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_12250 7674 9098 gene locus_tag LOCUS_12260 gene ftsA 7674 9098 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108835.1 protein_id gnl|my_center|LOCUS_12260 9114 10469 gene locus_tag LOCUS_12270 gene ftsZ 9114 10469 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_12270 10491 10940 gene locus_tag LOCUS_12280 10491 10940 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence083 1922 489 gene locus_tag LOCUS_12290 gene cobJ 1922 489 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_12290 3365 2637 gene locus_tag LOCUS_12300 3365 2637 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_12300 3910 3377 gene locus_tag LOCUS_12310 3910 3377 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_12310 5708 4548 gene locus_tag LOCUS_12320 gene nagA 5708 4548 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107394.1 protein_id gnl|my_center|LOCUS_12320 6922 5756 gene locus_tag LOCUS_12330 gene nagA 6922 5756 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765558.1 protein_id gnl|my_center|LOCUS_12330 9282 7345 gene locus_tag LOCUS_12340 9282 7345 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_12340 9374 9931 gene locus_tag LOCUS_12350 9374 9931 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence084 1281 565 gene locus_tag LOCUS_12360 1281 565 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_12360 2236 1283 gene locus_tag LOCUS_12370 2236 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3577 2243 gene locus_tag LOCUS_12380 3577 2243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_12380 5090 3675 gene locus_tag LOCUS_12390 5090 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 8560 5462 gene locus_tag LOCUS_12400 8560 5462 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_12400 9259 8627 gene locus_tag LOCUS_12410 9259 8627 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_12410 10130 9645 gene locus_tag LOCUS_12420 10130 9645 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762403.1 protein_id gnl|my_center|LOCUS_12420 11882 10179 gene locus_tag LOCUS_12430 11882 10179 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence085 1099 1857 gene locus_tag LOCUS_12440 gene trmB 1099 1857 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_12440 1917 3026 gene locus_tag LOCUS_12450 1917 3026 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_12450 3538 3185 gene locus_tag LOCUS_12460 gene trxA 3538 3185 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_12460 5193 3658 gene locus_tag LOCUS_12470 5193 3658 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_12470 5736 6158 gene locus_tag LOCUS_12480 5736 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6179 6580 gene locus_tag LOCUS_12490 6179 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6580 7929 gene locus_tag LOCUS_12500 gene lpdA 6580 7929 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_12500 9690 7993 gene locus_tag LOCUS_12510 gene sulP 9690 7993 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_12510 9949 12120 gene locus_tag LOCUS_12520 gene rnr 9949 12120 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence086 <1 2482 gene locus_tag LOCUS_12530 <1 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109093.1:glycoside hydrolase family 78 protein 2765 3475 gene locus_tag LOCUS_12540 gene pyrH 2765 3475 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_12540 3563 4675 gene locus_tag LOCUS_12550 3563 4675 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_12550 4894 5487 gene locus_tag LOCUS_12560 gene frr 4894 5487 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_12560 5487 6419 gene locus_tag LOCUS_12570 gene rsgA 5487 6419 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_12570 6543 7583 gene locus_tag LOCUS_12580 6543 7583 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_12580 8121 8705 gene locus_tag LOCUS_12590 8121 8705 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766891.1 protein_id gnl|my_center|LOCUS_12590 8774 9976 gene locus_tag LOCUS_12600 8774 9976 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence087 682 5082 gene locus_tag LOCUS_12610 682 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5241 5783 gene locus_tag LOCUS_12620 5241 5783 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_12620 5806 6324 gene locus_tag LOCUS_12630 5806 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6427 7443 gene locus_tag LOCUS_12640 6427 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8521 7607 gene locus_tag LOCUS_12650 8521 7607 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_12650 9914 8790 gene locus_tag LOCUS_12660 9914 8790 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_12660 11516 9936 gene locus_tag LOCUS_12670 11516 9936 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_12670 11755 11528 gene locus_tag LOCUS_12680 11755 11528 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763429.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence088 1034 15 gene locus_tag LOCUS_12690 1034 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4520 1104 gene locus_tag LOCUS_12700 4520 1104 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_12700 5654 4524 gene locus_tag LOCUS_12710 5654 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7248 5641 gene locus_tag LOCUS_12720 7248 5641 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_12720 7467 7249 gene locus_tag LOCUS_12730 7467 7249 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_12730 8197 7877 gene locus_tag LOCUS_12740 8197 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 8355 8855 gene locus_tag LOCUS_12750 8355 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 8868 9392 gene locus_tag LOCUS_12760 8868 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9708 9466 gene locus_tag LOCUS_12770 9708 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10866 9817 gene locus_tag LOCUS_12780 10866 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12780 11653 10928 gene locus_tag LOCUS_12790 11653 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence089 1158 40 gene locus_tag LOCUS_12800 1158 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4103 1188 gene locus_tag LOCUS_12810 4103 1188 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_12810 5559 4270 gene locus_tag LOCUS_12820 gene metK 5559 4270 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_12820 5979 5761 gene locus_tag LOCUS_12830 5979 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 6515 6030 gene locus_tag LOCUS_12840 gene folK 6515 6030 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_12840 7487 6522 gene locus_tag LOCUS_12850 gene queA 7487 6522 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762821.1 protein_id gnl|my_center|LOCUS_12850 8308 7604 gene locus_tag LOCUS_12860 gene truB 8308 7604 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_12860 9190 8396 gene locus_tag LOCUS_12870 9190 8396 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_12870 9429 9187 gene locus_tag LOCUS_12880 9429 9187 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_12880 10234 9443 gene locus_tag LOCUS_12890 10234 9443 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_12890 10844 10473 gene locus_tag LOCUS_12900 10844 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11130 10837 gene locus_tag LOCUS_12910 11130 10837 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence090 166 1212 gene locus_tag LOCUS_12920 166 1212 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_12920 1392 3221 gene locus_tag LOCUS_12930 gene ftsH 1392 3221 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_12930 5871 3250 gene locus_tag LOCUS_12940 gene mutS 5871 3250 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_12940 6925 5960 gene locus_tag LOCUS_12950 6925 5960 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_12950 7754 6930 gene locus_tag LOCUS_12960 7754 6930 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_12960 7917 8636 gene locus_tag LOCUS_12970 7917 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 9103 10089 gene locus_tag LOCUS_12980 9103 10089 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_12980 11102 10176 gene locus_tag LOCUS_12990 gene rnc 11102 10176 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_12990 <11655 11104 gene locus_tag LOCUS_13000 <11655 11104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201893.1:beta-ketoacyl-ACP synthase II >Feature sequence091 839 1825 gene locus_tag LOCUS_13010 839 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1852 2037 gene locus_tag LOCUS_13020 1852 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2050 3069 gene locus_tag LOCUS_13030 2050 3069 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661005.1 protein_id gnl|my_center|LOCUS_13030 3431 3730 gene locus_tag LOCUS_13040 3431 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4123 5124 gene locus_tag LOCUS_13050 4123 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791926.1 protein_id gnl|my_center|LOCUS_13050 5150 6199 gene locus_tag LOCUS_13060 5150 6199 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042373263.1 protein_id gnl|my_center|LOCUS_13060 6263 7375 gene locus_tag LOCUS_13070 6263 7375 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816589.1 protein_id gnl|my_center|LOCUS_13070 7530 8636 gene locus_tag LOCUS_13080 7530 8636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8641 9675 gene locus_tag LOCUS_13090 8641 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 9856 11163 gene locus_tag LOCUS_13100 gene guaD 9856 11163 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311109.1 protein_id gnl|my_center|LOCUS_13100 11558 11175 gene locus_tag LOCUS_13110 11558 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13110 >Feature sequence092 1273 2976 gene locus_tag LOCUS_13120 1273 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 2988 4043 gene locus_tag LOCUS_13130 2988 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 4541 4044 gene locus_tag LOCUS_13140 4541 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784803.1 protein_id gnl|my_center|LOCUS_13140 5350 4613 gene locus_tag LOCUS_13150 5350 4613 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_13150 7509 5497 gene locus_tag LOCUS_13160 7509 5497 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_13160 8222 7548 gene locus_tag LOCUS_13170 8222 7548 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_13170 9208 8258 gene locus_tag LOCUS_13180 gene metF 9208 8258 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_13180 9370 10389 gene locus_tag LOCUS_13190 9370 10389 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_13190 <11603 10630 gene locus_tag LOCUS_13200 <11603 10630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:S9 family peptidase >Feature sequence093 1831 959 gene locus_tag LOCUS_13210 gene lsrF 1831 959 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175220.1 protein_id gnl|my_center|LOCUS_13210 2538 1924 gene locus_tag LOCUS_13220 gene dhaL 2538 1924 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_13220 3557 2544 gene locus_tag LOCUS_13230 gene dhaK 3557 2544 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_13230 3897 3580 gene locus_tag LOCUS_13240 3897 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 6419 3933 gene locus_tag LOCUS_13250 gene ccsA 6419 3933 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_13250 10652 6603 gene locus_tag LOCUS_13260 10652 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence094 <1 3326 gene locus_tag LOCUS_13270 <1 3326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930803.1:IGHMBP2 family helicase 3316 8697 gene locus_tag LOCUS_13280 3316 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8690 9385 gene locus_tag LOCUS_13290 8690 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9424 10971 gene locus_tag LOCUS_13300 9424 10971 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence095 <1 631 gene locus_tag LOCUS_13310 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202118.1:TonB-dependent receptor 665 2416 gene locus_tag LOCUS_13320 665 2416 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_13320 2539 4590 gene locus_tag LOCUS_13330 2539 4590 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100235.1 protein_id gnl|my_center|LOCUS_13330 5286 4636 gene locus_tag LOCUS_13340 5286 4636 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_13340 7212 5428 gene locus_tag LOCUS_13350 gene rpsA 7212 5428 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_13350 8244 7555 gene locus_tag LOCUS_13360 8244 7555 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence096 <1 2029 gene locus_tag LOCUS_13370 <1 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765057.1:glutamine synthetase III 2250 3248 gene locus_tag LOCUS_13380 gene porQ 2250 3248 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_13380 3253 3951 gene locus_tag LOCUS_13390 gene cmk 3253 3951 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_13390 3936 4811 gene locus_tag LOCUS_13400 3936 4811 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_13400 4897 5877 gene locus_tag LOCUS_13410 gene pfkA 4897 5877 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_13410 6291 6779 gene locus_tag LOCUS_13420 6291 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6945 8912 gene locus_tag LOCUS_13430 6945 8912 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_13430 9037 9729 gene locus_tag LOCUS_13440 9037 9729 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_13440 <11054 9884 gene locus_tag LOCUS_13450 <11054 9884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202133.1:alpha-2-macroglobulin family protein >Feature sequence097 548 1372 gene locus_tag LOCUS_13460 548 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1404 2825 gene locus_tag LOCUS_13470 1404 2825 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_13470 3083 4492 gene locus_tag LOCUS_13480 3083 4492 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_13480 4635 5960 gene locus_tag LOCUS_13490 4635 5960 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_13490 6006 7034 gene locus_tag LOCUS_13500 6006 7034 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_13500 8433 7123 gene locus_tag LOCUS_13510 8433 7123 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_13510 8641 9720 gene locus_tag LOCUS_13520 8641 9720 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_13520 9784 10257 gene locus_tag LOCUS_13530 9784 10257 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence098 936 1391 gene locus_tag LOCUS_13540 936 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1466 2962 gene locus_tag LOCUS_13550 1466 2962 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_13550 3081 4196 gene locus_tag LOCUS_13560 3081 4196 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_13560 6776 4323 gene locus_tag LOCUS_13570 6776 4323 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_13570 8584 6794 gene locus_tag LOCUS_13580 8584 6794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence099 1084 2604 gene locus_tag LOCUS_13590 1084 2604 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_13590 3088 2588 gene locus_tag LOCUS_13600 3088 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3278 4600 gene locus_tag LOCUS_13610 3278 4600 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_13610 4620 5924 gene locus_tag LOCUS_13620 4620 5924 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760705.1 protein_id gnl|my_center|LOCUS_13620 5961 6389 gene locus_tag LOCUS_13630 5961 6389 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_13630 6922 6449 gene locus_tag LOCUS_13640 6922 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 8606 6966 gene locus_tag LOCUS_13650 8606 6966 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_13650 9413 8649 gene locus_tag LOCUS_13660 9413 8649 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791353.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence100 10 1386 gene locus_tag LOCUS_13670 10 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1397 2062 gene locus_tag LOCUS_13680 1397 2062 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_13680 2757 2080 gene locus_tag LOCUS_13690 gene trmD 2757 2080 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_13690 3650 4186 gene locus_tag LOCUS_13700 3650 4186 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_13700 5032 4199 gene locus_tag LOCUS_13710 5032 4199 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_13710 5566 6150 gene locus_tag LOCUS_13720 5566 6150 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_13720 6268 6831 gene locus_tag LOCUS_13730 gene pth 6268 6831 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_13730 6839 7276 gene locus_tag LOCUS_13740 6839 7276 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_13740 7325 8584 gene locus_tag LOCUS_13750 7325 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 10112 8790 gene locus_tag LOCUS_13760 10112 8790 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788174.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence101 303 2330 gene locus_tag LOCUS_13770 gene uvrB 303 2330 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763156.1 protein_id gnl|my_center|LOCUS_13770 2341 3180 gene locus_tag LOCUS_13780 2341 3180 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_13780 3386 4090 gene locus_tag LOCUS_13790 3386 4090 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_13790 4941 4189 gene locus_tag LOCUS_13800 4941 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5326 5970 gene locus_tag LOCUS_13810 5326 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5999 6661 gene locus_tag LOCUS_13820 5999 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7502 6699 gene locus_tag LOCUS_13830 gene kdsA 7502 6699 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_13830 8419 7505 gene locus_tag LOCUS_13840 gene miaA 8419 7505 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_13840 9532 8522 gene locus_tag LOCUS_13850 gene gap 9532 8522 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_13850 10091 9696 gene locus_tag LOCUS_13860 10091 9696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10455 10048 gene locus_tag LOCUS_13870 10455 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 10676 10455 gene locus_tag LOCUS_13880 10676 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence102 <1 613 gene locus_tag LOCUS_13890 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107739.1:bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC 610 1524 gene locus_tag LOCUS_13900 610 1524 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_13900 1532 3196 gene locus_tag LOCUS_13910 gene recN 1532 3196 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_13910 3939 3508 gene locus_tag LOCUS_13920 3939 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4248 5792 gene locus_tag LOCUS_13930 4248 5792 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107907.1 protein_id gnl|my_center|LOCUS_13930 5920 6426 gene locus_tag LOCUS_13940 5920 6426 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_13940 6438 7484 gene locus_tag LOCUS_13950 6438 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7570 10290 gene locus_tag LOCUS_13960 7570 10290 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence103 3181 2336 gene locus_tag LOCUS_13970 3181 2336 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786940.1 protein_id gnl|my_center|LOCUS_13970 3871 3314 gene locus_tag LOCUS_13980 3871 3314 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786942.1 protein_id gnl|my_center|LOCUS_13980 4290 5906 gene locus_tag LOCUS_13990 4290 5906 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_13990 6077 7813 gene locus_tag LOCUS_14000 6077 7813 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_14000 9484 7898 gene locus_tag LOCUS_14010 9484 7898 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_14010 9971 9699 gene locus_tag LOCUS_14020 9971 9699 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence104 2483 1029 gene locus_tag LOCUS_14030 2483 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3196 2480 gene locus_tag LOCUS_14040 3196 2480 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661702.1 protein_id gnl|my_center|LOCUS_14040 3365 4285 gene locus_tag LOCUS_14050 3365 4285 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_14050 4299 6359 gene locus_tag LOCUS_14060 4299 6359 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_14060 6443 7231 gene locus_tag LOCUS_14070 gene mazG 6443 7231 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_14070 7782 7336 gene locus_tag LOCUS_14080 7782 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 8235 7819 gene locus_tag LOCUS_14090 8235 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785404.1 protein_id gnl|my_center|LOCUS_14090 8833 8285 gene locus_tag LOCUS_14100 8833 8285 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_14100 9329 9871 gene locus_tag LOCUS_14110 9329 9871 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202986.1 protein_id gnl|my_center|LOCUS_14110 10489 10055 gene locus_tag LOCUS_14120 gene trxA 10489 10055 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence105 <1 840 gene locus_tag LOCUS_14130 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762594.1:TldD/PmbA family protein 1064 1510 gene locus_tag LOCUS_14140 1064 1510 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_14140 1507 2091 gene locus_tag LOCUS_14150 1507 2091 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_14150 4517 2202 gene locus_tag LOCUS_14160 gene pbpC 4517 2202 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_14160 5502 4600 gene locus_tag LOCUS_14170 5502 4600 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_14170 7706 5508 gene locus_tag LOCUS_14180 7706 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8669 7725 gene locus_tag LOCUS_14190 8669 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10559 8688 gene locus_tag LOCUS_14200 10559 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence106 <1 1228 gene locus_tag LOCUS_14210 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107268.1:TonB-dependent receptor 1240 3090 gene locus_tag LOCUS_14220 1240 3090 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107269.1 protein_id gnl|my_center|LOCUS_14220 3193 4035 gene locus_tag LOCUS_14230 3193 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4044 5402 gene locus_tag LOCUS_14240 4044 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5411 6079 gene locus_tag LOCUS_14250 5411 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 6137 7402 gene locus_tag LOCUS_14260 6137 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7515 8984 gene locus_tag LOCUS_14270 7515 8984 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_14270 9044 9865 gene locus_tag LOCUS_14280 9044 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <10621 10096 gene locus_tag LOCUS_14290 <10621 10096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077152653.1:transposase >Feature sequence107 611 1786 gene locus_tag LOCUS_14300 611 1786 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_14300 1869 3062 gene locus_tag LOCUS_14310 1869 3062 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_14310 3070 3678 gene locus_tag LOCUS_14320 3070 3678 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_14320 3756 4343 gene locus_tag LOCUS_14330 3756 4343 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_14330 4412 5692 gene locus_tag LOCUS_14340 4412 5692 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_14340 5711 5932 gene locus_tag LOCUS_14350 5711 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6044 6823 gene locus_tag LOCUS_14360 6044 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 6826 7695 gene locus_tag LOCUS_14370 6826 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 7707 8096 gene locus_tag LOCUS_14380 7707 8096 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107247.1 protein_id gnl|my_center|LOCUS_14380 8247 9356 gene locus_tag LOCUS_14390 8247 9356 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_14390 9358 10017 gene locus_tag LOCUS_14400 9358 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_14400 10313 10077 gene locus_tag LOCUS_14410 10313 10077 CDS product DUF4248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109076.