>Feature sequence001 61 1383 gene locus_tag LOCUS_00010 gene hisS 61 1383 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229755.1 protein_id gnl|my_center|LOCUS_00010 1376 3133 gene locus_tag LOCUS_00020 gene aspS 1376 3133 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840888.1 protein_id gnl|my_center|LOCUS_00020 3156 4193 gene locus_tag LOCUS_00030 3156 4193 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426912.1 protein_id gnl|my_center|LOCUS_00030 4301 5620 gene locus_tag LOCUS_00040 gene murC 4301 5620 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989758.1 protein_id gnl|my_center|LOCUS_00040 5669 5959 gene locus_tag LOCUS_00050 5669 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5975 6451 gene locus_tag LOCUS_00060 5975 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6451 7455 gene locus_tag LOCUS_00070 gene ccpA 6451 7455 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 protein_id gnl|my_center|LOCUS_00070 7826 9052 gene locus_tag LOCUS_00080 gene tyrS 7826 9052 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 protein_id gnl|my_center|LOCUS_00080 9841 9101 gene locus_tag LOCUS_00090 9841 9101 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_00090 9940 10782 gene locus_tag LOCUS_00100 gene truB 9940 10782 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_00100 10782 11696 gene locus_tag LOCUS_00110 gene ribF 10782 11696 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_00110 12388 12164 gene locus_tag LOCUS_00120 12388 12164 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_00120 13874 14731 gene locus_tag LOCUS_00130 13874 14731 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845702.1 protein_id gnl|my_center|LOCUS_00130 15601 14738 gene locus_tag LOCUS_00140 15601 14738 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400423.1 protein_id gnl|my_center|LOCUS_00140 16270 15602 gene locus_tag LOCUS_00150 16270 15602 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_00150 16415 18154 gene locus_tag LOCUS_00160 gene ezrA 16415 18154 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 protein_id gnl|my_center|LOCUS_00160 18197 19333 gene locus_tag LOCUS_00170 18197 19333 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_00170 19337 20533 gene locus_tag LOCUS_00180 gene thiI 19337 20533 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 protein_id gnl|my_center|LOCUS_00180 20594 20815 gene locus_tag LOCUS_00190 gene sasP 20594 20815 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284598.1 protein_id gnl|my_center|LOCUS_00190 21419 21111 gene locus_tag LOCUS_00200 21419 21111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22119 21433 gene locus_tag LOCUS_00210 22119 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23003 23221 gene locus_tag LOCUS_00220 gene sasP 23003 23221 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 protein_id gnl|my_center|LOCUS_00220 23393 24589 gene locus_tag LOCUS_00230 23393 24589 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_00230 24701 25639 gene locus_tag LOCUS_00240 24701 25639 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545136.1 protein_id gnl|my_center|LOCUS_00240 25632 27299 gene locus_tag LOCUS_00250 25632 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_00250 27394 28065 gene locus_tag LOCUS_00260 27394 28065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990021.1 protein_id gnl|my_center|LOCUS_00260 28062 29456 gene locus_tag LOCUS_00270 28062 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29460 30032 gene locus_tag LOCUS_00280 29460 30032 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_00280 30049 32994 gene locus_tag LOCUS_00290 30049 32994 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_00290 33007 33990 gene locus_tag LOCUS_00300 gene ftsY 33007 33990 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_00300 33992 34321 gene locus_tag LOCUS_00310 33992 34321 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 protein_id gnl|my_center|LOCUS_00310 34334 35725 gene locus_tag LOCUS_00320 gene ffh 34334 35725 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830113.1 protein_id gnl|my_center|LOCUS_00320 35968 36240 gene locus_tag LOCUS_00330 gene rpsP 35968 36240 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_00330 36243 36491 gene locus_tag LOCUS_00340 36243 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36532 37041 gene locus_tag LOCUS_00350 gene rimM 36532 37041 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_00350 37031 37750 gene locus_tag LOCUS_00360 gene trmD 37031 37750 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_00360 37855 38205 gene locus_tag LOCUS_00370 gene rplS 37855 38205 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_00370 38492 39037 gene locus_tag LOCUS_00380 gene lepB 38492 39037 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 protein_id gnl|my_center|LOCUS_00380 39049 39915 gene locus_tag LOCUS_00390 gene ylqF 39049 39915 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_00390 39902 40522 gene locus_tag LOCUS_00400 39902 40522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40594 41346 gene locus_tag LOCUS_00410 40594 41346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41422 43494 gene locus_tag LOCUS_00420 gene topA 41422 43494 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_00420 43556 44860 gene locus_tag LOCUS_00430 gene trmFO 43556 44860 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_00430 44841 45761 gene locus_tag LOCUS_00440 gene xerC 44841 45761 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_00440 45906 46766 gene locus_tag LOCUS_00450 gene rpsB 45906 46766 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_00450 46836 47723 gene locus_tag LOCUS_00460 gene tsf 46836 47723 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293878.1 protein_id gnl|my_center|LOCUS_00460 48432 49148 gene locus_tag LOCUS_00470 gene pyrH 48432 49148 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565806.1 protein_id gnl|my_center|LOCUS_00470 49150 49695 gene locus_tag LOCUS_00480 gene frr 49150 49695 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_00480 49820 50575 gene locus_tag LOCUS_00490 49820 50575 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 protein_id gnl|my_center|LOCUS_00490 50575 51357 gene locus_tag LOCUS_00500 gene cdsA 50575 51357 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_00500 51359 52510 gene locus_tag LOCUS_00510 gene dxr 51359 52510 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_00510 52510 53589 gene locus_tag LOCUS_00520 gene rseP 52510 53589 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_00520 53662 57981 gene locus_tag LOCUS_00530 53662 57981 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204669935.1 protein_id gnl|my_center|LOCUS_00530 58080 58547 gene locus_tag LOCUS_00540 gene rimP 58080 58547 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_00540 58560 59873 gene locus_tag LOCUS_00550 gene nusA 58560 59873 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_00550 59886 60143 gene locus_tag LOCUS_00560 gene rulR 59886 60143 CDS product glucose-induced regulator RulR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967250.1 protein_id gnl|my_center|LOCUS_00560 60136 60432 gene locus_tag LOCUS_00570 60136 60432 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020853.1 protein_id gnl|my_center|LOCUS_00570 60437 62284 gene locus_tag LOCUS_00580 gene infB 60437 62284 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 protein_id gnl|my_center|LOCUS_00580 62293 62640 gene locus_tag LOCUS_00590 gene rbfA 62293 62640 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_00590 62799 63959 gene locus_tag LOCUS_00600 gene nagA 62799 63959 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_00600 63940 64818 gene locus_tag LOCUS_00610 63940 64818 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_00610 64857 65030 gene locus_tag LOCUS_00620 64857 65030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 65097 65246 gene locus_tag LOCUS_00630 65097 65246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65310 65810 gene locus_tag LOCUS_00640 65310 65810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65791 66510 gene locus_tag LOCUS_00650 65791 66510 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_00650 66543 67196 gene locus_tag LOCUS_00660 gene trmB 66543 67196 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_00660 67189 67509 gene locus_tag LOCUS_00670 67189 67509 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 protein_id gnl|my_center|LOCUS_00670 67521 68120 gene locus_tag LOCUS_00680 67521 68120 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006759.1 protein_id gnl|my_center|LOCUS_00680 68135 68818 gene locus_tag LOCUS_00690 68135 68818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 68821 69153 gene locus_tag LOCUS_00700 gene acpS 68821 69153 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922620.1 protein_id gnl|my_center|LOCUS_00700 69385 69720 gene locus_tag LOCUS_00710 gene ssbB 69385 69720 CDS product single-stranded DNA-binding protein SsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227798.1 protein_id gnl|my_center|LOCUS_00710 69782 71593 gene locus_tag LOCUS_00720 gene lepA 69782 71593 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726525.1 protein_id gnl|my_center|LOCUS_00720 72052 74145 gene locus_tag LOCUS_00730 72052 74145 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038974.1 protein_id gnl|my_center|LOCUS_00730 74216 74365 gene locus_tag LOCUS_00740 gene rpmG 74216 74365 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 protein_id gnl|my_center|LOCUS_00740 74403 75011 gene locus_tag LOCUS_00750 74403 75011 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_00750 75359 76345 gene locus_tag LOCUS_00760 gene comGA 75359 76345 CDS product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013193.1 protein_id gnl|my_center|LOCUS_00760 76338 77339 gene locus_tag LOCUS_00770 76338 77339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 77352 77654 gene locus_tag LOCUS_00780 gene comGC 77352 77654 CDS product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 protein_id gnl|my_center|LOCUS_00780 77644 78051 gene locus_tag LOCUS_00790 77644 78051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 78038 78259 gene locus_tag LOCUS_00800 78038 78259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 78211 78663 gene locus_tag LOCUS_00810 78211 78663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 78647 79021 gene locus_tag LOCUS_00820 78647 79021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 79097 79654 gene locus_tag LOCUS_00830 gene efp 79097 79654 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183306.1 protein_id gnl|my_center|LOCUS_00830 79734 80204 gene locus_tag LOCUS_00840 79734 80204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 80255 80593 gene locus_tag LOCUS_00850 80255 80593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 80690 81094 gene locus_tag LOCUS_00860 80690 81094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 81094 82410 gene locus_tag LOCUS_00870 gene xseA 81094 82410 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286928.1 protein_id gnl|my_center|LOCUS_00870 82420 82635 gene locus_tag LOCUS_00880 82420 82635 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_00880 82637 83485 gene locus_tag LOCUS_00890 82637 83485 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_00890 83485 85359 gene locus_tag LOCUS_00900 gene dxs 83485 85359 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_00900 85340 86140 gene locus_tag LOCUS_00910 85340 86140 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274739.1 protein_id gnl|my_center|LOCUS_00910 86149 87804 gene locus_tag LOCUS_00920 gene recN 86149 87804 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_00920 87858 88856 gene locus_tag LOCUS_00930 87858 88856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89049 90248 gene locus_tag LOCUS_00940 89049 90248 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_00940 90299 90862 gene locus_tag LOCUS_00950 90299 90862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 90914 91828 gene locus_tag LOCUS_00960 gene xerD 90914 91828 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_00960 91847 93028 gene locus_tag LOCUS_00970 gene deoB 91847 93028 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 protein_id gnl|my_center|LOCUS_00970 93040 93312 gene locus_tag LOCUS_00980 93040 93312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 94133 93321 gene locus_tag LOCUS_00990 gene spo0A 94133 93321 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_00990 96190 94463 gene locus_tag LOCUS_01000 96190 94463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 97431 96202 gene locus_tag LOCUS_01010 97431 96202 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_01010 98841 97477 gene locus_tag LOCUS_01020 98841 97477 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_01020 99128 98856 gene locus_tag LOCUS_01030 99128 98856 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_01030 99579 99262 gene locus_tag LOCUS_01040 99579 99262 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_01040 99979 99665 gene locus_tag LOCUS_01050 99979 99665 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_01050 100201 100746 gene locus_tag LOCUS_01060 100201 100746 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 protein_id gnl|my_center|LOCUS_01060 101091 100762 gene locus_tag LOCUS_01070 101091 100762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 103539 101206 gene locus_tag LOCUS_01080 103539 101206 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_01080 104233 103544 gene locus_tag LOCUS_01090 gene mtnN 104233 103544 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 protein_id gnl|my_center|LOCUS_01090 104956 104234 gene locus_tag LOCUS_01100 104956 104234 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 protein_id gnl|my_center|LOCUS_01100 105300 104956 gene locus_tag LOCUS_01110 gene rsfS 105300 104956 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033582077.1 protein_id gnl|my_center|LOCUS_01110 106393 105293 gene locus_tag LOCUS_01120 106393 105293 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166626.1 protein_id gnl|my_center|LOCUS_01120 106677 106390 gene locus_tag LOCUS_01130 gene yhbY 106677 106390 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_01130 107789 106692 gene locus_tag LOCUS_01140 gene yqeH 107789 106692 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229966.1 protein_id gnl|my_center|LOCUS_01140 107923 108609 gene locus_tag LOCUS_01150 gene sigK 107923 108609 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_01150 111258 108643 gene locus_tag LOCUS_01160 gene parC 111258 108643 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_01160 113200 111272 gene locus_tag LOCUS_01170 gene parE 113200 111272 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231552.1 protein_id gnl|my_center|LOCUS_01170 113400 113999 gene locus_tag LOCUS_01180 gene plsY 113400 113999 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724132.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence002 787 1770 gene locus_tag LOCUS_01190 787 1770 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_01190 1781 2665 gene locus_tag LOCUS_01200 1781 2665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461074.1 protein_id gnl|my_center|LOCUS_01200 2652 3437 gene locus_tag LOCUS_01210 2652 3437 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039647756.1 protein_id gnl|my_center|LOCUS_01210 4067 4462 gene locus_tag LOCUS_01220 4067 4462 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418377.1 protein_id gnl|my_center|LOCUS_01220 4575 5930 gene locus_tag LOCUS_01230 4575 5930 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966714.1 protein_id gnl|my_center|LOCUS_01230 6500 6958 gene locus_tag LOCUS_01240 gene bcp 6500 6958 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_01240 6951 7355 gene locus_tag LOCUS_01250 6951 7355 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214503.1 protein_id gnl|my_center|LOCUS_01250 7427 8215 gene locus_tag LOCUS_01260 7427 8215 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_01260 8879 8262 gene locus_tag LOCUS_01270 gene lexA 8879 8262 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930693.1 protein_id gnl|my_center|LOCUS_01270 9080 9202 gene locus_tag LOCUS_01280 9080 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9829 10599 gene locus_tag LOCUS_01290 9829 10599 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_01290 11085 11702 gene locus_tag LOCUS_01300 11085 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 11821 12186 gene locus_tag LOCUS_01310 11821 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12660 14135 gene locus_tag LOCUS_01320 12660 14135 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_01320 14427 15395 gene locus_tag LOCUS_01330 14427 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15968 20689 gene locus_tag LOCUS_01340 15968 20689 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390216.1 protein_id gnl|my_center|LOCUS_01340 20691 20951 gene locus_tag LOCUS_01350 gene groES 20691 20951 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 protein_id gnl|my_center|LOCUS_01350 20965 22581 gene locus_tag LOCUS_01360 gene groL 20965 22581 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_01360 25675 23771 gene locus_tag LOCUS_01370 25675 23771 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_01370 25917 26675 gene locus_tag LOCUS_01380 25917 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 27092 27844 gene locus_tag LOCUS_01390 27092 27844 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_01390 27841 28593 gene locus_tag LOCUS_01400 27841 28593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 29337 28903 gene locus_tag LOCUS_01410 29337 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 29723 29334 gene locus_tag LOCUS_01420 29723 29334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 29979 29716 gene locus_tag LOCUS_01430 29979 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 31722 30910 gene locus_tag LOCUS_01440 gene yidA 31722 30910 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_01440 32015 32884 gene locus_tag LOCUS_01450 32015 32884 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725703.1 protein_id gnl|my_center|LOCUS_01450 32885 33472 gene locus_tag LOCUS_01460 32885 33472 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_01460 33472 33981 gene locus_tag LOCUS_01470 gene trmL 33472 33981 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_01470 33971 34621 gene locus_tag LOCUS_01480 33971 34621 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739741.1 protein_id gnl|my_center|LOCUS_01480 35318 34611 gene locus_tag LOCUS_01490 35318 34611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 36128 35544 gene locus_tag LOCUS_01500 36128 35544 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_01500 36536 36153 gene locus_tag LOCUS_01510 36536 36153 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_01510 37574 36660 gene locus_tag LOCUS_01520 gene ylbJ 37574 36660 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 protein_id gnl|my_center|LOCUS_01520 37632 38858 gene locus_tag LOCUS_01530 gene hflX 37632 38858 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_01530 38872 39057 gene locus_tag LOCUS_01540 38872 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 39111 40100 gene locus_tag LOCUS_01550 gene argF 39111 40100 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_01550 40296 41042 gene locus_tag LOCUS_01560 40296 41042 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_01560 41046 41876 gene locus_tag LOCUS_01570 41046 41876 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027818.1 protein_id gnl|my_center|LOCUS_01570 42158 43378 gene locus_tag LOCUS_01580 42158 43378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 44317 43628 gene locus_tag LOCUS_01590 44317 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 44953 44429 gene locus_tag LOCUS_01600 44953 44429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 46422 45334 gene locus_tag LOCUS_01610 46422 45334 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 protein_id gnl|my_center|LOCUS_01610 47107 46415 gene locus_tag LOCUS_01620 gene vanR 47107 46415 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_01620 48600 47212 gene locus_tag LOCUS_01630 gene argH 48600 47212 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_01630 49852 48641 gene locus_tag LOCUS_01640 49852 48641 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_01640 50013 51131 gene locus_tag LOCUS_01650 50013 51131 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_01650 51303 52016 gene locus_tag LOCUS_01660 51303 52016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_01660 52009 53619 gene locus_tag LOCUS_01670 52009 53619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 54078 55115 gene locus_tag LOCUS_01680 gene argC 54078 55115 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_01680 55127 56350 gene locus_tag LOCUS_01690 gene argJ 55127 56350 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965687.1 protein_id gnl|my_center|LOCUS_01690 56362 57225 gene locus_tag LOCUS_01700 gene argB 56362 57225 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_01700 57501 57881 gene locus_tag LOCUS_01710 57501 57881 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964084.1 protein_id gnl|my_center|LOCUS_01710 57901 58656 gene locus_tag LOCUS_01720 57901 58656 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_01720 58672 59148 gene locus_tag LOCUS_01730 58672 59148 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_01730 59347 60519 gene locus_tag LOCUS_01740 59347 60519 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_01740 61606 60776 gene locus_tag LOCUS_01750 61606 60776 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_01750 63369 61603 gene locus_tag LOCUS_01760 gene rnjA 63369 61603 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_01760 64311 63445 gene locus_tag LOCUS_01770 64311 63445 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 protein_id gnl|my_center|LOCUS_01770 64497 64862 gene locus_tag LOCUS_01780 gene ytrA 64497 64862 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_01780 64862 65764 gene locus_tag LOCUS_01790 64862 65764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_01790 65736 67610 gene locus_tag LOCUS_01800 65736 67610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 67613 69133 gene locus_tag LOCUS_01810 67613 69133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 69181 69486 gene locus_tag LOCUS_01820 gene trxA 69181 69486 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453775.1 protein_id gnl|my_center|LOCUS_01820 69566 70180 gene locus_tag LOCUS_01830 69566 70180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 70546 70214 gene locus_tag LOCUS_01840 70546 70214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 70644 71828 gene locus_tag LOCUS_01850 70644 71828 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_01850 71821 72420 gene locus_tag LOCUS_01860 71821 72420 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_01860 72556 74031 gene locus_tag LOCUS_01870 72556 74031 CDS product peptidoglycan binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358307.1 protein_id gnl|my_center|LOCUS_01870 74251 74901 gene locus_tag LOCUS_01880 74251 74901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 75161 76945 gene locus_tag LOCUS_01890 75161 76945 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_01890 77483 78943 gene locus_tag LOCUS_01900 77483 78943 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918342.1 protein_id gnl|my_center|LOCUS_01900 79354 80142 gene locus_tag LOCUS_01910 79354 80142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 80305 81492 gene locus_tag LOCUS_01920 80305 81492 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_01920 81495 82232 gene locus_tag LOCUS_01930 81495 82232 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_01930 82246 83451 gene locus_tag LOCUS_01940 82246 83451 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_01940 84070 84264 gene locus_tag LOCUS_01950 84070 84264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 85262 84369 gene locus_tag LOCUS_01960 85262 84369 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_01960 85525 85704 gene locus_tag LOCUS_01970 85525 85704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 85723 86997 gene locus_tag LOCUS_01980 85723 86997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_01980 86990 88498 gene locus_tag LOCUS_01990 gene cas10 86990 88498 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_01990 88495 89598 gene locus_tag LOCUS_02000 88495 89598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 89598 90407 gene locus_tag LOCUS_02010 gene cmr4 89598 90407 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_02010 90400 90807 gene locus_tag LOCUS_02020 90400 90807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 90809 91618 gene locus_tag LOCUS_02030 gene cmr6 90809 91618 CDS product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986670.1 protein_id gnl|my_center|LOCUS_02030 91627 93792 gene locus_tag LOCUS_02040 91627 93792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986676.1 protein_id gnl|my_center|LOCUS_02040 93794 95689 gene locus_tag LOCUS_02050 93794 95689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 95692 95952 gene locus_tag LOCUS_02060 gene cas2 95692 95952 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546411.1 protein_id gnl|my_center|LOCUS_02060 95963 96694 gene locus_tag LOCUS_02070 gene cas6 95963 96694 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_02070 96967 97622 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtaccttatctaatgaggaattgttac 97768 98439 gene locus_tag LOCUS_02080 97768 98439 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_02080 98433 99113 gene locus_tag LOCUS_02090 98433 99113 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_02090 99284 100084 gene locus_tag LOCUS_02100 99284 100084 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389749.1 protein_id gnl|my_center|LOCUS_02100 100488 101348 gene locus_tag LOCUS_02110 100488 101348 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785992.1 protein_id gnl|my_center|LOCUS_02110 101750 103243 gene locus_tag LOCUS_02120 gene glpK 101750 103243 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_02120 104657 103338 gene locus_tag LOCUS_02130 104657 103338 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence003 174 2318 gene locus_tag LOCUS_02140 174 2318 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_02140 2436 2780 gene locus_tag LOCUS_02150 2436 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 2784 3581 gene locus_tag LOCUS_02160 2784 3581 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862012.1 protein_id gnl|my_center|LOCUS_02160 3624 4082 gene locus_tag LOCUS_02170 3624 4082 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_02170 4282 6276 gene locus_tag LOCUS_02180 gene ligA 4282 6276 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_02180 6318 7394 gene locus_tag LOCUS_02190 6318 7394 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484897.1 protein_id gnl|my_center|LOCUS_02190 7404 7694 gene locus_tag LOCUS_02200 7404 7694 CDS product Glu-tRNA amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183058.1 protein_id gnl|my_center|LOCUS_02200 7694 9142 gene locus_tag LOCUS_02210 7694 9142 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166930.1 protein_id gnl|my_center|LOCUS_02210 9149 10582 gene locus_tag LOCUS_02220 gene gatB 9149 10582 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358703.1 protein_id gnl|my_center|LOCUS_02220 10632 11333 gene locus_tag LOCUS_02230 10632 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11366 12721 gene locus_tag LOCUS_02240 gene rlmD 11366 12721 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_02240 12992 13978 gene locus_tag LOCUS_02250 12992 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 13987 14232 gene locus_tag LOCUS_02260 13987 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14260 14685 gene locus_tag LOCUS_02270 14260 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 14690 15610 gene locus_tag LOCUS_02280 14690 15610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 16304 17503 gene locus_tag LOCUS_02290 16304 17503 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462283.1 protein_id gnl|my_center|LOCUS_02290 17764 18468 gene locus_tag LOCUS_02300 17764 18468 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217125.1 protein_id gnl|my_center|LOCUS_02300 18682 19983 gene locus_tag LOCUS_02310 18682 19983 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_02310 20136 20906 gene locus_tag LOCUS_02320 20136 20906 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_02320 20912 22060 gene locus_tag LOCUS_02330 20912 22060 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_02330 22057 22584 gene locus_tag LOCUS_02340 22057 22584 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964804.1 protein_id gnl|my_center|LOCUS_02340 22944 24092 gene locus_tag LOCUS_02350 22944 24092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 24101 24847 gene locus_tag LOCUS_02360 24101 24847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 25360 26112 gene locus_tag LOCUS_02370 gene yaaA 25360 26112 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_02370 26228 26494 gene locus_tag LOCUS_02380 gene rpsO 26228 26494 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 protein_id gnl|my_center|LOCUS_02380 27352 26531 gene locus_tag LOCUS_02390 27352 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 27905 27354 gene locus_tag LOCUS_02400 27905 27354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 28579 28022 gene locus_tag LOCUS_02410 28579 28022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 29706 28654 gene locus_tag LOCUS_02420 29706 28654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 30437 29706 gene locus_tag LOCUS_02430 30437 29706 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_02430 31199 30438 gene locus_tag LOCUS_02440 gene cps4B 31199 30438 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_02440 31900 31202 gene locus_tag LOCUS_02450 31900 31202 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_02450 32230 34134 gene locus_tag LOCUS_02460 32230 34134 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_02460 34508 35767 gene locus_tag LOCUS_02470 34508 35767 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_02470 35760 36095 gene locus_tag LOCUS_02480 35760 36095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 36217 37134 gene locus_tag LOCUS_02490 36217 37134 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_02490 37183 38136 gene locus_tag LOCUS_02500 37183 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 38725 38372 gene locus_tag LOCUS_02510 38725 38372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 40638 38821 gene locus_tag LOCUS_02520 gene glmS 40638 38821 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_02520 41032 41550 gene locus_tag LOCUS_02530 41032 41550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 42235 41570 gene locus_tag LOCUS_02540 42235 41570 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_02540 43463 42273 gene locus_tag LOCUS_02550 43463 42273 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_02550 43750 44277 gene locus_tag LOCUS_02560 43750 44277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 44433 44966 gene locus_tag LOCUS_02570 44433 44966 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_02570 44976 45425 gene locus_tag LOCUS_02580 gene tsaE 44976 45425 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_02580 45422 46024 gene locus_tag LOCUS_02590 gene tsaB 45422 46024 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183392.1 protein_id gnl|my_center|LOCUS_02590 46018 46461 gene locus_tag LOCUS_02600 gene rimI 46018 46461 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_02600 46464 47498 gene locus_tag LOCUS_02610 gene tsaD 46464 47498 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414606.1 protein_id gnl|my_center|LOCUS_02610 47491 48120 gene locus_tag LOCUS_02620 47491 48120 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_02620 48176 49561 gene locus_tag LOCUS_02630 gene asnS 48176 49561 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432177.1 protein_id gnl|my_center|LOCUS_02630 49626 51089 gene locus_tag LOCUS_02640 49626 51089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 51099 52484 gene locus_tag LOCUS_02650 51099 52484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 52685 52852 gene locus_tag LOCUS_02660 52685 52852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 53323 53186 gene locus_tag LOCUS_02670 53323 53186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 53452 54825 gene locus_tag LOCUS_02680 53452 54825 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_02680 54923 57031 gene locus_tag LOCUS_02690 54923 57031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 57533 57024 gene locus_tag LOCUS_02700 gene spmB 57533 57024 CDS product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029514.1 protein_id gnl|my_center|LOCUS_02700 58098 57526 gene locus_tag LOCUS_02710 58098 57526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 59107 58091 gene locus_tag LOCUS_02720 59107 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 59427 60026 gene locus_tag LOCUS_02730 59427 60026 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_02730 60039 60494 gene locus_tag LOCUS_02740 60039 60494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 62060 60537 gene locus_tag LOCUS_02750 62060 60537 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_02750 62219 62944 gene locus_tag LOCUS_02760 62219 62944 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830978.1 protein_id gnl|my_center|LOCUS_02760 63016 63252 gene locus_tag LOCUS_02770 63016 63252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 63526 64050 gene locus_tag LOCUS_02780 63526 64050 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 protein_id gnl|my_center|LOCUS_02780 64047 65780 gene locus_tag LOCUS_02790 gene thrS 64047 65780 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_02790 66485 65808 gene locus_tag LOCUS_02800 66485 65808 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_02800 66711 67064 gene locus_tag LOCUS_02810 66711 67064 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_02810 67141 68028 gene locus_tag LOCUS_02820 67141 68028 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183318.1 protein_id gnl|my_center|LOCUS_02820 68028 68498 gene locus_tag LOCUS_02830 gene folA 68028 68498 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 protein_id gnl|my_center|LOCUS_02830 68502 69218 gene locus_tag LOCUS_02840 68502 69218 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_02840 69445 69702 gene locus_tag LOCUS_02850 69445 69702 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_02850 69699 70352 gene locus_tag LOCUS_02860 69699 70352 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596541.1 protein_id gnl|my_center|LOCUS_02860 70790 70335 gene locus_tag LOCUS_02870 70790 70335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 72109 70787 gene locus_tag LOCUS_02880 72109 70787 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_02880 72368 72159 gene locus_tag LOCUS_02890 72368 72159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 72545 72631 gene locus_tag LOCUS_t00010 72545 72631 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73426 73007 gene locus_tag LOCUS_02900 73426 73007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence004 162 521 gene locus_tag LOCUS_02910 162 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 531 1022 gene locus_tag LOCUS_02920 531 1022 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_02920 2347 1019 gene locus_tag LOCUS_02930 2347 1019 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446180.1 protein_id gnl|my_center|LOCUS_02930 3289 2429 gene locus_tag LOCUS_02940 3289 2429 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860715.1 protein_id gnl|my_center|LOCUS_02940 5173 3401 gene locus_tag LOCUS_02950 5173 3401 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_02950 7208 5319 gene locus_tag LOCUS_02960 7208 5319 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_02960 8128 7208 gene locus_tag LOCUS_02970 gene pfkB 8128 7208 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_02970 8877 8125 gene locus_tag LOCUS_02980 8877 8125 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722576.1 protein_id gnl|my_center|LOCUS_02980 9828 8980 gene locus_tag LOCUS_02990 9828 8980 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_02990 10726 10031 gene locus_tag LOCUS_03000 10726 10031 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_03000 12154 10814 gene locus_tag LOCUS_03010 12154 10814 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_03010 12741 12154 gene locus_tag LOCUS_03020 12741 12154 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03020 12937 13935 gene locus_tag LOCUS_03030 12937 13935 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_03030 13935 14876 gene locus_tag LOCUS_03040 13935 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 15271 15113 gene locus_tag LOCUS_03050 15271 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 15443 15976 gene locus_tag LOCUS_03060 15443 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 16222 16007 gene locus_tag LOCUS_03070 16222 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 17014 16340 gene locus_tag LOCUS_03080 gene rgbR 17014 16340 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_03080 18215 17313 gene locus_tag LOCUS_03090 gene trxB 18215 17313 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_03090 18816 19028 gene locus_tag LOCUS_03100 18816 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 19947 19360 gene locus_tag LOCUS_03110 19947 19360 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 protein_id gnl|my_center|LOCUS_03110 20430 20642 gene locus_tag LOCUS_03120 20430 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03120 21979 20795 gene locus_tag LOCUS_03130 gene rlmD 21979 20795 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_03130 23229 22060 gene locus_tag LOCUS_03140 23229 22060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 23379 23504 gene locus_tag LOCUS_03150 23379 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 24073 23648 gene locus_tag LOCUS_03160 gene fabZ 24073 23648 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_03160 25319 24078 gene locus_tag LOCUS_03170 gene fabF 25319 24078 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_03170 26083 25331 gene locus_tag LOCUS_03180 gene fabG 26083 25331 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_03180 27017 26085 gene locus_tag LOCUS_03190 gene fabD 27017 26085 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048428.1 protein_id gnl|my_center|LOCUS_03190 28081 27017 gene locus_tag LOCUS_03200 28081 27017 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966843.1 protein_id gnl|my_center|LOCUS_03200 29016 28084 gene locus_tag LOCUS_03210 29016 28084 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_03210 29961 29020 gene locus_tag LOCUS_03220 29961 29020 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_03220 30431 29970 gene locus_tag LOCUS_03230 30431 29970 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993768.1 protein_id gnl|my_center|LOCUS_03230 31374 30424 gene locus_tag LOCUS_03240 31374 30424 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889903.1 protein_id gnl|my_center|LOCUS_03240 32246 31374 gene locus_tag LOCUS_03250 gene accD 32246 31374 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_03250 33602 32250 gene locus_tag LOCUS_03260 33602 32250 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_03260 34049 33609 gene locus_tag LOCUS_03270 gene accB 34049 33609 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566769.1 protein_id gnl|my_center|LOCUS_03270 34396 34169 gene locus_tag LOCUS_03280 gene acpP 34396 34169 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_03280 34582 35478 gene locus_tag LOCUS_03290 34582 35478 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_03290 36342 35566 gene locus_tag LOCUS_03300 36342 35566 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_03300 36460 36954 gene locus_tag LOCUS_03310 36460 36954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254447.1 protein_id gnl|my_center|LOCUS_03310 37780 36971 gene locus_tag LOCUS_03320 37780 36971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898037.1 protein_id gnl|my_center|LOCUS_03320 37991 38491 gene locus_tag LOCUS_03330 37991 38491 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809539.1 protein_id gnl|my_center|LOCUS_03330 39521 38493 gene locus_tag LOCUS_03340 39521 38493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 39709 40911 gene locus_tag LOCUS_03350 39709 40911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 41032 42351 gene locus_tag LOCUS_03360 41032 42351 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722638.1 protein_id gnl|my_center|LOCUS_03360 42440 42802 gene locus_tag LOCUS_03370 gene lrgA 42440 42802 CDS product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399155.1 protein_id gnl|my_center|LOCUS_03370 42795 43487 gene locus_tag LOCUS_03380 42795 43487 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_03380 46367 43836 gene locus_tag LOCUS_03390 46367 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 48002 46986 gene locus_tag LOCUS_03400 gene gap 48002 46986 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_03400 48247 48819 gene locus_tag LOCUS_03410 gene clpP 48247 48819 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_03410 49471 49034 gene locus_tag LOCUS_03420 49471 49034 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948707.1 protein_id gnl|my_center|LOCUS_03420 49862 49515 gene locus_tag LOCUS_03430 49862 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 51537 49876 gene locus_tag LOCUS_03440 gene argS 51537 49876 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_03440 53204 51684 gene locus_tag LOCUS_03450 gene cls 53204 51684 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_03450 53586 53206 gene locus_tag LOCUS_03460 53586 53206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 53642 55519 gene locus_tag LOCUS_03470 53642 55519 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_03470 56762 55530 gene locus_tag LOCUS_03480 56762 55530 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262734.1 protein_id gnl|my_center|LOCUS_03480 57649 56960 gene locus_tag LOCUS_03490 57649 56960 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_03490 58648 57653 gene locus_tag LOCUS_03500 58648 57653 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_03500 60573 58648 gene locus_tag LOCUS_03510 60573 58648 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_03510 60752 62605 gene locus_tag LOCUS_03520 60752 62605 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_03520 62836 62615 gene locus_tag LOCUS_03530 62836 62615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 63094 62891 gene locus_tag LOCUS_03540 63094 62891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 63767 63270 gene locus_tag LOCUS_03550 63767 63270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 64825 63764 gene locus_tag LOCUS_03560 64825 63764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 65475 64822 gene locus_tag LOCUS_03570 65475 64822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638551.1 protein_id gnl|my_center|LOCUS_03570 65783 65478 gene locus_tag LOCUS_03580 65783 65478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 66148 65978 gene locus_tag LOCUS_03590 66148 65978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 66742 66317 gene locus_tag LOCUS_03600 66742 66317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 67382 66753 gene locus_tag LOCUS_03610 67382 66753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 protein_id gnl|my_center|LOCUS_03610 69438 67384 gene locus_tag LOCUS_03620 69438 67384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 69835 69509 gene locus_tag LOCUS_03630 69835 69509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 71123 70482 gene locus_tag LOCUS_03640 71123 70482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 71683 71549 gene locus_tag LOCUS_03650 71683 71549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 71828 71652 gene locus_tag LOCUS_03660 71828 71652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 72036 72728 gene locus_tag LOCUS_03670 gene lytT 72036 72728 CDS product two-component system response regulator LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229479.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence005 609 112 gene locus_tag LOCUS_03680 609 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4068 850 gene locus_tag LOCUS_03690 gene carB 4068 850 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_03690 4371 4841 gene locus_tag LOCUS_03700 4371 4841 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948074.1 protein_id gnl|my_center|LOCUS_03700 4895 5770 gene locus_tag LOCUS_03710 4895 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7023 5821 gene locus_tag LOCUS_03720 gene ilvA 7023 5821 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_03720 7299 7120 gene locus_tag LOCUS_03730 7299 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8117 7299 gene locus_tag LOCUS_03740 8117 7299 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_03740 8698 8261 gene locus_tag LOCUS_03750 8698 8261 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379156.1 protein_id gnl|my_center|LOCUS_03750 9267 8686 gene locus_tag LOCUS_03760 9267 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10068 9268 gene locus_tag LOCUS_03770 10068 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 11858 10419 gene locus_tag LOCUS_03780 gene gltX 11858 10419 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_03780 12342 11860 gene locus_tag LOCUS_03790 gene ispF 12342 11860 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_03790 13116 12415 gene locus_tag LOCUS_03800 13116 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14907 13303 gene locus_tag LOCUS_03810 14907 13303 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_03810 16565 15312 gene locus_tag LOCUS_03820 16565 15312 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836379.1 protein_id gnl|my_center|LOCUS_03820 19294 16646 gene locus_tag LOCUS_03830 gene adhE 19294 16646 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836312.1 protein_id gnl|my_center|LOCUS_03830 20163 19474 gene locus_tag LOCUS_03840 20163 19474 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_03840 21114 20173 gene locus_tag LOCUS_03850 21114 20173 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_03850 22025 21234 gene locus_tag LOCUS_03860 22025 21234 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_03860 22552 22079 gene locus_tag LOCUS_03870 22552 22079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 23374 22622 gene locus_tag LOCUS_03880 23374 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 23685 23377 gene locus_tag LOCUS_03890 23685 23377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 24431 23691 gene locus_tag LOCUS_03900 24431 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29547 24556 gene locus_tag LOCUS_03910 29547 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 31331 29904 gene locus_tag LOCUS_03920 31331 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 31856 31692 gene locus_tag LOCUS_03930 31856 31692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 32524 31967 gene locus_tag LOCUS_03940 gene nusG 32524 31967 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_03940 32714 32526 gene locus_tag LOCUS_03950 32714 32526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 32875 32726 gene locus_tag LOCUS_03960 gene rpmG 32875 32726 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700682.1 protein_id gnl|my_center|LOCUS_03960 33538 32924 gene locus_tag LOCUS_03970 33538 32924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 34221 33556 gene locus_tag LOCUS_03980 gene rlmB 34221 33556 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_03980 34696 34319 gene locus_tag LOCUS_03990 34696 34319 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_03990 36033 34696 gene locus_tag LOCUS_04000 gene cysS 36033 34696 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_04000 36815 36294 gene locus_tag LOCUS_04010 36815 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 37672 36893 gene locus_tag LOCUS_04020 37672 36893 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_04020 39144 37717 gene locus_tag LOCUS_04030 gene glgA 39144 37717 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 protein_id gnl|my_center|LOCUS_04030 40253 39144 gene locus_tag LOCUS_04040 gene glgD 40253 39144 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_04040 41392 40268 gene locus_tag LOCUS_04050 41392 40268 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922500.1 protein_id gnl|my_center|LOCUS_04050 41617 42039 gene locus_tag LOCUS_04060 gene cwlJ 41617 42039 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_04060 42052 42399 gene locus_tag LOCUS_04070 42052 42399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 42539 44359 gene locus_tag LOCUS_04080 gene asnB 42539 44359 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_04080 45588 44428 gene locus_tag LOCUS_04090 gene folC 45588 44428 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_04090 46343 45681 gene locus_tag LOCUS_04100 46343 45681 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_04100 47163 46333 gene locus_tag LOCUS_04110 47163 46333 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_04110 47984 47163 gene locus_tag LOCUS_04120 47984 47163 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_04120 48813 48037 gene locus_tag LOCUS_04130 48813 48037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 49137 48853 gene locus_tag LOCUS_04140 49137 48853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 49813 49517 gene locus_tag LOCUS_04150 49813 49517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 50380 49862 gene locus_tag LOCUS_04160 50380 49862 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 protein_id gnl|my_center|LOCUS_04160 52109 50742 gene locus_tag LOCUS_04170 52109 50742 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_04170 52485 52219 gene locus_tag LOCUS_04180 52485 52219 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194330.1 protein_id gnl|my_center|LOCUS_04180 54127 52487 gene locus_tag LOCUS_04190 54127 52487 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_04190 54802 54137 gene locus_tag LOCUS_04200 54802 54137 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939481.1 protein_id gnl|my_center|LOCUS_04200 55867 54995 gene locus_tag LOCUS_04210 55867 54995 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_04210 56859 56275 gene locus_tag LOCUS_04220 56859 56275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 58417 57029 gene locus_tag LOCUS_04230 gene gltA 58417 57029 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_04230 59265 58417 gene locus_tag LOCUS_04240 59265 58417 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_04240 60042 59458 gene locus_tag LOCUS_04250 60042 59458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 60227 60931 gene locus_tag LOCUS_04260 60227 60931 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_04260 61057 62193 gene locus_tag LOCUS_04270 gene tgt 61057 62193 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04270 62195 63220 gene locus_tag LOCUS_04280 gene queA 62195 63220 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence006 185 1720 gene locus_tag LOCUS_04290 185 1720 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649719.1 protein_id gnl|my_center|LOCUS_04290 2651 1695 gene locus_tag LOCUS_04300 2651 1695 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129416.1 protein_id gnl|my_center|LOCUS_04300 3894 2656 gene locus_tag LOCUS_04310 3894 2656 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_04310 5050 3896 gene locus_tag LOCUS_04320 5050 3896 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_04320 5381 6865 gene locus_tag LOCUS_04330 gene thrC 5381 6865 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_04330 6875 7768 gene locus_tag LOCUS_04340 gene thrB 6875 7768 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_04340 8018 7797 gene locus_tag LOCUS_04350 8018 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8359 8117 gene locus_tag LOCUS_04360 8359 8117 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_04360 8498 9184 gene locus_tag LOCUS_04370 8498 9184 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_04370 9184 9426 gene locus_tag LOCUS_04380 9184 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 9426 10166 gene locus_tag LOCUS_04390 9426 10166 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_04390 10479 10916 gene locus_tag LOCUS_04400 gene rplM 10479 10916 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906417.1 protein_id gnl|my_center|LOCUS_04400 10934 11326 gene locus_tag LOCUS_04410 gene rpsI 10934 11326 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_04410 11534 12010 gene locus_tag LOCUS_04420 11534 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11989 12588 gene locus_tag LOCUS_04430 11989 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 12632 13675 gene locus_tag LOCUS_04440 12632 13675 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287705.1 protein_id gnl|my_center|LOCUS_04440 13749 13922 gene locus_tag LOCUS_04450 13749 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 14771 14088 gene locus_tag LOCUS_04460 14771 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861924.1 protein_id gnl|my_center|LOCUS_04460 15258 14764 gene locus_tag LOCUS_04470 15258 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 16141 15233 gene locus_tag LOCUS_04480 16141 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 16452 17810 gene locus_tag LOCUS_04490 16452 17810 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_04490 17810 18520 gene locus_tag LOCUS_04500 17810 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 19348 25674 gene locus_tag LOCUS_04510 19348 25674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 26217 27569 gene locus_tag LOCUS_04520 26217 27569 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485248.1 protein_id gnl|my_center|LOCUS_04520 27645 27794 gene locus_tag LOCUS_04530 27645 27794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 28255 28398 gene locus_tag LOCUS_04540 28255 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28615 28932 gene locus_tag LOCUS_04550 28615 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 29405 29551 gene locus_tag LOCUS_04560 29405 29551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 30091 30420 gene locus_tag LOCUS_04570 30091 30420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 30481 30678 gene locus_tag LOCUS_04580 30481 30678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 31294 31635 gene locus_tag LOCUS_04590 31294 31635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 32455 32276 gene locus_tag LOCUS_04600 32455 32276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 33143 32760 gene locus_tag LOCUS_04610 33143 32760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 33839 33180 gene locus_tag LOCUS_04620 33839 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 35196 37439 gene locus_tag LOCUS_04630 35196 37439 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246323.1 protein_id gnl|my_center|LOCUS_04630 37709 38224 gene locus_tag LOCUS_04640 37709 38224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 38691 38867 gene locus_tag LOCUS_04650 38691 38867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 39192 39821 gene locus_tag LOCUS_04660 39192 39821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 39822 40328 gene locus_tag LOCUS_04670 39822 40328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 41088 42701 gene locus_tag LOCUS_04680 41088 42701 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_04680 42825 43358 gene locus_tag LOCUS_04690 42825 43358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 43985 44539 gene locus_tag LOCUS_04700 43985 44539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 45029 44550 gene locus_tag LOCUS_04710 45029 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 45512 45588 gene locus_tag LOCUS_t00020 45512 45588 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 45617 45693 gene locus_tag LOCUS_t00030 45617 45693 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 45708 45783 gene locus_tag LOCUS_t00040 45708 45783 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45840 46598 gene locus_tag LOCUS_04720 45840 46598 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_04720 46598 47974 gene locus_tag LOCUS_04730 46598 47974 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_04730 47961 48956 gene locus_tag LOCUS_04740 47961 48956 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_04740 52309 49112 gene locus_tag LOCUS_04750 52309 49112 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_04750 52651 52818 gene locus_tag LOCUS_04760 52651 52818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 52808 52978 gene locus_tag LOCUS_04770 52808 52978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 54560 53049 gene locus_tag LOCUS_04780 54560 53049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 54826 54533 gene locus_tag LOCUS_04790 54826 54533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 55465 55001 gene locus_tag LOCUS_04800 55465 55001 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869083.1 protein_id gnl|my_center|LOCUS_04800 55599 55524 gene locus_tag LOCUS_t00050 55599 55524 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 55732 56415 gene locus_tag LOCUS_04810 55732 56415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 57326 56481 gene locus_tag LOCUS_04820 57326 56481 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861326.1 protein_id gnl|my_center|LOCUS_04820 57443 58306 gene locus_tag LOCUS_04830 57443 58306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 58548 58623 gene locus_tag LOCUS_t00060 58548 58623 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 1234 371 gene locus_tag LOCUS_04840 1234 371 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_04840 1470 1243 gene locus_tag LOCUS_04850 1470 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2863 1472 gene locus_tag LOCUS_04860 gene mnmE 2863 1472 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131240.1 protein_id gnl|my_center|LOCUS_04860 2906 3901 gene locus_tag LOCUS_04870 2906 3901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_04870 5166 3976 gene locus_tag LOCUS_04880 5166 3976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476412.1 protein_id gnl|my_center|LOCUS_04880 6301 5684 gene locus_tag LOCUS_04890 6301 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7302 6700 gene locus_tag LOCUS_04900 7302 6700 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 protein_id gnl|my_center|LOCUS_04900 8213 7320 gene locus_tag LOCUS_04910 gene spoIIIJ 8213 7320 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727738.1 protein_id gnl|my_center|LOCUS_04910 8552 8214 gene locus_tag LOCUS_04920 gene rnpA 8552 8214 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183578.1 protein_id gnl|my_center|LOCUS_04920 8727 8593 gene locus_tag LOCUS_04930 8727 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15053 9105 gene locus_tag LOCUS_04940 15053 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 15714 17060 gene locus_tag LOCUS_04950 gene dnaA 15714 17060 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873974.1 protein_id gnl|my_center|LOCUS_04950 17215 18324 gene locus_tag LOCUS_04960 gene dnaN 17215 18324 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_04960 18534 18740 gene locus_tag LOCUS_04970 gene yaaA 18534 18740 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583899.1 protein_id gnl|my_center|LOCUS_04970 18740 19837 gene locus_tag LOCUS_04980 gene recF 18740 19837 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_04980 19837 21762 gene locus_tag LOCUS_04990 gene gyrB 19837 21762 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_04990 21778 24237 gene locus_tag LOCUS_05000 gene gyrA 21778 24237 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_05000 24528 25730 gene locus_tag LOCUS_05010 24528 25730 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542320.1 protein_id gnl|my_center|LOCUS_05010 26283 25924 gene locus_tag LOCUS_05020 26283 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 26864 27505 gene locus_tag LOCUS_05030 26864 27505 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_05030 27765 29045 gene locus_tag LOCUS_05040 gene serS 27765 29045 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_05040 29062 29883 gene locus_tag LOCUS_05050 29062 29883 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108784.1 protein_id gnl|my_center|LOCUS_05050 30084 30515 gene locus_tag LOCUS_05060 30084 30515 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437661.1 protein_id gnl|my_center|LOCUS_05060 30524 30943 gene locus_tag LOCUS_05070 30524 30943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 31034 31972 gene locus_tag LOCUS_05080 31034 31972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015509966.1 protein_id gnl|my_center|LOCUS_05080 31972 33102 gene locus_tag LOCUS_05090 31972 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 33089 34237 gene locus_tag LOCUS_05100 33089 34237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 protein_id gnl|my_center|LOCUS_05100 34250 34753 gene locus_tag LOCUS_05110 34250 34753 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 protein_id gnl|my_center|LOCUS_05110 34910 35359 gene locus_tag LOCUS_05120 gene tadA 34910 35359 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_05120 35482 37287 gene locus_tag LOCUS_05130 gene dnaX 35482 37287 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 protein_id gnl|my_center|LOCUS_05130 37300 37893 gene locus_tag LOCUS_05140 gene recR 37300 37893 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637790.1 protein_id gnl|my_center|LOCUS_05140 38358 38978 gene locus_tag LOCUS_05150 gene tmk 38358 38978 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677216.1 protein_id gnl|my_center|LOCUS_05150 38975 39916 gene locus_tag LOCUS_05160 gene holB 38975 39916 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169561.1 protein_id gnl|my_center|LOCUS_05160 39930 40742 gene locus_tag LOCUS_05170 39930 40742 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_05170 40742 41479 gene locus_tag LOCUS_05180 40742 41479 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183570.1 protein_id gnl|my_center|LOCUS_05180 41472 42326 gene locus_tag LOCUS_05190 gene rsmI 41472 42326 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_05190 42442 43758 gene locus_tag LOCUS_05200 gene pgdA 42442 43758 CDS product peptidoglycan N-acetylglucosamine deacetylase PgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733946.1 protein_id gnl|my_center|LOCUS_05200 44361 44981 gene locus_tag LOCUS_05210 44361 44981 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_05210 45354 47282 gene locus_tag LOCUS_05220 gene metG 45354 47282 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_05220 47787 48428 gene locus_tag LOCUS_05230 47787 48428 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 protein_id gnl|my_center|LOCUS_05230 48651 49397 gene locus_tag LOCUS_05240 gene spo0A 48651 49397 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_05240 50561 49746 gene locus_tag LOCUS_05250 gene spo0A 50561 49746 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 protein_id gnl|my_center|LOCUS_05250 51009 52505 gene locus_tag LOCUS_05260 51009 52505 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_05260 52607 54109 gene locus_tag LOCUS_05270 52607 54109 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837625.1 protein_id gnl|my_center|LOCUS_05270 54267 55769 gene locus_tag LOCUS_05280 54267 55769 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_05280 56643 55795 gene locus_tag LOCUS_05290 56643 55795 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence008 1956 211 gene locus_tag LOCUS_05300 1956 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3286 2720 gene locus_tag LOCUS_05310 3286 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4422 3358 gene locus_tag LOCUS_05320 4422 3358 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 protein_id gnl|my_center|LOCUS_05320 4479 4895 gene locus_tag LOCUS_05330 4479 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6010 4985 gene locus_tag LOCUS_05340 gene recA 6010 4985 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287328.1 protein_id gnl|my_center|LOCUS_05340 6506 6048 gene locus_tag LOCUS_05350 6506 6048 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013447851.1 protein_id gnl|my_center|LOCUS_05350 7099 6506 gene locus_tag LOCUS_05360 gene pgsA 7099 6506 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723921.1 protein_id gnl|my_center|LOCUS_05360 8112 7099 gene locus_tag LOCUS_05370 8112 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 9503 8358 gene locus_tag LOCUS_05380 gene fucO 9503 8358 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_05380 10087 9956 gene locus_tag LOCUS_05390 10087 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10325 10203 gene locus_tag LOCUS_05400 10325 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 11419 11021 gene locus_tag LOCUS_05410 11419 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 12246 11911 gene locus_tag LOCUS_05420 gene gpsB 12246 11911 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 protein_id gnl|my_center|LOCUS_05420 12427 13026 gene locus_tag LOCUS_05430 gene recU 12427 13026 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155598.1 protein_id gnl|my_center|LOCUS_05430 13016 15709 gene locus_tag LOCUS_05440 13016 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 17065 16409 gene locus_tag LOCUS_05450 gene nth 17065 16409 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831179.1 protein_id gnl|my_center|LOCUS_05450 17651 17058 gene locus_tag LOCUS_05460 gene dnaD 17651 17058 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728542.1 protein_id gnl|my_center|LOCUS_05460 18148 17657 gene locus_tag LOCUS_05470 18148 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 24071 18252 