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence108 636 2351 gene locus_tag LOCUS_14420 636 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2344 3936 gene locus_tag LOCUS_14430 2344 3936 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_14430 3957 4826 gene locus_tag LOCUS_14440 3957 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4854 6245 gene locus_tag LOCUS_14450 4854 6245 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785074.1 protein_id gnl|my_center|LOCUS_14450 6265 7512 gene locus_tag LOCUS_14460 6265 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 7603 8946 gene locus_tag LOCUS_14470 7603 8946 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_14470 8946 10001 gene locus_tag LOCUS_14480 8946 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence109 257 505 gene locus_tag LOCUS_14490 257 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 530 862 gene locus_tag LOCUS_14500 530 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 994 2487 gene locus_tag LOCUS_14510 994 2487 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 protein_id gnl|my_center|LOCUS_14510 2503 3396 gene locus_tag LOCUS_14520 gene rhuM 2503 3396 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_14520 3402 4772 gene locus_tag LOCUS_14530 3402 4772 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_14530 4763 6061 gene locus_tag LOCUS_14540 4763 6061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_14540 6141 6392 gene locus_tag LOCUS_14550 6141 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6405 6638 gene locus_tag LOCUS_14560 6405 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8305 6728 gene locus_tag LOCUS_14570 gene nadB 8305 6728 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_14570 9467 8364 gene locus_tag LOCUS_14580 gene ychF 9467 8364 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence110 1056 211 gene locus_tag LOCUS_14590 1056 211 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_14590 1219 2049 gene locus_tag LOCUS_14600 1219 2049 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_14600 3195 2134 gene locus_tag LOCUS_14610 gene leuB 3195 2134 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_14610 4753 3224 gene locus_tag LOCUS_14620 4753 3224 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_14620 5654 5055 gene locus_tag LOCUS_14630 gene leuD 5654 5055 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_14630 7076 5682 gene locus_tag LOCUS_14640 gene leuC 7076 5682 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_14640 8579 7083 gene locus_tag LOCUS_14650 8579 7083 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_14650 9021 9563 gene locus_tag LOCUS_14660 gene fldA 9021 9563 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765037.1 protein_id gnl|my_center|LOCUS_14660 9589 9933 gene locus_tag LOCUS_14670 9589 9933 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763079.1 protein_id gnl|my_center|LOCUS_14670 10201 10097 gene locus_tag LOCUS_r00010 10201 10097 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence111 150 1568 gene locus_tag LOCUS_14680 gene ahcY 150 1568 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781763.1 protein_id gnl|my_center|LOCUS_14680 2066 3661 gene locus_tag LOCUS_14690 2066 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6696 3754 gene locus_tag LOCUS_14700 6696 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 9652 6743 gene locus_tag LOCUS_14710 9652 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence112 2293 1190 gene locus_tag LOCUS_14720 2293 1190 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_14720 2831 2295 gene locus_tag LOCUS_14730 2831 2295 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_14730 4681 2894 gene locus_tag LOCUS_14740 4681 2894 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_14740 5974 4823 gene locus_tag LOCUS_14750 5974 4823 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_14750 6451 7578 gene locus_tag LOCUS_14760 gene hemW 6451 7578 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_14760 7796 8296 gene locus_tag LOCUS_14770 7796 8296 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_14770 8289 8459 gene locus_tag LOCUS_14780 8289 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <10056 8539 gene locus_tag LOCUS_14790 <10056 8539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203170.1:S46 family peptidase >Feature sequence113 1726 527 gene locus_tag LOCUS_14800 1726 527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769619.1 protein_id gnl|my_center|LOCUS_14800 3140 1770 gene locus_tag LOCUS_14810 3140 1770 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_14810 3842 3171 gene locus_tag LOCUS_14820 3842 3171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_14820 4574 3858 gene locus_tag LOCUS_14830 4574 3858 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_14830 9097 5096 gene locus_tag LOCUS_14840 9097 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence114 <1 1750 gene locus_tag LOCUS_14850 <1 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203553.1:beta-N-acetylglucosaminidase domain-containing protein 4245 1852 gene locus_tag LOCUS_14860 4245 1852 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_14860 4961 4539 gene locus_tag LOCUS_14870 4961 4539 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_14870 6851 4998 gene locus_tag LOCUS_14880 6851 4998 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100251.1 protein_id gnl|my_center|LOCUS_14880 7465 6848 gene locus_tag LOCUS_14890 7465 6848 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_14890 8860 7541 gene locus_tag LOCUS_14900 8860 7541 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_14900 <9840 8875 gene locus_tag LOCUS_14910 <9840 8875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788434.1:V-type ATP synthase subunit A >Feature sequence115 <1 1125 gene locus_tag LOCUS_14920 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762301.1:ABC transporter permease 1253 2395 gene locus_tag LOCUS_14930 1253 2395 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766479.1 protein_id gnl|my_center|LOCUS_14930 2412 3170 gene locus_tag LOCUS_14940 2412 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4110 3250 gene locus_tag LOCUS_14950 gene map 4110 3250 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_14950 4267 6615 gene locus_tag LOCUS_14960 4267 6615 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_14960 6658 8718 gene locus_tag LOCUS_14970 6658 8718 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_14970 8820 9671 gene locus_tag LOCUS_14980 8820 9671 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence116 <1 1135 gene locus_tag LOCUS_14990 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107588.1:DUF4838 domain-containing protein 3369 1246 gene locus_tag LOCUS_15000 3369 1246 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_15000 3606 4604 gene locus_tag LOCUS_15010 3606 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4592 5041 gene locus_tag LOCUS_15020 4592 5041 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_15020 5089 5982 gene locus_tag LOCUS_15030 5089 5982 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_15030 7376 6114 gene locus_tag LOCUS_15040 7376 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 8897 7380 gene locus_tag LOCUS_15050 8897 7380 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence117 253 471 gene locus_tag LOCUS_15060 gene infA 253 471 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_15060 635 1018 gene locus_tag LOCUS_15070 gene rpsM 635 1018 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_15070 1029 1418 gene locus_tag LOCUS_15080 gene rpsK 1029 1418 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_15080 1542 2147 gene locus_tag LOCUS_15090 gene rpsD 1542 2147 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_15090 2159 3151 gene locus_tag LOCUS_15100 2159 3151 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_15100 3161 3649 gene locus_tag LOCUS_15110 gene rplQ 3161 3649 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_15110 4202 3855 gene locus_tag LOCUS_15120 gene rplS 4202 3855 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_15120 4498 7356 gene locus_tag LOCUS_15130 4498 7356 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_15130 7402 8424 gene locus_tag LOCUS_15140 gene cobD 7402 8424 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_15140 8780 8481 gene locus_tag LOCUS_15150 8780 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8893 9528 gene locus_tag LOCUS_15160 8893 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence118 2922 1498 gene locus_tag LOCUS_15170 2922 1498 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_15170 3130 4062 gene locus_tag LOCUS_15180 3130 4062 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_15180 4143 5000 gene locus_tag LOCUS_15190 4143 5000 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_15190 5077 5685 gene locus_tag LOCUS_15200 5077 5685 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761010.1 protein_id gnl|my_center|LOCUS_15200 8132 5736 gene locus_tag LOCUS_15210 8132 5736 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203439.1 protein_id gnl|my_center|LOCUS_15210 8517 9404 gene locus_tag LOCUS_15220 8517 9404 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence119 2087 1197 gene locus_tag LOCUS_15230 2087 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3977 2181 gene locus_tag LOCUS_15240 3977 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 7517 3996 gene locus_tag LOCUS_15250 7517 3996 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763977.1 protein_id gnl|my_center|LOCUS_15250 8610 7633 gene locus_tag LOCUS_15260 8610 7633 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_15260 <9666 8794 gene locus_tag LOCUS_15270 <9666 8794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042373263.1:6-bladed beta-propeller >Feature sequence120 459 1127 gene locus_tag LOCUS_15280 gene ung 459 1127 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802535.1 protein_id gnl|my_center|LOCUS_15280 1219 2391 gene locus_tag LOCUS_15290 1219 2391 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_15290 2475 3053 gene locus_tag LOCUS_15300 2475 3053 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_15300 3083 4162 gene locus_tag LOCUS_15310 gene aroC 3083 4162 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766481.1 protein_id gnl|my_center|LOCUS_15310 5786 4230 gene locus_tag LOCUS_15320 5786 4230 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107435.1 protein_id gnl|my_center|LOCUS_15320 6488 7114 gene locus_tag LOCUS_15330 6488 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8131 7175 gene locus_tag LOCUS_15340 8131 7175 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_15340 8626 8153 gene locus_tag LOCUS_15350 gene rlmH 8626 8153 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_15350 8711 9082 gene locus_tag LOCUS_15360 8711 9082 CDS product DUF4783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786212.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence121 820 3414 gene locus_tag LOCUS_15370 820 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4241 3618 gene locus_tag LOCUS_15380 gene yihA 4241 3618 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_15380 5701 4250 gene locus_tag LOCUS_15390 5701 4250 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_15390 7014 5704 gene locus_tag LOCUS_15400 7014 5704 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767086.1 protein_id gnl|my_center|LOCUS_15400 9171 7168 gene locus_tag LOCUS_15410 9171 7168 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence122 629 342 gene locus_tag LOCUS_15420 629 342 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_15420 1210 623 gene locus_tag LOCUS_15430 1210 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_15430 1486 1271 gene locus_tag LOCUS_15440 1486 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1726 2076 gene locus_tag LOCUS_15450 1726 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2191 3345 gene locus_tag LOCUS_15460 2191 3345 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_15460 3361 6507 gene locus_tag LOCUS_15470 3361 6507 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_15470 6494 7936 gene locus_tag LOCUS_15480 6494 7936 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_15480 8108 7890 gene locus_tag LOCUS_15490 8108 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 9299 8136 gene locus_tag LOCUS_15500 gene nspC 9299 8136 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence123 <1 2190 gene locus_tag LOCUS_15510 <1 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202860.1:ATP-dependent Clp protease ATP-binding subunit 2625 3905 gene locus_tag LOCUS_15520 2625 3905 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_15520 3947 6292 gene locus_tag LOCUS_15530 3947 6292 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_15530 6425 7105 gene locus_tag LOCUS_15540 6425 7105 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_15540 7108 8379 gene locus_tag LOCUS_15550 7108 8379 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_15550 8474 8911 gene locus_tag LOCUS_15560 8474 8911 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788539.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence124 2370 1105 gene locus_tag LOCUS_15570 2370 1105 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_15570 4322 2385 gene locus_tag LOCUS_15580 4322 2385 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_15580 4856 5272 gene locus_tag LOCUS_15590 4856 5272 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_15590 5299 5865 gene locus_tag LOCUS_15600 5299 5865 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_15600 5917 7116 gene locus_tag LOCUS_15610 5917 7116 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_15610 7113 8081 gene locus_tag LOCUS_15620 gene argC 7113 8081 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence125 4908 2371 gene locus_tag LOCUS_15630 4908 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 7528 5030 gene locus_tag LOCUS_15640 7528 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7786 7535 gene locus_tag LOCUS_15650 7786 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8069 7788 gene locus_tag LOCUS_15660 8069 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 8476 8162 gene locus_tag LOCUS_15670 8476 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8778 8473 gene locus_tag LOCUS_15680 8778 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence126 922 1251 gene locus_tag LOCUS_15690 922 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1899 1405 gene locus_tag LOCUS_15700 1899 1405 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948926.1 protein_id gnl|my_center|LOCUS_15700 2526 1963 gene locus_tag LOCUS_15710 2526 1963 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_15710 2883 5489 gene locus_tag LOCUS_15720 2883 5489 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_15720 5861 5589 gene locus_tag LOCUS_15730 5861 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15730 6191 5904 gene locus_tag LOCUS_15740 6191 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15740 6349 6161 gene locus_tag LOCUS_15750 6349 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6915 6346 gene locus_tag LOCUS_15760 gene gmk 6915 6346 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_15760 7794 6931 gene locus_tag LOCUS_15770 7794 6931 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_15770 8727 7882 gene locus_tag LOCUS_15780 8727 7882 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence127 1353 310 gene locus_tag LOCUS_15790 gene ilvC 1353 310 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_15790 2148 1405 gene locus_tag LOCUS_15800 2148 1405 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_15800 2723 2172 gene locus_tag LOCUS_15810 gene ilvN 2723 2172 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 protein_id gnl|my_center|LOCUS_15810 4436 2742 gene locus_tag LOCUS_15820 gene ilvB 4436 2742 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_15820 6291 4456 gene locus_tag LOCUS_15830 gene ilvD 6291 4456 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_15830 <9136 7082 gene locus_tag LOCUS_15840 <9136 7082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109202.1:DNA translocase FtsK >Feature sequence128 161 853 gene locus_tag LOCUS_15850 gene radC 161 853 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_15850 1791 847 gene locus_tag LOCUS_15860 1791 847 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_15860 2582 1815 gene locus_tag LOCUS_15870 2582 1815 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_15870 2917 2582 gene locus_tag LOCUS_15880 2917 2582 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_15880 4496 3213 gene locus_tag LOCUS_15890 4496 3213 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_15890 4579 5418 gene locus_tag LOCUS_15900 gene folP 4579 5418 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_15900 5437 6222 gene locus_tag LOCUS_15910 gene cdaA 5437 6222 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_15910 6348 7361 gene locus_tag LOCUS_15920 gene pta 6348 7361 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_15920 7389 8591 gene locus_tag LOCUS_15930 7389 8591 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence129 <1 2907 gene locus_tag LOCUS_15940 <1 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202099.1:TonB-dependent receptor 2939 4417 gene locus_tag LOCUS_15950 2939 4417 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_15950 4750 6327 gene locus_tag LOCUS_15960 4750 6327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_15960 <9007 6418 gene locus_tag LOCUS_15970 <9007 6418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109217.1:valine--tRNA ligase >Feature sequence130 66 377 gene locus_tag LOCUS_15980 66 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 374 673 gene locus_tag LOCUS_15990 374 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 912 2960 gene locus_tag LOCUS_16000 912 2960 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476431.1 protein_id gnl|my_center|LOCUS_16000 2961 5066 gene locus_tag LOCUS_16010 2961 5066 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019873.1 protein_id gnl|my_center|LOCUS_16010 5164 6576 gene locus_tag LOCUS_16020 5164 6576 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_16020 6767 6889 gene locus_tag LOCUS_16030 6767 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 7068 8024 gene locus_tag LOCUS_16040 7068 8024 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417631.1 protein_id gnl|my_center|LOCUS_16040 8151 8762 gene locus_tag LOCUS_16050 8151 8762 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860796.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence131 <1 1365 gene locus_tag LOCUS_16060 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000914581.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1386 2474 gene locus_tag LOCUS_16070 1386 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2487 5120 gene locus_tag LOCUS_16080 2487 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5496 5675 gene locus_tag LOCUS_16090 5496 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5836 6168 gene locus_tag LOCUS_16100 5836 6168 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_16100 6308 6634 gene locus_tag LOCUS_16110 6308 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16110 6649 7281 gene locus_tag LOCUS_16120 6649 7281 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_16120 7283 7492 gene locus_tag LOCUS_16130 7283 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_16130 7489 8043 gene locus_tag LOCUS_16140 7489 8043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_16140 8065 8700 gene locus_tag LOCUS_16150 8065 8700 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021707.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence132 424 1743 gene locus_tag LOCUS_16160 424 1743 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_16160 1900 2196 gene locus_tag LOCUS_16170 1900 2196 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_16170 2202 2567 gene locus_tag LOCUS_16180 2202 2567 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_16180 2668 3465 gene locus_tag LOCUS_16190 gene panB 2668 3465 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787461.1 protein_id gnl|my_center|LOCUS_16190 3478 4803 gene locus_tag LOCUS_16200 3478 4803 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_16200 4866 6617 gene locus_tag LOCUS_16210 4866 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6623 8110 gene locus_tag LOCUS_16220 6623 8110 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_16220 8155 8508 gene locus_tag LOCUS_16230 8155 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203154.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence133 347 108 gene locus_tag LOCUS_16240 347 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 542 1669 gene locus_tag LOCUS_16250 542 1669 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797794.1 protein_id gnl|my_center|LOCUS_16250 1673 4813 gene locus_tag LOCUS_16260 1673 4813 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108069.1 protein_id gnl|my_center|LOCUS_16260 4810 6180 gene locus_tag LOCUS_16270 4810 6180 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767229.1 protein_id gnl|my_center|LOCUS_16270 6649 6251 gene locus_tag LOCUS_16280 6649 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765641.1 protein_id gnl|my_center|LOCUS_16280 7531 6755 gene locus_tag LOCUS_16290 7531 6755 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_16290 7669 8151 gene locus_tag LOCUS_16300 7669 8151 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_16300 8165 8767 gene locus_tag LOCUS_16310 8165 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence134 3562 1694 gene locus_tag LOCUS_16320 gene mutA 3562 1694 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_16320 3732 3805 gene locus_tag LOCUS_t00260 3732 3805 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3962 4252 gene locus_tag LOCUS_16330 3962 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16330 4233 4613 gene locus_tag LOCUS_16340 4233 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 6156 5050 gene locus_tag LOCUS_16350 gene meaB 6156 5050 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_16350 7217 6168 gene locus_tag LOCUS_16360 7217 6168 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_16360 7710 7330 gene locus_tag LOCUS_16370 7710 7330 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_16370 8190 8381 gene locus_tag LOCUS_16380 gene rpsU 8190 8381 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence135 8 1093 gene locus_tag LOCUS_16390 8 1093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_16390 1125 2489 gene locus_tag LOCUS_16400 1125 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_16400 2496 3146 gene locus_tag LOCUS_16410 gene lptC 2496 3146 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_16410 3206 4405 gene locus_tag LOCUS_16420 3206 4405 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_16420 4518 5234 gene locus_tag LOCUS_16430 4518 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16430 5135 6652 gene locus_tag LOCUS_16440 5135 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16440 7227 7640 gene locus_tag LOCUS_16450 7227 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 7693 8598 gene locus_tag LOCUS_16460 7693 8598 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence136 3059 2145 gene locus_tag LOCUS_16470 3059 2145 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786940.1 protein_id gnl|my_center|LOCUS_16470 3442 3239 gene locus_tag LOCUS_16480 3442 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3777 3484 gene locus_tag LOCUS_16490 3777 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4367 3864 gene locus_tag LOCUS_16500 4367 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5193 5120 gene locus_tag LOCUS_t00270 5193 5120 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5406 6230 gene locus_tag LOCUS_16510 gene menB 5406 6230 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_16510 6802 6422 gene locus_tag LOCUS_16520 6802 6422 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_16520 7573 6815 gene locus_tag LOCUS_16530 gene rlmB 7573 6815 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_16530 <8746 7702 gene locus_tag LOCUS_16540 <8746 7702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767964.1:phospho-sugar mutase >Feature sequence137 5929 2402 gene locus_tag LOCUS_16550 gene brxC 5929 2402 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176947249.1 protein_id gnl|my_center|LOCUS_16550 6546 5935 gene locus_tag LOCUS_16560 6546 5935 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_16560 7162 6524 gene locus_tag LOCUS_16570 7162 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 7354 7163 gene locus_tag LOCUS_16580 7354 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence138 1126 338 gene locus_tag LOCUS_16590 1126 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16590 1758 1093 gene locus_tag LOCUS_16600 1758 1093 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693578.1 protein_id gnl|my_center|LOCUS_16600 3099 1912 gene locus_tag LOCUS_16610 3099 1912 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107783.1 protein_id gnl|my_center|LOCUS_16610 4370 3096 gene locus_tag LOCUS_16620 4370 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16620 5347 4367 gene locus_tag LOCUS_16630 5347 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16630 5748 5410 gene locus_tag LOCUS_16640 5748 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7288 5771 gene locus_tag LOCUS_16650 7288 5771 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_16650 8389 7319 gene locus_tag LOCUS_16660 8389 7319 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764542.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence139 328 2991 gene locus_tag LOCUS_16670 328 2991 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_16670 3033 4418 gene locus_tag LOCUS_16680 3033 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4435 5457 gene locus_tag LOCUS_16690 4435 5457 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_16690 5906 7027 gene locus_tag LOCUS_16700 5906 7027 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_16700 7043 8428 gene locus_tag LOCUS_16710 gene mnmE 7043 8428 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence140 <1 863 gene locus_tag LOCUS_16720 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109053.1:GH92 family glycosyl hydrolase 941 1261 gene locus_tag LOCUS_16730 941 1261 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_16730 1610 1341 gene locus_tag LOCUS_16740 gene rpsO 1610 1341 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_16740 1779 3578 gene locus_tag LOCUS_16750 gene typA 1779 3578 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_16750 3885 3811 gene locus_tag LOCUS_t00280 3885 3811 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3971 3897 gene locus_tag LOCUS_t00290 3971 3897 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4052 3978 gene locus_tag LOCUS_t00300 4052 3978 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4157 5146 gene locus_tag LOCUS_16760 4157 5146 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_16760 5193 6869 gene locus_tag LOCUS_16770 5193 6869 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_16770 8028 7153 gene locus_tag LOCUS_16780 8028 7153 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence141 100 759 gene locus_tag LOCUS_16790 100 759 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759894.1 protein_id gnl|my_center|LOCUS_16790 1250 822 gene locus_tag LOCUS_16800 1250 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760478.1 protein_id gnl|my_center|LOCUS_16800 2565 1255 gene locus_tag LOCUS_16810 2565 1255 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762009.1 protein_id gnl|my_center|LOCUS_16810 2700 5192 gene locus_tag LOCUS_16820 gene galB 2700 5192 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_16820 6571 5288 gene locus_tag LOCUS_16830 6571 5288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_16830 7685 6588 gene locus_tag LOCUS_16840 7685 6588 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence142 1391 678 gene locus_tag LOCUS_16850 1391 678 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_16850 1792 2262 gene locus_tag LOCUS_16860 1792 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2284 3174 gene locus_tag LOCUS_16870 2284 3174 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_16870 3291 4694 gene locus_tag LOCUS_16880 3291 4694 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_16880 4684 6876 gene locus_tag LOCUS_16890 4684 6876 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_16890 6925 8196 gene locus_tag LOCUS_16900 gene purD 6925 8196 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence143 941 1855 gene locus_tag LOCUS_16910 941 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1852 2547 gene locus_tag LOCUS_16920 1852 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2818 5499 gene locus_tag LOCUS_16930 2818 5499 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244282.1 protein_id gnl|my_center|LOCUS_16930 5496 6194 gene locus_tag LOCUS_16940 5496 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6196 8163 gene locus_tag LOCUS_16950 6196 8163 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233883.