gene locus_tag LOCUS_05480 24071 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 24882 24175 gene locus_tag LOCUS_05490 24882 24175 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_05490 25284 25012 gene locus_tag LOCUS_05500 25284 25012 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640587.1 protein_id gnl|my_center|LOCUS_05500 27360 25885 gene locus_tag LOCUS_05510 gene spoIVA 27360 25885 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 protein_id gnl|my_center|LOCUS_05510 27462 28322 gene locus_tag LOCUS_05520 27462 28322 CDS product AraC family ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959952.1 protein_id gnl|my_center|LOCUS_05520 30559 28334 gene locus_tag LOCUS_05530 30559 28334 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476111.1 protein_id gnl|my_center|LOCUS_05530 31970 30540 gene locus_tag LOCUS_05540 gene melB 31970 30540 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_05540 32442 31975 gene locus_tag LOCUS_05550 32442 31975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 32708 33868 gene locus_tag LOCUS_05560 32708 33868 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_05560 34265 34474 gene locus_tag LOCUS_05570 34265 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 36338 34908 gene locus_tag LOCUS_05580 gene pyk 36338 34908 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_05580 38071 36794 gene locus_tag LOCUS_05590 gene galK 38071 36794 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263235.1 protein_id gnl|my_center|LOCUS_05590 39081 38071 gene locus_tag LOCUS_05600 39081 38071 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_05600 40579 39083 gene locus_tag LOCUS_05610 gene galT 40579 39083 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_05610 41347 42348 gene locus_tag LOCUS_05620 41347 42348 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836854.1 protein_id gnl|my_center|LOCUS_05620 44615 42624 gene locus_tag LOCUS_05630 44615 42624 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_05630 44993 45316 gene locus_tag LOCUS_05640 44993 45316 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_05640 46253 45330 gene locus_tag LOCUS_05650 46253 45330 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965842.1 protein_id gnl|my_center|LOCUS_05650 46473 47222 gene locus_tag LOCUS_05660 46473 47222 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_05660 47224 47679 gene locus_tag LOCUS_05670 47224 47679 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965564.1 protein_id gnl|my_center|LOCUS_05670 47676 48812 gene locus_tag LOCUS_05680 47676 48812 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_05680 51421 49031 gene locus_tag LOCUS_05690 gene pheT 51421 49031 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_05690 52463 51426 gene locus_tag LOCUS_05700 gene pheS 52463 51426 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence009 1338 109 gene locus_tag LOCUS_05710 1338 109 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_05710 2468 1335 gene locus_tag LOCUS_05720 gene proB 2468 1335 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_05720 3848 2574 gene locus_tag LOCUS_05730 3848 2574 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_05730 3990 4997 gene locus_tag LOCUS_05740 gene asnA 3990 4997 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_05740 6536 5151 gene locus_tag LOCUS_05750 gene purB 6536 5151 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262318.1 protein_id gnl|my_center|LOCUS_05750 10299 6538 gene locus_tag LOCUS_05760 10299 6538 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_05760 11560 10310 gene locus_tag LOCUS_05770 gene purD 11560 10310 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_05770 13102 11579 gene locus_tag LOCUS_05780 gene purH 13102 11579 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436063.1 protein_id gnl|my_center|LOCUS_05780 13697 13104 gene locus_tag LOCUS_05790 gene purN 13697 13104 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_05790 14200 13691 gene locus_tag LOCUS_05800 14200 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 14519 14157 gene locus_tag LOCUS_05810 14519 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 15236 14535 gene locus_tag LOCUS_05820 15236 14535 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_05820 15792 15259 gene locus_tag LOCUS_05830 gene purE 15792 15259 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425290.1 protein_id gnl|my_center|LOCUS_05830 17465 15795 gene locus_tag LOCUS_05840 17465 15795 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_05840 19108 18065 gene locus_tag LOCUS_05850 19108 18065 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_05850 19202 19651 gene locus_tag LOCUS_05860 19202 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20907 19795 gene locus_tag LOCUS_05870 20907 19795 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 protein_id gnl|my_center|LOCUS_05870 21635 20907 gene locus_tag LOCUS_05880 21635 20907 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_05880 22308 21628 gene locus_tag LOCUS_05890 22308 21628 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888558.1 protein_id gnl|my_center|LOCUS_05890 23045 22311 gene locus_tag LOCUS_05900 23045 22311 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_05900 23635 23354 gene locus_tag LOCUS_05910 23635 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 26585 24999 gene locus_tag LOCUS_05920 gene asnB 26585 24999 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_05920 29806 26609 gene locus_tag LOCUS_05930 gene carB 29806 26609 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_05930 30878 29808 gene locus_tag LOCUS_05940 30878 29808 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_05940 32513 31041 gene locus_tag LOCUS_05950 gene gltD 32513 31041 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_05950 36508 32516 gene locus_tag LOCUS_05960 gene gltB 36508 32516 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_05960 37009 36518 gene locus_tag LOCUS_05970 37009 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05970 38424 37024 gene locus_tag LOCUS_05980 gene purF 38424 37024 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_05980 40559 38481 gene locus_tag LOCUS_05990 40559 38481 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_05990 41781 43049 gene locus_tag LOCUS_06000 gene eno 41781 43049 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292812.1 protein_id gnl|my_center|LOCUS_06000 43255 43998 gene locus_tag LOCUS_06010 43255 43998 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_06010 43995 45290 gene locus_tag LOCUS_06020 43995 45290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 46965 46126 gene locus_tag LOCUS_06030 46965 46126 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_06030 47822 46962 gene locus_tag LOCUS_06040 47822 46962 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 protein_id gnl|my_center|LOCUS_06040 49520 47874 gene locus_tag LOCUS_06050 49520 47874 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068613.1 protein_id gnl|my_center|LOCUS_06050 <50204 49533 gene locus_tag LOCUS_06060 <50204 49533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162225034.1:SpaA isopeptide-forming pilin-related protein >Feature sequence010 692 895 gene locus_tag LOCUS_06070 692 895 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357750.1 protein_id gnl|my_center|LOCUS_06070 1200 4088 gene locus_tag LOCUS_06080 1200 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4078 7776 gene locus_tag LOCUS_06090 gene addA 4078 7776 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_06090 8808 7801 gene locus_tag LOCUS_06100 8808 7801 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_06100 8876 9601 gene locus_tag LOCUS_06110 gene yaaA 8876 9601 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_06110 10682 9621 gene locus_tag LOCUS_06120 gene hisC 10682 9621 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_06120 11753 10794 gene locus_tag LOCUS_06130 gene pfkA 11753 10794 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421189.1 protein_id gnl|my_center|LOCUS_06130 12468 11764 gene locus_tag LOCUS_06140 12468 11764 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916629.1 protein_id gnl|my_center|LOCUS_06140 13539 12691 gene locus_tag LOCUS_06150 13539 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 14584 13832 gene locus_tag LOCUS_06160 14584 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 15053 14586 gene locus_tag LOCUS_06170 15053 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 16792 15065 gene locus_tag LOCUS_06180 16792 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19223 16782 gene locus_tag LOCUS_06190 19223 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19601 19236 gene locus_tag LOCUS_06200 19601 19236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 21944 19617 gene locus_tag LOCUS_06210 21944 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 22028 22459 gene locus_tag LOCUS_06220 22028 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 23275 23769 gene locus_tag LOCUS_06230 23275 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 25029 24217 gene locus_tag LOCUS_06240 25029 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25568 25167 gene locus_tag LOCUS_06250 25568 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 25876 25550 gene locus_tag LOCUS_06260 25876 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 26363 25896 gene locus_tag LOCUS_06270 26363 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 26757 26377 gene locus_tag LOCUS_06280 26757 26377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 27370 27035 gene locus_tag LOCUS_06290 27370 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 27647 27357 gene locus_tag LOCUS_06300 27647 27357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 27935 27771 gene locus_tag LOCUS_06310 27935 27771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 27971 28309 gene locus_tag LOCUS_06320 27971 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 29217 28348 gene locus_tag LOCUS_06330 29217 28348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 29741 29226 gene locus_tag LOCUS_06340 29741 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 31258 29741 gene locus_tag LOCUS_06350 gene gpmI 31258 29741 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_06350 31551 31366 gene locus_tag LOCUS_06360 31551 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 31978 31601 gene locus_tag LOCUS_06370 31978 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 32549 31959 gene locus_tag LOCUS_06380 gene pgsA 32549 31959 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_06380 33077 32646 gene locus_tag LOCUS_06390 33077 32646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_06390 33972 33067 gene locus_tag LOCUS_06400 33972 33067 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_06400 35306 34116 gene locus_tag LOCUS_06410 35306 34116 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027644.1 protein_id gnl|my_center|LOCUS_06410 36198 35854 gene locus_tag LOCUS_06420 36198 35854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 36562 36200 gene locus_tag LOCUS_06430 36562 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 37311 36577 gene locus_tag LOCUS_06440 37311 36577 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_06440 37477 37552 gene locus_tag LOCUS_t00070 37477 37552 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42322 38798 gene locus_tag LOCUS_06450 42322 38798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 42956 44833 gene locus_tag LOCUS_06460 42956 44833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 46721 45444 gene locus_tag LOCUS_06470 46721 45444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 47796 46726 gene locus_tag LOCUS_06480 47796 46726 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_06480 48030 48344 gene locus_tag LOCUS_06490 48030 48344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence011 708 265 gene locus_tag LOCUS_06500 708 265 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_06500 2174 1665 gene locus_tag LOCUS_06510 2174 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2505 2206 gene locus_tag LOCUS_06520 2505 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6169 2738 gene locus_tag LOCUS_06530 gene mfd 6169 2738 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_06530 6732 6178 gene locus_tag LOCUS_06540 gene pth 6732 6178 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_06540 8828 6744 gene locus_tag LOCUS_06550 gene pulA 8828 6744 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 protein_id gnl|my_center|LOCUS_06550 9111 10194 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatacatcctatgttgttattaaac 12825 10429 gene locus_tag LOCUS_06560 gene glgP 12825 10429 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 protein_id gnl|my_center|LOCUS_06560 14714 12837 gene locus_tag LOCUS_06570 gene glgB 14714 12837 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111383.1 protein_id gnl|my_center|LOCUS_06570 17049 15355 gene locus_tag LOCUS_06580 17049 15355 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104191.1 protein_id gnl|my_center|LOCUS_06580 17647 17150 gene locus_tag LOCUS_06590 gene cobO 17647 17150 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_06590 18129 17650 gene locus_tag LOCUS_06600 gene ybaK 18129 17650 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_06600 18442 18173 gene locus_tag LOCUS_06610 18442 18173 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831726.1 protein_id gnl|my_center|LOCUS_06610 19739 18633 gene locus_tag LOCUS_06620 19739 18633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 20425 19739 gene locus_tag LOCUS_06630 20425 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 21942 20422 gene locus_tag LOCUS_06640 21942 20422 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_06640 22774 21935 gene locus_tag LOCUS_06650 22774 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 23462 22797 gene locus_tag LOCUS_06660 23462 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 24793 23750 gene locus_tag LOCUS_06670 24793 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 26219 24798 gene locus_tag LOCUS_06680 26219 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 27092 26469 gene locus_tag LOCUS_06690 27092 26469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 27287 27153 gene locus_tag LOCUS_06700 27287 27153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 29447 27741 gene locus_tag LOCUS_06710 29447 27741 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_06710 30246 29449 gene locus_tag LOCUS_06720 30246 29449 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251908.1 protein_id gnl|my_center|LOCUS_06720 30566 30297 gene locus_tag LOCUS_06730 30566 30297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 31417 30581 gene locus_tag LOCUS_06740 31417 30581 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262151.1 protein_id gnl|my_center|LOCUS_06740 32270 31419 gene locus_tag LOCUS_06750 32270 31419 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262152.1 protein_id gnl|my_center|LOCUS_06750 32782 32291 gene locus_tag LOCUS_06760 32782 32291 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263460.1 protein_id gnl|my_center|LOCUS_06760 33220 32798 gene locus_tag LOCUS_06770 33220 32798 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964766.1 protein_id gnl|my_center|LOCUS_06770 34651 33362 gene locus_tag LOCUS_06780 34651 33362 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_06780 35318 34644 gene locus_tag LOCUS_06790 35318 34644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263457.1 protein_id gnl|my_center|LOCUS_06790 36618 35311 gene locus_tag LOCUS_06800 36618 35311 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907421.1 protein_id gnl|my_center|LOCUS_06800 37568 36618 gene locus_tag LOCUS_06810 37568 36618 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964762.1 protein_id gnl|my_center|LOCUS_06810 42748 37739 gene locus_tag LOCUS_06820 42748 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 44077 43859 gene locus_tag LOCUS_06830 44077 43859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 44807 44376 gene locus_tag LOCUS_06840 44807 44376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 47230 44792 gene locus_tag LOCUS_06850 47230 44792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence012 760 1830 gene locus_tag LOCUS_06860 760 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2148 5762 gene locus_tag LOCUS_06870 2148 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6180 5944 gene locus_tag LOCUS_06880 6180 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6247 6507 gene locus_tag LOCUS_06890 6247 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6522 7379 gene locus_tag LOCUS_06900 6522 7379 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035641.1 protein_id gnl|my_center|LOCUS_06900 7388 8359 gene locus_tag LOCUS_06910 7388 8359 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_06910 8656 9456 gene locus_tag LOCUS_06920 8656 9456 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_06920 9507 10349 gene locus_tag LOCUS_06930 9507 10349 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_06930 10346 10900 gene locus_tag LOCUS_06940 10346 10900 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_06940 10915 12162 gene locus_tag LOCUS_06950 10915 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 12204 13835 gene locus_tag LOCUS_06960 12204 13835 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_06960 13939 16239 gene locus_tag LOCUS_06970 13939 16239 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_06970 16239 16754 gene locus_tag LOCUS_06980 gene nrdG 16239 16754 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_06980 17109 17510 gene locus_tag LOCUS_06990 17109 17510 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878124.1 protein_id gnl|my_center|LOCUS_06990 19366 17621 gene locus_tag LOCUS_07000 19366 17621 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_07000 19809 20117 gene locus_tag LOCUS_07010 19809 20117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 20130 21161 gene locus_tag LOCUS_07020 20130 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 21175 22536 gene locus_tag LOCUS_07030 21175 22536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 22549 24441 gene locus_tag LOCUS_07040 22549 24441 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_07040 24462 24893 gene locus_tag LOCUS_07050 24462 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 24913 25221 gene locus_tag LOCUS_07060 24913 25221 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_07060 25234 25830 gene locus_tag LOCUS_07070 25234 25830 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_07070 25846 27597 gene locus_tag LOCUS_07080 25846 27597 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_07080 27610 29052 gene locus_tag LOCUS_07090 27610 29052 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869268.1 protein_id gnl|my_center|LOCUS_07090 29055 29663 gene locus_tag LOCUS_07100 29055 29663 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_07100 30185 29757 gene locus_tag LOCUS_07110 30185 29757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 30680 30318 gene locus_tag LOCUS_07120 30680 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 30836 33949 gene locus_tag LOCUS_07130 30836 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 33933 34868 gene locus_tag LOCUS_07140 gene gldA 33933 34868 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_07140 34849 35766 gene locus_tag LOCUS_07150 34849 35766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 35825 36706 gene locus_tag LOCUS_07160 35825 36706 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_07160 36827 37588 gene locus_tag LOCUS_07170 gene aroD 36827 37588 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_07170 37651 38028 gene locus_tag LOCUS_07180 37651 38028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 40053 38236 gene locus_tag LOCUS_07190 gene asnB 40053 38236 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_07190 41375 40464 gene locus_tag LOCUS_07200 41375 40464 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_07200 41814 41389 gene locus_tag LOCUS_07210 41814 41389 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_07210 42194 41829 gene locus_tag LOCUS_07220 42194 41829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence013 2595 2008 gene locus_tag LOCUS_07230 2595 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3364 3086 gene locus_tag LOCUS_07240 3364 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4457 3792 gene locus_tag LOCUS_07250 4457 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5232 5591 gene locus_tag LOCUS_07260 5232 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5718 7196 gene locus_tag LOCUS_07270 5718 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7825 7592 gene locus_tag LOCUS_07280 7825 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 8292 9818 gene locus_tag LOCUS_07290 8292 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 9820 10983 gene locus_tag LOCUS_07300 9820 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 11126 11302 gene locus_tag LOCUS_07310 11126 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 11352 11558 gene locus_tag LOCUS_07320 11352 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 11908 12741 gene locus_tag LOCUS_07330 gene dapF 11908 12741 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_07330 12756 13460 gene locus_tag LOCUS_07340 gene dapD 12756 13460 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386624.1 protein_id gnl|my_center|LOCUS_07340 13470 14600 gene locus_tag LOCUS_07350 13470 14600 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891676.1 protein_id gnl|my_center|LOCUS_07350 14603 15790 gene locus_tag LOCUS_07360 14603 15790 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965684.1 protein_id gnl|my_center|LOCUS_07360 15859 16416 gene locus_tag LOCUS_07370 15859 16416 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_07370 16416 16979 gene locus_tag LOCUS_07380 16416 16979 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_07380 18032 19216 gene locus_tag LOCUS_07390 18032 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 19611 19973 gene locus_tag LOCUS_07400 19611 19973 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435155.1 protein_id gnl|my_center|LOCUS_07400 20629 22671 gene locus_tag LOCUS_07410 20629 22671 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_07410 22681 23139 gene locus_tag LOCUS_07420 gene ybeY 22681 23139 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_07420 23142 23537 gene locus_tag LOCUS_07430 23142 23537 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_07430 23534 24427 gene locus_tag LOCUS_07440 gene era 23534 24427 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721968.1 protein_id gnl|my_center|LOCUS_07440 24417 25163 gene locus_tag LOCUS_07450 gene recO 24417 25163 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_07450 25336 27162 gene locus_tag LOCUS_07460 25336 27162 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_07460 27159 28052 gene locus_tag LOCUS_07470 27159 28052 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_07470 28209 29582 gene locus_tag LOCUS_07480 28209 29582 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_07480 29598 31355 gene locus_tag LOCUS_07490 gene dnaG 29598 31355 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_07490 31359 32609 gene locus_tag LOCUS_07500 gene rpoD 31359 32609 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_07500 32610 33302 gene locus_tag LOCUS_07510 32610 33302 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006542.1 protein_id gnl|my_center|LOCUS_07510 33289 34038 gene locus_tag LOCUS_07520 33289 34038 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_07520 34841 36160 gene locus_tag LOCUS_07530 34841 36160 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_07530 36234 36809 gene locus_tag LOCUS_07540 36234 36809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 37936 37025 gene locus_tag LOCUS_07550 37936 37025 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246170.1 protein_id gnl|my_center|LOCUS_07550 38302 37952 gene locus_tag LOCUS_07560 38302 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 38494 39864 gene locus_tag LOCUS_07570 gene cshB 38494 39864 CDS product DEAD-box ATP-dependent RNA helicase CshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721956.1 protein_id gnl|my_center|LOCUS_07570 39864 40724 gene locus_tag LOCUS_07580 39864 40724 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924220.1 protein_id gnl|my_center|LOCUS_07580 40966 40697 gene locus_tag LOCUS_07590 40966 40697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 42146 41019 gene locus_tag LOCUS_07600 gene ispG 42146 41019 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence014 1475 753 gene locus_tag LOCUS_07610 gene speB 1475 753 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_07610 2356 1472 gene locus_tag LOCUS_07620 2356 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2746 3297 gene locus_tag LOCUS_07630 2746 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3887 3519 gene locus_tag LOCUS_07640 3887 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6458 3897 gene locus_tag LOCUS_07650 6458 3897 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_07650 7369 6632 gene locus_tag LOCUS_07660 7369 6632 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_07660 8940 7369 gene locus_tag LOCUS_07670 8940 7369 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568253.1 protein_id gnl|my_center|LOCUS_07670 10140 9571 gene locus_tag LOCUS_07680 10140 9571 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_07680 10553 10158 gene locus_tag LOCUS_07690 10553 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 11158 10574 gene locus_tag LOCUS_07700 11158 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 13449 11158 gene locus_tag LOCUS_07710 13449 11158 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_07710 13922 13449 gene locus_tag LOCUS_07720 13922 13449 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_07720 14715 13912 gene locus_tag LOCUS_07730 14715 13912 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434058.1 protein_id gnl|my_center|LOCUS_07730 16122 14719 gene locus_tag LOCUS_07740 16122 14719 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_07740 16901 16134 gene locus_tag LOCUS_07750 16901 16134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018231.1 protein_id gnl|my_center|LOCUS_07750 17893 16901 gene locus_tag LOCUS_07760 17893 16901 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101422.1 protein_id gnl|my_center|LOCUS_07760 18916 17900 gene locus_tag LOCUS_07770 18916 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 19442 18903 gene locus_tag LOCUS_07780 19442 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19930 19628 gene locus_tag LOCUS_07790 19930 19628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 20597 19947 gene locus_tag LOCUS_07800 20597 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 21459 20653 gene locus_tag LOCUS_07810 21459 20653 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895974.1 protein_id gnl|my_center|LOCUS_07810 21542 22189 gene locus_tag LOCUS_07820 21542 22189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 protein_id gnl|my_center|LOCUS_07820 23183 22233 gene locus_tag LOCUS_07830 23183 22233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 23535 24068 gene locus_tag LOCUS_07840 23535 24068 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_07840 25143 24163 gene locus_tag LOCUS_07850 25143 24163 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_07850 26350 25310 gene locus_tag LOCUS_07860 gene rsmH 26350 25310 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_07860 26992 26786 gene locus_tag LOCUS_07870 26992 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 27450 27247 gene locus_tag LOCUS_07880 27450 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 27593 27865 gene locus_tag LOCUS_07890 27593 27865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 28797 28192 gene locus_tag LOCUS_07900 28797 28192 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_07900 28861 29097 gene locus_tag LOCUS_07910 28861 29097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 29566 29420 gene locus_tag LOCUS_07920 29566 29420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30181 29948 gene locus_tag LOCUS_07930 30181 29948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 30462 30184 gene locus_tag LOCUS_07940 30462 30184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 31235 30918 gene locus_tag LOCUS_07950 31235 30918 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_07950 31505 31239 gene locus_tag LOCUS_07960 31505 31239 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_07960 31856 31587 gene locus_tag LOCUS_07970 31856 31587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 32073 31918 gene locus_tag LOCUS_07980 32073 31918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 32351 32025 gene locus_tag LOCUS_07990 32351 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 32566 32297 gene locus_tag LOCUS_08000 32566 32297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 32862 32632 gene locus_tag LOCUS_08010 32862 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 33509 32883 gene locus_tag LOCUS_08020 33509 32883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 35440 33710 gene locus_tag LOCUS_08030 35440 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 37403 35424 gene locus_tag LOCUS_08040 37403 35424 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 protein_id gnl|my_center|LOCUS_08040 38295 37396 gene locus_tag LOCUS_08050 38295 37396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 38648 38292 gene locus_tag LOCUS_08060 38648 38292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 39344 38688 gene locus_tag LOCUS_08070 39344 38688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 39522 39737 gene locus_tag LOCUS_08080 39522 39737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 39865 40197 gene locus_tag LOCUS_08090 39865 40197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 <40941 40190 gene locus_tag LOCUS_08100 <40941 40190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143015502.1:IS3 family transposase >Feature sequence015 478 170 gene locus_tag LOCUS_08110 478 170 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989050.1 protein_id gnl|my_center|LOCUS_08110 2355 1171 gene locus_tag LOCUS_08120 gene tuf 2355 1171 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235058.1 protein_id gnl|my_center|LOCUS_08120 4515 2440 gene locus_tag LOCUS_08130 gene fusA 4515 2440 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 protein_id gnl|my_center|LOCUS_08130 5019 4549 gene locus_tag LOCUS_08140 gene rpsG 5019 4549 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225784.1 protein_id gnl|my_center|LOCUS_08140 5458 5045 gene locus_tag LOCUS_08150 gene rpsL 5458 5045 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_08150 9910 6230 gene locus_tag LOCUS_08160 gene rpoC 9910 6230 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_08160 13599 9922 gene locus_tag LOCUS_08170 gene rpoB 13599 9922 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966326.1 protein_id gnl|my_center|LOCUS_08170 14413 13808 gene locus_tag LOCUS_08180 14413 13808 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 protein_id gnl|my_center|LOCUS_08180 14835 14464 gene locus_tag LOCUS_08190 gene rplL 14835 14464 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262825.1 protein_id gnl|my_center|LOCUS_08190 15453 14866 gene locus_tag LOCUS_08200 gene rplJ 15453 14866 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_08200 16310 15624 gene locus_tag LOCUS_08210 gene rplA 16310 15624 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_08210 16791 16378 gene locus_tag LOCUS_08220 gene rplK 16791 16378 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183506.1 protein_id gnl|my_center|LOCUS_08220 17367 17011 gene locus_tag LOCUS_08230 17367 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 17613 17440 gene locus_tag LOCUS_08240 17613 17440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 18046 17663 gene locus_tag LOCUS_08250 18046 17663 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_08250 18961 18218 gene locus_tag LOCUS_08260 gene tpiA 18961 18218 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_08260 20161 18977 gene locus_tag LOCUS_08270 20161 18977 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 protein_id gnl|my_center|LOCUS_08270 20246 20557 gene locus_tag LOCUS_08280 20246 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 21628 20774 gene locus_tag LOCUS_08290 21628 20774 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723662.1 protein_id gnl|my_center|LOCUS_08290 22626 21736 gene locus_tag LOCUS_08300 22626 21736 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_08300 22904 22689 gene locus_tag LOCUS_08310 22904 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 23387 23944 gene locus_tag LOCUS_08320 23387 23944 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_08320 24053 25744 gene locus_tag LOCUS_08330 24053 25744 