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence144 129 1127 gene locus_tag LOCUS_16960 gene floA 129 1127 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_16960 1124 1987 gene locus_tag LOCUS_16970 1124 1987 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_16970 2693 3922 gene locus_tag LOCUS_16980 2693 3922 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109071.1 protein_id gnl|my_center|LOCUS_16980 3942 5135 gene locus_tag LOCUS_16990 3942 5135 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766275.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence145 207 1364 gene locus_tag LOCUS_17000 207 1364 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992113.1 protein_id gnl|my_center|LOCUS_17000 1483 3669 gene locus_tag LOCUS_17010 1483 3669 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_17010 4525 3674 gene locus_tag LOCUS_17020 4525 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791738.1 protein_id gnl|my_center|LOCUS_17020 5387 4620 gene locus_tag LOCUS_17030 gene lpxA 5387 4620 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_17030 6772 5408 gene locus_tag LOCUS_17040 6772 5408 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_17040 8337 6802 gene locus_tag LOCUS_17050 8337 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence146 1265 372 gene locus_tag LOCUS_17060 1265 372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_17060 1393 1953 gene locus_tag LOCUS_17070 1393 1953 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801526.1 protein_id gnl|my_center|LOCUS_17070 2055 3044 gene locus_tag LOCUS_17080 2055 3044 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801525.1 protein_id gnl|my_center|LOCUS_17080 3633 3091 gene locus_tag LOCUS_17090 3633 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17090 5412 3643 gene locus_tag LOCUS_17100 5412 3643 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence147 549 1409 gene locus_tag LOCUS_17110 549 1409 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202128.1 protein_id gnl|my_center|LOCUS_17110 1560 4022 gene locus_tag LOCUS_17120 gene pheT 1560 4022 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_17120 4074 4811 gene locus_tag LOCUS_17130 4074 4811 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_17130 7006 5231 gene locus_tag LOCUS_17140 7006 5231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_17140 7742 7047 gene locus_tag LOCUS_17150 7742 7047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence148 2079 3848 gene locus_tag LOCUS_17160 2079 3848 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_17160 3890 5359 gene locus_tag LOCUS_17170 3890 5359 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_17170 5362 5916 gene locus_tag LOCUS_17180 5362 5916 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198788.1 protein_id gnl|my_center|LOCUS_17180 6095 7360 gene locus_tag LOCUS_17190 6095 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence149 <1 1305 gene locus_tag LOCUS_17200 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963675.1:ATP-dependent endonuclease 1290 3197 gene locus_tag LOCUS_17210 1290 3197 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963674.1 protein_id gnl|my_center|LOCUS_17210 3324 4694 gene locus_tag LOCUS_17220 3324 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 4701 5810 gene locus_tag LOCUS_17230 4701 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5817 7013 gene locus_tag LOCUS_17240 5817 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence150 461 288 gene locus_tag LOCUS_17250 461 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1549 467 gene locus_tag LOCUS_17260 1549 467 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_17260 2214 5075 gene locus_tag LOCUS_17270 gene uvrA 2214 5075 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_17270 5077 5298 gene locus_tag LOCUS_17280 5077 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5300 5905 gene locus_tag LOCUS_17290 5300 5905 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_17290 5923 6699 gene locus_tag LOCUS_17300 5923 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 6674 7051 gene locus_tag LOCUS_17310 6674 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence151 <1 612 gene locus_tag LOCUS_17320 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107588.1:DUF4838 domain-containing protein 868 2943 gene locus_tag LOCUS_17330 868 2943 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_17330 2956 3183 gene locus_tag LOCUS_17340 2956 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 4885 5481 gene locus_tag LOCUS_17350 4885 5481 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_17350 5478 5813 gene locus_tag LOCUS_17360 5478 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6513 5917 gene locus_tag LOCUS_17370 6513 5917 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690625.1 protein_id gnl|my_center|LOCUS_17370 6883 6554 gene locus_tag LOCUS_17380 6883 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7754 6900 gene locus_tag LOCUS_17390 gene rhuM 7754 6900 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648596.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence152 3133 995 gene locus_tag LOCUS_17400 3133 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3995 3147 gene locus_tag LOCUS_17410 3995 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5814 4003 gene locus_tag LOCUS_17420 5814 4003 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_17420 7090 5816 gene locus_tag LOCUS_17430 7090 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7560 7081 gene locus_tag LOCUS_17440 7560 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence153 2058 3116 gene locus_tag LOCUS_17450 2058 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3392 5023 gene locus_tag LOCUS_17460 3392 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6096 6575 gene locus_tag LOCUS_17470 6096 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 6578 7705 gene locus_tag LOCUS_17480 6578 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence154 <1 655 gene locus_tag LOCUS_17490 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202409.1:tRNA lysidine(34) synthetase TilS 838 2823 gene locus_tag LOCUS_17500 838 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5252 2910 gene locus_tag LOCUS_17510 5252 2910 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_17510 5520 6815 gene locus_tag LOCUS_17520 5520 6815 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_17520 6833 7867 gene locus_tag LOCUS_17530 6833 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence155 1078 311 gene locus_tag LOCUS_17540 1078 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295303.1 protein_id gnl|my_center|LOCUS_17540 2057 1128 gene locus_tag LOCUS_17550 2057 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3121 2657 gene locus_tag LOCUS_17560 3121 2657 CDS product DUF3408 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007902100.1 protein_id gnl|my_center|LOCUS_17560 3575 3895 gene locus_tag LOCUS_17570 3575 3895 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295307.1 protein_id gnl|my_center|LOCUS_17570 3937 4248 gene locus_tag LOCUS_17580 3937 4248 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108660.1 protein_id gnl|my_center|LOCUS_17580 4769 4311 gene locus_tag LOCUS_17590 4769 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 6084 4747 gene locus_tag LOCUS_17600 6084 4747 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence156 870 4046 gene locus_tag LOCUS_17610 870 4046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_17610 4076 5650 gene locus_tag LOCUS_17620 4076 5650 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_17620 5965 6204 gene locus_tag LOCUS_17630 5965 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6201 6527 gene locus_tag LOCUS_17640 6201 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 7395 6646 gene locus_tag LOCUS_17650 7395 6646 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence157 <1 1507 gene locus_tag LOCUS_17660 <1 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:RagB/SusD family nutrient uptake outer membrane protein 1804 2952 gene locus_tag LOCUS_17670 gene fucO 1804 2952 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_17670 3028 5856 gene locus_tag LOCUS_17680 3028 5856 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence158 <1 805 gene locus_tag LOCUS_17690 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801462.1:6-bladed beta-propeller 1103 2173 gene locus_tag LOCUS_17700 1103 2173 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_17700 2182 5277 gene locus_tag LOCUS_17710 2182 5277 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_17710 5349 6776 gene locus_tag LOCUS_17720 5349 6776 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_17720 6980 6771 gene locus_tag LOCUS_17730 6980 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence159 609 277 gene locus_tag LOCUS_17740 609 277 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_17740 952 614 gene locus_tag LOCUS_17750 952 614 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555815.1 protein_id gnl|my_center|LOCUS_17750 1116 3590 gene locus_tag LOCUS_17760 1116 3590 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_17760 4188 3706 gene locus_tag LOCUS_17770 gene ybaK 4188 3706 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_17770 6317 4185 gene locus_tag LOCUS_17780 6317 4185 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_17780 <7727 6377 gene locus_tag LOCUS_17790 <7727 6377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003646423.1:ABC transporter ATP-binding protein >Feature sequence160 1432 167 gene locus_tag LOCUS_17800 1432 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2016 2933 gene locus_tag LOCUS_17810 2016 2933 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_17810 3144 3425 gene locus_tag LOCUS_17820 3144 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3422 4048 gene locus_tag LOCUS_17830 3422 4048 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_17830 5370 4282 gene locus_tag LOCUS_17840 5370 4282 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767707.1 protein_id gnl|my_center|LOCUS_17840 7145 5493 gene locus_tag LOCUS_17850 7145 5493 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203709.1 protein_id gnl|my_center|LOCUS_17850 <7717 7159 gene locus_tag LOCUS_17860 <7717 7159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761981.1:XRE family transcriptional regulator >Feature sequence161 531 1286 gene locus_tag LOCUS_17870 531 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1451 1633 gene locus_tag LOCUS_17880 1451 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3477 4586 gene locus_tag LOCUS_17890 3477 4586 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_17890 5310 6350 gene locus_tag LOCUS_17900 5310 6350 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence162 <1 1395 gene locus_tag LOCUS_17910 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775649.1:class I SAM-dependent DNA methyltransferase 1395 2948 gene locus_tag LOCUS_17920 1395 2948 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680807.1 protein_id gnl|my_center|LOCUS_17920 3802 2993 gene locus_tag LOCUS_17930 3802 2993 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_17930 4413 3844 gene locus_tag LOCUS_17940 4413 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5841 4444 gene locus_tag LOCUS_17950 5841 4444 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220768.1 protein_id gnl|my_center|LOCUS_17950 5938 7140 gene locus_tag LOCUS_17960 5938 7140 CDS product DUF6361 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804170.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence163 306 2477 gene locus_tag LOCUS_17970 306 2477 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795983.1 protein_id gnl|my_center|LOCUS_17970 2480 3325 gene locus_tag LOCUS_17980 gene lipA 2480 3325 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_17980 3730 4626 gene locus_tag LOCUS_17990 3730 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5282 6745 gene locus_tag LOCUS_18000 5282 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 7088 6810 gene locus_tag LOCUS_18010 gene vapD 7088 6810 CDS product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271050.1 protein_id gnl|my_center|LOCUS_18010 7280 7092 gene locus_tag LOCUS_18020 7280 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence164 6223 3626 gene locus_tag LOCUS_18030 6223 3626 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_18030 <7577 6272 gene locus_tag LOCUS_18040 <7577 6272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766199.1:transcription-repair coupling factor >Feature sequence165 714 1307 gene locus_tag LOCUS_18050 714 1307 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_18050 1351 1569 gene locus_tag LOCUS_18060 1351 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1649 2305 gene locus_tag LOCUS_18070 gene rpe 1649 2305 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_18070 2502 3632 gene locus_tag LOCUS_18080 2502 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3683 4735 gene locus_tag LOCUS_18090 3683 4735 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_18090 4789 5376 gene locus_tag LOCUS_18100 4789 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5402 6793 gene locus_tag LOCUS_18110 gene glmM 5402 6793 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_18110 <7551 6883 gene locus_tag LOCUS_18120 <7551 6883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108297.1:FAD-dependent oxidoreductase >Feature sequence166 260 622 gene locus_tag LOCUS_18130 260 622 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_18130 626 2140 gene locus_tag LOCUS_18140 626 2140 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_18140 3472 2360 gene locus_tag LOCUS_18150 3472 2360 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_18150 4181 3618 gene locus_tag LOCUS_18160 4181 3618 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_18160 6048 4498 gene locus_tag LOCUS_18170 6048 4498 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_18170 6248 7318 gene locus_tag LOCUS_18180 6248 7318 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925117.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence167 294 3443 gene locus_tag LOCUS_18190 294 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3491 4114 gene locus_tag LOCUS_18200 3491 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4114 5223 gene locus_tag LOCUS_18210 4114 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5225 5905 gene locus_tag LOCUS_18220 5225 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5938 6921 gene locus_tag LOCUS_18230 5938 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence168 445 206 gene locus_tag LOCUS_18240 445 206 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009009556.1 protein_id gnl|my_center|LOCUS_18240 863 435 gene locus_tag LOCUS_18250 863 435 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003061815.1 protein_id gnl|my_center|LOCUS_18250 1790 1170 gene locus_tag LOCUS_18260 1790 1170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571330.1 protein_id gnl|my_center|LOCUS_18260 2881 1838 gene locus_tag LOCUS_18270 2881 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4250 3909 gene locus_tag LOCUS_18280 4250 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5529 5831 gene locus_tag LOCUS_18290 5529 5831 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_18290 5899 6468 gene locus_tag LOCUS_18300 5899 6468 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_18300 6465 7130 gene locus_tag LOCUS_18310 6465 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence169 1524 571 gene locus_tag LOCUS_18320 gene ftsY 1524 571 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_18320 3947 1587 gene locus_tag LOCUS_18330 3947 1587 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_18330 4069 4878 gene locus_tag LOCUS_18340 gene ispE 4069 4878 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_18340 4999 5232 gene locus_tag LOCUS_18350 4999 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5219 6067 gene locus_tag LOCUS_18360 5219 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 6082 6768 gene locus_tag LOCUS_18370 6082 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6874 7092 gene locus_tag LOCUS_18380 6874 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence170 <1 623 gene locus_tag LOCUS_18390 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790476.1:Xaa-Pro peptidase family protein 641 2341 gene locus_tag LOCUS_18400 641 2341 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074555177.1 protein_id gnl|my_center|LOCUS_18400 2440 3300 gene locus_tag LOCUS_18410 2440 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3569 4762 gene locus_tag LOCUS_18420 gene trpB 3569 4762 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_18420 4767 6170 gene locus_tag LOCUS_18430 4767 6170 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_18430 6477 7043 gene locus_tag LOCUS_18440 6477 7043 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence171 2600 621 gene locus_tag LOCUS_18450 2600 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3670 2723 gene locus_tag LOCUS_18460 3670 2723 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_18460 3827 5152 gene locus_tag LOCUS_18470 3827 5152 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence172 3766 1580 gene locus_tag LOCUS_18480 3766 1580 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_18480 5173 3809 gene locus_tag LOCUS_18490 5173 3809 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_18490 <7385 5502 gene locus_tag LOCUS_18500 <7385 5502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201991.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence173 233 922 gene locus_tag LOCUS_18510 233 922 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_18510 924 2237 gene locus_tag LOCUS_18520 924 2237 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_18520 2249 2947 gene locus_tag LOCUS_18530 2249 2947 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_18530 2981 3799 gene locus_tag LOCUS_18540 2981 3799 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_18540 3796 4365 gene locus_tag LOCUS_18550 3796 4365 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_18550 4456 5478 gene locus_tag LOCUS_18560 4456 5478 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_18560 5501 6268 gene locus_tag LOCUS_18570 5501 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence174 1567 1064 gene locus_tag LOCUS_18580 1567 1064 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763441.1 protein_id gnl|my_center|LOCUS_18580 2410 1742 gene locus_tag LOCUS_18590 2410 1742 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_18590 2481 4754 gene locus_tag LOCUS_18600 2481 4754 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107617.1 protein_id gnl|my_center|LOCUS_18600 4762 5517 gene locus_tag LOCUS_18610 gene kdsB 4762 5517 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_18610 5715 6788 gene locus_tag LOCUS_18620 5715 6788 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764608.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence175 <1 846 gene locus_tag LOCUS_18630 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193449.1:glycosyltransferase family 39 protein 889 1839 gene locus_tag LOCUS_18640 889 1839 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_18640 1845 3206 gene locus_tag LOCUS_18650 1845 3206 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_18650 3556 4407 gene locus_tag LOCUS_18660 gene hisG 3556 4407 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_18660 4419 5699 gene locus_tag LOCUS_18670 gene hisD 4419 5699 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_18670 5696 6742 gene locus_tag LOCUS_18680 gene hisC 5696 6742 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence176 <1 1982 gene locus_tag LOCUS_18690 <1 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203621.1:TonB-dependent receptor 2008 3594 gene locus_tag LOCUS_18700 2008 3594 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_18700 3770 7078 gene locus_tag LOCUS_18710 3770 7078 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence177 2275 248 gene locus_tag LOCUS_18720 2275 248 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_18720 2463 3464 gene locus_tag LOCUS_18730 2463 3464 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_18730 3709 7044 gene locus_tag LOCUS_18740 3709 7044 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence178 220 699 gene locus_tag LOCUS_18750 220 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 930 1421 gene locus_tag LOCUS_18760 gene folK 930 1421 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_18760 1625 2917 gene locus_tag LOCUS_18770 1625 2917 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021591.1 protein_id gnl|my_center|LOCUS_18770 2917 3267 gene locus_tag LOCUS_18780 2917 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3463 3732 gene locus_tag LOCUS_18790 3463 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3824 5179 gene locus_tag LOCUS_18800 3824 5179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_18800 5195 5788 gene locus_tag LOCUS_18810 5195 5788 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_18810 5792 6493 gene locus_tag LOCUS_18820 5792 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 6498 6737 gene locus_tag LOCUS_18830 6498 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence179 4467 1372 gene locus_tag LOCUS_18840 4467 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5530 4472 gene locus_tag LOCUS_18850 5530 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 6138 5545 gene locus_tag LOCUS_18860 6138 5545 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_18860 <7151 6143 gene locus_tag LOCUS_18870 <7151 6143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942726.1:D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase >Feature sequence180 110 1591 gene locus_tag LOCUS_18880 110 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1588 2265 gene locus_tag LOCUS_18890 1588 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2267 4012 gene locus_tag LOCUS_18900 2267 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4017 6428 gene locus_tag LOCUS_18910 4017 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence181 <1 3663 gene locus_tag LOCUS_18920 <1 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107519.1:translocation/assembly module TamB domain-containing protein 3803 5011 gene locus_tag LOCUS_18930 3803 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_18930 5127 5726 gene locus_tag LOCUS_18940 5127 5726 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_18940 6261 5734 gene locus_tag LOCUS_18950 6261 5734 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_18950 <7098 6269 gene locus_tag LOCUS_18960 <7098 6269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256941.1:glycosyltransferase family 2 protein >Feature sequence182 148 1449 gene locus_tag LOCUS_18970 148 1449 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_18970 1471 1896 gene locus_tag LOCUS_18980 1471 1896 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_18980 1966 2775 gene locus_tag LOCUS_18990 gene bamD 1966 2775 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_18990 2800 3132 gene locus_tag LOCUS_19000 2800 3132 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_19000 3288 3752 gene locus_tag LOCUS_19010 3288 3752 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_19010 6257 3888 gene locus_tag LOCUS_19020 6257 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 <7096 6261 gene locus_tag LOCUS_19030 <7096 6261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase >Feature sequence183 150 1235 gene locus_tag LOCUS_19040 150 1235 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_19040 2605 1292 gene locus_tag LOCUS_19050 gene der 2605 1292 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_19050 3584 2691 gene locus_tag LOCUS_19060 gene era 3584 2691 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_19060 4569 3565 gene locus_tag LOCUS_19070 4569 3565 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_19070 4856 4671 gene locus_tag LOCUS_19080 gene rpmF 4856 4671 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_19080 5445 4870 gene locus_tag LOCUS_19090 5445 4870 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_19090 6713 5556 gene locus_tag LOCUS_19100 6713 5556 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence184 1102 668 gene locus_tag LOCUS_19110 gene dut 1102 668 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_19110 1329 4007 gene locus_tag LOCUS_19120 1329 4007 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_19120 4064 5371 gene locus_tag LOCUS_19130 4064 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6573 5455 gene locus_tag LOCUS_19140 6573 5455 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence185 1 567 gene locus_tag LOCUS_19150 1 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1586 612 gene locus_tag LOCUS_19160 gene fmt 1586 612 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109030.1 protein_id gnl|my_center|LOCUS_19160 3383 1593 gene locus_tag LOCUS_19170 3383 1593 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_19170 4790 3387 gene locus_tag LOCUS_19180 4790 3387 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_19180 5365 4796 gene locus_tag LOCUS_19190 5365 4796 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence186 <1 1381 gene locus_tag LOCUS_19200 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783975.