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_08330 25932 25813 gene locus_tag LOCUS_08340 25932 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 26810 26124 gene locus_tag LOCUS_08350 26810 26124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 27229 27053 gene locus_tag LOCUS_08360 27229 27053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 27664 27374 gene locus_tag LOCUS_08370 27664 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 28225 28016 gene locus_tag LOCUS_08380 28225 28016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 30082 28403 gene locus_tag LOCUS_08390 gene ilvB 30082 28403 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_08390 31775 30099 gene locus_tag LOCUS_08400 gene ilvD 31775 30099 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_08400 32878 31796 gene locus_tag LOCUS_08410 gene leuB 32878 31796 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_08410 33363 32884 gene locus_tag LOCUS_08420 gene leuD 33363 32884 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_08420 34637 33363 gene locus_tag LOCUS_08430 gene leuC 34637 33363 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_08430 35751 34735 gene locus_tag LOCUS_08440 gene ilvC 35751 34735 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_08440 36280 35771 gene locus_tag LOCUS_08450 gene ilvN 36280 35771 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_08450 37976 36300 gene locus_tag LOCUS_08460 gene leuA 37976 36300 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_08460 38576 39784 gene locus_tag LOCUS_08470 38576 39784 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_08470 40201 39872 gene locus_tag LOCUS_08480 40201 39872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence016 400 194 gene locus_tag LOCUS_08490 400 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 945 403 gene locus_tag LOCUS_08500 945 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1862 1308 gene locus_tag LOCUS_08510 1862 1308 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_08510 3994 1862 gene locus_tag LOCUS_08520 gene pnp 3994 1862 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_08520 4118 5374 gene locus_tag LOCUS_08530 4118 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6155 5475 gene locus_tag LOCUS_08540 6155 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6899 6225 gene locus_tag LOCUS_08550 6899 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7601 7212 gene locus_tag LOCUS_08560 7601 7212 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_08560 7708 8502 gene locus_tag LOCUS_08570 7708 8502 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_08570 8844 9836 gene locus_tag LOCUS_08580 8844 9836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 protein_id gnl|my_center|LOCUS_08580 9848 10777 gene locus_tag LOCUS_08590 9848 10777 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_08590 10770 11564 gene locus_tag LOCUS_08600 10770 11564 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157662.1 protein_id gnl|my_center|LOCUS_08600 12213 11581 gene locus_tag LOCUS_08610 12213 11581 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_08610 12263 12619 gene locus_tag LOCUS_08620 12263 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13304 13068 gene locus_tag LOCUS_08630 13304 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 13676 13473 gene locus_tag LOCUS_08640 13676 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14240 13755 gene locus_tag LOCUS_08650 gene greA 14240 13755 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431312.1 protein_id gnl|my_center|LOCUS_08650 14917 14294 gene locus_tag LOCUS_08660 gene udk 14917 14294 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537078.1 protein_id gnl|my_center|LOCUS_08660 16158 14917 gene locus_tag LOCUS_08670 16158 14917 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217966.1 protein_id gnl|my_center|LOCUS_08670 17077 16142 gene locus_tag LOCUS_08680 17077 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 17673 17077 gene locus_tag LOCUS_08690 17673 17077 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389102.1 protein_id gnl|my_center|LOCUS_08690 18769 17675 gene locus_tag LOCUS_08700 gene mltG 18769 17675 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230083.1 protein_id gnl|my_center|LOCUS_08700 19328 18960 gene locus_tag LOCUS_08710 19328 18960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 19760 19341 gene locus_tag LOCUS_08720 gene ruvX 19760 19341 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830837.1 protein_id gnl|my_center|LOCUS_08720 20013 19762 gene locus_tag LOCUS_08730 20013 19762 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_08730 22683 20074 gene locus_tag LOCUS_08740 gene alaS 22683 20074 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811825.1 protein_id gnl|my_center|LOCUS_08740 25293 23098 gene locus_tag LOCUS_08750 25293 23098 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528083.1 protein_id gnl|my_center|LOCUS_08750 26426 25293 gene locus_tag LOCUS_08760 gene mnmA 26426 25293 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_08760 27414 26494 gene locus_tag LOCUS_08770 27414 26494 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_08770 28442 27474 gene locus_tag LOCUS_08780 28442 27474 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_08780 28657 29190 gene locus_tag LOCUS_08790 28657 29190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986429.1 protein_id gnl|my_center|LOCUS_08790 29790 29299 gene locus_tag LOCUS_08800 29790 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 30017 29823 gene locus_tag LOCUS_08810 30017 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 30256 30038 gene locus_tag LOCUS_08820 30256 30038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 30727 30651 gene locus_tag LOCUS_t00080 30727 30651 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30825 30735 gene locus_tag LOCUS_t00090 30825 30735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31471 31016 gene locus_tag LOCUS_08830 31471 31016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 31847 32044 gene locus_tag LOCUS_08840 31847 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 32267 32192 gene locus_tag LOCUS_t00100 32267 32192 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32374 33924 gene locus_tag LOCUS_08850 32374 33924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 33902 34420 gene locus_tag LOCUS_08860 33902 34420 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_08860 35184 34450 gene locus_tag LOCUS_08870 35184 34450 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987422.1 protein_id gnl|my_center|LOCUS_08870 36040 35195 gene locus_tag LOCUS_08880 36040 35195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 36430 36095 gene locus_tag LOCUS_08890 36430 36095 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_08890 36540 37190 gene locus_tag LOCUS_08900 36540 37190 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_08900 38121 37441 gene locus_tag LOCUS_08910 gene rnc 38121 37441 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 protein_id gnl|my_center|LOCUS_08910 39097 38123 gene locus_tag LOCUS_08920 gene plsX 39097 38123 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905085.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence017 276 1109 gene locus_tag LOCUS_08930 276 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1826 1149 gene locus_tag LOCUS_08940 1826 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2209 4368 gene locus_tag LOCUS_08950 gene nrdD 2209 4368 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_08950 4371 4889 gene locus_tag LOCUS_08960 gene nrdG 4371 4889 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_08960 5084 5698 gene locus_tag LOCUS_08970 5084 5698 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_08970 5695 6555 gene locus_tag LOCUS_08980 5695 6555 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_08980 6569 7339 gene locus_tag LOCUS_08990 gene soj 6569 7339 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_08990 7329 8243 gene locus_tag LOCUS_09000 gene spo0J 7329 8243 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_09000 8935 9501 gene locus_tag LOCUS_09010 8935 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 9543 11504 gene locus_tag LOCUS_09020 gene gdpP 9543 11504 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081640.1 protein_id gnl|my_center|LOCUS_09020 11504 11950 gene locus_tag LOCUS_09030 gene rplI 11504 11950 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864228.1 protein_id gnl|my_center|LOCUS_09030 11960 13321 gene locus_tag LOCUS_09040 gene dnaB 11960 13321 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_09040 13335 13925 gene locus_tag LOCUS_09050 13335 13925 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280862.1 protein_id gnl|my_center|LOCUS_09050 15609 16160 gene locus_tag LOCUS_09060 15609 16160 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 protein_id gnl|my_center|LOCUS_09060 16503 16766 gene locus_tag LOCUS_09070 16503 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 16729 17013 gene locus_tag LOCUS_09080 16729 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 17060 17329 gene locus_tag LOCUS_09090 17060 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 17369 17572 gene locus_tag LOCUS_09100 17369 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 17726 18457 gene locus_tag LOCUS_09110 17726 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 18603 19091 gene locus_tag LOCUS_09120 18603 19091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 19445 20521 gene locus_tag LOCUS_09130 gene prfA 19445 20521 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183530.1 protein_id gnl|my_center|LOCUS_09130 20521 21378 gene locus_tag LOCUS_09140 gene prmC 20521 21378 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 protein_id gnl|my_center|LOCUS_09140 21813 21496 gene locus_tag LOCUS_09150 21813 21496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 22172 21882 gene locus_tag LOCUS_09160 22172 21882 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460993.1 protein_id gnl|my_center|LOCUS_09160 23001 23375 gene locus_tag LOCUS_09170 23001 23375 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812538.1 protein_id gnl|my_center|LOCUS_09170 23368 25101 gene locus_tag LOCUS_09180 23368 25101 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_09180 25088 26734 gene locus_tag LOCUS_09190 gene cydC 25088 26734 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_09190 26734 27021 gene locus_tag LOCUS_09200 26734 27021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 27069 27563 gene locus_tag LOCUS_09210 27069 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 28718 27888 gene locus_tag LOCUS_09220 28718 27888 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435498.1 protein_id gnl|my_center|LOCUS_09220 29031 31238 gene locus_tag LOCUS_09230 gene spoIIE 29031 31238 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_09230 31335 32579 gene locus_tag LOCUS_09240 gene tilS 31335 32579 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166253.1 protein_id gnl|my_center|LOCUS_09240 32605 33135 gene locus_tag LOCUS_09250 gene hpt 32605 33135 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775463.1 protein_id gnl|my_center|LOCUS_09250 33145 35094 gene locus_tag LOCUS_09260 gene ftsH 33145 35094 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733155.1 protein_id gnl|my_center|LOCUS_09260 35238 36107 gene locus_tag LOCUS_09270 gene hslO 35238 36107 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359370.1 protein_id gnl|my_center|LOCUS_09270 36365 37345 gene locus_tag LOCUS_09280 gene dusB 36365 37345 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_09280 37407 38255 gene locus_tag LOCUS_09290 gene folD 37407 38255 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_09290 38257 38436 gene locus_tag LOCUS_09300 38257 38436 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639829.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence018 236 688 gene locus_tag LOCUS_09310 236 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 688 2916 gene locus_tag LOCUS_09320 688 2916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_09320 2909 4765 gene locus_tag LOCUS_09330 2909 4765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_09330 4848 6176 gene locus_tag LOCUS_09340 4848 6176 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_09340 6599 7438 gene locus_tag LOCUS_09350 6599 7438 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680113.1 protein_id gnl|my_center|LOCUS_09350 7826 9237 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaataacaacataagatgtattgaaac 10044 11114 gene locus_tag LOCUS_09360 10044 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11124 11375 gene locus_tag LOCUS_09370 11124 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_09370 12340 11453 gene locus_tag LOCUS_09380 12340 11453 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_09380 12492 13763 gene locus_tag LOCUS_09390 12492 13763 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100223.1 protein_id gnl|my_center|LOCUS_09390 13775 15322 gene locus_tag LOCUS_09400 gene guaA 13775 15322 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_09400 15592 17463 gene locus_tag LOCUS_09410 15592 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 17456 18565 gene locus_tag LOCUS_09420 17456 18565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 18626 18751 gene locus_tag LOCUS_09430 18626 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 19424 19708 gene locus_tag LOCUS_09440 19424 19708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 19656 19913 gene locus_tag LOCUS_09450 19656 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 20074 23796 gene locus_tag LOCUS_09460 20074 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 24540 25766 gene locus_tag LOCUS_09470 24540 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 25841 26398 gene locus_tag LOCUS_09480 gene efp 25841 26398 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_09480 26419 27165 gene locus_tag LOCUS_09490 gene fabG 26419 27165 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_09490 28421 27162 gene locus_tag LOCUS_09500 28421 27162 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829506.1 protein_id gnl|my_center|LOCUS_09500 29609 30799 gene locus_tag LOCUS_09510 29609 30799 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_09510 30824 31807 gene locus_tag LOCUS_09520 30824 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 31917 33941 gene locus_tag LOCUS_09530 31917 33941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 35484 33994 gene locus_tag LOCUS_09540 35484 33994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 36131 35520 gene locus_tag LOCUS_09550 36131 35520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 36311 36490 gene locus_tag LOCUS_09560 36311 36490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 36524 37591 gene locus_tag LOCUS_09570 36524 37591 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_09570 37588 37929 gene locus_tag LOCUS_09580 37588 37929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 37904 38179 gene locus_tag LOCUS_09590 37904 38179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence019 475 717 gene locus_tag LOCUS_09600 475 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 714 1241 gene locus_tag LOCUS_09610 714 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1300 3249 gene locus_tag LOCUS_09620 1300 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3577 4413 gene locus_tag LOCUS_09630 3577 4413 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_09630 4364 4546 gene locus_tag LOCUS_09640 4364 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4735 5289 gene locus_tag LOCUS_09650 gene infC 4735 5289 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973214.1 protein_id gnl|my_center|LOCUS_09650 5307 5501 gene locus_tag LOCUS_09660 gene rpmI 5307 5501 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_09660 5525 5884 gene locus_tag LOCUS_09670 gene rplT 5525 5884 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_09670 5995 6390 gene locus_tag LOCUS_09680 5995 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6927 6412 gene locus_tag LOCUS_09690 6927 6412 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476166.1 protein_id gnl|my_center|LOCUS_09690 7074 7778 gene locus_tag LOCUS_09700 7074 7778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 protein_id gnl|my_center|LOCUS_09700 7780 10974 gene locus_tag LOCUS_09710 7780 10974 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964141.1 protein_id gnl|my_center|LOCUS_09710 12855 11221 gene locus_tag LOCUS_09720 12855 11221 CDS product IS1634-like element ISMac12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065563.1 protein_id gnl|my_center|LOCUS_09720 13015 14361 gene locus_tag LOCUS_09730 13015 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 14516 16000 gene locus_tag LOCUS_09740 14516 16000 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_09740 16746 15997 gene locus_tag LOCUS_09750 gene pgeF 16746 15997 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986855.1 protein_id gnl|my_center|LOCUS_09750 16821 17201 gene locus_tag LOCUS_09760 16821 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 18867 17224 gene locus_tag LOCUS_09770 18867 17224 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_09770 18963 19535 gene locus_tag LOCUS_09780 gene gmk 18963 19535 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_09780 19563 19973 gene locus_tag LOCUS_09790 19563 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 20099 20500 gene locus_tag LOCUS_09800 20099 20500 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964881.1 protein_id gnl|my_center|LOCUS_09800 20548 21120 gene locus_tag LOCUS_09810 20548 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 21210 23408 gene locus_tag LOCUS_09820 21210 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 23421 24674 gene locus_tag LOCUS_09830 gene rsmB 23421 24674 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_09830 24676 25704 gene locus_tag LOCUS_09840 gene rlmN 24676 25704 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356987.1 protein_id gnl|my_center|LOCUS_09840 25704 26441 gene locus_tag LOCUS_09850 25704 26441 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_09850 26443 28392 gene locus_tag LOCUS_09860 gene prkC 26443 28392 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_09860 28404 29261 gene locus_tag LOCUS_09870 gene rsgA 28404 29261 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_09870 29254 29895 gene locus_tag LOCUS_09880 gene rpe 29254 29895 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183120.1 protein_id gnl|my_center|LOCUS_09880 29892 30482 gene locus_tag LOCUS_09890 29892 30482 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_09890 30651 34523 gene locus_tag LOCUS_09900 30651 34523 CDS product DUF5011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389333.1 protein_id gnl|my_center|LOCUS_09900 34594 34758 gene locus_tag LOCUS_09910 34594 34758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 34724 34963 gene locus_tag LOCUS_09920 34724 34963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09920 35847 35362 gene locus_tag LOCUS_09930 35847 35362 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987108.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence020 726 214 gene locus_tag LOCUS_09940 726 214 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_09940 1198 2025 gene locus_tag LOCUS_09950 gene cdaA 1198 2025 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829928.1 protein_id gnl|my_center|LOCUS_09950 2009 3424 gene locus_tag LOCUS_09960 2009 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3437 4786 gene locus_tag LOCUS_09970 gene glmM 3437 4786 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_09970 4861 5514 gene locus_tag LOCUS_09980 4861 5514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948085.1 protein_id gnl|my_center|LOCUS_09980 5514 6827 gene locus_tag LOCUS_09990 gene cssS 5514 6827 CDS product secretion stress-responsive two-component system sensor histidine kinase CssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228527.1 protein_id gnl|my_center|LOCUS_09990 6877 7350 gene locus_tag LOCUS_10000 6877 7350 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847054.1 protein_id gnl|my_center|LOCUS_10000 7367 7549 gene locus_tag LOCUS_10010 7367 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 7546 7833 gene locus_tag LOCUS_10020 7546 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 7817 8701 gene locus_tag LOCUS_10030 7817 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 8792 9469 gene locus_tag LOCUS_10040 8792 9469 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_10040 9807 10136 gene locus_tag LOCUS_10050 9807 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10182 12362 gene locus_tag LOCUS_10060 10182 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 12366 12995 gene locus_tag LOCUS_10070 12366 12995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 protein_id gnl|my_center|LOCUS_10070 13040 13477 gene locus_tag LOCUS_10080 13040 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 13936 14151 gene locus_tag LOCUS_10090 13936 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 14384 14767 gene locus_tag LOCUS_10100 14384 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 15257 14973 gene locus_tag LOCUS_10110 15257 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 15638 15429 gene locus_tag LOCUS_10120 15638 15429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 15984 16634 gene locus_tag LOCUS_10130 15984 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 16671 17741 gene locus_tag LOCUS_10140 16671 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 19429 18209 gene locus_tag LOCUS_10150 gene rpoN 19429 18209 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 protein_id gnl|my_center|LOCUS_10150 19554 22232 gene locus_tag LOCUS_10160 19554 22232 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383122.1 protein_id gnl|my_center|LOCUS_10160 22353 22766 gene locus_tag LOCUS_10170 22353 22766 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861087.1 protein_id gnl|my_center|LOCUS_10170 22779 23249 gene locus_tag LOCUS_10180 22779 23249 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_10180 23267 24028 gene locus_tag LOCUS_10190 23267 24028 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 protein_id gnl|my_center|LOCUS_10190 24018 24845 gene locus_tag LOCUS_10200 24018 24845 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627941.1 protein_id gnl|my_center|LOCUS_10200 24865 25860 gene locus_tag LOCUS_10210 24865 25860 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067059.1 protein_id gnl|my_center|LOCUS_10210 25863 26510 gene locus_tag LOCUS_10220 25863 26510 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_10220 26804 27637 gene locus_tag LOCUS_10230 26804 27637 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_10230 27637 28257 gene locus_tag LOCUS_10240 27637 28257 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_10240 28273 30030 gene locus_tag LOCUS_10250 gene dnaK 28273 30030 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_10250 30226 31137 gene locus_tag LOCUS_10260 gene nadA 30226 31137 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_10260 31152 32453 gene locus_tag LOCUS_10270 31152 32453 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430790.1 protein_id gnl|my_center|LOCUS_10270 32431 33285 gene locus_tag LOCUS_10280 gene nadC 32431 33285 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_10280 33346 34710 gene locus_tag LOCUS_10290 33346 34710 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245031.1 protein_id gnl|my_center|LOCUS_10290 35381 34752 gene locus_tag LOCUS_10300 35381 34752 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_10300 35789 35496 gene locus_tag LOCUS_10310 35789 35496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence021 292 1386 gene locus_tag LOCUS_10320 292 1386 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 protein_id gnl|my_center|LOCUS_10320 1828 2118 gene locus_tag LOCUS_10330 1828 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2115 2474 gene locus_tag LOCUS_10340 gene tnpB 2115 2474 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_10340 2507 4078 gene locus_tag LOCUS_10350 2507 4078 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_10350 5235 5777 gene locus_tag LOCUS_10360 5235 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 5780 8005 gene locus_tag LOCUS_10370 5780 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 9456 8023 gene locus_tag LOCUS_10380 gene gltX 9456 8023 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_10380 9514 9589 gene locus_tag LOCUS_t00110 9514 9589 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9711 9636 gene locus_tag LOCUS_t00120 9711 9636 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12678 10291 gene locus_tag LOCUS_10390 12678 10291 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109494.1 protein_id gnl|my_center|LOCUS_10390 13108 14316 gene locus_tag LOCUS_10400 13108 14316 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273809.1 protein_id gnl|my_center|LOCUS_10400 14365 14769 gene locus_tag LOCUS_10410 14365 14769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 15312 14839 gene locus_tag LOCUS_10420 15312 14839 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 protein_id gnl|my_center|LOCUS_10420 15387 15944 gene locus_tag LOCUS_10430 15387 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 17287 15965 gene locus_tag LOCUS_10440 17287 15965 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 protein_id gnl|my_center|LOCUS_10440 19733 17400 gene locus_tag LOCUS_10450 19733 17400 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_10450 20000 21340 gene locus_tag LOCUS_10460 20000 21340 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_10460 21364 21834 gene locus_tag LOCUS_10470 21364 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 22980 21916 gene locus_tag LOCUS_10480 22980 21916 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_10480 23672 23145 gene locus_tag LOCUS_10490 23672 23145 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002785057.1 protein_id gnl|my_center|LOCUS_10490 23785 24117 gene locus_tag LOCUS_10500 23785 24117 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_10500 24130 26553 gene locus_tag LOCUS_10510 24130 26553 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965539.1 protein_id gnl|my_center|LOCUS_10510 26805 27041 gene locus_tag LOCUS_10520 26805 27041 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_10520 27031 29043 gene locus_tag LOCUS_10530 gene feoB 27031 29043 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_10530 29063 29734 gene locus_tag LOCUS_10540 29063 29734 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_10540 29736 31151 gene locus_tag LOCUS_10550 gene malQ 29736 31151 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028948.1 protein_id gnl|my_center|LOCUS_10550 31153 31662 gene locus_tag LOCUS_10560 31153 31662 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_10560 31715 32410 gene locus_tag LOCUS_10570 31715 32410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 32610 32996 gene locus_tag LOCUS_10580 32610 32996 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243451.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence022 94 169 gene locus_tag LOCUS_t00130 94 169 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 247 642 gene locus_tag LOCUS_10590 247 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1999 659 gene locus_tag LOCUS_10600 gene gdhA 1999 659 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_10600 2902 3882 gene locus_tag LOCUS_10610 2902 3882 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881652.1 protein_id gnl|my_center|LOCUS_10610 3875 4504 gene locus_tag LOCUS_10620 gene hisG 3875 4504 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131107.1 protein_id gnl|my_center|LOCUS_10620 4504 5802 gene locus_tag LOCUS_10630 gene hisD 4504 5802 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038603405.1 protein_id gnl|my_center|LOCUS_10630 5805 6392 gene locus_tag LOCUS_10640 gene hisB 5805 6392 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131113.1 protein_id gnl|my_center|LOCUS_10640 6394 7002 gene locus_tag LOCUS_10650 gene hisH 6394 7002 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905832.1 protein_id gnl|my_center|LOCUS_10650 6996 7721 gene locus_tag LOCUS_10660 gene hisA 6996 7721 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_10660 7703 8467 gene locus_tag LOCUS_10670 gene hisF 7703 8467 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864484.1 protein_id gnl|my_center|LOCUS_10670 8467 9105 gene locus_tag LOCUS_10680 gene hisIE 8467 9105 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_10680 9134 9928 gene locus_tag LOCUS_10690 9134 9928 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131121.1 protein_id gnl|my_center|LOCUS_10690 9936 10367 gene locus_tag LOCUS_10700 9936 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10628 10975 gene locus_tag LOCUS_10710 10628 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10977 12143 gene locus_tag LOCUS_10720 10977 12143 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_10720 12502 12338 gene locus_tag LOCUS_10730 12502 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12774 12484 gene locus_tag LOCUS_10740 12774 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 13123 13296 gene locus_tag LOCUS_10750 13123 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13363 13572 gene locus_tag LOCUS_10760 13363 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 15052 13880 gene locus_tag LOCUS_10770 15052 13880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966815.1 protein_id gnl|my_center|LOCUS_10770 15776 15045 gene locus_tag LOCUS_10780 15776 15045 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966816.1 protein_id gnl|my_center|LOCUS_10780 16300 15833 gene locus_tag LOCUS_10790 16300 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 16502 16293 gene locus_tag LOCUS_10800 16502 16293 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966596.1 protein_id gnl|my_center|LOCUS_10800 16883 16602 gene locus_tag LOCUS_10810 16883 16602 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_10810 17318 18322 gene locus_tag LOCUS_10820 17318 18322 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601775.1 protein_id gnl|my_center|LOCUS_10820 18323 18988 gene locus_tag LOCUS_10830 18323 18988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 protein_id gnl|my_center|LOCUS_10830 18998 19819 gene locus_tag LOCUS_10840 gene metQ 18998 19819 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228595.1 protein_id gnl|my_center|LOCUS_10840 19906 20265 gene locus_tag LOCUS_10850 19906 20265 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890780.1 protein_id gnl|my_center|LOCUS_10850 20258 20605 gene locus_tag LOCUS_10860 20258 20605 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_10860 20598 21038 gene locus_tag LOCUS_10870 20598 21038 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_10870 21617 22393 gene locus_tag LOCUS_10880 21617 22393 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_10880 22393 23295 gene locus_tag LOCUS_10890 22393 23295 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018365292.1 protein_id gnl|my_center|LOCUS_10890 23396 24142 gene locus_tag LOCUS_10900 23396 24142 CDS product YoaP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948704.1 protein_id gnl|my_center|LOCUS_10900 24139 24771 gene locus_tag LOCUS_10910 24139 24771 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_10910 24815 25684 gene locus_tag LOCUS_10920 24815 25684 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_10920 26333 27280 gene locus_tag LOCUS_10930 26333 27280 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_10930 27315 27815 gene locus_tag LOCUS_10940 27315 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 27812 28309 gene locus_tag LOCUS_10950 27812 28309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 28525 28989 gene locus_tag LOCUS_10960 28525 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 29003 29614 gene locus_tag LOCUS_10970 29003 29614 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_10970 29611 30498 gene locus_tag LOCUS_10980 29611 30498 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 protein_id gnl|my_center|LOCUS_10980 30495 31706 gene locus_tag LOCUS_10990 30495 31706 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_10990 31710 32189 gene locus_tag LOCUS_11000 31710 32189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 32191 32523 gene locus_tag LOCUS_11010 32191 32523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence023 622 1155 gene locus_tag LOCUS_11020 gene rnmV 622 1155 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 protein_id gnl|my_center|LOCUS_11020 1190 1996 gene locus_tag LOCUS_11030 gene rsmA 1190 1996 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_11030 2024 2767 gene locus_tag LOCUS_11040 gene yabG 2024 2767 CDS product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458914.1 protein_id gnl|my_center|LOCUS_11040 2772 3632 gene locus_tag LOCUS_11050 gene ispE 2772 3632 