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1497 2039 gene locus_tag LOCUS_19210 1497 2039 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_19210 2036 2638 gene locus_tag LOCUS_19220 2036 2638 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_19220 2622 3746 gene locus_tag LOCUS_19230 gene mtnA 2622 3746 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_19230 3771 6047 gene locus_tag LOCUS_19240 3771 6047 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence187 563 147 gene locus_tag LOCUS_19250 563 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 781 560 gene locus_tag LOCUS_19260 781 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2062 893 gene locus_tag LOCUS_19270 gene uxuA 2062 893 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_19270 2893 2084 gene locus_tag LOCUS_19280 2893 2084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_19280 4605 3169 gene locus_tag LOCUS_19290 4605 3169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769494.1 protein_id gnl|my_center|LOCUS_19290 5310 4639 gene locus_tag LOCUS_19300 5310 4639 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_19300 6369 5329 gene locus_tag LOCUS_19310 6369 5329 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_19310 <6938 6388 gene locus_tag LOCUS_19320 <6938 6388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765680.1:glucuronate isomerase >Feature sequence188 1500 481 gene locus_tag LOCUS_19330 1500 481 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_19330 2499 1513 gene locus_tag LOCUS_19340 2499 1513 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_19340 3517 2501 gene locus_tag LOCUS_19350 3517 2501 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_19350 4395 3526 gene locus_tag LOCUS_19360 4395 3526 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_19360 5478 4483 gene locus_tag LOCUS_19370 5478 4483 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_19370 5674 5489 gene locus_tag LOCUS_19380 5674 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 <6923 6010 gene locus_tag LOCUS_19390 <6923 6010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788084.1:Na+/H+ antiporter NhaA >Feature sequence189 1520 492 gene locus_tag LOCUS_19400 1520 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5345 1524 gene locus_tag LOCUS_19410 5345 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5947 5390 gene locus_tag LOCUS_19420 5947 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 <6922 6311 gene locus_tag LOCUS_19430 <6922 6311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_220818393.1:IS630 family transposase >Feature sequence190 45 842 gene locus_tag LOCUS_19440 45 842 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_19440 832 1746 gene locus_tag LOCUS_19450 832 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1746 2096 gene locus_tag LOCUS_19460 1746 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2170 3225 gene locus_tag LOCUS_19470 2170 3225 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_19470 3235 3528 gene locus_tag LOCUS_19480 3235 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3547 3984 gene locus_tag LOCUS_19490 3547 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4137 4400 gene locus_tag LOCUS_19500 4137 4400 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_19500 4393 4695 gene locus_tag LOCUS_19510 4393 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 5274 5570 gene locus_tag LOCUS_19520 5274 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 5669 6166 gene locus_tag LOCUS_19530 5669 6166 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_19530 6253 6876 gene locus_tag LOCUS_19540 6253 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence191 107 727 gene locus_tag LOCUS_19550 107 727 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_19550 1758 802 gene locus_tag LOCUS_19560 1758 802 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_19560 3436 1775 gene locus_tag LOCUS_19570 3436 1775 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_19570 4002 3448 gene locus_tag LOCUS_19580 4002 3448 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784392.1 protein_id gnl|my_center|LOCUS_19580 4471 4154 gene locus_tag LOCUS_19590 4471 4154 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_19590 <6870 4936 gene locus_tag LOCUS_19600 <6870 4936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804126.1:DNA-directed RNA polymerase subunit beta' >Feature sequence192 1923 784 gene locus_tag LOCUS_19610 gene wecB 1923 784 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_19610 2821 2006 gene locus_tag LOCUS_19620 2821 2006 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836406.1 protein_id gnl|my_center|LOCUS_19620 3993 2833 gene locus_tag LOCUS_19630 3993 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5238 4189 gene locus_tag LOCUS_19640 5238 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 6793 5240 gene locus_tag LOCUS_19650 6793 5240 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence193 1997 729 gene locus_tag LOCUS_19660 1997 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2792 2010 gene locus_tag LOCUS_19670 2792 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4675 2885 gene locus_tag LOCUS_19680 4675 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4982 4707 gene locus_tag LOCUS_19690 4982 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <6856 5384 gene locus_tag LOCUS_19700 <6856 5384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399407.1:alpha-amylase family glycosyl hydrolase >Feature sequence194 <1 1134 gene locus_tag LOCUS_19710 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010536410.1:L-rhamnose isomerase 1137 2159 gene locus_tag LOCUS_19720 gene rhaT 1137 2159 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_19720 2338 3111 gene locus_tag LOCUS_19730 gene rhaD 2338 3111 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_19730 3124 4872 gene locus_tag LOCUS_19740 3124 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence195 2 349 gene locus_tag LOCUS_19750 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1843 575 gene locus_tag LOCUS_19760 1843 575 CDS product DUF3874 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766174.1 protein_id gnl|my_center|LOCUS_19760 2216 4621 gene locus_tag LOCUS_19770 2216 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 4642 6627 gene locus_tag LOCUS_19780 4642 6627 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence196 359 2590 gene locus_tag LOCUS_19790 359 2590 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107975.1 protein_id gnl|my_center|LOCUS_19790 3630 2677 gene locus_tag LOCUS_19800 gene trxB 3630 2677 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_19800 4312 3662 gene locus_tag LOCUS_19810 4312 3662 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_19810 6136 4382 gene locus_tag LOCUS_19820 6136 4382 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555717.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence197 1 633 gene locus_tag LOCUS_19830 1 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 960 2423 gene locus_tag LOCUS_19840 960 2423 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_19840 2395 3078 gene locus_tag LOCUS_19850 2395 3078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_19850 4517 3090 gene locus_tag LOCUS_19860 4517 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 5209 4652 gene locus_tag LOCUS_19870 5209 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 6516 5206 gene locus_tag LOCUS_19880 6516 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence198 16 1290 gene locus_tag LOCUS_19890 16 1290 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_19890 1292 2677 gene locus_tag LOCUS_19900 1292 2677 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_19900 2706 3629 gene locus_tag LOCUS_19910 gene kduI 2706 3629 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_19910 3727 5205 gene locus_tag LOCUS_19920 3727 5205 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_19920 5533 6063 gene locus_tag LOCUS_19930 5533 6063 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence199 441 1901 gene locus_tag LOCUS_19940 441 1901 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108551.1 protein_id gnl|my_center|LOCUS_19940 2276 1995 gene locus_tag LOCUS_19950 2276 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3164 2448 gene locus_tag LOCUS_19960 3164 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 3611 4039 gene locus_tag LOCUS_19970 3611 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 4138 5289 gene locus_tag LOCUS_19980 4138 5289 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203014.1 protein_id gnl|my_center|LOCUS_19980 5374 6315 gene locus_tag LOCUS_19990 5374 6315 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310189.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence200 1567 533 gene locus_tag LOCUS_20000 1567 533 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795587.1 protein_id gnl|my_center|LOCUS_20000 2175 1711 gene locus_tag LOCUS_20010 2175 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2403 2331 gene locus_tag LOCUS_t00310 2403 2331 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2650 3207 gene locus_tag LOCUS_20020 gene rfbC 2650 3207 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787720.1 protein_id gnl|my_center|LOCUS_20020 3220 4365 gene locus_tag LOCUS_20030 gene rfbB 3220 4365 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_20030 4378 5265 gene locus_tag LOCUS_20040 4378 5265 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_20040 5371 6417 gene locus_tag LOCUS_20050 5371 6417 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence201 405 1178 gene locus_tag LOCUS_20060 405 1178 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_20060 1182 1883 gene locus_tag LOCUS_20070 1182 1883 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_20070 2081 2353 gene locus_tag LOCUS_20080 2081 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761566.1 protein_id gnl|my_center|LOCUS_20080 2551 3669 gene locus_tag LOCUS_20090 2551 3669 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_20090 3906 4304 gene locus_tag LOCUS_20100 3906 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4301 4957 gene locus_tag LOCUS_20110 4301 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5098 5349 gene locus_tag LOCUS_20120 5098 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5346 5858 gene locus_tag LOCUS_20130 5346 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence202 1660 728 gene locus_tag LOCUS_20140 1660 728 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_20140 2072 1674 gene locus_tag LOCUS_20150 2072 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4930 2063 gene locus_tag LOCUS_20160 4930 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 5790 4951 gene locus_tag LOCUS_20170 5790 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence203 2169 502 gene locus_tag LOCUS_20180 2169 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2260 2063 gene locus_tag LOCUS_20190 2260 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2329 3540 gene locus_tag LOCUS_20200 gene hflX 2329 3540 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_20200 3577 4158 gene locus_tag LOCUS_20210 3577 4158 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_20210 4165 5025 gene locus_tag LOCUS_20220 4165 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5120 5884 gene locus_tag LOCUS_20230 5120 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence204 916 233 gene locus_tag LOCUS_20240 916 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1858 944 gene locus_tag LOCUS_20250 1858 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5248 2093 gene locus_tag LOCUS_20260 5248 2093 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence205 2545 134 gene locus_tag LOCUS_20270 2545 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5359 2591 gene locus_tag LOCUS_20280 gene polA 5359 2591 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence206 <1 2266 gene locus_tag LOCUS_20290 <1 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766599.1:glycoside hydrolase family 38 C-terminal domain-containing protein 2272 4896 gene locus_tag LOCUS_20300 2272 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence207 <1 2154 gene locus_tag LOCUS_20310 <1 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921395.1:S9 family peptidase 2186 3001 gene locus_tag LOCUS_20320 2186 3001 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20320 4820 3027 gene locus_tag LOCUS_20330 4820 3027 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_20330 4975 5817 gene locus_tag LOCUS_20340 4975 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence208 936 1691 gene locus_tag LOCUS_20350 936 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1797 2363 gene locus_tag LOCUS_20360 1797 2363 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759987.1 protein_id gnl|my_center|LOCUS_20360 2461 3735 gene locus_tag LOCUS_20370 gene serS 2461 3735 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_20370 5928 3853 gene locus_tag LOCUS_20380 5928 3853 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence209 3598 1487 gene locus_tag LOCUS_20390 3598 1487 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_20390 3692 3997 gene locus_tag LOCUS_20400 3692 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3998 4333 gene locus_tag LOCUS_20410 3998 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4993 4532 gene locus_tag LOCUS_20420 4993 4532 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_20420 5644 5057 gene locus_tag LOCUS_20430 gene coaE 5644 5057 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence210 1633 1205 gene locus_tag LOCUS_20440 1633 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039966.1 protein_id gnl|my_center|LOCUS_20440 2158 1688 gene locus_tag LOCUS_20450 gene upgY 2158 1688 CDS product capsular polysaccharide transcription antiterminator UpgY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784914.1 protein_id gnl|my_center|LOCUS_20450 <6252 3432 gene locus_tag LOCUS_20460 <6252 3432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein >Feature sequence211 1849 413 gene locus_tag LOCUS_20470 gene aldA 1849 413 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225842.1 protein_id gnl|my_center|LOCUS_20470 3675 1966 gene locus_tag LOCUS_20480 3675 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4901 3861 gene locus_tag LOCUS_20490 gene galE 4901 3861 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_20490 5495 4920 gene locus_tag LOCUS_20500 gene rsxA 5495 4920 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_20500 6092 5508 gene locus_tag LOCUS_20510 6092 5508 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence212 2907 526 gene locus_tag LOCUS_20520 2907 526 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_20520 3951 3010 gene locus_tag LOCUS_20530 3951 3010 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_20530 >Feature sequence213 4827 2092 gene locus_tag LOCUS_20540 4827 2092 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_20540 <6204 5142 gene locus_tag LOCUS_20550 <6204 5142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202205.1:DUF5107 domain-containing protein >Feature sequence214 2159 1065 gene locus_tag LOCUS_20560 2159 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3916 2165 gene locus_tag LOCUS_20570 3916 2165 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_20570 5216 3930 gene locus_tag LOCUS_20580 5216 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence215 4298 1077 gene locus_tag LOCUS_20590 4298 1077 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_20590 <6159 4649 gene locus_tag LOCUS_20600 <6159 4649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase >Feature sequence216 <1 531 gene locus_tag LOCUS_20610 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783769.1:S26 family signal peptidase 570 1199 gene locus_tag LOCUS_20620 570 1199 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_20620 1673 2956 gene locus_tag LOCUS_20630 1673 2956 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_20630 5355 3097 gene locus_tag LOCUS_20640 5355 3097 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_20640 <6158 5603 gene locus_tag LOCUS_20650 <6158 5603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201924.1:alpha-galactosidase >Feature sequence217 4283 669 gene locus_tag LOCUS_20660 4283 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4672 4346 gene locus_tag LOCUS_20670 4672 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 <6155 4692 gene locus_tag LOCUS_20680 <6155 4692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022338.1:protease Lon-related BREX system protein BrxL >Feature sequence218 89 490 gene locus_tag LOCUS_20690 89 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 493 1206 gene locus_tag LOCUS_20700 493 1206 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_20700 1248 1661 gene locus_tag LOCUS_20710 1248 1661 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_20710 1675 2643 gene locus_tag LOCUS_20720 1675 2643 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_20720 3334 4404 gene locus_tag LOCUS_20730 3334 4404 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933236.1 protein_id gnl|my_center|LOCUS_20730 4412 5476 gene locus_tag LOCUS_20740 4412 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence219 2473 608 gene locus_tag LOCUS_20750 gene mrdA 2473 608 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_20750 2981 2463 gene locus_tag LOCUS_20760 gene mreD 2981 2463 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_20760 3828 2971 gene locus_tag LOCUS_20770 gene mreC 3828 2971 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_20770 4910 3891 gene locus_tag LOCUS_20780 4910 3891 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_20780 <6083 4942 gene locus_tag LOCUS_20790 <6083 4942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792044.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence220 2773 1238 gene locus_tag LOCUS_20800 2773 1238 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_20800 <6041 2948 gene locus_tag LOCUS_20810 <6041 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616105.1:DUF1080 domain-containing protein >Feature sequence221 2578 239 gene locus_tag LOCUS_20820 2578 239 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_20820 2974 3798 gene locus_tag LOCUS_20830 2974 3798 CDS product IS5-like element ISMac11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020489.1 protein_id gnl|my_center|LOCUS_20830 4594 4082 gene locus_tag LOCUS_20840 4594 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20840 <6015 5005 gene locus_tag LOCUS_20850 <6015 5005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764307.1:GH92 family glycosyl hydrolase >Feature sequence222 653 1627 gene locus_tag LOCUS_20860 653 1627 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_20860 4423 1745 gene locus_tag LOCUS_20870 4423 1745 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_20870 4677 5240 gene locus_tag LOCUS_20880 4677 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence223 832 1944 gene locus_tag LOCUS_20890 832 1944 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_20890 2053 2472 gene locus_tag LOCUS_20900 2053 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2479 3432 gene locus_tag LOCUS_20910 2479 3432 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_20910 3445 4776 gene locus_tag LOCUS_20920 gene rsxC 3445 4776 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_20920 4787 5755 gene locus_tag LOCUS_20930 4787 5755 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence224 365 1177 gene locus_tag LOCUS_20940 gene nagB 365 1177 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_20940 1321 2505 gene locus_tag LOCUS_20950 1321 2505 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_20950 3641 2526 gene locus_tag LOCUS_20960 3641 2526 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_20960 4030 4626 gene locus_tag LOCUS_20970 4030 4626 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761745.1 protein_id gnl|my_center|LOCUS_20970 5170 4667 gene locus_tag LOCUS_20980 5170 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5325 5164 gene locus_tag LOCUS_20990 5325 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 <5958 5449 gene locus_tag LOCUS_21000 <5958 5449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986486.1:MATE family efflux transporter >Feature sequence225 1750 566 gene locus_tag LOCUS_21010 1750 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2588 2214 gene locus_tag LOCUS_21020 2588 2214 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_21020 4246 2807 gene locus_tag LOCUS_21030 4246 2807 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947536.1 protein_id gnl|my_center|LOCUS_21030 4499 5179 gene locus_tag LOCUS_21040 gene queC 4499 5179 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786207.1 protein_id gnl|my_center|LOCUS_21040 5172 5645 gene locus_tag LOCUS_21050 gene queF 5172 5645 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_21050 5929 5741 gene locus_tag LOCUS_21060 5929 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence226 <1 625 gene locus_tag LOCUS_21070 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793658.1:PcfJ domain-containing protein 610 876 gene locus_tag LOCUS_21080 610 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1444 965 gene locus_tag LOCUS_21090 1444 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2664 1456 gene locus_tag LOCUS_21100 2664 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3238 2864 gene locus_tag LOCUS_21110 3238 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3899 3330 gene locus_tag LOCUS_21120 3899 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4831 3899 gene locus_tag LOCUS_21130 gene traN 4831 3899 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485412.1 protein_id gnl|my_center|LOCUS_21130 <5891 4851 gene locus_tag LOCUS_21140 <5891 4851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107098.1:conjugative transposon protein TraM >Feature sequence227 266 901 gene locus_tag LOCUS_21150 266 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_21150 977 1795 gene locus_tag LOCUS_21160 977 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2193 3980 gene locus_tag LOCUS_21170 gene lepA 2193 3980 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_21170 5797 4076 gene locus_tag LOCUS_21180 5797 4076 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence228 1754 534 gene locus_tag LOCUS_21190 1754 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2285 1986 gene locus_tag LOCUS_21200 2285 1986 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_21200 2755 2381 gene locus_tag LOCUS_21210 gene secG 2755 2381 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_21210 3523 2765 gene locus_tag LOCUS_21220 3523 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_21220 4047 3535 gene locus_tag LOCUS_21230 4047 3535 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_21230 5232 4051 gene locus_tag LOCUS_21240 5232 4051 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_21240 <5832 5329 gene locus_tag LOCUS_21250 <5832 5329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531975.1:GNAT family N-acetyltransferase >Feature sequence229 939 268 gene locus_tag LOCUS_21260 939 268 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228783.1 protein_id gnl|my_center|LOCUS_21260 1259 2326 gene locus_tag LOCUS_21270 1259 2326 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214286.1 protein_id gnl|my_center|LOCUS_21270 2357 4303 gene locus_tag LOCUS_21280 2357 4303 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_21280 4303 5517 gene locus_tag LOCUS_21290 4303 5517 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122999.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence230 516 1106 gene locus_tag LOCUS_21300 516 1106 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109391.1 protein_id gnl|my_center|LOCUS_21300 1142 2083 gene locus_tag LOCUS_21310 1142 2083 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766780.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence231 940 704 gene locus_tag LOCUS_21320 940 704 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_21320 1094 1666 gene locus_tag LOCUS_21330 gene purN 1094 1666 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_21330 2057 1650 gene locus_tag LOCUS_21340 2057 1650 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767551.1 protein_id gnl|my_center|LOCUS_21340 3620 2139 gene locus_tag LOCUS_21350 gene cysS 3620 2139 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_21350 4122 3697 gene locus_tag LOCUS_21360 4122 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4399 4100 gene locus_tag LOCUS_21370 4399 4100 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767829.1 protein_id gnl|my_center|LOCUS_21370 5472 4771 gene locus_tag LOCUS_21380 5472 4771 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence232 <1 621 gene locus_tag LOCUS_21390 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764094.1:glutamine-hydrolyzing GMP synthase 1270 767 gene locus_tag LOCUS_21400 1270 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1503 1267 gene locus_tag LOCUS_21410 1503 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 3365 1614 gene locus_tag LOCUS_21420 3365 1614 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_21420 3400 4215 gene locus_tag LOCUS_21430 3400 4215 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_21430 4218 4616 gene locus_tag LOCUS_21440 4218 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 5581 4652 gene locus_tag LOCUS_21450 5581 4652 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence233 3 1238 gene locus_tag LOCUS_21460 3 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1942 1280 gene locus_tag LOCUS_21470 gene ung 1942 1280 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_21470 3039 2002 gene locus_tag LOCUS_21480 gene asnA 3039 2002 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_21480 3242 3316 gene locus_tag LOCUS_t00320 3242 3316 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3409 4209 gene locus_tag LOCUS_21490 3409 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4240 5379 gene locus_tag LOCUS_21500 4240 5379 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence234 <1 997 gene locus_tag LOCUS_21510 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202073.1:cofactor-independent phosphoglycerate mutase 1000 2310 gene locus_tag LOCUS_21520 gene thrC 1000 2310 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_21520 3176 2502 gene locus_tag LOCUS_21530 3176 2502 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_21530 4004 3258 gene locus_tag LOCUS_21540 gene fabG 4004 3258 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_21540 4971 4027 gene locus_tag LOCUS_21550 4971 4027 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117506.1 protein_id gnl|my_center|LOCUS_21550 5548 4982 gene locus_tag LOCUS_21560 5548 4982 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence235 3948 868 gene locus_tag LOCUS_21570 3948 868 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107268.1 protein_id gnl|my_center|LOCUS_21570 4605 4907 gene locus_tag LOCUS_21580 4605 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21580 >Feature sequence236 267 533 gene locus_tag LOCUS_21590 gene rpmA 267 533 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_21590 1186 4245 gene locus_tag LOCUS_21600 1186 4245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence237 177 2813 gene locus_tag LOCUS_21610 177 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2901 4889 gene locus_tag LOCUS_21620 2901 4889 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547409.