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321008.1 protein_id gnl|my_center|LOCUS_11050 3930 5309 gene locus_tag LOCUS_11060 gene glmU 3930 5309 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_11060 5319 6275 gene locus_tag LOCUS_11070 5319 6275 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_11070 6414 7226 gene locus_tag LOCUS_11080 6414 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7455 8975 gene locus_tag LOCUS_11090 7455 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8966 9868 gene locus_tag LOCUS_11100 8966 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 9846 10733 gene locus_tag LOCUS_11110 gene isdE 9846 10733 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_11110 10720 11703 gene locus_tag LOCUS_11120 10720 11703 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995381.1 protein_id gnl|my_center|LOCUS_11120 11687 12457 gene locus_tag LOCUS_11130 11687 12457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403758.1 protein_id gnl|my_center|LOCUS_11130 12938 13696 gene locus_tag LOCUS_11140 12938 13696 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_11140 13708 14637 gene locus_tag LOCUS_11150 13708 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 15041 15391 gene locus_tag LOCUS_11160 15041 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 15564 17426 gene locus_tag LOCUS_11170 gene mnmG 15564 17426 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249657.1 protein_id gnl|my_center|LOCUS_11170 17433 18134 gene locus_tag LOCUS_11180 gene rsmG 17433 18134 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_11180 18143 18913 gene locus_tag LOCUS_11190 gene noc 18143 18913 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_11190 19012 19389 gene locus_tag LOCUS_11200 gene spxA 19012 19389 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703607.1 protein_id gnl|my_center|LOCUS_11200 19379 19828 gene locus_tag LOCUS_11210 19379 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680353.1 protein_id gnl|my_center|LOCUS_11210 20649 19840 gene locus_tag LOCUS_11220 20649 19840 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986494.1 protein_id gnl|my_center|LOCUS_11220 20733 22463 gene locus_tag LOCUS_11230 20733 22463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897981.1 protein_id gnl|my_center|LOCUS_11230 22456 24234 gene locus_tag LOCUS_11240 22456 24234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_11240 24413 24613 gene locus_tag LOCUS_11250 24413 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 25414 24902 gene locus_tag LOCUS_11260 25414 24902 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049186.1 protein_id gnl|my_center|LOCUS_11260 26776 25454 gene locus_tag LOCUS_11270 26776 25454 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_11270 27470 26769 gene locus_tag LOCUS_11280 27470 26769 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_11280 27603 30044 gene locus_tag LOCUS_11290 27603 30044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 30016 30417 gene locus_tag LOCUS_11300 30016 30417 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642250.1 protein_id gnl|my_center|LOCUS_11300 30410 31354 gene locus_tag LOCUS_11310 30410 31354 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_11310 31717 31595 gene locus_tag LOCUS_11320 31717 31595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 32275 32153 gene locus_tag LOCUS_11330 32275 32153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence024 2765 144 gene locus_tag LOCUS_11340 2765 144 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 protein_id gnl|my_center|LOCUS_11340 3396 2758 gene locus_tag LOCUS_11350 3396 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4571 3651 gene locus_tag LOCUS_11360 4571 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5481 4558 gene locus_tag LOCUS_11370 5481 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 6144 5545 gene locus_tag LOCUS_11380 gene yihA 6144 5545 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166487.1 protein_id gnl|my_center|LOCUS_11380 8523 6205 gene locus_tag LOCUS_11390 gene lon 8523 6205 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_11390 9858 8575 gene locus_tag LOCUS_11400 gene tig 9858 8575 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_11400 10875 9952 gene locus_tag LOCUS_11410 10875 9952 CDS product DUF3196 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183422.1 protein_id gnl|my_center|LOCUS_11410 11048 10914 gene locus_tag LOCUS_11420 11048 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 12002 11124 gene locus_tag LOCUS_11430 12002 11124 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_11430 12111 13115 gene locus_tag LOCUS_11440 12111 13115 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_11440 13223 14410 gene locus_tag LOCUS_11450 13223 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15121 15045 gene locus_tag LOCUS_t00140 15121 15045 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15829 15650 gene locus_tag LOCUS_11460 15829 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 16041 15965 gene locus_tag LOCUS_t00150 16041 15965 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16562 16098 gene locus_tag LOCUS_11470 16562 16098 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645488.1 protein_id gnl|my_center|LOCUS_11470 17523 16609 gene locus_tag LOCUS_11480 17523 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 18385 17600 gene locus_tag LOCUS_11490 gene murI 18385 17600 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_11490 19571 18390 gene locus_tag LOCUS_11500 19571 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 20085 19882 gene locus_tag LOCUS_11510 gene gerE 20085 19882 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_11510 21832 20123 gene locus_tag LOCUS_11520 gene uvrC 21832 20123 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_11520 24207 21895 gene locus_tag LOCUS_11530 24207 21895 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_11530 25018 24209 gene locus_tag LOCUS_11540 25018 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 25126 25917 gene locus_tag LOCUS_11550 25126 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 26763 26299 gene locus_tag LOCUS_11560 26763 26299 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_11560 27676 26756 gene locus_tag LOCUS_11570 27676 26756 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_11570 28148 27663 gene locus_tag LOCUS_11580 gene lspA 28148 27663 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989666.1 protein_id gnl|my_center|LOCUS_11580 28870 28217 gene locus_tag LOCUS_11590 28870 28217 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence025 108 1298 gene locus_tag LOCUS_11600 108 1298 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860746.1 protein_id gnl|my_center|LOCUS_11600 1767 1603 gene locus_tag LOCUS_11610 1767 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2514 1855 gene locus_tag LOCUS_11620 2514 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3476 2592 gene locus_tag LOCUS_11630 3476 2592 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681111.1 protein_id gnl|my_center|LOCUS_11630 5243 3495 gene locus_tag LOCUS_11640 5243 3495 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11640 7052 5253 gene locus_tag LOCUS_11650 gene nuoF 7052 5253 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_11650 7432 7064 gene locus_tag LOCUS_11660 7432 7064 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_11660 7962 7429 gene locus_tag LOCUS_11670 7962 7429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_11670 8666 7965 gene locus_tag LOCUS_11680 8666 7965 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_11680 8994 8668 gene locus_tag LOCUS_11690 8994 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_11690 10159 8999 gene locus_tag LOCUS_11700 10159 8999 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869444.1 protein_id gnl|my_center|LOCUS_11700 10563 10159 gene locus_tag LOCUS_11710 10563 10159 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_11710 10913 10560 gene locus_tag LOCUS_11720 10913 10560 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_11720 11398 10907 gene locus_tag LOCUS_11730 gene nuoE 11398 10907 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_11730 11589 12518 gene locus_tag LOCUS_11740 11589 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12610 13827 gene locus_tag LOCUS_11750 12610 13827 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_11750 13920 14447 gene locus_tag LOCUS_11760 13920 14447 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680597.1 protein_id gnl|my_center|LOCUS_11760 14723 15547 gene locus_tag LOCUS_11770 14723 15547 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_11770 16245 15922 gene locus_tag LOCUS_11780 16245 15922 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_11780 16414 17055 gene locus_tag LOCUS_11790 16414 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 17921 17274 gene locus_tag LOCUS_11800 17921 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 18233 18433 gene locus_tag LOCUS_11810 18233 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 19382 18969 gene locus_tag LOCUS_11820 19382 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19688 19521 gene locus_tag LOCUS_11830 19688 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 19991 20113 gene locus_tag LOCUS_11840 19991 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 20657 20800 gene locus_tag LOCUS_11850 20657 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 21035 20961 gene locus_tag LOCUS_t00160 21035 20961 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21717 22586 gene locus_tag LOCUS_11860 21717 22586 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_11860 22778 25378 gene locus_tag LOCUS_11870 22778 25378 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_11870 25492 25971 gene locus_tag LOCUS_11880 25492 25971 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 protein_id gnl|my_center|LOCUS_11880 25972 26412 gene locus_tag LOCUS_11890 25972 26412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 26576 27949 gene locus_tag LOCUS_11900 26576 27949 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_11900 27963 28397 gene locus_tag LOCUS_11910 27963 28397 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence026 194 106 gene locus_tag LOCUS_t00170 194 106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 274 200 gene locus_tag LOCUS_t00180 274 200 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2302 458 gene locus_tag LOCUS_11920 2302 458 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_11920 3137 2280 gene locus_tag LOCUS_11930 3137 2280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_11930 4180 3137 gene locus_tag LOCUS_11940 4180 3137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_11940 4724 4191 gene locus_tag LOCUS_11950 4724 4191 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_11950 5677 4847 gene locus_tag LOCUS_11960 5677 4847 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_11960 6068 5688 gene locus_tag LOCUS_11970 6068 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7547 6087 gene locus_tag LOCUS_11980 7547 6087 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_11980 7919 7611 gene locus_tag LOCUS_11990 7919 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9105 8002 gene locus_tag LOCUS_12000 9105 8002 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905635.1 protein_id gnl|my_center|LOCUS_12000 10292 9114 gene locus_tag LOCUS_12010 10292 9114 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905634.1 protein_id gnl|my_center|LOCUS_12010 12547 10331 gene locus_tag LOCUS_12020 12547 10331 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195718935.1 protein_id gnl|my_center|LOCUS_12020 12934 12548 gene locus_tag LOCUS_12030 gene tagD 12934 12548 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643222.1 protein_id gnl|my_center|LOCUS_12030 13771 12944 gene locus_tag LOCUS_12040 13771 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 14602 13781 gene locus_tag LOCUS_12050 gene tagG 14602 13781 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_12050 15409 14777 gene locus_tag LOCUS_12060 gene pyrE 15409 14777 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_12060 16128 15421 gene locus_tag LOCUS_12070 gene pyrF 16128 15421 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_12070 16419 16658 gene locus_tag LOCUS_12080 16419 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 17522 16917 gene locus_tag LOCUS_12090 gene rpsD 17522 16917 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294265.1 protein_id gnl|my_center|LOCUS_12090 18246 17902 gene locus_tag LOCUS_12100 18246 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 19016 19408 gene locus_tag LOCUS_12110 19016 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 19488 20072 gene locus_tag LOCUS_12120 19488 20072 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_12120 20184 21515 gene locus_tag LOCUS_12130 gene rsxC 20184 21515 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_12130 21508 22431 gene locus_tag LOCUS_12140 21508 22431 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_12140 22434 23066 gene locus_tag LOCUS_12150 22434 23066 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_12150 23059 23790 gene locus_tag LOCUS_12160 23059 23790 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_12160 23791 24363 gene locus_tag LOCUS_12170 gene rsxA 23791 24363 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_12170 24379 25170 gene locus_tag LOCUS_12180 24379 25170 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_12180 27695 25572 gene locus_tag LOCUS_12190 27695 25572 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107206.1 protein_id gnl|my_center|LOCUS_12190 28352 28122 gene locus_tag LOCUS_12200 28352 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence027 663 1616 gene locus_tag LOCUS_12210 663 1616 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174124611.1 protein_id gnl|my_center|LOCUS_12210 2313 1999 gene locus_tag LOCUS_12220 2313 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3058 2900 gene locus_tag LOCUS_12230 3058 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 4449 3556 gene locus_tag LOCUS_12240 gene xerC 4449 3556 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288415.1 protein_id gnl|my_center|LOCUS_12240 5650 4580 gene locus_tag LOCUS_12250 5650 4580 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_12250 6000 6146 gene locus_tag LOCUS_12260 6000 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 6106 6351 gene locus_tag LOCUS_12270 6106 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 6344 6670 gene locus_tag LOCUS_12280 6344 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6917 7255 gene locus_tag LOCUS_12290 6917 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7227 8504 gene locus_tag LOCUS_12300 7227 8504 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_12300 9106 8561 gene locus_tag LOCUS_12310 9106 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9441 9130 gene locus_tag LOCUS_12320 9441 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10349 9447 gene locus_tag LOCUS_12330 10349 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 10724 10569 gene locus_tag LOCUS_12340 10724 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 13822 10721 gene locus_tag LOCUS_12350 13822 10721 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_12350 14619 13825 gene locus_tag LOCUS_12360 14619 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15872 14622 gene locus_tag LOCUS_12370 15872 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17035 15869 gene locus_tag LOCUS_12380 17035 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12380 17602 17066 gene locus_tag LOCUS_12390 17602 17066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12390 18147 17683 gene locus_tag LOCUS_12400 18147 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 19856 18150 gene locus_tag LOCUS_12410 19856 18150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 20336 19992 gene locus_tag LOCUS_12420 20336 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 20718 20548 gene locus_tag LOCUS_12430 20718 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12430 20903 20679 gene locus_tag LOCUS_12440 20903 20679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12440 21860 21009 gene locus_tag LOCUS_12450 21860 21009 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_12450 22715 22041 gene locus_tag LOCUS_12460 22715 22041 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_12460 23402 22890 gene locus_tag LOCUS_12470 23402 22890 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_12470 23876 23418 gene locus_tag LOCUS_12480 23876 23418 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_12480 24540 23866 gene locus_tag LOCUS_12490 24540 23866 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_12490 25105 24692 gene locus_tag LOCUS_12500 25105 24692 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_12500 26369 25329 gene locus_tag LOCUS_12510 26369 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 26902 26372 gene locus_tag LOCUS_12520 26902 26372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 27516 27199 gene locus_tag LOCUS_12530 27516 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence028 127 699 gene locus_tag LOCUS_12540 127 699 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_12540 770 1405 gene locus_tag LOCUS_12550 770 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1540 3591 gene locus_tag LOCUS_12560 1540 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3975 3700 gene locus_tag LOCUS_12570 3975 3700 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_12570 5075 4053 gene locus_tag LOCUS_12580 5075 4053 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986709.1 protein_id gnl|my_center|LOCUS_12580 5922 5092 gene locus_tag LOCUS_12590 5922 5092 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047704.1 protein_id gnl|my_center|LOCUS_12590 7057 6149 gene locus_tag LOCUS_12600 7057 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 8249 7050 gene locus_tag LOCUS_12610 8249 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9218 8331 gene locus_tag LOCUS_12620 9218 8331 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_12620 9945 9208 gene locus_tag LOCUS_12630 gene truA 9945 9208 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_12630 10745 9945 gene locus_tag LOCUS_12640 10745 9945 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186526.1 protein_id gnl|my_center|LOCUS_12640 11589 10738 gene locus_tag LOCUS_12650 11589 10738 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 protein_id gnl|my_center|LOCUS_12650 12395 11565 gene locus_tag LOCUS_12660 12395 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 12852 12490 gene locus_tag LOCUS_12670 gene rplQ 12852 12490 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331497.1 protein_id gnl|my_center|LOCUS_12670 13829 12885 gene locus_tag LOCUS_12680 13829 12885 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_12680 14269 13877 gene locus_tag LOCUS_12690 gene rpsK 14269 13877 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 protein_id gnl|my_center|LOCUS_12690 14655 14290 gene locus_tag LOCUS_12700 gene rpsM 14655 14290 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090788.1 protein_id gnl|my_center|LOCUS_12700 15048 14827 gene locus_tag LOCUS_12710 gene infA 15048 14827 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_12710 15815 15069 gene locus_tag LOCUS_12720 gene map 15815 15069 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_12720 16462 15815 gene locus_tag LOCUS_12730 16462 15815 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_12730 17787 16486 gene locus_tag LOCUS_12740 gene secY 17787 16486 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_12740 18229 17789 gene locus_tag LOCUS_12750 gene rplO 18229 17789 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_12750 18425 18243 gene locus_tag LOCUS_12760 18425 18243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 19002 18439 gene locus_tag LOCUS_12770 gene rpsE 19002 18439 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829701.1 protein_id gnl|my_center|LOCUS_12770 19371 19015 gene locus_tag LOCUS_12780 gene rplR 19371 19015 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_12780 19938 19393 gene locus_tag LOCUS_12790 gene rplF 19938 19393 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_12790 20364 19969 gene locus_tag LOCUS_12800 gene rpsH 20364 19969 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_12800 20584 20399 gene locus_tag LOCUS_12810 20584 20399 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140799.1 protein_id gnl|my_center|LOCUS_12810 21144 20605 gene locus_tag LOCUS_12820 gene rplE 21144 20605 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 protein_id gnl|my_center|LOCUS_12820 21491 21156 gene locus_tag LOCUS_12830 gene rplX 21491 21156 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_12830 21873 21505 gene locus_tag LOCUS_12840 gene rplN 21873 21505 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723686.1 protein_id gnl|my_center|LOCUS_12840 22166 21906 gene locus_tag LOCUS_12850 gene rpsQ 22166 21906 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004106.1 protein_id gnl|my_center|LOCUS_12850 22372 22178 gene locus_tag LOCUS_12860 gene rpmC 22372 22178 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 protein_id gnl|my_center|LOCUS_12860 22785 22375 gene locus_tag LOCUS_12870 gene rplP 22785 22375 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166906.1 protein_id gnl|my_center|LOCUS_12870 23441 22788 gene locus_tag LOCUS_12880 gene rpsC 23441 22788 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_12880 23785 23453 gene locus_tag LOCUS_12890 gene rplV 23785 23453 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_12890 24083 23805 gene locus_tag LOCUS_12900 gene rpsS 24083 23805 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_12900 24935 24102 gene locus_tag LOCUS_12910 gene rplB 24935 24102 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_12910 25278 24988 gene locus_tag LOCUS_12920 gene rplW 25278 24988 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205558.1 protein_id gnl|my_center|LOCUS_12920 25901 25278 gene locus_tag LOCUS_12930 gene rplD 25901 25278 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399658.1 protein_id gnl|my_center|LOCUS_12930 26651 25923 gene locus_tag LOCUS_12940 gene rplC 26651 25923 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_12940 26981 26673 gene locus_tag LOCUS_12950 gene rpsJ 26981 26673 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence029 <1 1066 gene locus_tag LOCUS_12960 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861926.1:collagen-like exosporium glycoprotein BclA3 1343 2524 gene locus_tag LOCUS_12970 1343 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2550 3101 gene locus_tag LOCUS_12980 2550 3101 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_12980 3130 3702 gene locus_tag LOCUS_12990 3130 3702 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071130048.1 protein_id gnl|my_center|LOCUS_12990 3971 4438 gene locus_tag LOCUS_13000 3971 4438 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_13000 4431 5606 gene locus_tag LOCUS_13010 4431 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5630 6277 gene locus_tag LOCUS_13020 5630 6277 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_13020 6274 6831 gene locus_tag LOCUS_13030 6274 6831 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190182.1 protein_id gnl|my_center|LOCUS_13030 7341 6865 gene locus_tag LOCUS_13040 gene queF 7341 6865 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_13040 8027 7344 gene locus_tag LOCUS_13050 gene queC 8027 7344 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_13050 8603 8037 gene locus_tag LOCUS_13060 gene folE 8603 8037 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_13060 9267 8605 gene locus_tag LOCUS_13070 gene queE 9267 8605 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_13070 9686 9270 gene locus_tag LOCUS_13080 gene queD 9686 9270 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_13080 9982 11634 gene locus_tag LOCUS_13090 9982 11634 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_13090 13100 12420 gene locus_tag LOCUS_13100 13100 12420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 13567 14334 gene locus_tag LOCUS_13110 13567 14334 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_13110 14414 15250 gene locus_tag LOCUS_13120 14414 15250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 15263 15949 gene locus_tag LOCUS_13130 15263 15949 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_13130 16110 16775 gene locus_tag LOCUS_13140 16110 16775 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_13140 19232 16806 gene locus_tag LOCUS_13150 19232 16806 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 protein_id gnl|my_center|LOCUS_13150 19904 21529 gene locus_tag LOCUS_13160 19904 21529 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294025.1 protein_id gnl|my_center|LOCUS_13160 22033 21638 gene locus_tag LOCUS_13170 22033 21638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 22154 23593 gene locus_tag LOCUS_13180 22154 23593 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_13180 23700 25040 gene locus_tag LOCUS_13190 23700 25040 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036271.1 protein_id gnl|my_center|LOCUS_13190 25658 25443 gene locus_tag LOCUS_13200 25658 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence030 613 176 gene locus_tag LOCUS_13210 613 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1010 630 gene locus_tag LOCUS_13220 1010 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1341 1003 gene locus_tag LOCUS_13230 1341 1003 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002032268.1 protein_id gnl|my_center|LOCUS_13230 1490 2023 gene locus_tag LOCUS_13240 1490 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2025 2723 gene locus_tag LOCUS_13250 2025 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2881 3180 gene locus_tag LOCUS_13260 2881 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3308 3778 gene locus_tag LOCUS_13270 3308 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3766 4167 gene locus_tag LOCUS_13280 3766 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4247 4480 gene locus_tag LOCUS_13290 4247 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4813 6498 gene locus_tag LOCUS_13300 4813 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6491 8032 gene locus_tag LOCUS_13310 6491 8032 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546358.1 protein_id gnl|my_center|LOCUS_13310 8784 10142 gene locus_tag LOCUS_13320 8784 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10135 10776 gene locus_tag LOCUS_13330 10135 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 10745 13954 gene locus_tag LOCUS_13340 10745 13954 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_13340 13947 15134 gene locus_tag LOCUS_13350 13947 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 15956 15318 gene locus_tag LOCUS_13360 15956 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 16659 15985 gene locus_tag LOCUS_13370 16659 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17983 16679 gene locus_tag LOCUS_13380 17983 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 18337 21582 gene locus_tag LOCUS_13390 18337 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 21684 22583 gene locus_tag LOCUS_13400 gene cas1 21684 22583 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_13400 22603 22896 gene locus_tag LOCUS_13410 22603 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 22893 23765 gene locus_tag LOCUS_13420 22893 23765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 23814 24707 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttgttaccatatggaattttgctagaattagac 24982 25134 gene locus_tag LOCUS_13430 24982 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence031 123 584 gene locus_tag LOCUS_13440 123 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2380 3822 gene locus_tag LOCUS_13450 2380 3822 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963977.1 protein_id gnl|my_center|LOCUS_13450 4534 4304 gene locus_tag LOCUS_13460 4534 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5047 4562 gene locus_tag LOCUS_13470 5047 4562 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_13470 5816 5070 gene locus_tag LOCUS_13480 gene trpA 5816 5070 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_13480 6993 5809 gene locus_tag LOCUS_13490 gene trpB 6993 5809 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_13490 7893 7093 gene locus_tag LOCUS_13500 gene trpC 7893 7093 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_13500 8500 8744 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtaacaattcctcattagataaggtacaac 10032 9148 gene locus_tag LOCUS_13510 10032 9148 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_13510 11433 10159 gene locus_tag LOCUS_13520 11433 10159 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_13520 12274 11435 gene locus_tag LOCUS_13530 gene rfbD 12274 11435 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_13530 12867 12397 gene locus_tag LOCUS_13540 12867 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 13312 12944 gene locus_tag LOCUS_13550 13312 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 14533 14024 gene locus_tag LOCUS_13560 14533 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 15452 14505 gene locus_tag LOCUS_13570 15452 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 16455 15457 gene locus_tag LOCUS_13580 gene ytvI 16455 15457 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_13580 17903 16509 gene locus_tag LOCUS_13590 17903 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 18381 17980 gene locus_tag LOCUS_13600 18381 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 18760 18425 gene locus_tag LOCUS_13610 18760 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 22326 19066 gene locus_tag LOCUS_13620 22326 19066 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_13620 24283 22532 gene locus_tag LOCUS_13630 24283 22532 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_13630 24711 24577 gene locus_tag LOCUS_13640 24711 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence032 1838 252 gene locus_tag LOCUS_13650 1838 252 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_13650 3374 2127 gene locus_tag LOCUS_13660 3374 2127 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_13660 3796 3371 gene locus_tag LOCUS_13670 3796 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6098 3876 gene locus_tag LOCUS_13680 6098 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6490 6146 gene locus_tag LOCUS_13690 6490 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6578 7774 gene locus_tag LOCUS_13700 6578 7774 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 protein_id gnl|my_center|LOCUS_13700 8603 7782 gene locus_tag LOCUS_13710 8603 7782 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_13710 9382 8600 gene locus_tag LOCUS_13720 9382 8600 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356486.1 protein_id gnl|my_center|LOCUS_13720 9436 10005 gene locus_tag LOCUS_13730 9436 10005 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922294.1 protein_id gnl|my_center|LOCUS_13730 10838 10392 gene locus_tag LOCUS_13740 gene spxA 10838 10392 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703607.1 protein_id gnl|my_center|LOCUS_13740 11283 10927 gene locus_tag LOCUS_13750 11283 10927 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119149.1 protein_id gnl|my_center|LOCUS_13750 12020 11292 gene locus_tag LOCUS_13760 12020 11292 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262156.1 protein_id gnl|my_center|LOCUS_13760 12712 12014 gene locus_tag LOCUS_13770 12712 12014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963589.1 protein_id gnl|my_center|LOCUS_13770 13371 12793 gene locus_tag LOCUS_13780 13371 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 13467 14309 gene locus_tag LOCUS_13790 13467 14309 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_13790 14729 14355 gene locus_tag LOCUS_13800 14729 14355 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_13800 14917 16194 gene locus_tag LOCUS_13810 14917 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 16231 16749 gene locus_tag LOCUS_13820 16231 16749 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922059.1 protein_id gnl|my_center|LOCUS_13820 18135 16765 gene locus_tag LOCUS_13830 18135 16765 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_13830 18455 19252 gene locus_tag LOCUS_13840 18455 19252 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963758.1 protein_id gnl|my_center|LOCUS_13840 20704 19274 gene locus_tag LOCUS_13850 20704 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 22043 20877 gene locus_tag LOCUS_13860 22043 20877 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_13860 23139 22054 gene locus_tag LOCUS_13870 gene serC 23139 22054 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_13870 24250 23465 gene locus_tag LOCUS_13880 24250 23465 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence033 186 52 gene locus_tag LOCUS_13890 186 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2221 359 gene locus_tag LOCUS_13900 2221 359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_13900 3947 2214 gene locus_tag LOCUS_13910 3947 2214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_13910 4425 3997 gene locus_tag LOCUS_13920 4425 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5270 4512 gene locus_tag LOCUS_13930 5270 4512 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459709.1 protein_id gnl|my_center|LOCUS_13930 6924 5329 gene locus_tag LOCUS_13940 6924 5329 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_13940 7817 7146 gene locus_tag LOCUS_13950 7817 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7982 8656 gene locus_tag LOCUS_13960 7982 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8704 9000 gene locus_tag LOCUS_13970 8704 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 11200 9638 gene locus_tag LOCUS_13980 11200 9638 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_13980 11865 11503 gene locus_tag LOCUS_13990 11865 11503 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_13990 12012 12371 gene locus_tag LOCUS_14000 12012 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14000 12429 12620 gene locus_tag LOCUS_14010 12429 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 13108 12776 gene locus_tag LOCUS_14020 13108 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 15755 13722 gene locus_tag LOCUS_14030 15755 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 16885 15752 gene locus_tag LOCUS_14040 16885 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17741 16878 gene locus_tag LOCUS_14050 17741 16878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_14050 18927 17731 gene locus_tag LOCUS_14060 18927 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 19774 18884 gene locus_tag LOCUS_14070 19774 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 20263 19850 gene locus_tag LOCUS_14080 20263 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 20550 20885 gene locus_tag LOCUS_14090 20550 20885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 21041 20907 gene locus_tag LOCUS_14100 21041 20907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 21540 21004 gene locus_tag LOCUS_14110 21540 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 21680 22390 gene locus_tag LOCUS_14120 21680 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 22381 23661 gene locus_tag LOCUS_14130 22381 23661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence034 874 353 gene locus_tag LOCUS_14140 874 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1484 861 gene locus_tag LOCUS_14150 gene scpB 1484 861 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_14150 2212 1484 gene locus_tag LOCUS_14160 2212 1484 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723598.1 protein_id gnl|my_center|LOCUS_14160 3602 2325 gene locus_tag LOCUS_14170 gene spoVAF 3602 2325 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_14170 3952 3602 gene locus_tag LOCUS_14180 gene spoVAE 3952 3602 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230467.1 protein_id gnl|my_center|LOCUS_14180 4956 3952 gene locus_tag LOCUS_14190 gene spoVAD 4956 3952 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_14190 5377 4934 gene locus_tag LOCUS_14200 gene spoVAC 5377 4934 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_14200 6015 5809 gene locus_tag LOCUS_14210 6015 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14210 6216 6383 gene locus_tag LOCUS_14220 6216 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 6310 6672 gene locus_tag LOCUS_14230 6310 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 7791 6997 gene locus_tag LOCUS_14240 7791 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 9674 8037 gene locus_tag LOCUS_14250 9674 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 10055 9729 gene locus_tag LOCUS_14260 10055 9729 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_14260 11306 10128 gene locus_tag LOCUS_14270 11306 10128 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258767.1 protein_id gnl|my_center|LOCUS_14270 12790 11351 gene locus_tag LOCUS_14280 12790 11351 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_14280 14156 12795 gene locus_tag LOCUS_14290 gene trkA 14156 12795 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_14290 15103 14441 gene locus_tag LOCUS_14300 15103 14441 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_14300 16517 15114 gene locus_tag LOCUS_14310 16517 15114 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897705.1 protein_id gnl|my_center|LOCUS_14310 17095 16535 gene locus_tag LOCUS_14320 17095 16535 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_14320 18666 17083 gene locus_tag LOCUS_14330 18666 17083 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_14330 19780 18668 gene locus_tag LOCUS_14340 19780 18668 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_14340 19924 20658 gene locus_tag LOCUS_14350 19924 20658 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_14350 20687 21364 gene locus_tag LOCUS_14360 20687 21364 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_14360 21354 21770 gene locus_tag LOCUS_14370 21354 21770 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_14370 22158 21790 gene locus_tag LOCUS_14380 22158 21790 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767940.1 protein_id gnl|my_center|LOCUS_14380 23295 22174 gene locus_tag LOCUS_14390 23295 22174 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence035 191 544 gene locus_tag LOCUS_14400 191 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 537 1091 gene locus_tag LOCUS_14410 537 1091 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_14410 1160 1714 gene locus_tag LOCUS_14420 1160 1714 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537055.1 protein_id gnl|my_center|LOCUS_14420 1716 3452 gene locus_tag LOCUS_14430 1716 3452 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_14430 3569 4240 gene locus_tag LOCUS_14440 3569 4240 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903427.1 protein_id gnl|my_center|LOCUS_14440 4233 5231 gene locus_tag LOCUS_14450 4233 5231 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439911.1 protein_id gnl|my_center|LOCUS_14450 5324 6079 gene locus_tag LOCUS_14460 5324 6079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_14460 6076 7974 gene locus_tag LOCUS_14470 6076 7974 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861796.1 protein_id gnl|my_center|LOCUS_14470 8121 8333 gene locus_tag LOCUS_14480 8121 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8330 8509 gene locus_tag LOCUS_14490 8330 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 9266 10039 gene locus_tag LOCUS_14500 9266 10039 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_14500 10151 10324 gene locus_tag LOCUS_14510 10151 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 10928 10455 gene locus_tag LOCUS_14520 10928 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11596 10955 gene locus_tag LOCUS_14530 11596 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12150 12010 gene locus_tag LOCUS_14540 12150 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 13063 12569 gene locus_tag LOCUS_14550 13063 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 13631 13074 gene locus_tag LOCUS_14560 13631 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 14704 14042 gene locus_tag LOCUS_14570 14704 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 15964 14798 gene locus_tag LOCUS_14580 15964 14798 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835622.1 protein_id gnl|my_center|LOCUS_14580 16029 16964 gene locus_tag LOCUS_14590 16029 16964 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526434.1 protein_id gnl|my_center|LOCUS_14590 17044 18762 gene locus_tag LOCUS_14600 17044 18762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_14600 18755 20488 gene locus_tag LOCUS_14610 18755 20488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_14610 21526 20513 gene locus_tag LOCUS_14620 21526 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22608 21604 gene locus_tag LOCUS_14630 22608 21604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 23119 22646 gene locus_tag LOCUS_14640 23119 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 23871 23566 gene locus_tag LOCUS_14650 23871 23566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence036 20 95 gene locus_tag LOCUS_t00190 20 95 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 156 229 gene locus_tag LOCUS_t00200 156 229 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 908 774 gene locus_tag LOCUS_14660 908 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1347 1991 gene locus_tag LOCUS_14670 1347 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1984 2403 gene locus_tag LOCUS_14680 1984 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3400 2564 gene locus_tag LOCUS_14690 3400 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 4038 3385 gene locus_tag LOCUS_14700 4038 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6648 4072 gene locus_tag LOCUS_14710 6648 4072 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_14710 7355 6774 gene locus_tag LOCUS_14720 7355 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 8440 7367 gene locus_tag LOCUS_14730 gene mglC 8440 7367 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 protein_id gnl|my_center|LOCUS_14730 9951 8455 gene locus_tag LOCUS_14740 gene mglA 9951 8455 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_14740 11095 10025 gene locus_tag LOCUS_14750 gene mglB 11095 10025 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097954.1 protein_id gnl|my_center|LOCUS_14750 12234 11284 gene locus_tag LOCUS_14760 12234 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 13945 12227 gene locus_tag LOCUS_14770 13945 12227 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_14770 15551 13935 gene locus_tag LOCUS_14780 15551 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 17104 15695 gene locus_tag LOCUS_14790 17104 15695 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091276.1 protein_id gnl|my_center|LOCUS_14790 17678 17148 gene locus_tag LOCUS_14800 17678 17148 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_14800 19077 17671 gene locus_tag LOCUS_14810 gene sufB 19077 17671 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_14810 19516 19088 gene locus_tag LOCUS_14820 gene sufU 19516 19088 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_14820 20726 19500 gene locus_tag LOCUS_14830 20726 19500 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_14830 21619 20726 gene locus_tag LOCUS_14840 21619 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 22434 21619 gene locus_tag LOCUS_14850 gene sufC 22434 21619 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_14850 22602 23681 gene locus_tag LOCUS_14860 22602 23681 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594900.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence037 5655 5521 gene locus_tag LOCUS_14870 5655 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 7031 6183 gene locus_tag LOCUS_14880 7031 6183 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_14880 7218 8540 gene locus_tag LOCUS_14890 gene kbaZ 7218 8540 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263816.1 protein_id gnl|my_center|LOCUS_14890 14248 8864 gene locus_tag LOCUS_14900 14248 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14949 14410 gene locus_tag LOCUS_14910 14949 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 16087 14936 gene locus_tag LOCUS_14920 gene nagA 16087 14936 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_14920 16325 17512 gene locus_tag LOCUS_14930 16325 17512 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 protein_id gnl|my_center|LOCUS_14930 17518 17952 gene locus_tag LOCUS_14940 17518 17952 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027178.1 protein_id gnl|my_center|LOCUS_14940 17956 18237 gene locus_tag LOCUS_14950 17956 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 18985 18332 gene locus_tag LOCUS_14960 18985 18332 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_14960 19653 19006 gene locus_tag LOCUS_14970 19653 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 20657 19749 gene locus_tag LOCUS_14980 20657 19749 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167627999.1 protein_id gnl|my_center|LOCUS_14980 21468 20647 gene locus_tag LOCUS_14990 gene agaW 21468 20647 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_14990 21988 21512 gene locus_tag LOCUS_15000 gene agaV 21988 21512 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_15000 22583 23068 gene locus_tag LOCUS_15010 22583 23068 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 protein_id gnl|my_center|LOCUS_15010 23389 23120 gene locus_tag LOCUS_15020 23389 23120 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814546.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence038 173 457 gene locus_tag LOCUS_15030 173 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1703 489 gene locus_tag LOCUS_15040 1703 489 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272771.1 protein_id gnl|my_center|LOCUS_15040 2943 1711 gene locus_tag LOCUS_15050 2943 1711 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_15050 4663 3002 gene locus_tag LOCUS_15060 4663 3002 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_15060 5655 4681 gene locus_tag LOCUS_15070 5655 4681 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_15070 6669 5659 gene locus_tag LOCUS_15080 6669 5659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966904.1 protein_id gnl|my_center|LOCUS_15080 7620 6685 gene locus_tag LOCUS_15090 7620 6685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966905.1 protein_id gnl|my_center|LOCUS_15090 8549 7632 gene locus_tag LOCUS_15100 8549 7632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_15100 9320 8787 gene locus_tag LOCUS_15110 9320 8787 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_15110 9900 9313 gene locus_tag LOCUS_15120 9900 9313 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_15120 10024 11232 gene locus_tag LOCUS_15130 gene pepT 10024 11232 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_15130 11237 12133 gene locus_tag LOCUS_15140 11237 12133 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_15140 12419 12240 gene locus_tag LOCUS_15150 12419 12240 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_15150 13201 12422 gene locus_tag LOCUS_15160 13201 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 13887 13198 gene locus_tag LOCUS_15170 13887 13198 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669622.1 protein_id gnl|my_center|LOCUS_15170 14204 13887 gene locus_tag LOCUS_15180 14204 13887 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_15180 14529 14747 gene locus_tag LOCUS_15190 14529 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 14714 16168 gene locus_tag LOCUS_15200 14714 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 17711 16833 gene locus_tag LOCUS_15210 gene gmuE 17711 16833 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_15210 18563 17814 gene locus_tag LOCUS_15220 gene pflA 18563 17814 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_15220 20919 18667 gene locus_tag LOCUS_15230 gene pflB 20919 18667 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_15230 21373 22053 gene locus_tag LOCUS_15240 21373 22053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence039 2611 1034 gene locus_tag LOCUS_15250 2611 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3744 2836 gene locus_tag LOCUS_15260 3744 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15260 5599 3689 gene locus_tag LOCUS_15270 5599 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 8175 6748 gene locus_tag LOCUS_15280 8175 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 11623 10814 gene locus_tag LOCUS_15290 11623 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 12646 11810 gene locus_tag LOCUS_15300 12646 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12893 12630 gene locus_tag LOCUS_15310 12893 12630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 14166 12898 gene locus_tag LOCUS_15320 14166 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 16062 14167 gene locus_tag LOCUS_15330 16062 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 16493 16059 gene locus_tag LOCUS_15340 16493 16059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 18199 16490 gene locus_tag LOCUS_15350 18199 16490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 18411 18247 gene locus_tag LOCUS_15360 18411 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 18987 18424 gene locus_tag LOCUS_15370 18987 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 19353 18988 gene locus_tag LOCUS_15380 19353 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 19858 19373 gene locus_tag LOCUS_15390 19858 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 20271 19861 gene locus_tag LOCUS_15400 20271 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 20732 20316 gene locus_tag LOCUS_15410 20732 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 21343 20915 gene locus_tag LOCUS_15420 21343 20915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 21600 22226 gene locus_tag LOCUS_15430 21600 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence040 174 857 gene locus_tag LOCUS_15440 gene ftsE 174 857 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_15440 857 1768 gene locus_tag LOCUS_15450 gene ftsX 857 1768 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732506.1 protein_id gnl|my_center|LOCUS_15450 1804 2493 gene locus_tag LOCUS_15460 1804 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2510 3886 gene locus_tag LOCUS_15470 2510 3886 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_15470 5781 4018 gene locus_tag LOCUS_15480 5781 4018 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948735.1 protein_id gnl|my_center|LOCUS_15480 6110 7147 gene locus_tag LOCUS_15490 6110 7147 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_15490 7786 7713 gene locus_tag LOCUS_t00210 7786 7713 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7992 9533 gene locus_tag LOCUS_15500 7992 9533 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905675.1 protein_id gnl|my_center|LOCUS_15500 9521 10474 gene locus_tag LOCUS_15510 9521 10474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_15510 10467 10871 gene locus_tag LOCUS_15520 10467 10871 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_15520 10929 11063 gene locus_tag LOCUS_15530 10929 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 11060 11341 gene locus_tag LOCUS_15540 11060 11341 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964646.1 protein_id gnl|my_center|LOCUS_15540 11305 11727 gene locus_tag LOCUS_15550 11305 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 13213 12461 gene locus_tag LOCUS_15560 13213 12461 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215889.1 protein_id gnl|my_center|LOCUS_15560 13645 13220 gene locus_tag LOCUS_15570 13645 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 14013 13666 gene locus_tag LOCUS_15580 14013 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 14317 14000 gene locus_tag LOCUS_15590 14317 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 14981 17245 gene locus_tag LOCUS_15600 14981 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 18081 17623 gene locus_tag LOCUS_15610 18081 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 18774 19493 gene locus_tag LOCUS_15620 18774 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 20984 20646 gene locus_tag LOCUS_15630 20984 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 21478 20939 gene locus_tag LOCUS_15640 21478 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence041 136 1422 gene locus_tag LOCUS_15650 136 1422 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15650 1442 2746 gene locus_tag LOCUS_15660 gene rlmD 1442 2746 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233644.1 protein_id gnl|my_center|LOCUS_15660 2809 3054 gene locus_tag LOCUS_15670 2809 3054 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_15670 3131 3436 gene locus_tag LOCUS_15680 3131 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3496 6549 gene locus_tag LOCUS_15690 gene dnaE 3496 6549 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_15690 6562 9174 gene locus_tag LOCUS_15700 gene polA 6562 9174 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_15700 9183 9995 gene locus_tag LOCUS_15710 gene mutM 9183 9995 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114617.1 protein_id gnl|my_center|LOCUS_15710 9997 10950 gene locus_tag LOCUS_15720 9997 10950 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_15720 10951 11520 gene locus_tag LOCUS_15730 gene coaE 10951 11520 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_15730 11522 12760 gene locus_tag LOCUS_15740 11522 12760 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_15740 12770 13678 gene locus_tag LOCUS_15750 gene dnaI 12770 13678 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355760.1 protein_id gnl|my_center|LOCUS_15750 13787 14746 gene locus_tag LOCUS_15760 gene pfkA 13787 14746 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 protein_id gnl|my_center|LOCUS_15760 14781 16217 gene locus_tag LOCUS_15770 gene pyk 14781 16217 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732565.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence042 318 1664 gene locus_tag LOCUS_15780 318 1664 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_15780 2230 2054 gene locus_tag LOCUS_15790 2230 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2620 2297 gene locus_tag LOCUS_15800 2620 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2756 2586 gene locus_tag LOCUS_15810 2756 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 3410 3129 gene locus_tag LOCUS_15820 3410 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3661 3449 gene locus_tag LOCUS_15830 3661 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4610 3663 gene locus_tag LOCUS_15840 gene whiA 4610 3663 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_15840 5467 4619 gene locus_tag LOCUS_15850 gene rapZ 5467 4619 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_15850 5714 5860 gene locus_tag LOCUS_15860 5714 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6717 6139 gene locus_tag LOCUS_15870 6717 6139 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_15870 10748 6864 gene locus_tag LOCUS_15880 10748 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 16945 11078 gene locus_tag LOCUS_15890 16945 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 17393 17085 gene locus_tag LOCUS_15900 17393 17085 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435043.1 protein_id gnl|my_center|LOCUS_15900 18484 17411 gene locus_tag LOCUS_15910 18484 17411 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722829.1 protein_id gnl|my_center|LOCUS_15910 18942 18490 gene locus_tag LOCUS_15920 18942 18490 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931475.1 protein_id gnl|my_center|LOCUS_15920 20984 18945 gene locus_tag LOCUS_15930 20984 18945 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860670.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence043 1427 111 gene locus_tag LOCUS_15940 1427 111 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366303.1 protein_id gnl|my_center|LOCUS_15940 1831 2460 gene locus_tag LOCUS_15950 1831 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3629 2697 gene locus_tag LOCUS_15960 gene cysK 3629 2697 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_15960 4191 3757 gene locus_tag LOCUS_15970 4191 3757 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_15970 4984 4247 gene locus_tag LOCUS_15980 4984 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7140 4996 gene locus_tag LOCUS_15990 7140 4996 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426223.1 protein_id gnl|my_center|LOCUS_15990 11468 7275 gene locus_tag LOCUS_16000 11468 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 12020 11589 gene locus_tag LOCUS_16010 12020 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 12122 13489 gene locus_tag LOCUS_16020 gene pepV 12122 13489 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732537.1 protein_id gnl|my_center|LOCUS_16020 13541 13627 gene locus_tag LOCUS_t00220 13541 13627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13728 13801 gene locus_tag LOCUS_t00230 13728 13801 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14774 13830 gene locus_tag LOCUS_16030 gene metA 14774 13830 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_16030 16080 14836 gene locus_tag LOCUS_16040 16080 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 17235 16504 gene locus_tag LOCUS_16050 gene nagB 17235 16504 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166981.1 protein_id gnl|my_center|LOCUS_16050 18091 19800 gene locus_tag LOCUS_16060 gene ptsP 18091 19800 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722867.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence044 278 111 gene locus_tag LOCUS_16070 278 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 585 313 gene locus_tag LOCUS_16080 585 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 919 605 gene locus_tag LOCUS_16090 919 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1067 2137 gene locus_tag LOCUS_16100 1067 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2161 2841 gene locus_tag LOCUS_16110 2161 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3459 3001 gene locus_tag LOCUS_16120 3459 3001 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_16120 4910 4110 gene locus_tag LOCUS_16130 4910 4110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_227020148.1 protein_id gnl|my_center|LOCUS_16130 5805 4903 gene locus_tag LOCUS_16140 5805 4903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 protein_id gnl|my_center|LOCUS_16140 6375 6767 gene locus_tag LOCUS_16150 6375 6767 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_16150 7703 7044 gene locus_tag LOCUS_16160 7703 7044 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_16160 8951 7827 gene locus_tag LOCUS_16170 8951 7827 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_16170 9910 9554 gene locus_tag LOCUS_16180 9910 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 13086 10027 gene locus_tag LOCUS_16190 13086 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 13595 15388 gene locus_tag LOCUS_16200 13595 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 16664 16260 gene locus_tag LOCUS_16210 16664 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 17983 16664 gene locus_tag LOCUS_16220 17983 16664 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_16220 19478 18057 gene locus_tag LOCUS_16230 19478 18057 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390736.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence045 1472 921 gene locus_tag LOCUS_16240 gene cobB2 1472 921 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_16240 2528 1653 gene locus_tag LOCUS_16250 2528 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3752 2634 gene locus_tag LOCUS_16260 3752 2634 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_16260 3883 4650 gene locus_tag LOCUS_16270 3883 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4721 5065 gene locus_tag LOCUS_16280 4721 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5180 5255 gene locus_tag LOCUS_t00240 5180 5255 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5351 5569 gene locus_tag LOCUS_16290 5351 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 5597 5926 gene locus_tag LOCUS_16300 5597 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 6389 6808 gene locus_tag LOCUS_16310 6389 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 7104 8255 gene locus_tag LOCUS_16320 7104 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 8334 11120 gene locus_tag LOCUS_16330 8334 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 11110 11652 gene locus_tag LOCUS_16340 11110 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 11669 12004 gene locus_tag LOCUS_16350 11669 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 12111 13796 gene locus_tag LOCUS_16360 12111 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 13877 14176 gene locus_tag LOCUS_16370 13877 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 14176 14466 gene locus_tag LOCUS_16380 14176 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 14456 14995 gene locus_tag LOCUS_16390 14456 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 15066 15245 gene locus_tag LOCUS_16400 15066 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 15390 15563 gene locus_tag LOCUS_16410 15390 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 15637 16254 gene locus_tag LOCUS_16420 15637 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 16596 18479 gene locus_tag LOCUS_16430 16596 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 18479 19429 gene locus_tag LOCUS_16440 18479 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence046 2254 353 gene locus_tag LOCUS_16450 2254 353 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 protein_id gnl|my_center|LOCUS_16450 4440 2299 gene locus_tag LOCUS_16460 4440 2299 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731976.1 protein_id gnl|my_center|LOCUS_16460 4742 4443 gene locus_tag LOCUS_16470 4742 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 5675 4746 gene locus_tag LOCUS_16480 gene rsmH 5675 4746 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481788.1 protein_id gnl|my_center|LOCUS_16480 6029 5685 gene locus_tag LOCUS_16490 gene mraZ 6029 5685 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_16490 6293 6126 gene locus_tag LOCUS_16500 gene rpmF 6293 6126 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_16500 6813 6310 gene locus_tag LOCUS_16510 6813 6310 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989883.1 protein_id gnl|my_center|LOCUS_16510 7158 6916 gene locus_tag LOCUS_16520 7158 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8202 7189 gene locus_tag LOCUS_16530 gene gpsA 8202 7189 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161776.1 protein_id gnl|my_center|LOCUS_16530 9568 8264 gene locus_tag LOCUS_16540 gene engA 9568 8264 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_16540 10238 9570 gene locus_tag LOCUS_16550 gene cmk 10238 9570 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_16550 11186 10281 gene locus_tag LOCUS_16560 11186 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11306 11482 gene locus_tag LOCUS_16570 11306 11482 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_16570 12096 11737 gene locus_tag LOCUS_16580 12096 11737 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_16580 12742 12098 gene locus_tag LOCUS_16590 12742 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 14248 13010 gene locus_tag LOCUS_16600 gene htrC 14248 13010 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_16600 15573 14356 gene locus_tag LOCUS_16610 15573 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 16240 15566 gene locus_tag LOCUS_16620 16240 15566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_16620 17189 16233 gene locus_tag LOCUS_16630 17189 16233 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_16630 18110 17190 gene locus_tag LOCUS_16640 18110 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 18298 18107 gene locus_tag LOCUS_16650 18298 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 18580 18398 gene locus_tag LOCUS_16660 gene rpsU 18580 18398 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565673.