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence238 <1 546 gene locus_tag LOCUS_21630 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790215.1:MATE family efflux transporter 714 2042 gene locus_tag LOCUS_21640 714 2042 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_21640 3577 2123 gene locus_tag LOCUS_21650 3577 2123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202063.1 protein_id gnl|my_center|LOCUS_21650 4716 3589 gene locus_tag LOCUS_21660 4716 3589 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_21660 <5730 4788 gene locus_tag LOCUS_21670 <5730 4788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769710.1:TrkH family potassium uptake protein >Feature sequence239 <1 1615 gene locus_tag LOCUS_21680 <1 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109052.1:GH92 family glycosyl hydrolase 1757 4033 gene locus_tag LOCUS_21690 1757 4033 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107968.1 protein_id gnl|my_center|LOCUS_21690 4253 5521 gene locus_tag LOCUS_21700 4253 5521 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence240 1967 471 gene locus_tag LOCUS_21710 1967 471 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_21710 4142 2388 gene locus_tag LOCUS_21720 4142 2388 CDS product DUF3858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203668.1 protein_id gnl|my_center|LOCUS_21720 <5661 4160 gene locus_tag LOCUS_21730 <5661 4160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108263.1:DUF3857 and transglutaminase domain-containing protein >Feature sequence241 83 580 gene locus_tag LOCUS_21740 gene ssb 83 580 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107825.1 protein_id gnl|my_center|LOCUS_21740 606 1943 gene locus_tag LOCUS_21750 606 1943 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_21750 1972 2514 gene locus_tag LOCUS_21760 1972 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2558 3142 gene locus_tag LOCUS_21770 2558 3142 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_21770 3887 3144 gene locus_tag LOCUS_21780 3887 3144 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_21780 4641 3901 gene locus_tag LOCUS_21790 gene ubiE 4641 3901 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_21790 5604 4654 gene locus_tag LOCUS_21800 5604 4654 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence242 1211 534 gene locus_tag LOCUS_21810 1211 534 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_21810 1809 1213 gene locus_tag LOCUS_21820 gene hisIE 1809 1213 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_21820 2581 1826 gene locus_tag LOCUS_21830 gene hisF 2581 1826 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_21830 3319 2597 gene locus_tag LOCUS_21840 gene hisA 3319 2597 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_21840 3914 3324 gene locus_tag LOCUS_21850 gene hisH 3914 3324 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_21850 4288 4896 gene locus_tag LOCUS_21860 4288 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence243 400 1293 gene locus_tag LOCUS_21870 gene dapA 400 1293 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_21870 1483 2805 gene locus_tag LOCUS_21880 1483 2805 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202958.1 protein_id gnl|my_center|LOCUS_21880 2958 3032 gene locus_tag LOCUS_t00330 2958 3032 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3067 3141 gene locus_tag LOCUS_t00340 3067 3141 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence244 1867 530 gene locus_tag LOCUS_21890 1867 530 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_21890 2064 2471 gene locus_tag LOCUS_21900 2064 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2832 2458 gene locus_tag LOCUS_21910 gene rplL 2832 2458 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_21910 3408 2908 gene locus_tag LOCUS_21920 gene rplJ 3408 2908 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_21920 4548 3853 gene locus_tag LOCUS_21930 gene rplA 4548 3853 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_21930 5133 4708 gene locus_tag LOCUS_21940 gene rplK 5133 4708 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence245 1913 813 gene locus_tag LOCUS_21950 gene lpxK 1913 813 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_21950 2898 1960 gene locus_tag LOCUS_21960 2898 1960 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_21960 4325 2895 gene locus_tag LOCUS_21970 4325 2895 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_21970 5416 4370 gene locus_tag LOCUS_21980 5416 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence246 2784 1342 gene locus_tag LOCUS_21990 2784 1342 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_21990 <5534 2822 gene locus_tag LOCUS_22000 <5534 2822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107318.1:glutamate synthase large subunit >Feature sequence247 1419 247 gene locus_tag LOCUS_22010 1419 247 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_22010 1580 2950 gene locus_tag LOCUS_22020 1580 2950 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_22020 <5511 3047 gene locus_tag LOCUS_22030 <5511 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704406.1:methionine synthase >Feature sequence248 1 1032 gene locus_tag LOCUS_22040 1 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1150 1986 gene locus_tag LOCUS_22050 1150 1986 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_22050 2674 1973 gene locus_tag LOCUS_22060 2674 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2823 2993 gene locus_tag LOCUS_22070 2823 2993 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_22070 3482 3105 gene locus_tag LOCUS_22080 3482 3105 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_22080 3767 4693 gene locus_tag LOCUS_22090 gene nusB 3767 4693 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_22090 4755 5066 gene locus_tag LOCUS_22100 gene yajC 4755 5066 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence249 55 3084 gene locus_tag LOCUS_22110 55 3084 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_22110 3101 4807 gene locus_tag LOCUS_22120 3101 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence250 943 251 gene locus_tag LOCUS_22130 943 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2400 946 gene locus_tag LOCUS_22140 2400 946 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_22140 2627 3490 gene locus_tag LOCUS_22150 2627 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 3393 4070 gene locus_tag LOCUS_22160 3393 4070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_22160 4134 5060 gene locus_tag LOCUS_22170 4134 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence251 <1 1591 gene locus_tag LOCUS_22180 <1 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107420.1:outer membrane beta-barrel family protein 1626 2945 gene locus_tag LOCUS_22190 1626 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence252 <1 2110 gene locus_tag LOCUS_22200 <1 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203588.1:translocation/assembly module TamB domain-containing protein 2100 4418 gene locus_tag LOCUS_22210 2100 4418 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_22210 <5428 4502 gene locus_tag LOCUS_22220 <5428 4502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813548.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence253 1472 465 gene locus_tag LOCUS_22230 1472 465 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_22230 2102 1479 gene locus_tag LOCUS_22240 2102 1479 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_22240 2843 2106 gene locus_tag LOCUS_22250 2843 2106 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_22250 4498 2852 gene locus_tag LOCUS_22260 4498 2852 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_22260 5403 4597 gene locus_tag LOCUS_22270 5403 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence254 3809 858 gene locus_tag LOCUS_22280 3809 858 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence255 806 1006 gene locus_tag LOCUS_22290 806 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1012 1836 gene locus_tag LOCUS_22300 gene tatC 1012 1836 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_22300 2184 2768 gene locus_tag LOCUS_22310 2184 2768 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107770.1 protein_id gnl|my_center|LOCUS_22310 2824 5034 gene locus_tag LOCUS_22320 2824 5034 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence256 34 1347 gene locus_tag LOCUS_22330 34 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1404 4094 gene locus_tag LOCUS_22340 1404 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 4898 5242 gene locus_tag LOCUS_22350 4898 5242 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323231.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence257 1833 445 gene locus_tag LOCUS_22360 1833 445 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_22360 3378 2353 gene locus_tag LOCUS_22370 3378 2353 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_22370 4919 4683 gene locus_tag LOCUS_22380 4919 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5289 4978 gene locus_tag LOCUS_22390 5289 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence258 1754 309 gene locus_tag LOCUS_22400 gene sufB 1754 309 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_22400 2276 1785 gene locus_tag LOCUS_22410 2276 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5163 2281 gene locus_tag LOCUS_22420 gene infB 5163 2281 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence259 1910 279 gene locus_tag LOCUS_22430 gene pruA 1910 279 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_22430 2689 5130 gene locus_tag LOCUS_22440 gene thrA 2689 5130 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence260 232 1893 gene locus_tag LOCUS_22450 gene menD 232 1893 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_22450 1907 2953 gene locus_tag LOCUS_22460 1907 2953 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_22460 3448 2936 gene locus_tag LOCUS_22470 3448 2936 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763953.1 protein_id gnl|my_center|LOCUS_22470 5111 3729 gene locus_tag LOCUS_22480 5111 3729 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence261 175 657 gene locus_tag LOCUS_22490 175 657 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_22490 1564 848 gene locus_tag LOCUS_22500 1564 848 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_22500 2001 1561 gene locus_tag LOCUS_22510 2001 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2816 2004 gene locus_tag LOCUS_22520 2816 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3684 2809 gene locus_tag LOCUS_22530 3684 2809 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203382.1 protein_id gnl|my_center|LOCUS_22530 4244 3681 gene locus_tag LOCUS_22540 4244 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802421.1 protein_id gnl|my_center|LOCUS_22540 5113 4463 gene locus_tag LOCUS_22550 5113 4463 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence262 920 1990 gene locus_tag LOCUS_22560 920 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2584 2111 gene locus_tag LOCUS_22570 2584 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3042 3446 gene locus_tag LOCUS_22580 3042 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 3447 3989 gene locus_tag LOCUS_22590 3447 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4001 4594 gene locus_tag LOCUS_22600 4001 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence263 245 589 gene locus_tag LOCUS_22610 gene mobC 245 589 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_22610 754 1065 gene locus_tag LOCUS_22620 754 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1062 1361 gene locus_tag LOCUS_22630 1062 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1575 3749 gene locus_tag LOCUS_22640 1575 3749 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470931.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence264 <1 892 gene locus_tag LOCUS_22650 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107154.1:transglycosylase SLT domain-containing protein 963 2339 gene locus_tag LOCUS_22660 963 2339 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_22660 2521 2820 gene locus_tag LOCUS_22670 gene trxA 2521 2820 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789105.1 protein_id gnl|my_center|LOCUS_22670 2880 3614 gene locus_tag LOCUS_22680 2880 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3633 4301 gene locus_tag LOCUS_22690 3633 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 <5216 4304 gene locus_tag LOCUS_22700 <5216 4304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986890.1:AEC family transporter >Feature sequence265 <1 1125 gene locus_tag LOCUS_22710 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964541.1:recombinase family protein >Feature sequence266 1217 6 gene locus_tag LOCUS_22720 1217 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2223 1168 gene locus_tag LOCUS_22730 2223 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3299 4318 gene locus_tag LOCUS_22740 3299 4318 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence267 798 403 gene locus_tag LOCUS_22750 798 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 1691 816 gene locus_tag LOCUS_22760 1691 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2185 2901 gene locus_tag LOCUS_22770 2185 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 3099 3662 gene locus_tag LOCUS_22780 3099 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 5000 3762 gene locus_tag LOCUS_22790 5000 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence268 998 3193 gene locus_tag LOCUS_22800 998 3193 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046082417.1 protein_id gnl|my_center|LOCUS_22800 3159 3344 gene locus_tag LOCUS_22810 3159 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3353 4390 gene locus_tag LOCUS_22820 3353 4390 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence269 1797 1180 gene locus_tag LOCUS_22830 gene nqrE 1797 1180 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_22830 2454 1825 gene locus_tag LOCUS_22840 2454 1825 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_22840 3259 2462 gene locus_tag LOCUS_22850 3259 2462 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_22850 4478 3270 gene locus_tag LOCUS_22860 4478 3270 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_22860 <5160 4500 gene locus_tag LOCUS_22870 <5160 4500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787198.1:Na(+)-translocating NADH-quinone reductase subunit A >Feature sequence270 <1 804 gene locus_tag LOCUS_22880 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203005.1:glycosyltransferase 947 1516 gene locus_tag LOCUS_22890 947 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1535 2761 gene locus_tag LOCUS_22900 1535 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2754 3728 gene locus_tag LOCUS_22910 2754 3728 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643284.1 protein_id gnl|my_center|LOCUS_22910 3845 4147 gene locus_tag LOCUS_22920 3845 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 4134 5072 gene locus_tag LOCUS_22930 4134 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence271 1630 353 gene locus_tag LOCUS_22940 1630 353 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_22940 2829 1669 gene locus_tag LOCUS_22950 2829 1669 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_22950 3035 4990 gene locus_tag LOCUS_22960 3035 4990 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence272 2029 953 gene locus_tag LOCUS_22970 gene proB 2029 953 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_22970 3135 2200 gene locus_tag LOCUS_22980 3135 2200 CDS product FimB/Mfa2 family fimbrial subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797605.1 protein_id gnl|my_center|LOCUS_22980 4860 3721 gene locus_tag LOCUS_22990 4860 3721 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_22990 5093 4938 gene locus_tag LOCUS_23000 5093 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence273 <5057 1835 gene locus_tag LOCUS_23010 <5057 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861850.1:helicase-related protein >Feature sequence274 <1 662 gene locus_tag LOCUS_23020 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107374.1:thiamine phosphate synthase 704 1930 gene locus_tag LOCUS_23030 gene serB 704 1930 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_23030 1942 2244 gene locus_tag LOCUS_23040 1942 2244 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_23040 2267 2740 gene locus_tag LOCUS_23050 2267 2740 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_23050 3478 2774 gene locus_tag LOCUS_23060 3478 2774 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677254.1 protein_id gnl|my_center|LOCUS_23060 4629 3601 gene locus_tag LOCUS_23070 4629 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence275 1383 112 gene locus_tag LOCUS_23080 1383 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_23080 2618 1908 gene locus_tag LOCUS_23090 2618 1908 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_23090 3649 2615 gene locus_tag LOCUS_23100 3649 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3914 4363 gene locus_tag LOCUS_23110 3914 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4390 4704 gene locus_tag LOCUS_23120 4390 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence276 1664 348 gene locus_tag LOCUS_23130 1664 348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_23130 2601 1657 gene locus_tag LOCUS_23140 2601 1657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_23140 4754 2640 gene locus_tag LOCUS_23150 gene dnaG 4754 2640 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence277 332 766 gene locus_tag LOCUS_23160 gene rpiB 332 766 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_23160 981 1613 gene locus_tag LOCUS_23170 981 1613 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_23170 3127 1700 gene locus_tag LOCUS_23180 3127 1700 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_23180 3573 4127 gene locus_tag LOCUS_23190 3573 4127 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_23190 4835 4218 gene locus_tag LOCUS_23200 4835 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence278 <1 2820 gene locus_tag LOCUS_23210 <1 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202755.1:UvrD-helicase domain-containing protein 2891 3562 gene locus_tag LOCUS_23220 2891 3562 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_23220 3627 4268 gene locus_tag LOCUS_23230 gene pssA 3627 4268 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence279 <1 1178 gene locus_tag LOCUS_23240 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107232.1:NAD-dependent epimerase/dehydratase family protein 1399 1274 gene locus_tag LOCUS_23250 1399 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1420 2598 gene locus_tag LOCUS_23260 1420 2598 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence280 1115 168 gene locus_tag LOCUS_23270 gene miaA 1115 168 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_23270 1659 1096 gene locus_tag LOCUS_23280 1659 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764414.1 protein_id gnl|my_center|LOCUS_23280 2566 1778 gene locus_tag LOCUS_23290 gene lpxA 2566 1778 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764415.1 protein_id gnl|my_center|LOCUS_23290 3966 2581 gene locus_tag LOCUS_23300 3966 2581 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_23300 <4914 3972 gene locus_tag LOCUS_23310 <4914 3972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764416.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence281 1270 2079 gene locus_tag LOCUS_23320 gene dapF 1270 2079 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_23320 2113 3342 gene locus_tag LOCUS_23330 2113 3342 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence282 201 761 gene locus_tag LOCUS_23340 201 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1048 2271 gene locus_tag LOCUS_23350 1048 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2288 2971 gene locus_tag LOCUS_23360 2288 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2889 4220 gene locus_tag LOCUS_23370 2889 4220 CDS product virulence-associated E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001668899.1 protein_id gnl|my_center|LOCUS_23370 4446 4625 gene locus_tag LOCUS_23380 4446 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence283 564 3554 gene locus_tag LOCUS_23390 564 3554 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058064.1 protein_id gnl|my_center|LOCUS_23390 3544 4809 gene locus_tag LOCUS_23400 3544 4809 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027693.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence284 479 1234 gene locus_tag LOCUS_23410 gene sufC 479 1234 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_23410 1231 2574 gene locus_tag LOCUS_23420 gene sufD 1231 2574 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_23420 2813 4054 gene locus_tag LOCUS_23430 2813 4054 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_23430 4830 4294 gene locus_tag LOCUS_23440 4830 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence285 4652 3471 gene locus_tag LOCUS_23450 4652 3471 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence286 <1 515 gene locus_tag LOCUS_23460 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454111.1:glycosyltransferase family 2 protein 518 1906 gene locus_tag LOCUS_23470 518 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1973 2659 gene locus_tag LOCUS_23480 1973 2659 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_23480 2656 3621 gene locus_tag LOCUS_23490 2656 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3746 3949 gene locus_tag LOCUS_23500 3746 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence287 2 1741 gene locus_tag LOCUS_23510 2 1741 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_23510 1989 3485 gene locus_tag LOCUS_23520 1989 3485 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_23520 4775 3672 gene locus_tag LOCUS_23530 4775 3672 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence288 <1 662 gene locus_tag LOCUS_23540 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109374.1:endonuclease MutS2 675 1754 gene locus_tag LOCUS_23550 gene corA 675 1754 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785927.1 protein_id gnl|my_center|LOCUS_23550 2861 1755 gene locus_tag LOCUS_23560 gene dinB 2861 1755 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_23560 3239 3439 gene locus_tag LOCUS_23570 gene thiS 3239 3439 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_23570 3492 4268 gene locus_tag LOCUS_23580 3492 4268 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence289 1684 254 gene locus_tag LOCUS_23590 1684 254 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_23590 3173 1839 gene locus_tag LOCUS_23600 3173 1839 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_23600 4161 3553 gene locus_tag LOCUS_23610 4161 3553 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108808.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence290 709 206 gene locus_tag LOCUS_23620 709 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 986 690 gene locus_tag LOCUS_23630 986 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1686 967 gene locus_tag LOCUS_23640 1686 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1946 1698 gene locus_tag LOCUS_23650 1946 1698 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23650 2436 2041 gene locus_tag LOCUS_23660 2436 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2618 2436 gene locus_tag LOCUS_23670 2618 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2844 2701 gene locus_tag LOCUS_23680 2844 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 3002 2793 gene locus_tag LOCUS_23690 3002 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3637 3014 gene locus_tag LOCUS_23700 3637 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072906.1 protein_id gnl|my_center|LOCUS_23700 4230 3634 gene locus_tag LOCUS_23710 4230 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence291 739 11 gene locus_tag LOCUS_23720 739 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_23720 3220 887 gene locus_tag LOCUS_23730 3220 887 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_23730 3630 4655 gene locus_tag LOCUS_23740 gene ruvB 3630 4655 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence292 241 468 gene locus_tag LOCUS_23750 241 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 536 772 gene locus_tag LOCUS_23760 536 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 888 1010 gene locus_tag LOCUS_23770 888 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1878 1117 gene locus_tag LOCUS_23780 1878 1117 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_23780 <4750 2615 gene locus_tag LOCUS_23790 <4750 2615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108984.1:ATP-binding protein >Feature sequence293 1955 1023 gene locus_tag LOCUS_23800 1955 1023 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_23800 2640 2035 gene locus_tag LOCUS_23810 2640 2035 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_23810 3898 2750 gene locus_tag LOCUS_23820 gene araJ 3898 2750 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence294 658 5 gene locus_tag LOCUS_23830 658 5 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_23830 1551 655 gene locus_tag LOCUS_23840 1551 655 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_23840 2253 1573 gene locus_tag LOCUS_23850 gene truA 2253 1573 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_23850 2824 2372 gene locus_tag LOCUS_23860 2824 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3372 2821 gene locus_tag LOCUS_23870 3372 2821 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence295 1340 930 gene locus_tag LOCUS_23880 1340 930 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766985.1 protein_id gnl|my_center|LOCUS_23880 2001 1363 gene locus_tag LOCUS_23890 gene pyrE 2001 1363 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_23890 2822 2136 gene locus_tag LOCUS_23900 2822 2136 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_23900 3294 2800 gene locus_tag LOCUS_23910 3294 2800 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_23910 4139 3291 gene locus_tag LOCUS_23920 gene prmC 4139 3291 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_23920 4360 4256 gene locus_tag LOCUS_r00020 4360 4256 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence296 <1 940 gene locus_tag LOCUS_23930 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795630.1:glycoside hydrolase family 43 protein 960 1529 gene locus_tag LOCUS_23940 960 1529 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555647.1 protein_id gnl|my_center|LOCUS_23940 1624 2958 gene locus_tag LOCUS_23950 1624 2958 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_23950 4032 4253 gene locus_tag LOCUS_23960 4032 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 >Feature sequence297 2669 1344 gene locus_tag LOCUS_23970 2669 1344 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_23970 3923 2922 gene locus_tag LOCUS_23980 3923 2922 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780364.1 protein_id gnl|my_center|LOCUS_23980 4121 3930 gene locus_tag LOCUS_23990 4121 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 <4671 4114 gene locus_tag LOCUS_24000 <4671 4114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005780363.1:iron-sulfur cluster assembly scaffold protein >Feature sequence298 539 138 gene locus_tag LOCUS_24010 gene nikR 539 138 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_24010 2436 607 gene locus_tag LOCUS_24020 gene cbiD 2436 607 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_24020 4264 2441 gene locus_tag LOCUS_24030 gene cobM 4264 2441 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence299 <1 2565 gene locus_tag LOCUS_24040 <1 2565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769702.1:multidrug efflux RND transporter permease subunit 2946 3533 gene locus_tag LOCUS_24050 2946 3533 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence300 1460 951 gene locus_tag LOCUS_24060 1460 951 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_24060 1825 1634 gene locus_tag LOCUS_24070 1825 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 2187 1999 gene locus_tag LOCUS_24080 2187 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24080 3042 2203 gene locus_tag LOCUS_24090 gene panC 3042 2203 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_24090 3142 3960 gene locus_tag LOCUS_24100 3142 3960 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence301 953 186 gene locus_tag LOCUS_24110 953 186 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_24110 1800 1021 gene locus_tag LOCUS_24120 1800 1021 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_24120 3381 1927 gene locus_tag LOCUS_24130 3381 1927 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763223.1 protein_id gnl|my_center|LOCUS_24130 3784 3416 gene locus_tag LOCUS_24140 gene folB 3784 3416 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_24140 3891 4286 gene locus_tag LOCUS_24150 3891 4286 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence302 1797 613 gene locus_tag LOCUS_24160 1797 613 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_24160 2153 3439 gene locus_tag LOCUS_24170 2153 3439 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence303 48 698 gene locus_tag LOCUS_24180 48 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 1174 848 gene locus_tag LOCUS_24190 1174 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2732 1185 gene locus_tag LOCUS_24200 2732 1185 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_24200 3368 2811 gene locus_tag LOCUS_24210 gene def 3368 2811 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_24210 3792 3370 gene locus_tag LOCUS_24220 gene ruvX 3792 3370 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_24220 <4594 3859 gene locus_tag LOCUS_24230 <4594 3859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766006.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence304 5 295 gene locus_tag LOCUS_24240 5 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 312 833 gene locus_tag LOCUS_24250 gene rplJ 312 833 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_24250 879 1253 gene locus_tag LOCUS_24260 gene rplL 879 1253 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence305 1391 1032 gene locus_tag LOCUS_24270 gene rsfS 1391 1032 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_24270 1908 1979 gene locus_tag LOCUS_t00350 1908 1979 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2011 2082 gene locus_tag LOCUS_t00360 2011 2082 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2287 3222 gene locus_tag LOCUS_24280 gene metA 2287 3222 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence306 1982 261 gene locus_tag LOCUS_24290 1982 261 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108833.1 protein_id gnl|my_center|LOCUS_24290 2880 2248 gene locus_tag LOCUS_24300 2880 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence307 7 729 gene locus_tag LOCUS_24310 7 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 729 3044 gene locus_tag LOCUS_24320 729 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 3056 4060 gene locus_tag LOCUS_24330 3056 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 4064 4450 gene locus_tag LOCUS_24340 4064 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence308 <1 996 gene locus_tag LOCUS_24350 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787751.1:ABC transporter permease 1303 2673 gene locus_tag LOCUS_24360 1303 2673 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_24360 2675 3919 gene locus_tag LOCUS_24370 2675 3919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence309 1114 1455 gene locus_tag LOCUS_24380 1114 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1462 2163 gene locus_tag LOCUS_24390 1462 2163 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence310 1841 9 gene locus_tag LOCUS_24400 1841 9 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_24400 2396 1890 gene locus_tag LOCUS_24410 gene purE 2396 1890 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_24410 2778 2398 gene locus_tag LOCUS_24420 gene gcvH 2778 2398 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_24420 3411 2791 gene locus_tag LOCUS_24430 3411 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 <4484 3423 gene locus_tag LOCUS_24440 <4484 3423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108333.1:RNA polymerase factor sigma-54 >Feature sequence311 2041 14 gene locus_tag LOCUS_24450 2041 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2235 3755 gene locus_tag LOCUS_24460 gene guaA 2235 3755 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence312 896 1591 gene locus_tag LOCUS_24470 896 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1595 2722 gene locus_tag LOCUS_24480 1595 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2897 3391 gene locus_tag LOCUS_24490 2897 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3520 4125 gene locus_tag LOCUS_24500 3520 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence313 1280 2890 gene locus_tag LOCUS_24510 1280 2890 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788170.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence314 52 1071 gene locus_tag LOCUS_24520 52 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1480 1839 gene locus_tag LOCUS_24530 1480 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3264 2407 gene locus_tag LOCUS_24540 3264 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence315 3801 2833 gene locus_tag LOCUS_24550 3801 2833 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785220.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence316 103 1506 gene locus_tag LOCUS_24560 103 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 1595 1948 gene locus_tag LOCUS_24570 1595 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 2211 2020 gene locus_tag LOCUS_24580 2211 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24580 2385 2233 gene locus_tag LOCUS_24590 2385 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2908 2396 gene locus_tag LOCUS_24600 2908 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 3385 2933 gene locus_tag LOCUS_24610 3385 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence317 >Feature sequence318 988 89 gene locus_tag LOCUS_24620 988 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1266 1120 gene locus_tag LOCUS_24630 1266 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 1878 1381 gene locus_tag LOCUS_24640 1878 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2286 1906 gene locus_tag LOCUS_24650 2286 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 3285 2290 gene locus_tag LOCUS_24660 3285 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence319 2623 161 gene locus_tag LOCUS_24670 2623 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2839 3456 gene locus_tag LOCUS_24680 2839 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3738 3947 gene locus_tag LOCUS_24690 3738 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence320 633 499 gene locus_tag LOCUS_24700 633 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1462 692 gene locus_tag LOCUS_24710 1462 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 1797 1459 gene locus_tag LOCUS_24720 1797 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2528 1935 gene locus_tag LOCUS_24730 2528 1935 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764520.1 protein_id gnl|my_center|LOCUS_24730 3093 4118 gene locus_tag LOCUS_24740 3093 4118 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_24740 >Feature sequence321 1570 950 gene locus_tag LOCUS_24750 1570 950 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203132.1 protein_id gnl|my_center|LOCUS_24750 2272 1667 gene locus_tag LOCUS_24760 2272 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24760 2429 3247 gene locus_tag LOCUS_24770 2429 3247 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_24770 3318 3944 gene locus_tag LOCUS_24780 3318 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence322 6 3185 gene locus_tag LOCUS_24790 6 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3472 3308 gene locus_tag LOCUS_24800 3472 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence323 3184 1571 gene locus_tag LOCUS_24810 3184 1571 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24810 3682 3245 gene locus_tag LOCUS_24820 3682 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24820 3784 4275 gene locus_tag LOCUS_24830 3784 4275 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766080.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence324 360 121 gene locus_tag LOCUS_24840 360 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 756 1799 gene locus_tag LOCUS_24850 756 1799 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116631520.1 protein_id gnl|my_center|LOCUS_24850 1823 2317 gene locus_tag LOCUS_24860 1823 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2740 2375 gene locus_tag LOCUS_24870 2740 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3797 2892 gene locus_tag LOCUS_24880 3797 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 <4319 3790 gene locus_tag LOCUS_24890 <4319 3790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461990.1:DUF3991 domain-containing protein >Feature sequence325 1421 375 gene locus_tag LOCUS_24900 1421 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_24900 4106 1458 gene locus_tag LOCUS_24910 gene mgtA 4106 1458 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107551.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence326 1139 78 gene locus_tag LOCUS_24920 1139 78 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201876.1 protein_id gnl|my_center|LOCUS_24920 2146 1205 gene locus_tag LOCUS_24930 2146 1205 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_24930 2855 2244 gene locus_tag LOCUS_24940 2855 2244 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_24940 <4293 2975 gene locus_tag LOCUS_24950 <4293 2975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793972.1:phosphatase PAP2 family protein >Feature sequence327 587 928 gene locus_tag LOCUS_24960 587 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2152 1082 gene locus_tag LOCUS_24970 2152 1082 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393827.1 protein_id gnl|my_center|LOCUS_24970 3233 2163 gene locus_tag LOCUS_24980 3233 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence328 688 2691 gene locus_tag LOCUS_24990 688 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2694 3578 gene locus_tag LOCUS_25000 2694 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence329 2025 1798 gene locus_tag LOCUS_25010 2025 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 2534 2022 gene locus_tag LOCUS_25020 2534 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3202 2531 gene locus_tag LOCUS_25030 3202 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 4136 3372 gene locus_tag LOCUS_25040 4136 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence330 350 1039 gene locus_tag LOCUS_25050 350 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_25050 3970 1118 gene locus_tag LOCUS_25060 gene gcvP 3970 1118 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202698.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence331 178 981 gene locus_tag LOCUS_25070 gene proC 178 981 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_25070 2068 1079 gene locus_tag LOCUS_25080 gene tsf 2068 1079 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_25080 3124 2213 gene locus_tag LOCUS_25090 gene rpsB 3124 2213 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_25090 3657 3271 gene locus_tag LOCUS_25100 gene rpsI 3657 3271 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_25100 4118 3663 gene locus_tag LOCUS_25110 gene rplM 4118 3663 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence332 1459 155 gene locus_tag LOCUS_25120 gene murA 1459 155 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_25120 2052 1456 gene locus_tag LOCUS_25130 2052 1456 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_25130 3068 2184 gene locus_tag LOCUS_25140 3068 2184 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence333 473 1372 gene locus_tag LOCUS_25150 473 1372 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_25150 2963 1482 gene locus_tag LOCUS_25160 gene proS 2963 1482 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_25160 3981 3172 gene locus_tag LOCUS_25170 3981 3172 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence334 784 1521 gene locus_tag LOCUS_25180 784 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1733 2335 gene locus_tag LOCUS_25190 1733 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2299 3447 gene locus_tag LOCUS_25200 2299 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence335 135 1469 gene locus_tag LOCUS_25210 135 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1579 2235 gene locus_tag LOCUS_25220 1579 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2238 2567 gene locus_tag LOCUS_25230 2238 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2677 3591 gene locus_tag LOCUS_25240 2677 3591 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence336 <1 1252 gene locus_tag LOCUS_25250 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787744.1:ATP-binding protein 1396 1142 gene locus_tag LOCUS_25260 1396 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1928 1494 gene locus_tag LOCUS_25270 gene ybeY 1928 1494 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_25270 2294 1971 gene locus_tag LOCUS_25280 2294 1971 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962809.1 protein_id gnl|my_center|LOCUS_25280 2677 2276 gene locus_tag LOCUS_25290 2677 2276 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_25290 2764 3594 gene locus_tag LOCUS_25300 2764 3594 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_25300 <4192 3616 gene locus_tag LOCUS_25310 <4192 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766109.1:ATP-binding protein >Feature sequence337 2706 226 gene locus_tag LOCUS_25320 2706 226 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_25320 3350 4009 gene locus_tag LOCUS_25330 3350 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence338 <1 1327 gene locus_tag LOCUS_25340 <1 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062175791.1:cell surface protein SprA 1780 1481 gene locus_tag LOCUS_25350 1780 1481 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence339 895 191 gene locus_tag LOCUS_25360 895 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1709 903 gene locus_tag LOCUS_25370 1709 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1879 1721 gene locus_tag LOCUS_25380 1879 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2066 1860 gene locus_tag LOCUS_25390 2066 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3466 2984 gene locus_tag LOCUS_25400 3466 2984 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_25400 3636 3463 gene locus_tag LOCUS_25410 3636 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence340 2482 107 gene locus_tag LOCUS_25420 2482 107 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_25420 4141 2492 gene locus_tag LOCUS_25430 4141 2492 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038270.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence341 2677 227 gene locus_tag LOCUS_25440 2677 227 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_25440 3612 2785 gene locus_tag LOCUS_25450 3612 2785 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_25450 <4128 3609 gene locus_tag LOCUS_25460 <4128 3609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108288.1:U32 family peptidase >Feature sequence342 1264 656 gene locus_tag LOCUS_25470 1264 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2612 1275 gene locus_tag LOCUS_25480 2612 1275 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_25480 2918 2637 gene locus_tag LOCUS_25490 2918 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3783 3013 gene locus_tag LOCUS_25500 3783 3013 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_25500 4023 3811 gene locus_tag LOCUS_25510 4023 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence343 358 657 gene locus_tag LOCUS_25520 gene raiA 358 657 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_25520 751 825 gene locus_tag LOCUS_t00370 751 825 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 844 927 gene locus_tag LOCUS_t00380 844 927 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 971 1044 gene locus_tag LOCUS_t00390 971 1044 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1054 1126 gene locus_tag LOCUS_t00400 1054 1126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1175 2362 gene locus_tag LOCUS_25530 gene tuf 1175 2362 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_25530 2409 2482 gene locus_tag LOCUS_t00410 2409 2482 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2500 2694 gene locus_tag LOCUS_25540 gene secE 2500 2694 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_25540 2708 3250 gene locus_tag LOCUS_25550 gene nusG 2708 3250 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_25550 3317 3760 gene locus_tag LOCUS_25560 gene rplK 3317 3760 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence344 325 1740 gene locus_tag LOCUS_25570 325 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 1745 2416 gene locus_tag LOCUS_25580 1745 2416 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797095.1 protein_id gnl|my_center|LOCUS_25580 3338 2763 gene locus_tag LOCUS_25590 3338 2763 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_25590 <4118 3502 gene locus_tag LOCUS_25600 <4118 3502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201960.1:glycoside hydrolase family 78 protein >Feature sequence345 1399 50 gene locus_tag LOCUS_25610 1399 50 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788965.1 protein_id gnl|my_center|LOCUS_25610 1813 1445 gene locus_tag LOCUS_25620 1813 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2398 1820 gene locus_tag LOCUS_25630 2398 1820 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_25630 2811 3209 gene locus_tag LOCUS_25640 2811 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108002.1 protein_id gnl|my_center|LOCUS_25640 <4107 3376 gene locus_tag LOCUS_25650 <4107 3376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800561.1:GH92 family glycosyl hydrolase >Feature sequence346 1543 863 gene locus_tag LOCUS_25660 1543 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1958 1524 gene locus_tag LOCUS_25670 1958 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2216 2007 gene locus_tag LOCUS_25680 2216 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3913 2627 gene locus_tag LOCUS_25690 3913 2627 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627853.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence347 1697 1095 gene locus_tag LOCUS_25700 1697 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2194 1694 gene locus_tag LOCUS_25710 2194 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2558 2199 gene locus_tag LOCUS_25720 2558 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2716 3630 gene locus_tag LOCUS_25730 2716 3630 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence348 2224 512 gene locus_tag LOCUS_25740 gene cas8c 2224 512 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_25740 2901 2221 gene locus_tag LOCUS_25750 gene cas5c 2901 2221 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_25750 <4074 2917 gene locus_tag LOCUS_25760 <4074 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932807.1:CRISPR-associated helicase Cas3' >Feature sequence349 2024 1011 gene locus_tag LOCUS_25770 2024 1011 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766270.1 protein_id gnl|my_center|LOCUS_25770 2590 2027 gene locus_tag LOCUS_25780 2590 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence350 1883 693 gene locus_tag LOCUS_25790 1883 693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_25790 3322 1892 gene locus_tag LOCUS_25800 3322 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 <4049 3496 gene locus_tag LOCUS_25810 <4049 3496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence351 159 557 gene locus_tag LOCUS_tm00010 159 557 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 785 1165 gene locus_tag LOCUS_25820 785 1165 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_25820 1169 1729 gene locus_tag LOCUS_25830 1169 1729 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020835216.1 protein_id gnl|my_center|LOCUS_25830 3090 1738 gene locus_tag LOCUS_25840 3090 1738 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence352 <1 916 gene locus_tag LOCUS_25850 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107748.1:MATE family efflux transporter 1396 884 gene locus_tag LOCUS_25860 1396 884 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_25860 2354 1449 gene locus_tag LOCUS_25870 2354 1449 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_25870 2464 3945 gene locus_tag LOCUS_25880 gene rhaB 2464 3945 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence353 1868 2860 gene locus_tag LOCUS_25890 1868 2860 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence354 1213 233 gene locus_tag LOCUS_25900 1213 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2244 1210 gene locus_tag LOCUS_25910 2244 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3155 2250 gene locus_tag LOCUS_25920 3155 2250 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107077.1 protein_id gnl|my_center|LOCUS_25920 3958 3170 gene locus_tag LOCUS_25930 3958 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence355 922 461 gene locus_tag LOCUS_25940 gene smpB 922 461 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_25940 1525 938 gene locus_tag LOCUS_25950 1525 938 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760494.1 protein_id gnl|my_center|LOCUS_25950 2333 1545 gene locus_tag LOCUS_25960 2333 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3238 2453 gene locus_tag LOCUS_25970 3238 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 <3982 3263 gene locus_tag LOCUS_25980 <3982 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766767.1:outer membrane beta-barrel protein >Feature sequence356 651 1718 gene locus_tag LOCUS_25990 gene serC 651 1718 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_25990 1721 2644 gene locus_tag LOCUS_26000 1721 2644 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_26000 2648 3895 gene locus_tag LOCUS_26010 2648 3895 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence357 2540 3334 gene locus_tag LOCUS_26020 gene nudC 2540 3334 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107851.1 protein_id gnl|my_center|LOCUS_26020 3954 3331 gene locus_tag LOCUS_26030 3954 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence358 856 443 gene locus_tag LOCUS_26040 856 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1941 1192 gene locus_tag LOCUS_26050 1941 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2744 2025 gene locus_tag LOCUS_26060 2744 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence359 1 1113 gene locus_tag LOCUS_26070 1 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 1125 3014 gene locus_tag LOCUS_26080 1125 3014 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence360 1958 882 gene locus_tag LOCUS_26090 1958 882 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_26090 <3893 1999 gene locus_tag LOCUS_26100 <3893 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766599.1:glycoside hydrolase family 38 C-terminal domain-containing protein >Feature sequence361 1432 842 gene locus_tag LOCUS_26110 1432 842 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_26110 1983 3536 gene locus_tag LOCUS_26120 1983 3536 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208070.