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence047 1350 100 gene locus_tag LOCUS_16670 1350 100 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_16670 2237 1365 gene locus_tag LOCUS_16680 2237 1365 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_16680 2876 2457 gene locus_tag LOCUS_16690 2876 2457 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888119.1 protein_id gnl|my_center|LOCUS_16690 5819 3090 gene locus_tag LOCUS_16700 gene ileS2 5819 3090 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455930.1 protein_id gnl|my_center|LOCUS_16700 6483 6052 gene locus_tag LOCUS_16710 6483 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7254 6496 gene locus_tag LOCUS_16720 7254 6496 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731984.1 protein_id gnl|my_center|LOCUS_16720 7718 7287 gene locus_tag LOCUS_16730 gene sepF 7718 7287 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_16730 8126 7887 gene locus_tag LOCUS_16740 8126 7887 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_16740 8926 8150 gene locus_tag LOCUS_16750 gene sigG 8926 8150 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_16750 9670 8975 gene locus_tag LOCUS_16760 gene sigE 9670 8975 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_16760 10407 9670 gene locus_tag LOCUS_16770 10407 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 11287 10511 gene locus_tag LOCUS_16780 gene proC 11287 10511 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434098.1 protein_id gnl|my_center|LOCUS_16780 12424 11330 gene locus_tag LOCUS_16790 gene ftsZ 12424 11330 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166766.1 protein_id gnl|my_center|LOCUS_16790 13710 12451 gene locus_tag LOCUS_16800 gene ftsA 13710 12451 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731981.1 protein_id gnl|my_center|LOCUS_16800 14545 13784 gene locus_tag LOCUS_16810 14545 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 15463 14549 gene locus_tag LOCUS_16820 gene murB 15463 14549 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_16820 16550 15465 gene locus_tag LOCUS_16830 gene murG 16550 15465 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 protein_id gnl|my_center|LOCUS_16830 17655 16579 gene locus_tag LOCUS_16840 gene spoVE 17655 16579 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_16840 18631 17729 gene locus_tag LOCUS_16850 18631 17729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence048 1884 895 gene locus_tag LOCUS_16860 gene hemW 1884 895 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027377.1 protein_id gnl|my_center|LOCUS_16860 3193 1979 gene locus_tag LOCUS_16870 3193 1979 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_16870 4152 3202 gene locus_tag LOCUS_16880 gene holA 4152 3202 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_16880 6198 4201 gene locus_tag LOCUS_16890 6198 4201 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475863.1 protein_id gnl|my_center|LOCUS_16890 6647 6189 gene locus_tag LOCUS_16900 6647 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7671 6679 gene locus_tag LOCUS_16910 gene ruvB 7671 6679 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_16910 8243 7683 gene locus_tag LOCUS_16920 gene ruvA 8243 7683 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_16920 9593 8421 gene locus_tag LOCUS_16930 9593 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16930 9812 9621 gene locus_tag LOCUS_16940 9812 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 9981 9790 gene locus_tag LOCUS_16950 9981 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 11400 10114 gene locus_tag LOCUS_16960 gene obgE 11400 10114 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_16960 11748 11464 gene locus_tag LOCUS_16970 gene rpmA 11748 11464 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_16970 12075 11752 gene locus_tag LOCUS_16980 12075 11752 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732583.1 protein_id gnl|my_center|LOCUS_16980 12383 12075 gene locus_tag LOCUS_16990 gene rplU 12383 12075 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_16990 13251 12508 gene locus_tag LOCUS_17000 gene spoIVFB 13251 12508 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599075.1 protein_id gnl|my_center|LOCUS_17000 13801 13226 gene locus_tag LOCUS_17010 13801 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 14629 13850 gene locus_tag LOCUS_17020 gene minD 14629 13850 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583751.1 protein_id gnl|my_center|LOCUS_17020 15197 14622 gene locus_tag LOCUS_17030 15197 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 15705 15172 gene locus_tag LOCUS_17040 15705 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 16552 15698 gene locus_tag LOCUS_17050 gene mreC 16552 15698 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_17050 17289 16612 gene locus_tag LOCUS_17060 gene radC 17289 16612 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_17060 17672 17286 gene locus_tag LOCUS_17070 17672 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 17880 17737 gene locus_tag LOCUS_17080 17880 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 18040 17882 gene locus_tag LOCUS_17090 18040 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence049 482 1924 gene locus_tag LOCUS_17100 482 1924 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_17100 2032 4005 gene locus_tag LOCUS_17110 gene uvrB 2032 4005 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_17110 3995 5350 gene locus_tag LOCUS_17120 3995 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5354 8176 gene locus_tag LOCUS_17130 gene uvrA 5354 8176 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_17130 8190 9125 gene locus_tag LOCUS_17140 gene hprK 8190 9125 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289568.1 protein_id gnl|my_center|LOCUS_17140 9129 9929 gene locus_tag LOCUS_17150 gene lgt 9129 9929 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513305.1 protein_id gnl|my_center|LOCUS_17150 10098 12185 gene locus_tag LOCUS_17160 10098 12185 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890592.1 protein_id gnl|my_center|LOCUS_17160 12205 13032 gene locus_tag LOCUS_17170 gene glcT 12205 13032 CDS product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073864.1 protein_id gnl|my_center|LOCUS_17170 13259 14248 gene locus_tag LOCUS_17180 13259 14248 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_17180 14265 15080 gene locus_tag LOCUS_17190 14265 15080 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_17190 15103 16020 gene locus_tag LOCUS_17200 15103 16020 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286670.1 protein_id gnl|my_center|LOCUS_17200 16068 16448 gene locus_tag LOCUS_17210 16068 16448 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 protein_id gnl|my_center|LOCUS_17210 17176 16562 gene locus_tag LOCUS_17220 17176 16562 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_17220 17835 17530 gene locus_tag LOCUS_17230 17835 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence050 1152 1622 gene locus_tag LOCUS_17240 1152 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1635 2528 gene locus_tag LOCUS_17250 gene dapA 1635 2528 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_17250 2530 3273 gene locus_tag LOCUS_17260 gene dapB 2530 3273 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_17260 3287 4594 gene locus_tag LOCUS_17270 gene lysA 3287 4594 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_17270 4703 5401 gene locus_tag LOCUS_17280 4703 5401 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_17280 5398 6624 gene locus_tag LOCUS_17290 5398 6624 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_17290 6751 7266 gene locus_tag LOCUS_17300 6751 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 7241 7372 gene locus_tag LOCUS_17310 7241 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 8050 7556 gene locus_tag LOCUS_17320 8050 7556 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_17320 8844 8146 gene locus_tag LOCUS_17330 8844 8146 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_17330 8918 9280 gene locus_tag LOCUS_17340 8918 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 9509 11500 gene locus_tag LOCUS_17350 9509 11500 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 protein_id gnl|my_center|LOCUS_17350 12138 11560 gene locus_tag LOCUS_17360 12138 11560 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_17360 13015 12110 gene locus_tag LOCUS_17370 13015 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 13178 13813 gene locus_tag LOCUS_17380 gene ispD 13178 13813 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_17380 13932 14795 gene locus_tag LOCUS_17390 13932 14795 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_17390 14811 15284 gene locus_tag LOCUS_17400 14811 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 16135 15341 gene locus_tag LOCUS_17410 16135 15341 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860631.1 protein_id gnl|my_center|LOCUS_17410 16319 16600 gene locus_tag LOCUS_17420 gene rpsF 16319 16600 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_17420 16615 17088 gene locus_tag LOCUS_17430 gene ssb 16615 17088 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934799.1 protein_id gnl|my_center|LOCUS_17430 17106 17336 gene locus_tag LOCUS_17440 gene rpsR 17106 17336 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence051 393 566 gene locus_tag LOCUS_17450 393 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2898 721 gene locus_tag LOCUS_17460 gene topB 2898 721 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140209.1 protein_id gnl|my_center|LOCUS_17460 3198 4754 gene locus_tag LOCUS_17470 gene rny 3198 4754 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221010.1 protein_id gnl|my_center|LOCUS_17470 4801 5580 gene locus_tag LOCUS_17480 gene ymdB 4801 5580 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_17480 5627 5887 gene locus_tag LOCUS_17490 gene spoVS 5627 5887 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_17490 6134 7579 gene locus_tag LOCUS_17500 gene miaB 6134 7579 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005381.1 protein_id gnl|my_center|LOCUS_17500 7569 7898 gene locus_tag LOCUS_17510 7569 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7975 9489 gene locus_tag LOCUS_17520 7975 9489 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_17520 9593 10087 gene locus_tag LOCUS_17530 gene cotE 9593 10087 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288799.1 protein_id gnl|my_center|LOCUS_17530 10163 12676 gene locus_tag LOCUS_17540 gene mutS 10163 12676 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990113.1 protein_id gnl|my_center|LOCUS_17540 12682 14496 gene locus_tag LOCUS_17550 gene mutL 12682 14496 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732291.1 protein_id gnl|my_center|LOCUS_17550 14496 15443 gene locus_tag LOCUS_17560 gene miaA 14496 15443 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_17560 15729 16268 gene locus_tag LOCUS_17570 15729 16268 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861314.1 protein_id gnl|my_center|LOCUS_17570 16342 17121 gene locus_tag LOCUS_17580 16342 17121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence052 237 728 gene locus_tag LOCUS_17590 237 728 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_17590 728 1897 gene locus_tag LOCUS_17600 728 1897 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_17600 2405 3040 gene locus_tag LOCUS_17610 2405 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 3051 4049 gene locus_tag LOCUS_17620 3051 4049 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_17620 4433 10519 gene locus_tag LOCUS_17630 4433 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 11259 11969 gene locus_tag LOCUS_17640 11259 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 12013 12912 gene locus_tag LOCUS_17650 12013 12912 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_17650 15010 12923 gene locus_tag LOCUS_17660 15010 12923 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_17660 15723 15019 gene locus_tag LOCUS_17670 15723 15019 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861605.1 protein_id gnl|my_center|LOCUS_17670 16479 15796 gene locus_tag LOCUS_17680 16479 15796 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965993.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence053 6695 4812 gene locus_tag LOCUS_17690 6695 4812 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_17690 8339 6813 gene locus_tag LOCUS_17700 8339 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9466 8402 gene locus_tag LOCUS_17710 9466 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 10614 9541 gene locus_tag LOCUS_17720 gene trpS 10614 9541 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_17720 12402 10993 gene locus_tag LOCUS_17730 12402 10993 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_17730 12973 12587 gene locus_tag LOCUS_17740 12973 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 13476 13159 gene locus_tag LOCUS_17750 13476 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 14106 13645 gene locus_tag LOCUS_17760 14106 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 14259 14113 gene locus_tag LOCUS_17770 14259 14113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 14394 14263 gene locus_tag LOCUS_17780 14394 14263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 14631 14452 gene locus_tag LOCUS_17790 14631 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 15596 15075 gene locus_tag LOCUS_17800 15596 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence054 555 115 gene locus_tag LOCUS_17810 555 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 813 1418 gene locus_tag LOCUS_17820 813 1418 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_17820 1415 1858 gene locus_tag LOCUS_17830 gene rpiB 1415 1858 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_17830 1860 3098 gene locus_tag LOCUS_17840 gene glyA 1860 3098 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_17840 3113 3736 gene locus_tag LOCUS_17850 gene upp 3113 3736 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_17850 3884 4090 gene locus_tag LOCUS_17860 3884 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4087 4440 gene locus_tag LOCUS_17870 4087 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4463 5122 gene locus_tag LOCUS_17880 gene atpB 4463 5122 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_17880 5195 5422 gene locus_tag LOCUS_17890 gene atpE 5195 5422 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421370.1 protein_id gnl|my_center|LOCUS_17890 5445 5945 gene locus_tag LOCUS_17900 gene atpF 5445 5945 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393859.1 protein_id gnl|my_center|LOCUS_17900 5945 6478 gene locus_tag LOCUS_17910 gene atpH 5945 6478 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064678.1 protein_id gnl|my_center|LOCUS_17910 6488 8011 gene locus_tag LOCUS_17920 gene atpA 6488 8011 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183010.1 protein_id gnl|my_center|LOCUS_17920 8018 8875 gene locus_tag LOCUS_17930 gene atpG 8018 8875 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167039.1 protein_id gnl|my_center|LOCUS_17930 8887 10293 gene locus_tag LOCUS_17940 gene atpD 8887 10293 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_17940 10286 10684 gene locus_tag LOCUS_17950 gene atpC 10286 10684 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence055 3334 1358 gene locus_tag LOCUS_17960 3334 1358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_17960 4088 3321 gene locus_tag LOCUS_17970 4088 3321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_17970 5166 4156 gene locus_tag LOCUS_17980 5166 4156 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_17980 5822 5163 gene locus_tag LOCUS_17990 5822 5163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_17990 6124 5948 gene locus_tag LOCUS_18000 6124 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 7132 6260 gene locus_tag LOCUS_18010 7132 6260 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 protein_id gnl|my_center|LOCUS_18010 8212 7247 gene locus_tag LOCUS_18020 8212 7247 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_18020 8375 8725 gene locus_tag LOCUS_18030 8375 8725 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_18030 8725 9510 gene locus_tag LOCUS_18040 8725 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9641 10309 gene locus_tag LOCUS_18050 9641 10309 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_18050 10311 11789 gene locus_tag LOCUS_18060 10311 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 11871 13664 gene locus_tag LOCUS_18070 11871 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 13803 15149 gene locus_tag LOCUS_18080 13803 15149 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence056 1624 359 gene locus_tag LOCUS_18090 1624 359 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_18090 1903 2040 gene locus_tag LOCUS_18100 1903 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2169 2678 gene locus_tag LOCUS_18110 2169 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2809 3942 gene locus_tag LOCUS_18120 2809 3942 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_18120 3942 4622 gene locus_tag LOCUS_18130 3942 4622 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_18130 4624 5430 gene locus_tag LOCUS_18140 4624 5430 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_18140 5434 5853 gene locus_tag LOCUS_18150 gene tagD 5434 5853 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_18150 5850 6689 gene locus_tag LOCUS_18160 5850 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6855 7694 gene locus_tag LOCUS_18170 6855 7694 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_18170 7691 8491 gene locus_tag LOCUS_18180 7691 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 8575 9597 gene locus_tag LOCUS_18190 8575 9597 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964711.1 protein_id gnl|my_center|LOCUS_18190 9575 10825 gene locus_tag LOCUS_18200 9575 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 10843 11652 gene locus_tag LOCUS_18210 10843 11652 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_18210 11772 12953 gene locus_tag LOCUS_18220 11772 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 13003 14529 gene locus_tag LOCUS_18230 13003 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence057 279 1685 gene locus_tag LOCUS_18240 279 1685 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_18240 3504 1720 gene locus_tag LOCUS_18250 gene pepF 3504 1720 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_18250 3798 3538 gene locus_tag LOCUS_18260 gene rpsT 3798 3538 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_18260 3928 4902 gene locus_tag LOCUS_18270 gene gpr 3928 4902 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_18270 4954 5706 gene locus_tag LOCUS_18280 4954 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5703 5987 gene locus_tag LOCUS_18290 5703 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6003 6956 gene locus_tag LOCUS_18300 gene fmt 6003 6956 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598785.1 protein_id gnl|my_center|LOCUS_18300 7047 8348 gene locus_tag LOCUS_18310 7047 8348 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_18310 8369 9208 gene locus_tag LOCUS_18320 8369 9208 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582540.1 protein_id gnl|my_center|LOCUS_18320 9227 9601 gene locus_tag LOCUS_18330 9227 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 9723 10289 gene locus_tag LOCUS_18340 9723 10289 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_18340 11513 10371 gene locus_tag LOCUS_18350 gene dacF 11513 10371 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_18350 11683 12006 gene locus_tag LOCUS_18360 gene spoIIAA 11683 12006 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_18360 12006 12440 gene locus_tag LOCUS_18370 gene spoIIAB 12006 12440 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_18370 12433 13152 gene locus_tag LOCUS_18380 gene sigF 12433 13152 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_18380 13167 13718 gene locus_tag LOCUS_18390 gene lepB 13167 13718 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425129.1 protein_id gnl|my_center|LOCUS_18390 13852 14376 gene locus_tag LOCUS_18400 gene lepB 13852 14376 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_18400 14497 15003 gene locus_tag LOCUS_18410 14497 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence058 4859 4341 gene locus_tag LOCUS_18420 4859 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6327 5059 gene locus_tag LOCUS_18430 6327 5059 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227628.1 protein_id gnl|my_center|LOCUS_18430 7416 6550 gene locus_tag LOCUS_18440 gene fba 7416 6550 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_18440 8311 7571 gene locus_tag LOCUS_18450 8311 7571 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 protein_id gnl|my_center|LOCUS_18450 8570 8301 gene locus_tag LOCUS_18460 8570 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 9143 8592 gene locus_tag LOCUS_18470 9143 8592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_18470 10240 9167 gene locus_tag LOCUS_18480 10240 9167 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_18480 10314 11120 gene locus_tag LOCUS_18490 10314 11120 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207834.1 protein_id gnl|my_center|LOCUS_18490 11725 11129 gene locus_tag LOCUS_18500 11725 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 12396 11905 gene locus_tag LOCUS_18510 12396 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13403 12519 gene locus_tag LOCUS_18520 13403 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 13563 14300 gene locus_tag LOCUS_18530 13563 14300 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence059 83 8 gene locus_tag LOCUS_t00250 83 8 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1462 182 gene locus_tag LOCUS_18540 1462 182 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_18540 1841 1464 gene locus_tag LOCUS_18550 1841 1464 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287231.1 protein_id gnl|my_center|LOCUS_18550 2029 2280 gene locus_tag LOCUS_18560 2029 2280 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 protein_id gnl|my_center|LOCUS_18560 2449 2586 gene locus_tag LOCUS_18570 2449 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2741 3883 gene locus_tag LOCUS_18580 gene metK 2741 3883 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166676.1 protein_id gnl|my_center|LOCUS_18580 4007 4537 gene locus_tag LOCUS_18590 gene raiA 4007 4537 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_18590 5503 4562 gene locus_tag LOCUS_18600 5503 4562 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_18600 5542 7380 gene locus_tag LOCUS_18610 5542 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7382 9253 gene locus_tag LOCUS_18620 7382 9253 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989556.1 protein_id gnl|my_center|LOCUS_18620 9552 11948 gene locus_tag LOCUS_18630 gene leuS 9552 11948 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_18630 12470 14029 gene locus_tag LOCUS_18640 12470 14029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence060 792 1073 gene locus_tag LOCUS_18650 792 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1708 1298 gene locus_tag LOCUS_18660 1708 1298 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_18660 3614 2124 gene locus_tag LOCUS_18670 gene lysS 3614 2124 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359372.1 protein_id gnl|my_center|LOCUS_18670 4172 3927 gene locus_tag LOCUS_18680 gene cdd1 4172 3927 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_18680 5875 4457 gene locus_tag LOCUS_18690 5875 4457 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_18690 6199 7023 gene locus_tag LOCUS_18700 gene thiM 6199 7023 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_18700 7013 7642 gene locus_tag LOCUS_18710 gene thiE 7013 7642 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_18710 7635 8276 gene locus_tag LOCUS_18720 7635 8276 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_18720 8276 9079 gene locus_tag LOCUS_18730 gene thiD 8276 9079 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_18730 9463 9179 gene locus_tag LOCUS_18740 9463 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 9864 9700 gene locus_tag LOCUS_18750 9864 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 11170 9842 gene locus_tag LOCUS_18760 11170 9842 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227677.1 protein_id gnl|my_center|LOCUS_18760 11681 11469 gene locus_tag LOCUS_18770 11681 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 12251 12087 gene locus_tag LOCUS_18780 12251 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 13251 12739 gene locus_tag LOCUS_18790 13251 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 13893 13252 gene locus_tag LOCUS_18800 13893 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence061 2551 179 gene locus_tag LOCUS_18810 2551 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4133 5170 gene locus_tag LOCUS_18820 gene pgl 4133 5170 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_18820 5177 5851 gene locus_tag LOCUS_18830 5177 5851 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_18830 5961 7127 gene locus_tag LOCUS_18840 5961 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 13464 7249 gene locus_tag LOCUS_18850 13464 7249 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390242.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence062 896 714 gene locus_tag LOCUS_18860 896 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1169 3733 gene locus_tag LOCUS_18870 gene clpB 1169 3733 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_18870 3845 4654 gene locus_tag LOCUS_18880 3845 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4788 5528 gene locus_tag LOCUS_18890 4788 5528 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_18890 5525 6292 gene locus_tag LOCUS_18900 5525 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6302 7588 gene locus_tag LOCUS_18910 gene mtaB 6302 7588 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_18910 7588 9036 gene locus_tag LOCUS_18920 7588 9036 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_18920 9038 9676 gene locus_tag LOCUS_18930 gene deoC 9038 9676 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence063 20 95 gene locus_tag LOCUS_t00260 20 95 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 550 149 gene locus_tag LOCUS_18940 550 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1231 1431 gene locus_tag LOCUS_18950 1231 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 1477 2376 gene locus_tag LOCUS_18960 1477 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2421 3062 gene locus_tag LOCUS_18970 2421 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 3179 4168 gene locus_tag LOCUS_18980 3179 4168 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_18980 4578 6254 gene locus_tag LOCUS_18990 4578 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6247 6726 gene locus_tag LOCUS_19000 6247 6726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 6838 7068 gene locus_tag LOCUS_19010 6838 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 7121 9379 gene locus_tag LOCUS_19020 gene rnr 7121 9379 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_19020 9401 9847 gene locus_tag LOCUS_19030 gene smpB 9401 9847 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289013.1 protein_id gnl|my_center|LOCUS_19030 9851 10203 gene locus_tag LOCUS_tm00010 9851 10203 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 10934 10164 gene locus_tag LOCUS_19040 10934 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 11244 10981 gene locus_tag LOCUS_19050 11244 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11819 11376 gene locus_tag LOCUS_19060 11819 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 12559 11816 gene locus_tag LOCUS_19070 12559 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 12842 12982 gene locus_tag LOCUS_19080 12842 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence064 446 952 gene locus_tag LOCUS_19090 446 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 1334 1939 gene locus_tag LOCUS_19100 1334 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2442 3206 gene locus_tag LOCUS_19110 2442 3206 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099972008.1 protein_id gnl|my_center|LOCUS_19110 3647 8695 gene locus_tag LOCUS_19120 3647 8695 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189858.1 protein_id gnl|my_center|LOCUS_19120 10099 8744 gene locus_tag LOCUS_19130 10099 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 10878 10099 gene locus_tag LOCUS_19140 10878 10099 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence065 123 1181 gene locus_tag LOCUS_19150 gene aroB 123 1181 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_19150 1183 2463 gene locus_tag LOCUS_19160 gene aroA 1183 2463 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_19160 2441 3508 gene locus_tag LOCUS_19170 gene aroC 2441 3508 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_19170 3511 4629 gene locus_tag LOCUS_19180 gene pheA 3511 4629 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_19180 4639 5130 gene locus_tag LOCUS_19190 4639 5130 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439413.1 protein_id gnl|my_center|LOCUS_19190 5233 5643 gene locus_tag LOCUS_19200 5233 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5647 6777 gene locus_tag LOCUS_19210 5647 6777 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_19210 6767 9799 gene locus_tag LOCUS_19220 6767 9799 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 protein_id gnl|my_center|LOCUS_19220 9853 11292 gene locus_tag LOCUS_19230 gene proS 9853 11292 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_19230 11399 11827 gene locus_tag LOCUS_19240 11399 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11820 13169 gene locus_tag LOCUS_19250 11820 13169 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence066 78 203 gene locus_tag LOCUS_19260 78 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 203 721 gene locus_tag LOCUS_19270 203 721 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397309.1 protein_id gnl|my_center|LOCUS_19270 2994 769 gene locus_tag LOCUS_19280 2994 769 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723527.1 protein_id gnl|my_center|LOCUS_19280 3556 3038 gene locus_tag LOCUS_19290 3556 3038 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_19290 5267 3630 gene locus_tag LOCUS_19300 5267 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 5595 5305 gene locus_tag LOCUS_19310 5595 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5663 6964 gene locus_tag LOCUS_19320 5663 6964 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_19320 7982 6984 gene locus_tag LOCUS_19330 7982 6984 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986736.1 protein_id gnl|my_center|LOCUS_19330 8320 9012 gene locus_tag LOCUS_19340 8320 9012 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_19340 9028 10026 gene locus_tag LOCUS_19350 9028 10026 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_19350 11807 10086 gene locus_tag LOCUS_19360 11807 10086 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964053.1 protein_id gnl|my_center|LOCUS_19360 12025 11798 gene locus_tag LOCUS_19370 12025 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 12999 12022 gene locus_tag LOCUS_19380 12999 12022 CDS product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964051.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence067 1627 485 gene locus_tag LOCUS_19390 1627 485 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_19390 3147 1627 gene locus_tag LOCUS_19400 3147 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4220 3144 gene locus_tag LOCUS_19410 4220 3144 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 protein_id gnl|my_center|LOCUS_19410 5396 4392 gene locus_tag LOCUS_19420 5396 4392 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 protein_id gnl|my_center|LOCUS_19420 6489 5506 gene locus_tag LOCUS_19430 6489 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 7594 6506 gene locus_tag LOCUS_19440 7594 6506 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_19440 8871 7591 gene locus_tag LOCUS_19450 8871 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 9999 8872 gene locus_tag LOCUS_19460 9999 8872 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_19460 11039 9996 gene locus_tag LOCUS_19470 11039 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 12195 11032 gene locus_tag LOCUS_19480 12195 11032 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence068 786 1901 gene locus_tag LOCUS_19490 786 1901 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_19490 1985 2113 gene locus_tag LOCUS_19500 1985 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2204 3655 gene locus_tag LOCUS_19510 2204 3655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986490.1 protein_id gnl|my_center|LOCUS_19510 3657 4328 gene locus_tag LOCUS_19520 3657 4328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933367.1 protein_id gnl|my_center|LOCUS_19520 4568 4777 gene locus_tag LOCUS_19530 4568 4777 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_19530 4791 5012 gene locus_tag LOCUS_19540 4791 5012 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_19540 5027 7210 gene locus_tag LOCUS_19550 gene feoB 5027 7210 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_19550 7222 7431 gene locus_tag LOCUS_19560 7222 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 8012 8845 gene locus_tag LOCUS_19570 8012 8845 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_19570 9356 9556 gene locus_tag LOCUS_19580 9356 9556 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059082.1 protein_id gnl|my_center|LOCUS_19580 9946 11835 gene locus_tag LOCUS_19590 gene htpG 9946 11835 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_19590 11891 12427 gene locus_tag LOCUS_19600 11891 12427 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence069 199 510 gene locus_tag LOCUS_19610 199 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19610 699 887 gene locus_tag LOCUS_19620 699 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 1857 940 gene locus_tag LOCUS_19630 gene pyrD 1857 940 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_19630 2605 1850 gene locus_tag LOCUS_19640 gene pyrK 2605 1850 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_19640 3882 2614 gene locus_tag LOCUS_19650 gene pyrC 3882 2614 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 protein_id gnl|my_center|LOCUS_19650 4747 3875 gene locus_tag LOCUS_19660 4747 3875 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895276.1 protein_id gnl|my_center|LOCUS_19660 5370 4888 gene locus_tag LOCUS_19670 gene coaD 5370 4888 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_19670 5923 5375 gene locus_tag LOCUS_19680 gene rsmD 5923 5375 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 protein_id gnl|my_center|LOCUS_19680 6279 5932 gene locus_tag LOCUS_19690 6279 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6468 6286 gene locus_tag LOCUS_19700 6468 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 6793 6458 gene locus_tag LOCUS_19710 6793 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 8046 6793 gene locus_tag LOCUS_19720 gene ftsW 8046 6793 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832779.1 protein_id gnl|my_center|LOCUS_19720 8314 8048 gene locus_tag LOCUS_19730 8314 8048 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456560.1 protein_id gnl|my_center|LOCUS_19730 8427 8645 gene locus_tag LOCUS_19740 8427 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 8706 9275 gene locus_tag LOCUS_19750 gene def 8706 9275 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 protein_id gnl|my_center|LOCUS_19750 9554 9381 gene locus_tag LOCUS_19760 9554 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 10850 9570 gene locus_tag LOCUS_19770 10850 9570 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 protein_id gnl|my_center|LOCUS_19770 11551 11129 gene locus_tag LOCUS_19780 11551 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence070 3273 2806 gene locus_tag LOCUS_19790 3273 2806 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_19790 5384 3342 gene locus_tag LOCUS_19800 5384 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 6289 5381 gene locus_tag LOCUS_19810 6289 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 7223 6291 gene locus_tag LOCUS_19820 7223 6291 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_19820 7514 8464 gene locus_tag LOCUS_19830 7514 8464 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384427.1 protein_id gnl|my_center|LOCUS_19830 9295 8531 gene locus_tag LOCUS_19840 9295 8531 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966069.1 protein_id gnl|my_center|LOCUS_19840 11016 9646 gene locus_tag LOCUS_19850 11016 9646 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence071 4675 6057 gene locus_tag LOCUS_19860 4675 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6199 7116 gene locus_tag LOCUS_19870 6199 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7820 7428 gene locus_tag LOCUS_19880 7820 7428 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272575.1 protein_id gnl|my_center|LOCUS_19880 8144 7827 gene locus_tag LOCUS_19890 8144 7827 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272757.1 protein_id gnl|my_center|LOCUS_19890 8418 8158 gene locus_tag LOCUS_19900 8418 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 9439 8435 gene locus_tag LOCUS_19910 9439 8435 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_19910 9788 9516 gene locus_tag LOCUS_19920 9788 9516 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461625.1 protein_id gnl|my_center|LOCUS_19920 10447 10043 gene locus_tag LOCUS_19930 10447 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272162.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence072 9674 6072 gene locus_tag LOCUS_19940 9674 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 10370 9888 gene locus_tag LOCUS_19950 10370 9888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence073 603 5291 gene locus_tag LOCUS_19960 603 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence074 383 138 gene locus_tag LOCUS_19970 383 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1074 535 gene locus_tag LOCUS_19980 1074 535 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_19980 2065 1094 gene locus_tag LOCUS_19990 2065 1094 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 protein_id gnl|my_center|LOCUS_19990 4134 2398 gene locus_tag LOCUS_20000 4134 2398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129119821.1 protein_id gnl|my_center|LOCUS_20000 4289 5959 gene locus_tag LOCUS_20010 4289 5959 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 protein_id gnl|my_center|LOCUS_20010 6038 7090 gene locus_tag LOCUS_20020 6038 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7369 7112 gene locus_tag LOCUS_20030 7369 7112 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_20030 9794 7356 gene locus_tag LOCUS_20040 9794 7356 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence075 940 1473 gene locus_tag LOCUS_20050 940 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1476 2177 gene locus_tag LOCUS_20060 gene deoD 1476 2177 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_20060 2177 2800 gene locus_tag LOCUS_20070 2177 2800 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861058.1 protein_id gnl|my_center|LOCUS_20070 3015 2815 gene locus_tag LOCUS_20080 3015 2815 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_20080 3109 4095 gene locus_tag LOCUS_20090 3109 4095 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_20090 4193 5266 gene locus_tag LOCUS_20100 gene alr 4193 5266 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 protein_id gnl|my_center|LOCUS_20100 5709 5290 gene locus_tag LOCUS_20110 5709 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6838 5837 gene locus_tag LOCUS_20120 gene galE 6838 5837 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_20120 9011 6960 gene locus_tag LOCUS_20130 gene fusA 9011 6960 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_20130 9289 9364 gene locus_tag LOCUS_t00270 9289 9364 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9379 9454 gene locus_tag LOCUS_t00280 9379 9454 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9459 9541 gene locus_tag LOCUS_t00290 9459 9541 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9550 9625 gene locus_tag LOCUS_t00300 9550 9625 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9636 9711 gene locus_tag LOCUS_t00310 9636 9711 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 1780 272 gene locus_tag LOCUS_20140 1780 272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_20140 3230 1773 gene locus_tag LOCUS_20150 3230 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4165 3227 gene locus_tag LOCUS_20160 4165 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 5384 4263 gene locus_tag LOCUS_20170 gene dnaJ 5384 4263 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_20170 7251 5440 gene locus_tag LOCUS_20180 gene dnaK 7251 5440 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034700.1 protein_id gnl|my_center|LOCUS_20180 7807 7268 gene locus_tag LOCUS_20190 gene grpE 7807 7268 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_20190 8859 7819 gene locus_tag LOCUS_20200 gene hrcA 8859 7819 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726026.1 protein_id gnl|my_center|LOCUS_20200 9422 9129 gene locus_tag LOCUS_20210 9422 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence077 1156 185 gene locus_tag LOCUS_20220 1156 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 1362 2432 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatacatcctatgttgttattaaac 4000 2660 gene locus_tag LOCUS_20230 gene murD 4000 2660 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 protein_id gnl|my_center|LOCUS_20230 4991 4002 gene locus_tag LOCUS_20240 gene mraY 4991 4002 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_20240 5356 5087 gene locus_tag LOCUS_20250 5356 5087 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719221.1 protein_id gnl|my_center|LOCUS_20250 5955 5431 gene locus_tag LOCUS_20260 5955 5431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262576.1 protein_id gnl|my_center|LOCUS_20260 6663 6016 gene locus_tag LOCUS_20270 gene bioD 6663 6016 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_20270 7619 6660 gene locus_tag LOCUS_20280 gene bioB 7619 6660 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_20280 8173 7613 gene locus_tag LOCUS_20290 8173 7613 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_20290 9122 8160 gene locus_tag LOCUS_20300 9122 8160 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_20300 9449 9237 gene locus_tag LOCUS_20310 9449 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence078 1589 183 gene locus_tag LOCUS_20320 1589 183 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101899431.1 protein_id gnl|my_center|LOCUS_20320 2113 1895 gene locus_tag LOCUS_20330 2113 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20330 3296 2880 gene locus_tag LOCUS_20340 3296 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3905 3321 gene locus_tag LOCUS_20350 3905 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4606 3917 gene locus_tag LOCUS_20360 4606 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 7112 5751 gene locus_tag LOCUS_20370 7112 5751 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705185.1 protein_id gnl|my_center|LOCUS_20370 7535 7900 gene locus_tag LOCUS_20380 7535 7900 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_20380 8187 7894 gene locus_tag LOCUS_20390 8187 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8289 8717 gene locus_tag LOCUS_20400 8289 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_20400 9183 8830 gene locus_tag LOCUS_20410 9183 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence079 303 752 gene locus_tag LOCUS_20420 303 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1200 1631 gene locus_tag LOCUS_20430 1200 1631 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_20430 1641 5864 gene locus_tag LOCUS_20440 1641 5864 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_20440 6676 6026 gene locus_tag LOCUS_20450 6676 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 6852 7934 gene locus_tag LOCUS_20460 6852 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 8842 7970 gene locus_tag LOCUS_20470 8842 7970 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence080 45 419 gene locus_tag LOCUS_20480 45 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 482 1231 gene locus_tag LOCUS_20490 482 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1218 1808 gene locus_tag LOCUS_20500 gene dpaB 1218 1808 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053596.1 protein_id gnl|my_center|LOCUS_20500 1801 2862 gene locus_tag LOCUS_20510 1801 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2865 3656 gene locus_tag LOCUS_20520 gene dapA 2865 3656 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262854.1 protein_id gnl|my_center|LOCUS_20520 3893 5578 gene locus_tag LOCUS_20530 3893 5578 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721939.1 protein_id gnl|my_center|LOCUS_20530 5659 7917 gene locus_tag LOCUS_20540 5659 7917 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990110.1 protein_id gnl|my_center|LOCUS_20540 8013 9107 gene locus_tag LOCUS_20550 8013 9107 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence081 2718 895 gene locus_tag LOCUS_20560 gene typA 2718 895 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_20560 3457 2840 gene locus_tag LOCUS_20570 3457 2840 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687254.1 protein_id gnl|my_center|LOCUS_20570 5677 3677 gene locus_tag LOCUS_20580 5677 3677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_20580 6431 5664 gene locus_tag LOCUS_20590 6431 5664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_20590 7512 6505 gene locus_tag LOCUS_20600 7512 6505 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_20600 8174 7509 gene locus_tag LOCUS_20610 8174 7509 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence082 385 200 gene locus_tag LOCUS_20620 gene rpmB 385 200 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517908.1 protein_id gnl|my_center|LOCUS_20620 609 965 gene locus_tag LOCUS_20630 609 965 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720130.1 protein_id gnl|my_center|LOCUS_20630 978 2633 gene locus_tag LOCUS_20640 978 2633 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027136.1 protein_id gnl|my_center|LOCUS_20640 3142 2849 gene locus_tag LOCUS_20650 3142 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3521 3117 gene locus_tag LOCUS_20660 3521 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20660 4066 5322 gene locus_tag LOCUS_20670 4066 5322 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_20670 6179 5976 gene locus_tag LOCUS_20680 6179 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20680 6900 7850 gene locus_tag LOCUS_20690 6900 7850 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_20690 7874 8374 gene locus_tag LOCUS_20700 7874 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8374 8871 gene locus_tag LOCUS_20710 8374 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence083 388 1017 gene locus_tag LOCUS_20720 gene ytaF 388 1017 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949142.1 protein_id gnl|my_center|LOCUS_20720 2322 1156 gene locus_tag LOCUS_20730 2322 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 2656 2994 gene locus_tag LOCUS_20740 2656 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948385.1 protein_id gnl|my_center|LOCUS_20740 3129 3683 gene locus_tag LOCUS_20750 3129 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 4350 4219 gene locus_tag LOCUS_20760 4350 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4661 4542 gene locus_tag LOCUS_20770 4661 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 4899 4654 gene locus_tag LOCUS_20780 4899 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 5930 5178 gene locus_tag LOCUS_20790 5930 5178 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_20790 6462 6106 gene locus_tag LOCUS_20800 6462 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 6907 6560 gene locus_tag LOCUS_20810 6907 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 7482 6961 gene locus_tag LOCUS_20820 7482 6961 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_20820 8827 7718 gene locus_tag LOCUS_20830 8827 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence084 620 823 gene locus_tag LOCUS_20840 gene rpmE 620 823 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_20840 1113 1862 gene locus_tag LOCUS_20850 1113 1862 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357943.1 protein_id gnl|my_center|LOCUS_20850 1852 2331 gene locus_tag LOCUS_20860 gene rlmH 1852 2331 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_20860 2347 2625 gene locus_tag LOCUS_20870 2347 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2628 3110 gene locus_tag LOCUS_20880 2628 3110 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_20880 3114 3371 gene locus_tag LOCUS_20890 3114 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3511 4125 gene locus_tag LOCUS_20900 3511 4125 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016144.1 protein_id gnl|my_center|LOCUS_20900 4127 4669 gene locus_tag LOCUS_20910 gene yfcE 4127 4669 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_20910 4770 5465 gene locus_tag LOCUS_20920 4770 5465 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723222.1 protein_id gnl|my_center|LOCUS_20920 5629 7707 gene locus_tag LOCUS_20930 5629 7707 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_20930 7868 8509 gene locus_tag LOCUS_20940 7868 8509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383117.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence085 171 1175 gene locus_tag LOCUS_20950 gene bgsA 171 1175 CDS product cell wall glycolipid biosynthesis glucosyltransferase BgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359375.1 protein_id gnl|my_center|LOCUS_20950 1190 2218 gene locus_tag LOCUS_20960 1190 2218 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_20960 2222 4210 gene locus_tag LOCUS_20970 2222 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4203 5147 gene locus_tag LOCUS_20980 gene yhaM 4203 5147 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456351.1 protein_id gnl|my_center|LOCUS_20980 5604 5191 gene locus_tag LOCUS_20990 5604 5191 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254651.1 protein_id gnl|my_center|LOCUS_20990 6288 6100 gene locus_tag LOCUS_21000 6288 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 7192 6329 gene locus_tag LOCUS_21010 7192 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 8187 7192 gene locus_tag LOCUS_21020 8187 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence086 241 1974 gene locus_tag LOCUS_21030 241 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3097 2240 gene locus_tag LOCUS_21040 3097 2240 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_21040 4202 3099 gene locus_tag LOCUS_21050 gene prfB 4202 3099 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_21050 6835 4202 gene locus_tag LOCUS_21060 gene secA 6835 4202 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence087 47 445 gene locus_tag LOCUS_21070 47 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 641 1708 gene locus_tag LOCUS_21080 641 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence088 767 147 gene locus_tag LOCUS_21090 767 147 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930753.1 protein_id gnl|my_center|LOCUS_21090 997 794 gene locus_tag LOCUS_21100 997 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1380 1000 gene locus_tag LOCUS_21110 1380 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3449 1473 gene locus_tag LOCUS_21120 gene tkt 3449 1473 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245397.1 protein_id gnl|my_center|LOCUS_21120 3768 3538 gene locus_tag LOCUS_21130 3768 3538 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 protein_id gnl|my_center|LOCUS_21130 5288 4008 gene locus_tag LOCUS_21140 5288 4008 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_21140 6550 5288 gene locus_tag LOCUS_21150 6550 5288 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 protein_id gnl|my_center|LOCUS_21150 7620 6658 gene locus_tag LOCUS_21160 7620 6658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence089 5679 4579 gene locus_tag LOCUS_21170 5679 4579 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_21170 5876 5691 gene locus_tag LOCUS_21180 5876 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 6502 5900 gene locus_tag LOCUS_21190 gene pgpB 6502 5900 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_21190 7016 6474 gene locus_tag LOCUS_21200 gene cysE 7016 6474 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence090 <1 547 gene locus_tag LOCUS_21210 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109578.1:EF3023 family LPXTG-anchored polysaccharide lyase 885 4778 gene locus_tag LOCUS_21220 885 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence091 <1 1095 gene locus_tag LOCUS_21230 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence092 652 113 gene locus_tag LOCUS_21240 652 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1829 642 gene locus_tag LOCUS_21250 gene hydF 1829 642 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_21250 3253 1832 gene locus_tag LOCUS_21260 gene hydG 3253 1832 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_21260 4340 3282 gene locus_tag LOCUS_21270 gene hydE 4340 3282 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_21270 4587 4342 gene locus_tag LOCUS_21280 4587 4342 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_21280 4845 5468 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatacatcttatgttgttattaaac 5940 5809 gene locus_tag LOCUS_21290 5940 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6975 5992 gene locus_tag LOCUS_21300 6975 5992 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964851.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence093 1209 100 gene locus_tag LOCUS_21310 gene nspC 1209 100 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_21310 2411 1209 gene locus_tag LOCUS_21320 2411 1209 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_21320 3272 2412 gene locus_tag LOCUS_21330 gene speB 3272 2412 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209831.1 protein_id gnl|my_center|LOCUS_21330 4113 3262 gene locus_tag LOCUS_21340 gene speE 4113 3262 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_21340 5571 4114 gene locus_tag LOCUS_21350 5571 4114 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_21350 6365 5580 gene locus_tag LOCUS_21360 gene speD 6365 5580 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_21360 <7495 6878 gene locus_tag LOCUS_21370 <7495 6878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109578.1:EF3023 family LPXTG-anchored polysaccharide lyase >Feature sequence094 256 378 gene locus_tag LOCUS_21380 256 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1691 651 gene locus_tag LOCUS_21390 1691 651 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_21390 4208 1701 gene locus_tag LOCUS_21400 4208 1701 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_21400 4991 4332 gene locus_tag LOCUS_21410 4991 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5249 6424 gene locus_tag LOCUS_21420 5249 6424 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_21420 6602 6462 gene locus_tag LOCUS_21430 6602 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 7261 6692 gene locus_tag LOCUS_21440 7261 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence095 216 1673 gene locus_tag LOCUS_21450 gene nagE 216 1673 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_21450 1689 2516 gene locus_tag LOCUS_21460 1689 2516 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432034.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence096 439 861 gene locus_tag LOCUS_21470 439 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1198 1569 gene locus_tag LOCUS_21480 1198 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1671 6218 gene locus_tag LOCUS_21490 1671 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence097 1363 116 gene locus_tag LOCUS_21500 1363 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1863 1621 gene locus_tag LOCUS_21510 1863 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2050 1832 gene locus_tag LOCUS_21520 2050 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2078 2620 gene locus_tag LOCUS_21530 2078 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3270 2746 gene locus_tag LOCUS_21540 3270 2746 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429214.1 protein_id gnl|my_center|LOCUS_21540 3681 3352 gene locus_tag LOCUS_21550 3681 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 5293 4568 gene locus_tag LOCUS_21560 5293 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21560 >Feature sequence098 828 1709 gene locus_tag LOCUS_21570 gene rfbA 828 1709 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_21570 1721 2296 gene locus_tag LOCUS_21580 gene rfbC 1721 2296 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_21580 2297 3322 gene locus_tag LOCUS_21590 gene rfbB 2297 3322 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_21590 4507 3344 gene locus_tag LOCUS_21600 4507 3344 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948530.1 protein_id gnl|my_center|LOCUS_21600 4747 6453 gene locus_tag LOCUS_21610 4747 6453 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674041.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence099 676 263 gene locus_tag LOCUS_21620 676 263 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_21620 1778 843 gene locus_tag LOCUS_21630 gene manA 1778 843 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_21630 2229 1756 gene locus_tag LOCUS_21640 2229 1756 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_21640 2866 2213 gene locus_tag LOCUS_21650 2866 2213 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_21650 3412 2972 gene locus_tag LOCUS_21660 3412 2972 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641234.1 protein_id gnl|my_center|LOCUS_21660 3611 6040 gene locus_tag LOCUS_21670 3611 6040 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837703.1 protein_id gnl|my_center|LOCUS_21670 6300 6094 gene locus_tag LOCUS_21680 6300 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence100 331 1431 gene locus_tag LOCUS_21690 gene ychF 331 1431 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 protein_id gnl|my_center|LOCUS_21690 1431 2237 gene locus_tag LOCUS_21700 gene srtB 1431 2237 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 protein_id gnl|my_center|LOCUS_21700 2486 3979 gene locus_tag LOCUS_21710 2486 3979 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775020.1 protein_id gnl|my_center|LOCUS_21710 4059 5423 gene locus_tag LOCUS_21720 4059 5423 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034537005.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence101 548 787 gene locus_tag LOCUS_21730 548 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1850 966 gene locus_tag LOCUS_21740 1850 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2248 3069 gene locus_tag LOCUS_21750 2248 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3191 4156 gene locus_tag LOCUS_21760 3191 4156 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715345.1 protein_id gnl|my_center|LOCUS_21760 4149 5003 gene locus_tag LOCUS_21770 4149 5003 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266418.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence102 >Feature sequence103 175 1458 gene locus_tag LOCUS_21780 175 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1532 2722 gene locus_tag LOCUS_21790 1532 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2731 4083 gene locus_tag LOCUS_21800 2731 4083 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_21800 4080 5120 gene locus_tag LOCUS_21810 4080 5120 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence104 >Feature sequence105 >Feature sequence106 1506 112 gene locus_tag LOCUS_21820 gene sacA 1506 112 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_21820 3399 1516 gene locus_tag LOCUS_21830 3399 1516 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108116.1 protein_id gnl|my_center|LOCUS_21830 4551 3559 gene locus_tag LOCUS_21840 4551 3559 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence107 97 22 gene locus_tag LOCUS_t00320 97 22 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 173 100 gene locus_tag LOCUS_t00330 173 100 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 832 329 gene locus_tag LOCUS_21850 832 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 1612 887 gene locus_tag LOCUS_21860 1612 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2359 1685 gene locus_tag LOCUS_21870 2359 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3794 2346 gene locus_tag LOCUS_21880 3794 2346 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_21880 4450 3791 gene locus_tag LOCUS_21890 4450 3791 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_21890 4695 4622 gene locus_tag LOCUS_t00340 4695 4622 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4789 4701 gene locus_tag LOCUS_t00350 4789 4701 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4882 4807 gene locus_tag LOCUS_t00360 4882 4807 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 188 712 gene locus_tag LOCUS_21900 188 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1294 734 gene locus_tag LOCUS_21910 1294 734 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836767.1 protein_id gnl|my_center|LOCUS_21910 1492 2100 gene locus_tag LOCUS_21920 1492 2100 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_21920 2102 3298 gene locus_tag LOCUS_21930 gene coaBC 2102 3298 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047883.1 protein_id gnl|my_center|LOCUS_21930 3282 4061 gene locus_tag LOCUS_21940 3282 4061 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_21940 4551 4138 gene locus_tag LOCUS_21950 4551 4138 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438867.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence109 295 98 gene locus_tag LOCUS_21960 gene cspC 295 98 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_21960 564 1670 gene locus_tag LOCUS_21970 gene comFA 564 1670 CDS product ATP-dependent helicase ComFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243962.1 protein_id gnl|my_center|LOCUS_21970 1805 2266 gene locus_tag LOCUS_21980 1805 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2804 2343 gene locus_tag LOCUS_21990 2804 2343 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287610.1 protein_id gnl|my_center|LOCUS_21990 2928 4499 gene locus_tag LOCUS_22000 2928 4499 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence110 >Feature sequence111 361 1413 gene locus_tag LOCUS_22010 gene vanG 361 1413 CDS product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 protein_id gnl|my_center|LOCUS_22010 1430 2560 gene locus_tag LOCUS_22020 1430 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2562 3749 gene locus_tag LOCUS_22030 2562 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3804 4265 gene locus_tag LOCUS_22040 3804 4265 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence112 2814 457 gene locus_tag LOCUS_22050 2814 457 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_22050 3428 2796 gene locus_tag LOCUS_22060 3428 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4311 3421 gene locus_tag LOCUS_22070 gene metF 4311 3421 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence113 2117 99 gene locus_tag LOCUS_22080 gene recG 2117 99 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289722.1 protein_id gnl|my_center|LOCUS_22080 2534 2229 gene locus_tag LOCUS_22090 2534 2229 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429250.1 protein_id gnl|my_center|LOCUS_22090 3929 2907 gene locus_tag LOCUS_22100 3929 2907 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence114 3770 3351 gene locus_tag LOCUS_22110 3770 3351 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546565.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence115 517 3114 gene locus_tag LOCUS_22120 517 3114 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence116 20 95 gene locus_tag LOCUS_t00370 20 95 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 100 175 gene locus_tag LOCUS_t00380 100 175 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 188 263 gene locus_tag LOCUS_t00390 188 263 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 271 354 gene locus_tag LOCUS_t00400 271 354 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2155 1655 gene locus_tag LOCUS_22130 2155 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2604 2747 gene locus_tag LOCUS_22140 2604 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2985 3227 gene locus_tag LOCUS_22150 2985 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence117 >Feature sequence118 359 853 gene locus_tag LOCUS_22160 359 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 866 1435 gene locus_tag LOCUS_22170 866 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1410 1781 gene locus_tag LOCUS_22180 1410 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2434 3093 gene locus_tag LOCUS_22190 2434 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 >Feature sequence119 1740 652 gene locus_tag LOCUS_22200 1740 652 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_22200 3399 1846 gene locus_tag LOCUS_22210 3399 1846 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902156.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence120 >Feature sequence121 154 1875 gene locus_tag LOCUS_22220 154 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2264 1863 gene locus_tag LOCUS_22230 2264 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3169 2357 gene locus_tag LOCUS_22240 3169 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence122 >Feature sequence123 218 1063 gene locus_tag LOCUS_22250 218 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 1056 1493 gene locus_tag LOCUS_22260 1056 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1708 1508 gene locus_tag LOCUS_22270 1708 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1763 2428 gene locus_tag LOCUS_22280 1763 2428 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041356927.1 protein_id gnl|my_center|LOCUS_22280 2425 3150 gene locus_tag LOCUS_22290 2425 3150 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence124 1146 232 gene locus_tag LOCUS_22300 gene trxB 1146 232 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 protein_id gnl|my_center|LOCUS_22300 1601 2569 gene locus_tag LOCUS_22310 1601 2569 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence125 >Feature sequence126 609 160 gene locus_tag LOCUS_22320 gene dtd 609 160 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_22320 686 1954 gene locus_tag LOCUS_22330 686 1954 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812946.1 protein_id gnl|my_center|LOCUS_22330 2766 2386 gene locus_tag LOCUS_22340 2766 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence127 186 52 gene locus_tag LOCUS_22350 186 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 950 813 gene locus_tag LOCUS_22360 950 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1621 1277 gene locus_tag LOCUS_22370 1621 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2392 1694 gene locus_tag LOCUS_22380 2392 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence128 153 1685 gene locus_tag LOCUS_22390 153 1685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_22390 1675 2628 gene locus_tag LOCUS_22400 1675 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence129 500 120 gene locus_tag LOCUS_22410 500 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 834 493 gene locus_tag LOCUS_22420 834 493 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_22420 1105 2427 gene locus_tag LOCUS_22430 1105 2427 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_22430