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence362 2587 1910 gene locus_tag LOCUS_26130 2587 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2946 2599 gene locus_tag LOCUS_26140 2946 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3271 3050 gene locus_tag LOCUS_26150 3271 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3781 3302 gene locus_tag LOCUS_26160 3781 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence363 544 1299 gene locus_tag LOCUS_26170 544 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1419 2126 gene locus_tag LOCUS_26180 gene rsmI 1419 2126 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_26180 2119 3018 gene locus_tag LOCUS_26190 2119 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_26190 3018 3710 gene locus_tag LOCUS_26200 3018 3710 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence364 1589 357 gene locus_tag LOCUS_26210 1589 357 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_26210 2122 1709 gene locus_tag LOCUS_26220 2122 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 <3839 2289 gene locus_tag LOCUS_26230 <3839 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793926.1:endopeptidase La >Feature sequence365 750 2456 gene locus_tag LOCUS_26240 gene kdpA 750 2456 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence366 986 753 gene locus_tag LOCUS_26250 986 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1437 1117 gene locus_tag LOCUS_26260 1437 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1799 1434 gene locus_tag LOCUS_26270 1799 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2380 2219 gene locus_tag LOCUS_26280 2380 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 <3834 2608 gene locus_tag LOCUS_26290 <3834 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788903.1:diphosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence367 1318 437 gene locus_tag LOCUS_26300 1318 437 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_26300 2144 1359 gene locus_tag LOCUS_26310 2144 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2242 3174 gene locus_tag LOCUS_26320 2242 3174 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence368 2779 1070 gene locus_tag LOCUS_26330 2779 1070 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_26330 <3805 2792 gene locus_tag LOCUS_26340 <3805 2792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765142.1:TonB-dependent receptor >Feature sequence369 1725 799 gene locus_tag LOCUS_26350 1725 799 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_26350 3618 1879 gene locus_tag LOCUS_26360 3618 1879 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence370 634 1077 gene locus_tag LOCUS_26370 634 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007659487.1 protein_id gnl|my_center|LOCUS_26370 1465 1160 gene locus_tag LOCUS_26380 1465 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783170.1 protein_id gnl|my_center|LOCUS_26380 3043 2144 gene locus_tag LOCUS_26390 3043 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3588 3040 gene locus_tag LOCUS_26400 3588 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence371 <1 1014 gene locus_tag LOCUS_26410 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203417.1:rRNA cytosine-C5-methyltransferase 1956 1009 gene locus_tag LOCUS_26420 1956 1009 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_26420 2096 2443 gene locus_tag LOCUS_26430 2096 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3170 2505 gene locus_tag LOCUS_26440 3170 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 <3779 3176 gene locus_tag LOCUS_26450 <3779 3176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657449.1:RNA degradosome polyphosphate kinase >Feature sequence372 530 1009 gene locus_tag LOCUS_26460 530 1009 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_26460 3088 1229 gene locus_tag LOCUS_26470 3088 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3524 3108 gene locus_tag LOCUS_26480 3524 3108 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811741.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence373 1278 2135 gene locus_tag LOCUS_26490 1278 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2135 3232 gene locus_tag LOCUS_26500 2135 3232 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence374 2205 1294 gene locus_tag LOCUS_26510 2205 1294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107758.1 protein_id gnl|my_center|LOCUS_26510 2517 3023 gene locus_tag LOCUS_26520 2517 3023 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815892.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence375 1706 1287 gene locus_tag LOCUS_26530 1706 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3050 1710 gene locus_tag LOCUS_26540 3050 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence376 >Feature sequence377 251 415 gene locus_tag LOCUS_26550 251 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2444 873 gene locus_tag LOCUS_26560 2444 873 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_26560 2864 2508 gene locus_tag LOCUS_26570 gene tnpB 2864 2508 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748682.1 protein_id gnl|my_center|LOCUS_26570 3231 2854 gene locus_tag LOCUS_26580 3231 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence378 206 1240 gene locus_tag LOCUS_26590 206 1240 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804212.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence379 1229 270 gene locus_tag LOCUS_26600 1229 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2338 1229 gene locus_tag LOCUS_26610 2338 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3393 2344 gene locus_tag LOCUS_26620 3393 2344 CDS product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 protein_id gnl|my_center|LOCUS_26620 3611 3399 gene locus_tag LOCUS_26630 3611 3399 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence380 202 1632 gene locus_tag LOCUS_26640 202 1632 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_26640 1714 3210 gene locus_tag LOCUS_26650 1714 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 3244 3597 gene locus_tag LOCUS_26660 3244 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence381 2 1249 gene locus_tag LOCUS_26670 2 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1313 1942 gene locus_tag LOCUS_26680 1313 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1978 2526 gene locus_tag LOCUS_26690 1978 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2677 3684 gene locus_tag LOCUS_26700 2677 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence382 2549 1509 gene locus_tag LOCUS_26710 2549 1509 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797794.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence383 1023 2399 gene locus_tag LOCUS_26720 1023 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2868 3038 gene locus_tag LOCUS_26730 2868 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3035 3397 gene locus_tag LOCUS_26740 3035 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence384 92 3424 gene locus_tag LOCUS_26750 92 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence385 2138 366 gene locus_tag LOCUS_26760 2138 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence386 2633 978 gene locus_tag LOCUS_26770 2633 978 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence387 2111 657 gene locus_tag LOCUS_26780 2111 657 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_26780 3046 2123 gene locus_tag LOCUS_26790 3046 2123 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence388 2050 836 gene locus_tag LOCUS_26800 2050 836 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_26800 3257 2052 gene locus_tag LOCUS_26810 3257 2052 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence389 1108 170 gene locus_tag LOCUS_26820 1108 170 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_26820 2693 1221 gene locus_tag LOCUS_26830 2693 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_26830 <3544 2845 gene locus_tag LOCUS_26840 <3544 2845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798834.1:aminoacyl-histidine dipeptidase >Feature sequence390 723 2255 gene locus_tag LOCUS_26850 723 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence391 2588 2391 gene locus_tag LOCUS_26860 2588 2391 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905249.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence392 1207 320 gene locus_tag LOCUS_26870 1207 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26870 1701 1138 gene locus_tag LOCUS_26880 1701 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 2190 3347 gene locus_tag LOCUS_26890 2190 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence393 298 501 gene locus_tag LOCUS_26900 298 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 1177 722 gene locus_tag LOCUS_26910 1177 722 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_26910 1326 2102 gene locus_tag LOCUS_26920 1326 2102 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_26920 2109 3131 gene locus_tag LOCUS_26930 gene holA 2109 3131 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence394 3477 2560 gene locus_tag LOCUS_26940 3477 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence395 <1 2317 gene locus_tag LOCUS_26950 <1 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769358.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 2337 3374 gene locus_tag LOCUS_26960 2337 3374 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797938.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence396 125 1165 gene locus_tag LOCUS_26970 125 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26970 1162 1299 gene locus_tag LOCUS_26980 1162 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1377 1703 gene locus_tag LOCUS_26990 1377 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3374 2268 gene locus_tag LOCUS_27000 3374 2268 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013548084.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence397 <1 808 gene locus_tag LOCUS_27010 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767220.1:methionine--tRNA ligase 817 1944 gene locus_tag LOCUS_27020 817 1944 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_27020 1934 2956 gene locus_tag LOCUS_27030 1934 2956 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence398 298 1143 gene locus_tag LOCUS_27040 298 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 1261 2022 gene locus_tag LOCUS_27050 1261 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2985 2104 gene locus_tag LOCUS_27060 2985 2104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence399 1344 172 gene locus_tag LOCUS_27070 1344 172 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_27070 2507 1350 gene locus_tag LOCUS_27080 gene lysA 2507 1350 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_27080 <3458 2672 gene locus_tag LOCUS_27090 <3458 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764912.1:aspartate kinase >Feature sequence400 2043 970 gene locus_tag LOCUS_27100 2043 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence401 1280 510 gene locus_tag LOCUS_27110 1280 510 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_27110 2413 1292 gene locus_tag LOCUS_27120 gene dnaN 2413 1292 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_27120 2728 2576 gene locus_tag LOCUS_27130 2728 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2932 2744 gene locus_tag LOCUS_27140 gene rpmG 2932 2744 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_27140 3188 2949 gene locus_tag LOCUS_27150 gene rpmB 3188 2949 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence402 >Feature sequence403 <1 868 gene locus_tag LOCUS_27160 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768920.1:PepSY-associated TM helix domain-containing protein 961 2322 gene locus_tag LOCUS_27170 961 2322 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767915.1 protein_id gnl|my_center|LOCUS_27170 <3423 2541 gene locus_tag LOCUS_27180 <3423 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801462.1:6-bladed beta-propeller >Feature sequence404 490 867 gene locus_tag LOCUS_27190 490 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 1584 1030 gene locus_tag LOCUS_27200 1584 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2085 1636 gene locus_tag LOCUS_27210 2085 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2372 2935 gene locus_tag LOCUS_27220 2372 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence405 1779 286 gene locus_tag LOCUS_27230 1779 286 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_27230 2096 1788 gene locus_tag LOCUS_27240 2096 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2410 2691 gene locus_tag LOCUS_27250 2410 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2691 3299 gene locus_tag LOCUS_27260 2691 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence406 86 1201 gene locus_tag LOCUS_27270 86 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 2203 1325 gene locus_tag LOCUS_27280 2203 1325 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_27280 3242 2211 gene locus_tag LOCUS_27290 3242 2211 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202849.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence407 1603 59 gene locus_tag LOCUS_27300 1603 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 1730 2905 gene locus_tag LOCUS_27310 1730 2905 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200548343.1 protein_id gnl|my_center|LOCUS_27310 2902 3093 gene locus_tag LOCUS_27320 2902 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence408 2124 322 gene locus_tag LOCUS_27330 2124 322 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_27330 3187 2351 gene locus_tag LOCUS_27340 3187 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence409 <1 580 gene locus_tag LOCUS_27350 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator transcription factor 820 1194 gene locus_tag LOCUS_27360 820 1194 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_27360 1508 2902 gene locus_tag LOCUS_27370 1508 2902 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680054.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence410 <1 1054 gene locus_tag LOCUS_27380 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795080.1:putative porin 1123 1893 gene locus_tag LOCUS_27390 1123 1893 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202508.1 protein_id gnl|my_center|LOCUS_27390 1927 3225 gene locus_tag LOCUS_27400 1927 3225 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence411 103 1272 gene locus_tag LOCUS_27410 103 1272 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_27410 1360 2469 gene locus_tag LOCUS_27420 gene prfA 1360 2469 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759884.1 protein_id gnl|my_center|LOCUS_27420 2473 3321 gene locus_tag LOCUS_27430 gene pyrF 2473 3321 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence412 1491 736 gene locus_tag LOCUS_27440 1491 736 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_27440 1902 1540 gene locus_tag LOCUS_27450 1902 1540 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_27450 <3341 1958 gene locus_tag LOCUS_27460 <3341 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783490.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence413 1189 188 gene locus_tag LOCUS_27470 1189 188 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_27470 2408 1224 gene locus_tag LOCUS_27480 2408 1224 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_27480 2992 2408 gene locus_tag LOCUS_27490 2992 2408 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence414 1234 923 gene locus_tag LOCUS_27500 1234 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2349 1243 gene locus_tag LOCUS_27510 2349 1243 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_27510 <3330 2434 gene locus_tag LOCUS_27520 <3330 2434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109329.1:helix-turn-helix domain-containing protein >Feature sequence415 <1 1319 gene locus_tag LOCUS_27530 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291471.1:sigma-54 dependent transcriptional regulator 1367 2275 gene locus_tag LOCUS_27540 1367 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2620 3042 gene locus_tag LOCUS_27550 2620 3042 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291474.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence416 380 853 gene locus_tag LOCUS_27560 380 853 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_27560 1179 1760 gene locus_tag LOCUS_27570 1179 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1859 2221 gene locus_tag LOCUS_27580 1859 2221 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108047.1 protein_id gnl|my_center|LOCUS_27580 2257 2991 gene locus_tag LOCUS_27590 2257 2991 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692954.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence417 1773 481 gene locus_tag LOCUS_27600 1773 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3123 1840 gene locus_tag LOCUS_27610 3123 1840 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence418 442 1752 gene locus_tag LOCUS_27620 442 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1752 1931 gene locus_tag LOCUS_27630 1752 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1928 3010 gene locus_tag LOCUS_27640 gene traN 1928 3010 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842179.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence419 <1 1174 gene locus_tag LOCUS_27650 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein 1318 1452 gene locus_tag LOCUS_27660 1318 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1650 2276 gene locus_tag LOCUS_27670 1650 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2273 3100 gene locus_tag LOCUS_27680 2273 3100 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence420 >Feature sequence421 1873 785 gene locus_tag LOCUS_27690 gene wecB 1873 785 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_27690 3168 1870 gene locus_tag LOCUS_27700 3168 1870 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582954.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence422 >Feature sequence423 <1 901 gene locus_tag LOCUS_27710 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798188.1:chromosomal replication initiator protein DnaA >Feature sequence424 479 955 gene locus_tag LOCUS_27720 479 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784803.1 protein_id gnl|my_center|LOCUS_27720 967 2376 gene locus_tag LOCUS_27730 967 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2395 3117 gene locus_tag LOCUS_27740 2395 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence425 1019 153 gene locus_tag LOCUS_27750 1019 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1151 2443 gene locus_tag LOCUS_27760 1151 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2544 3107 gene locus_tag LOCUS_27770 2544 3107 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107760.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence426 532 3189 gene locus_tag LOCUS_27780 532 3189 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence427 625 2022 gene locus_tag LOCUS_27790 625 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 2981 2307 gene locus_tag LOCUS_27800 2981 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence428 209 1225 gene locus_tag LOCUS_27810 209 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1433 2119 gene locus_tag LOCUS_27820 1433 2119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765779.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence429 3 293 gene locus_tag LOCUS_27830 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 274 519 gene locus_tag LOCUS_27840 274 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 2361 1249 gene locus_tag LOCUS_27850 2361 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 2810 2373 gene locus_tag LOCUS_27860 2810 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence430 <1 620 gene locus_tag LOCUS_27870 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875987.1:glycosyltransferase family 2 protein 647 1762 gene locus_tag LOCUS_27880 gene glf 647 1762 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_27880 1769 2680 gene locus_tag LOCUS_27890 1769 2680 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence431 987 16 gene locus_tag LOCUS_27900 987 16 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765277.1 protein_id gnl|my_center|LOCUS_27900 2441 1152 gene locus_tag LOCUS_27910 2441 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107078.1 protein_id gnl|my_center|LOCUS_27910 <3169 2468 gene locus_tag LOCUS_27920 <3169 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765275.1:glycosyltransferase family 2 protein >Feature sequence432 1149 2480 gene locus_tag LOCUS_27930 gene nrfA 1149 2480 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence433 1329 1033 gene locus_tag LOCUS_27940 1329 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322060.1 protein_id gnl|my_center|LOCUS_27940 2262 2957 gene locus_tag LOCUS_27950 2262 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence434 3 632 gene locus_tag LOCUS_27960 3 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 708 1619 gene locus_tag LOCUS_27970 708 1619 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_27970 <3147 1841 gene locus_tag LOCUS_27980 <3147 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121702.1:sulfatase >Feature sequence435 1417 566 gene locus_tag LOCUS_27990 1417 566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108118.1 protein_id gnl|my_center|LOCUS_27990 2646 1414 gene locus_tag LOCUS_28000 2646 1414 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108119.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence436 1639 449 gene locus_tag LOCUS_28010 1639 449 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_28010 2860 1658 gene locus_tag LOCUS_28020 2860 1658 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802156.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence437 3106 2243 gene locus_tag LOCUS_28030 3106 2243 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence438 56 2050 gene locus_tag LOCUS_28040 56 2050 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_28040 2155 3060 gene locus_tag LOCUS_28050 2155 3060 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence439 1300 20 gene locus_tag LOCUS_28060 gene pncB 1300 20 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_28060 1366 1450 gene locus_tag LOCUS_t00420 1366 1450 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence440 2090 963 gene locus_tag LOCUS_28070 2090 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence441 2940 1153 gene locus_tag LOCUS_28080 2940 1153 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence442 815 300 gene locus_tag LOCUS_28090 815 300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_28090 1281 808 gene locus_tag LOCUS_28100 1281 808 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_28100 1933 1466 gene locus_tag LOCUS_28110 1933 1466 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_28110 2523 1936 gene locus_tag LOCUS_28120 2523 1936 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_28120 3018 2545 gene locus_tag LOCUS_28130 3018 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence443 365 901 gene locus_tag LOCUS_28140 365 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1926 898 gene locus_tag LOCUS_28150 1926 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28150 2270 1923 gene locus_tag LOCUS_28160 2270 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 >Feature sequence444 1156 737 gene locus_tag LOCUS_28170 1156 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 <3098 1179 gene locus_tag LOCUS_28180 <3098 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051907092.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence445 <1 1185 gene locus_tag LOCUS_28190 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815685.1:phosphomethylpyrimidine synthase ThiC 1630 2784 gene locus_tag LOCUS_28200 gene thiH 1630 2784 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence446 1333 2109 gene locus_tag LOCUS_28210 1333 2109 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence447 >Feature sequence448 2 568 gene locus_tag LOCUS_28220 2 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 582 1703 gene locus_tag LOCUS_28230 582 1703 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence449 <1 967 gene locus_tag LOCUS_28240 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202802.1:FGGY-family carbohydrate kinase 1034 2350 gene locus_tag LOCUS_28250 gene xylA 1034 2350 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence450 386 1279 gene locus_tag LOCUS_28260 386 1279 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_28260 1653 1255 gene locus_tag LOCUS_28270 1653 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 2017 2295 gene locus_tag LOCUS_28280 2017 2295 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803434.1 protein_id gnl|my_center|LOCUS_28280 2292 2912 gene locus_tag LOCUS_28290 2292 2912 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761396.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence451 1129 542 gene locus_tag LOCUS_28300 1129 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2505 1156 gene locus_tag LOCUS_28310 2505 1156 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence452 328 921 gene locus_tag LOCUS_28320 328 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 1520 936 gene locus_tag LOCUS_28330 1520 936 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_28330 2241 1720 gene locus_tag LOCUS_28340 2241 1720 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_28340 3007 2243 gene locus_tag LOCUS_28350 3007 2243 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence453 792 478 gene locus_tag LOCUS_28360 792 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1326 2606 gene locus_tag LOCUS_28370 1326 2606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence454 1378 950 gene locus_tag LOCUS_28380 1378 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2032 1598 gene locus_tag LOCUS_28390 2032 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence455 653 907 gene locus_tag LOCUS_28400 653 907 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_28400 1715 924 gene locus_tag LOCUS_28410 1715 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 <3000 1858 gene locus_tag LOCUS_28420 <3000 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765859.1:heavy metal translocating P-type ATPase >Feature sequence456 3 269 gene locus_tag LOCUS_28430 3 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 282 1511 gene locus_tag LOCUS_28440 282 1511 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_28440 1508 2527 gene locus_tag LOCUS_28450 1508 2527 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence457 771 121 gene locus_tag LOCUS_28460 771 121 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_28460 1859 858 gene locus_tag LOCUS_28470 1859 858 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence458 1154 69 gene locus_tag LOCUS_28480 1154 69 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_28480 2343 1162 gene locus_tag LOCUS_28490 gene tgt 2343 1162 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_28490 <2975 2333 gene locus_tag LOCUS_28500 <2975 2333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765637.1:4Fe-4S binding protein >Feature sequence459 24 1196 gene locus_tag LOCUS_28510 24 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 1287 2846 gene locus_tag LOCUS_28520 1287 2846 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040066179.1 protein_id gnl|my_center|LOCUS_28520 >Feature sequence460 556 855 gene locus_tag LOCUS_28530 556 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 886 1035 gene locus_tag LOCUS_28540 886 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1046 2236 gene locus_tag LOCUS_28550 1046 2236 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039969.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence461 536 1153 gene locus_tag LOCUS_28560 536 1153 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_28560 1150 2163 gene locus_tag LOCUS_28570 1150 2163 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence462 161 427 gene locus_tag LOCUS_28580 161 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 1057 1533 gene locus_tag LOCUS_28590 1057 1533 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_28590 1538 2053 gene locus_tag LOCUS_28600 1538 2053 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence463 <2957 497 gene locus_tag LOCUS_28610 <2957 497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767711.1:alpha-L-fucosidase >Feature sequence464 1635 151 gene locus_tag LOCUS_28620 1635 151 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_28620 2389 1649 gene locus_tag LOCUS_28630 2389 1649 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_28630 2954 2517 gene locus_tag LOCUS_28640 2954 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence465 >Feature sequence466 2021 456 gene locus_tag LOCUS_28650 2021 456 CDS product IS66-like element ISBthe5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108243.1 protein_id gnl|my_center|LOCUS_28650 2850 2446 gene locus_tag LOCUS_28660 2850 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence467 717 304 gene locus_tag LOCUS_28670 717 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1725 1129 gene locus_tag LOCUS_28680 1725 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2241 1810 gene locus_tag LOCUS_28690 2241 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2836 2306 gene locus_tag LOCUS_28700 2836 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence468 1343 243 gene locus_tag LOCUS_28710 1343 243 CDS product DUF4934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797426.1 protein_id gnl|my_center|LOCUS_28710 2536 1502 gene locus_tag LOCUS_28720 2536 1502 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence469 2281 1151 gene locus_tag LOCUS_28730 2281 1151 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence470 520 2019 gene locus_tag LOCUS_28740 520 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence471 621 2162 gene locus_tag LOCUS_28750 621 2162 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_28750 2600 2223 gene locus_tag LOCUS_28760 2600 2223 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence472 1961 1269 gene locus_tag LOCUS_28770 1961 1269 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_28770 <2887 1988 gene locus_tag LOCUS_28780 <2887 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005800633.1:galactokinase >Feature sequence473 22 537 gene locus_tag LOCUS_28790 22 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1041 2255 gene locus_tag LOCUS_28800 1041 2255 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162038636.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence474 913 1506 gene locus_tag LOCUS_28810 913 1506 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_28810 1659 2117 gene locus_tag LOCUS_28820 gene bcp 1659 2117 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence475 <2867 937 gene locus_tag LOCUS_28830 <2867 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784513.1:LptF/LptG family permease >Feature sequence476 369 1196 gene locus_tag LOCUS_28840 gene trpC 369 1196 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202962.1 protein_id gnl|my_center|LOCUS_28840 1186 1803 gene locus_tag LOCUS_28850 1186 1803 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_28850 1800 2582 gene locus_tag LOCUS_28860 gene trpA 1800 2582 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788291.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence477 137 1078 gene locus_tag LOCUS_28870 137 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1079 1342 gene locus_tag LOCUS_28880 1079 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1359 1622 gene locus_tag LOCUS_28890 1359 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 1672 2541 gene locus_tag LOCUS_28900 1672 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence478 2303 1818 gene locus_tag LOCUS_28910 2303 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence479 675 466 gene locus_tag LOCUS_28920 675 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 2445 679 gene locus_tag LOCUS_28930 2445 679 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100190734.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence480 1 1206 gene locus_tag LOCUS_28940 1 1206 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_28940 1304 2209 gene locus_tag LOCUS_28950 1304 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_28950 2213 2809 gene locus_tag LOCUS_28960 2213 2809 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence481 2808 463 gene locus_tag LOCUS_28970 2808 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence482 2643 1138 gene locus_tag LOCUS_28980 2643 1138 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence483 484 1581 gene locus_tag LOCUS_28990 484 1581 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_28990 1583 2347 gene locus_tag LOCUS_29000 1583 2347 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence484 1293 709 gene locus_tag LOCUS_29010 1293 709 CDS product BfmA/BtgA family mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202090.1 protein_id gnl|my_center|LOCUS_29010 1909 1577 gene locus_tag LOCUS_29020 1909 1577 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478806.1 protein_id gnl|my_center|LOCUS_29020 2494 2072 gene locus_tag LOCUS_29030 2494 2072 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044093563.1 protein_id gnl|my_center|LOCUS_29030 2696 2469 gene locus_tag LOCUS_29040 2696 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478805.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence485 <1 2365 gene locus_tag LOCUS_29050 <1 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038873.1:BREX-1 system phosphatase PglZ type A >Feature sequence486 63 1976 gene locus_tag LOCUS_29060 63 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence487 1820 192 gene locus_tag LOCUS_29070 1820 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 <2759 2043 gene locus_tag LOCUS_29080 <2759 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202803.1:D-xylose transporter XylE >Feature sequence488 >Feature sequence489 1 276 gene locus_tag LOCUS_29090 1 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 706 353 gene locus_tag LOCUS_29100 706 353 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_29100 1832 693 gene locus_tag LOCUS_29110 1832 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2017 1829 gene locus_tag LOCUS_29120 2017 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 2581 2069 gene locus_tag LOCUS_29130 2581 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence490 2211 2059 gene locus_tag LOCUS_29140 2211 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence491 838 1629 gene locus_tag LOCUS_29150 838 1629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence492 1598 2515 gene locus_tag LOCUS_29160 1598 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence493 884 2629 gene locus_tag LOCUS_29170 884 2629 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence494 1426 314 gene locus_tag LOCUS_29180 1426 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 2016 1723 gene locus_tag LOCUS_29190 2016 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 <2687 2087 gene locus_tag LOCUS_29200 <2687 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047606.1:phage replisome organizer N-terminal domain-containing protein >Feature sequence495 <1 967 gene locus_tag LOCUS_29210 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058062.1:type I restriction-modification system subunit M 1063 1809 gene locus_tag LOCUS_29220 1063 1809 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence496 <1 641 gene locus_tag LOCUS_29230 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_089761628.1:TlpA disulfide reductase family protein note possible pseudo, internal stop codon 1308 862 gene locus_tag LOCUS_29240 1308 862 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_29240 1532 1305 gene locus_tag LOCUS_29250 1532 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_29250 1600 1968 gene locus_tag LOCUS_29260 1600 1968 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_29260 <2681 1989 gene locus_tag LOCUS_29270 <2681 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203125.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence497 2322 760 gene locus_tag LOCUS_29280 2322 760 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788554.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence498 1021 299 gene locus_tag LOCUS_29290 1021 299 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787542.1 protein_id gnl|my_center|LOCUS_29290 1590 1024 gene locus_tag LOCUS_29300 1590 1024 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_29300 2157 1687 gene locus_tag LOCUS_29310 gene pyrI 2157 1687 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761415.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence499 2233 1442 gene locus_tag LOCUS_29320 2233 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence500 1299 19 gene locus_tag LOCUS_29330 1299 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 <2660 1742 gene locus_tag LOCUS_29340 <2660 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496891.1:DNA topoisomerase I >Feature sequence501 758 252 gene locus_tag LOCUS_29350 758 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29350 2387 774 gene locus_tag LOCUS_29360 2387 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2645 2403 gene locus_tag LOCUS_29370 2645 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence502 2198 573 gene locus_tag LOCUS_29380 2198 573 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714962.1 protein_id gnl|my_center|LOCUS_29380 2643 2437 gene locus_tag LOCUS_29390 2643 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence503 >Feature sequence504 1399 1983 gene locus_tag LOCUS_29400 1399 1983 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323440.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence505 904 509 gene locus_tag LOCUS_29410 904 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1381 911 gene locus_tag LOCUS_29420 1381 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1869 1381 gene locus_tag LOCUS_29430 1869 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence506 <1 680 gene locus_tag LOCUS_29440 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784833.1:multidrug effflux MFS transporter 2003 774 gene locus_tag LOCUS_29450 2003 774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence507 2491 203 gene locus_tag LOCUS_29460 2491 203 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence508 <1 1263 gene locus_tag LOCUS_29470 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762102.1:sulfatase <2594 1340 gene locus_tag LOCUS_29480 <2594 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790318.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase >Feature sequence509 <2592 701 gene locus_tag LOCUS_29490 <2592 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108135.1:GH92 family glycosyl hydrolase >Feature sequence510 559 269 gene locus_tag LOCUS_29500 gene cas2 559 269 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_29500 1591 569 gene locus_tag LOCUS_29510 gene cas1c 1591 569 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009055.1 protein_id gnl|my_center|LOCUS_29510 2253 1588 gene locus_tag LOCUS_29520 gene cas4 2253 1588 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162614534.1 protein_id gnl|my_center|LOCUS_29520 >Feature sequence511 <2547 1961 gene locus_tag LOCUS_29530 <2547 1961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791521.1:DNA-directed RNA polymerase subunit beta >Feature sequence512 955 1527 gene locus_tag LOCUS_29540 955 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1658 1524 gene locus_tag LOCUS_29550 1658 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 1940 2356 gene locus_tag LOCUS_29560 1940 2356 CDS product PcfK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291533.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence513 1068 451 gene locus_tag LOCUS_29570 1068 451 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_29570 2146 1148 gene locus_tag LOCUS_29580 2146 1148 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence514 516 2066 gene locus_tag LOCUS_29590 516 2066 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence515 1624 452 gene locus_tag LOCUS_29600 1624 452 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_29600 2281 2024 gene locus_tag LOCUS_29610 2281 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29610 >Feature sequence516 1948 590 gene locus_tag LOCUS_29620 1948 590 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence517 >Feature sequence518 229 1317 gene locus_tag LOCUS_29630 229 1317 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_29630 1310 2119 gene locus_tag LOCUS_29640 1310 2119 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence519 1295 183 gene locus_tag LOCUS_29650 1295 183 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_29650 1637 1879 gene locus_tag LOCUS_29660 1637 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence520 693 917 gene locus_tag LOCUS_29670 693 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 939 1544 gene locus_tag LOCUS_29680 939 1544 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence521 <2491 1774 gene locus_tag LOCUS_29690 <2491 1774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760798.1:asparagine--tRNA ligase >Feature sequence522 201 599 gene locus_tag LOCUS_29700 201 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 608 1336 gene locus_tag LOCUS_29710 gene phbB 608 1336 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_29710 1343 2233 gene locus_tag LOCUS_29720 1343 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence523 443 1486 gene locus_tag LOCUS_29730 443 1486 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_29730 1493 2170 gene locus_tag LOCUS_29740 1493 2170 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence524 6 79 gene locus_tag LOCUS_t00430 6 79 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1134 352 gene locus_tag LOCUS_29750 1134 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1718 1374 gene locus_tag LOCUS_29760 1718 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence525 720 241 gene locus_tag LOCUS_29770 720 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1736 717 gene locus_tag LOCUS_29780 gene tsaD 1736 717 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence526 54 2039 gene locus_tag LOCUS_29790 54 2039 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence527 <1 971 gene locus_tag LOCUS_29800 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362003.1:transposase 1345 968 gene locus_tag LOCUS_29810 1345 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 <2468 1356 gene locus_tag LOCUS_29820 <2468 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202290.1:DUF87 domain-containing protein >Feature sequence528 1434 901 gene locus_tag LOCUS_29830 1434 901 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_29830 1834 1439 gene locus_tag LOCUS_29840 gene fur 1834 1439 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218609.1 protein_id gnl|my_center|LOCUS_29840 2053 2352 gene locus_tag LOCUS_29850 2053 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence529 1603 857 gene locus_tag LOCUS_29860 1603 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence530 1379 717 gene locus_tag LOCUS_29870 1379 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2435 1740 gene locus_tag LOCUS_29880 2435 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence531 574 86 gene locus_tag LOCUS_29890 574 86 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_29890 810 2099 gene locus_tag LOCUS_29900 810 2099 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence532 2015 564 gene locus_tag LOCUS_29910 2015 564 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence533 318 1238 gene locus_tag LOCUS_29920 318 1238 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_29920 1202 2359 gene locus_tag LOCUS_29930 1202 2359 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence534 2036 525 gene locus_tag LOCUS_29940 2036 525 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_29940 >Feature sequence535 <2416 236 gene locus_tag LOCUS_29950 <2416 236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789008.1:efflux RND transporter permease subunit >Feature sequence536 2 895 gene locus_tag LOCUS_29960 2 895 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_29960 1744 1016 gene locus_tag LOCUS_29970 1744 1016 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_29970 <2415 1829 gene locus_tag LOCUS_29980 <2415 1829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785475.1:MFS transporter >Feature sequence537 42 1355 gene locus_tag LOCUS_29990 42 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1348 2133 gene locus_tag LOCUS_30000 gene istB 1348 2133 CDS product IS21-like element ISMac9 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023283.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence538 420 2165 gene locus_tag LOCUS_30010 420 2165 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_30010 >Feature sequence539 413 751 gene locus_tag LOCUS_30020 413 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 775 2241 gene locus_tag LOCUS_30030 775 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 >Feature sequence540 1080 1565 gene locus_tag LOCUS_30040 1080 1565 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_30040 1640 2323 gene locus_tag LOCUS_30050 1640 2323 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence541 3 371 gene locus_tag LOCUS_30060 3 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 393 1823 gene locus_tag LOCUS_30070 393 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 >Feature sequence542 >Feature sequence543 1875 1537 gene locus_tag LOCUS_30080 1875 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 >Feature sequence544 496 1116 gene locus_tag LOCUS_30090 496 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 1118 1339 gene locus_tag LOCUS_30100 1118 1339 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_30100 <2354 1366 gene locus_tag LOCUS_30110 <2354 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107111.1:conjugal transfer protein MobC >Feature sequence545 1258 545 gene locus_tag LOCUS_30120 1258 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764091.1 protein_id gnl|my_center|LOCUS_30120 1855 1268 gene locus_tag LOCUS_30130 1855 1268 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764090.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence546 1259 369 gene locus_tag LOCUS_30140 1259 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 <2354 1710 gene locus_tag LOCUS_30150 <2354 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036944238.1:leucine-rich repeat domain-containing protein >Feature sequence547 <2337 615 gene locus_tag LOCUS_30160 <2337 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170127867.1:IS1634 family transposase >Feature sequence548 1988 756 gene locus_tag LOCUS_30170 1988 756 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786023.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence549 1817 216 gene locus_tag LOCUS_30180 1817 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 >Feature sequence550 484 1458 gene locus_tag LOCUS_30190 484 1458 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_30190 1496 2137 gene locus_tag LOCUS_30200 1496 2137 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence551 <1 553 gene locus_tag LOCUS_30210 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476101.1:aminotransferase class V-fold PLP-dependent enzyme 550 1221 gene locus_tag LOCUS_30220 550 1221 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_30220 1326 2291 gene locus_tag LOCUS_30230 1326 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence552 775 308 gene locus_tag LOCUS_30240 775 308 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_30240 960 772 gene locus_tag LOCUS_30250 960 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1752 1240 gene locus_tag LOCUS_30260 1752 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence553 <1 518 gene locus_tag LOCUS_30270 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002368703.1:relaxase/mobilization nuclease domain-containing protein 675 1019 gene locus_tag LOCUS_30280 675 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1059 1517 gene locus_tag LOCUS_30290 1059 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1589 1933 gene locus_tag LOCUS_30300 1589 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 >Feature sequence554 >Feature sequence555 >Feature sequence556 1 585 gene locus_tag LOCUS_30310 1 585 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_30310 609 1136 gene locus_tag LOCUS_30320 609 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1133 1918 gene locus_tag LOCUS_30330 1133 1918 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789184.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence557 2018 1389 gene locus_tag LOCUS_30340 2018 1389 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence558 1798 788 gene locus_tag LOCUS_30350 1798 788 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690326.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence559 822 1556 gene locus_tag LOCUS_30360 822 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1587 2180 gene locus_tag LOCUS_30370 1587 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence560 329 697 gene locus_tag LOCUS_30380 329 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence561 1903 719 gene locus_tag LOCUS_30390 1903 719 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218900.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence562 49 471 gene locus_tag LOCUS_30400 49 471 CDS product DUF977 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151126.1 protein_id gnl|my_center|LOCUS_30400 1438 683 gene locus_tag LOCUS_30410 1438 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence563 1050 664 gene locus_tag LOCUS_30420 1050 664 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_30420 1263 1337 gene locus_tag LOCUS_t00440 1263 1337 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1752 2219 gene locus_tag LOCUS_30430 gene rimP 1752 2219 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence564 >Feature sequence565 398 219 gene locus_tag LOCUS_30440 398 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence566 >Feature sequence567 >Feature sequence568 >Feature sequence569 245 1066 gene locus_tag LOCUS_30450 245 1066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence570 <2147 1041 gene locus_tag LOCUS_30460 <2147 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790315.1:TolC family protein >Feature sequence571 >Feature sequence572 942 2018 gene locus_tag LOCUS_30470 942 2018 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109328.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence573 295 1872 gene locus_tag LOCUS_30480 295 1872 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence574 1588 29 gene locus_tag LOCUS_30490 1588 29 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_30490 2130 1585 gene locus_tag LOCUS_30500 2130 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence575 1240 62 gene locus_tag LOCUS_30510 1240 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence576 705 1907 gene locus_tag LOCUS_30520 705 1907 CDS product IS110-like element ISDha10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461193.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence577 375 4 gene locus_tag LOCUS_30530 375 4 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_30530 1126 377 gene locus_tag LOCUS_30540 1126 377 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence578 <2116 413 gene locus_tag LOCUS_30550 <2116 413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051907092.1:type IV secretion system DNA-binding domain-containing protein >Feature sequence579 1066 617 gene locus_tag LOCUS_30560 1066 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1569 1222 gene locus_tag LOCUS_30570 1569 1222 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_30570 2108 1566 gene locus_tag LOCUS_30580 2108 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence580 <2102 1141 gene locus_tag LOCUS_30590 <2102 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207085.1:alpha/beta hydrolase >Feature sequence581 <1 1232 gene locus_tag LOCUS_30600 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861279.1:HpcH/HpaI aldolase/citrate lyase family protein 1445 1900 gene locus_tag LOCUS_30610 1445 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence582 550 1872 gene locus_tag LOCUS_30620 550 1872 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201883.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence583 9 161 gene locus_tag LOCUS_30630 9 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 317 391 gene locus_tag LOCUS_t00450 317 391 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence584 192 428 gene locus_tag LOCUS_30640 192 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 886 1503 gene locus_tag LOCUS_30650 886 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence585 <1 1105 gene locus_tag LOCUS_30660 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765279.1:glycosyltransferase family 4 protein 1181 1849 gene locus_tag LOCUS_30670 1181 1849 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107947.1 protein_id gnl|my_center|LOCUS_30670 >Feature sequence586 308 673 gene locus_tag LOCUS_30680 308 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence587 1208 387 gene locus_tag LOCUS_30690 1208 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 >Feature sequence588 79 163 gene locus_tag LOCUS_t00460 79 163 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 242 973 gene locus_tag LOCUS_30700 242 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 1114 1839 gene locus_tag LOCUS_30710 1114 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence589 102 1130 gene locus_tag LOCUS_30720 gene rlmN 102 1130 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence590 34 939 gene locus_tag LOCUS_30730 34 939 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361985.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence591 <2041 1271 gene locus_tag LOCUS_30740 <2041 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964642.1:AraC family transcriptional regulator >Feature sequence592 691 533 gene locus_tag LOCUS_30750 691 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1585 1355 gene locus_tag LOCUS_30760 1585 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence593 1076 1234 gene locus_tag LOCUS_30770 1076 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence594 140 1612 gene locus_tag LOCUS_30780 140 1612 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_30780 1684 1947 gene locus_tag LOCUS_30790 1684 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence595 1626 1551 gene locus_tag LOCUS_t00470 1626 1551 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38